Differential expression of nicotinic acetylcholine receptor subunits in fetal and neonatal mouse thymus

Journal of Neuroimmunology 130 (2002) 140 – 154 www.elsevier.com/locate/jneuroim

Differential expression of nicotinic acetylcholine receptor subunits in fetal and neonatal mouse thymus Yen-Ping Kuo a,*, Linda Lucero a, Jennifer Michaels b, Dominick DeLuca b, Ronald J. Lukas a a

b

Division of Neurobiology, Barrow Neurological Institute, 350 West Thomas Road, Phoenix, AZ 85013, USA Department of Microbiology and Immunology, College of Medicine, University of Arizona, Tucson, AZ 85724, USA Received 12 October 2001; received in revised form 25 February 2002; accepted 25 June 2002

Abstract Studies were initiated to identify nicotinic acetylcholine receptor (nAChR) subunits and subtypes expressed in the developing immune system and cell types on which nAChR are expressed. Reported here are reverse transcription-polymerase chain reactions (RT-PCR) studies of nAChR a2 – a7 and h2 – h4 subunit gene expression using fetal or neonatal regular or scid/scid C57BL/6 mouse thymus. Findings are augmented with studies of murine fetal thymic organ cultures (FOTC) and of human peripheral lymphocytes. Novel partial cDNA sequences were derived for mouse nAChR a2, a3, h3 and h4 subunits, polymorphisms were identified in mouse nAChR a4, a7 and h2 subunits, and recently derived sequences for mouse nAChR a5 and a6 subunits were confirmed. Thymic stromal cells appear to express nAChR a2, a3, a4, a7 and h4 subunits, perhaps in addition to a5 and h2 subunits, in a pattern reminiscent of expression in the developing brain. Immature T cells appear to express a3, a5, a7, h2 and h4 subunits, just as do neural crest-derived cells targeted by cholinergic innervation. Peripheral T cells seem to express an unusual profile of a2, a5 and a7 subunits, perhaps indicating that their nAChR express yet-to-be-identified assembly partners or that T cell nicotinic responsiveness occurs through homomeric nAChR composed of a7 subunits. Our findings are consistent with published work but show a much wider array of nAChR subunit gene expression in mouse thymic stromal and/or lymphoid cells and evidence for developmental regulation of nAChR subunit expression. These studies suggest important roles for nAChR in immune system development and function and in the neuroimmune network. D 2002 Elsevier Science B.V. All rights reserved. Keywords: Nicotine; Acetylcholine; Nicotinic acetylcholine receptor; T cells; Thymus

1. Introduction Advances from molecular, cellular, and physiological studies have heightened attention on links between the nervous and immune systems (Felten, 2000). For example, cytokine signaling affects cell function and fate in both nervous and immune systems (Carlson et al., 1998, 1999; Petro et al., 1999; Borovikova et al., 2000). Structural motifs in cell adhesion molecules or the molecules themselves (e.g., cadherin superfamily; Takeichi, 1995; Suzuki, 1996; Thy-1 antigen; Fields et al., 1982; major histocompatability complex molecules; Huh et al., 2000) are shared in both organ systems. The concept of the ‘‘immune synapse’’ as a site of cell –cell contact where intracellular signaling cascades are triggered derives from current views

*

Corresponding author. Tel.: +1-602-406-6534; fax: +1-602-406-4172. E-mail address: [email protected] (Y.-P. Kuo).

of chemical signaling between neurons and their targets (Davis et al., 1999; Grakoui et al., 1999; Delon, 2000). Nervous system modulation of immune system function is mediated, at least in part, through autonomic innervation of lymphoid organs (Bulloch and Pomerantz, 1984; Singh, 1984; Felten, 1993) and through activity of neurotransmitter/neuroendocrine receptors in lymphoid tissue and on immunocompetent cells (Maslinski et al., 1987, 1989; Radojcic et al., 1991). The chemical neurotransmitter, acetylcholine (ACh), has been postulated to play roles as an autocrine/paracrine immunomodulator (Kawashima and Fujii, 2000). The enzyme involved in ACh synthesis, choline acetyltransferase, is present in peripheral lymphocytes (Rinner and Schauestein, 1993), and its expression is developmentally regulated in thymus tissue (Tria et al., 1992). T lymphocyte cell lines exhibit increased synthesis and release of ACh in response to phytohemagglutinin, a T cell mitogen (Fujii et al., 1996; Kawashima et al., 1998). Furthermore, the pres-

0165-5728/02/$ - see front matter D 2002 Elsevier Science B.V. All rights reserved. PII: S 0 1 6 5 - 5 7 2 8 ( 0 2 ) 0 0 2 2 0 - 5

Y.-P. Kuo et al. / Journal of Neuroimmunology 130 (2002) 140–154

ence of both metabotropic muscarinic acetylcholine receptors and ionotropic nicotinic acetylcholine receptors (nAChR) in thymus tissue or lymphocytes has been shown by pharmacological studies (Richman et al., 1981; Rabey et al., 1986) and by using molecular and/or immunohistochemical approaches (Kaminski et al., 1993; Mihovilovic et al., 1993, 1997; Hiemke et al., 1996; Navaneetham et al., 1997, 2001; Toyabe et al., 1997; Sato et al., 1999). nAChR are diverse members of the ligand-gated ion channel superfamily (see reviews in Lukas, 1995, 1998; Lindstrom, 1996; Lukas et al., 1999). Each nAChR subtype, exhibiting specific functional properties, is a pentamer assembled as a unique combination of diverse subunits. Each subunit is encoded by a member of a family of at least 17 genes. nAChR also are targets of nicotine from tobacco products. Smoking behavior/nicotine exposure is known to cause immune suppression (McAllister-Sistilli et al., 1998; Sopori and Kozak, 1998), and prenatal nicotine exposure results in long-lasting impairment in the proliferative response of the offspring’s immune cells (Basta et al., 2000). In addition, chronic nicotine exposure produces T cell anergy and decreased proliferation in response to T cell mitogens; these effects are sensitive to inhibition by the nAChR antagonist, mecamylamine (Geng et al., 1995, 1996; Singh et al., 2000). However, our current understanding of the roles played by specific nAChR subtypes in the immune system is still very limited. Subunits that compose muscle-type nAChR appear to be expressed in incomplete sets in the thymus (Navaneetham et al., 2001). Mihovilovic and Roses (1993) and Mihovilovic et al. (1997) find nAChR a3, a5 and h4 subunit transcripts, which compose some of the nAChR subtypes found in the nervous system, in both thymocytes and thymic epithelial cells. Studies (Sato et al., 1999) employing reverse transcription-polymerase chain reactions (RT-PCR) reveal that nAChR a2, a5 and a7 subunits, which also are found in some nAChR subtypes in neurons, are prominently expressed nAChR subunit transcripts in peripheral T lymphocytes. Inspired by these hints of nAChR functional relevance in thymic development and by our own studies showing functional effects of nicotine and/or other nicotinic ligands on thymic function measured as T cell output in organ culture and in vivo (Middlebrook et al., 2000, 2002; Michaels et al., unpublished results), we initiated investigations of nAChR in the developing murine immune system. RT-PCR analyses using fetal or neonatal C57BL/6 mouse thymus have been employed in this first round of studies to identify patterns of nAChR subunit expression as message. Our findings are consistent with published work from other groups, but they also show a much wider array of nAChR subunit gene expression in the thymus as well as evidence for developmental regulation of nAChR subunit expression. These studies (see preliminary report; Kuo et al., 2000) suggest important roles for nAChR in immune system development and function and provide a foundation for

141

elucidating nicotinic signaling mechanisms in the neuroimmune network.

2. Materials and methods 2.1. Primer design Because murine nAChR subunit gene sequences were still largely undocumented or unknown when this study began, we initially designed oligonucleotide primers for RTPCR analysis of mouse nAChR subunit expression by finding consensus sequences in alignments (Clustal method; Lasergene, DNASTAR, Madison, WI) of known human and rat subunit sequences. The accession numbers for human (H), rat (R), or available mouse (M) genes used in sequence analyses were: a2 (H: U62431; R: L10077), a3 (H: M37981; R: L31621), a4 (H: L35901; R: AF007212), a5 (H: M83712; R: J05231), a6 (H: U62435; R:L08227), a7 (H: X70297; R: L31619, M: NM_007390), h2 (H: X53179; R: L31622), h3 (H: U62438; R: J04636), h4 (H: U62439; R: U42976). Sequence segments of 18 bp or more that were identical for human and rat sequences for a given subunit were then regarded as candidate primer sites for the corresponding mouse subunit. Candidate primers were then screened against a complete panel of human and rat nAChR subunit cDNA sequences to identify primers that are specific for only a given subunit. Cross-species conserved, subunit-specific sequences were then analyzed to select pairs of promising sense and anti-sense primers for RTPCR. In addition, we also assessed specificity and possible utility of rat nAChR subunit primers previously designed by other investigators (Keiger and Walker, 2000). A set of glyceraldehyde 6-phosphate dehydrogenase (GAPDH) gene primers (universal; specific for both mouse and human messages) was also designed for use as an internal control. Ultimately, oligonucleotide primers used (Table 1; customsynthesized by Operon Technologies, Alameda, CA) were those that proved to specifically and reliably amplify target sequences of interest. For our RT-PCR study examining human peripheral lymphocyte nAChR expression, we applied the same sets of primers for GAPDH and for nAChR a3, a4, a5, h3 and h4 subunits used for the mouse (Table 1). Human nAChR subunit RT-PCR primer pairs for other subunits were: a2 sense 5V-cgggcactgtgcactgggtg-3V, anti-sense 5V-cgaagagtcagcatcctcagacc-3V; a6 sense 5V-gtgtttgtgttgaacata-3V, anti-sense 5V-ctacctcctt(g/t)gtttcattgtggct-3V; a7 sense 5Vgttctatgagtgctgcaaagagcc-3V, anti-sense 5V-ctccacactggccaggctgcag-3V; h2 sense 5V-cggctcccttccaaacaca-3V, anti-sense 5V-gcaatgatggcgtggctgctgca-3V. 2.2. Tissue handling and organ culture C57BL/6J mouse brains were purchased from Pel-Freez Biologicals (Rogers, AR) and shipped on ice in RNALaterk

142

Y.-P. Kuo et al. / Journal of Neuroimmunology 130 (2002) 140–154

Table 1 List of oligonucleotide primers for mouse nAChR subunits and GAPDH RT-PCR Gene (GenBank accession number or reference) GAPDH (NM_008084) nAChR subunit a2 (Keiger and Walker, 2000) a3 a4 a5 a6 a7 (NM_007390) h2 h3 h4

Sense primer (5V! 3V)

Anti-sense primer (5V! 3V)

Predicted RT-PCR product (bp)

CGTATTGGGCGCCTGGTCACCAG

GTCCTTGCCCACAGCCTTGGCAGC

624

CGGGTGCCCAGGTGGCTGATGA TGGGGATTTCCAAGTGGA GCTGTGCTTCGGTGGTCAGCACC GAATGTCACCTCCATCCGCATC GGGTTCG(T/C)CCTGTGGAACACCTGA GTGTTCGTGCTGAACATA GGCCAACGACTCGCAGCCGCTC CTCCAACTCTATGGCGCTGCT CTCCTCAGACATTTGTTCCAAGG TCTGGTTGCCTGACATCGTG

GAGGTGACAGCAGAATCTCGCTAG CATGACCCTGGGGAGAAGGTT GCCGGCGGGATCCAAGTCACTTC CCGGCA(A/G)TTGTC(C/T)TTGACCAC GGTCCTGTAGGATTATATCG CTACCTCGTTTGTTTCATTGT GCAGGTCCAAGGACCACCCTC GAGCGGAACTTCATGGTGCAG AATGAGGTCAACCATGGT GGGTTCACAAAGTACATGGA

292 679 498 790 432 394 410 513 459 850

Sense (5V! 3V) and anti-sense (5V! 3V) primers used for PCR amplification of the indicated genes (GAPDH or nAChR subunit) are specified as are sizes of predicted PCR products. Also provided are GenBank accession numbers or the reference for the sequences used. No indication of sequence source means that a novel primer sequence obtained in our studies was used. Primers for the nAChR a2 subunit are in sequences coding for the large cytoplasmic loop. Primers for the nAChR a3 subunit are in sequences coding for the signal peptide (sense) and for the large cytoplasmic loop (antisense). Primers for nAChR a4 and h4 subunits are in sequences coding for the large N-terminal extracellular domain (sense) and for the large cytoplasmic loop (antisense). Primers for nAChR a5, a7, and h3 subunits are in sequences coding for the large N-terminal extracellular domain. Primers for the nAChR a6 subunit are in sequences coding for the M3 transmembrane domain (sense) and for the large cytoplasmic loop (antisense). Primers for the nAChR h2 subunit are in sequences coding for signal peptides (sense) and for the large N-terminal extracellular domain (antisense).

(Ambion, Austin, TX), a tissue collection/RNA stabilization reagent. Timed pregnancy C57BL/6J female mice were purchased from the National Cancer Institute (Ft. Detrick, MD). Upon arrival, mice were housed in microisolator cages with free access to food and water in accordance to the University of Arizona and International Animal Care and Use Committee standards. C57BL/6J scid/scid mice derived from breeding pairs kindly provided by Dr. L.D. Shultz of the Jackson Laboratories came from a breeding colony housed in the University of Arizona animal care facility. Pregnant mice were sacrificed by carbon dioxide inhalation when it was known (timed pregnancy) or estimated (scid/scid mice) that fetal gestational age was appropriate. Fetuses were removed from the dams and then more definitively aged based on developmental characteristics (Rugh, 1968). Fetuses were then sectioned for thorax isolation, and thymus lobes were dissected and placed in RNALaterk. Fetal thymic organ culture (FTOC) was performed as described previously (DeLuca et al., 1995). At least five thymus lobes dissected from 13 or 14 gestational day fetal mice were placed on the surface of 0.45 Am Millipore filters (Millipore, San Francisco, CA), which were supported on blocks of surgical gelfoam (UpJohn Kalamazoo, MI) and submerged in 3 ml of medium in 3.5 cm plastic Petri dishes. Dulbecco’s modified Eagle’s medium, supplemented with 20% fetal bovine serum (Hyclone Laboratories, Logan, UT), was used. The medium also contained streptomycin (100 Ag/ml), penicillin (250 units/ml), gentamycin (10 Ag/ml), non-essential amino acids (0.1 mM), sodium pyruvate (1 mM), 2-mercaptoethanol (20 AM) and 3.4 g/l of sodium

bicarbonate. The cultures were grown in a fully humidified incubator in 5% CO2 in air at 37 jC for 5 days. For some samples, to deplete lymphocytes from the thymus, 1.35 mM 2-deoxyguanosine (D2P) was also added to the culture medium for 5 days, at which time the tissues were removed and placed in standard organ culture medium until harvest. 2.3. RNA preparation To isolate total RNA, mouse brain or thymus tissues were disrupted using a Polytron or a 23-G needle syringe in the presence of TRIZOLR reagent (Bethesda Research Laboratories, Gaithersburg, MD), a mono-phasic solution of phenol and guanidine isothiocyanate. RNA was then immediately isolated, precipitated, and washed as described by the manufacturer and stored in 75% ethanol at
70 jC until ready for analysis. Prior to the RT-PCR experiment, the RNA pellet was centrifuged (7500  g, 5 min at room temperature), dried briefly, resuspended in RNase-free water, and quantified spectrophotometrically. The RNA preparation was then treated with amplification-grade RNase-free DNase (Bethesda Research Laboratories) to remove residue genomic DNA contamination. Typically, 1 Ag of RNA was incubated with 1 unit of DNaseI in a 10 Al reaction at room temperature for 15 min followed by DNaseI inactivation with the addition of 1 Al of 25 mM EDTA and incubation at 65 jC for 10 min. Human peripheral lymphocyte RNA was extracted from lymphocytes of whole blood sampled from a 40-year-old, non-smoking female. Briefly, 4 ml of whole blood was layered over 3 ml of Ficoll-PaqueR (Pharmacia Biotech;

Y.-P. Kuo et al. / Journal of Neuroimmunology 130 (2002) 140–154

Uppsala, Sweden) solution and centrifuged at 1400 rpm for 30 min at room temperature. Lymphocytes removed from the interphase were washed three times with 3 volumes of Hanks balanced salt solution (no Mg2 + /Ca2 + ). After the final wash, lymphocytes were immediately homogenized with addition of 1 ml TRIZOLR reagent followed by total RNA extraction, DNaseI treatment as described, and spectrophotometric quantitation of product. 2.4. Reverse transcription-polymerase chain reaction (RTPCR) A typical RT was carried out using 0.8 Ag of the DNAfree total RNA, a cocktail of nAChR subunit- and GAPDH gene-specific anti-sense primers, and the Superscript IIk Preamplification system (Bethesda Research Laboratories) in a 20 Al reaction at 48 jC. At the end of the RT, the reaction was incubated at 75 jC for 10 min to deactivate reverse transcriptase, and RNA was removed by adding 1 unit of RNaseH to the mixture followed by incubation at 37 jC for 30 min. While the location of the primer sets for nAChR a2, a3 and a6 subunits did not cross exon – intron boundaries, additional reactions carried out routinely in the absence of reverse transcriptase served as a negative control to check for residual genomic DNA-derived RT-PCR products. A typical PCR was performed using 2 Al of template DNA (representing first-strand cDNA derived from 5 –30 ng of thymus total RNA or from 1 ng of brain total RNA), 1 Al of 10 AM each 5V and 3V gene-specific primers, 1 Al of 10 mM dNTP and 2.5 units of RediTaqk (Sigma, St. Louis, MO) in a 50 Al reaction using a RoboCycler (Stratagene, La Jolla, CA). Standard PCR reactions were carried out for 35 amplification cycles (for nAChR subunits; see rationale for this approach below) or for 20 amplification cycles (for GAPDH) of 95 jC for 60 s, 55 jC for 90 s, and 72 jC for 90 s, followed by a 4-min extension at 72 jC. In situations where standard PCR conditions failed to yield a specific product, variations in [Mg2 + ] (1.5 F 0.5 mM) in PCR buffer and in primertemplate annealing temperature (49 jC to 60 jC) were examined to optimize gene-specific amplification. Reaction mixtures without cDNA template were routinely set up in each experiment to ensure the PCR components were free of exogenous DNA contamination. 2.5. Confirmation of identities of RT-PCR products To permit unequivocal analysis of mouse nAChR subunit gene expression, identities of mouse RT-PCR products were confirmed using a process that also provided novel sequence information for some murine subunit cDNAs. Partial nAChR subunit cDNAs derived from reverse transcription and PCR amplification of mouse brain total RNA were sequenced and then aligned with GenBank sequences for their human and rat counterparts using Lasergene. For sequencing, RT-PCR fragments typically were gel-purified using the Prep-A-Gene

143

system (Bio-Rad Laboratories, Hercules, CA) and sequenced directly using sense and anti-sense PCR primers. Less abundant products such as that for the nAChR a6 subunit were first purified using PCR-Kleen columns (Bio-Rad), introduced into the pGEMRT Easy Vector System (Promega, Madison, WI), and then subjected to sequencing. Once the identities of each partial cDNA fragment were verified, nested oligonucleotide probes were designed and customsynthesized for use in subsequent Southern hybridization experiments. Sequencing services were provided by the DNA Laboratory at Arizona State University (Tempe, AZ) using an ABI Prism 377 DNA sequencer. 2.6. Relative –quantitative analysis of RT-PCR products derived from thymus RNA We employed RT-PCR to establish how murine thymic nAChR subunit message levels varied as a function of developmental age and then to compare them to a murine brain RNA standard. First, we used a variant on the real-time PCR approach in pilot studies to determine for each nAChR subunit and for GAPDH the range of PCR cycles over which amplification was in the exponential phase. In these studies, we used total RNA preparations from fetal (12 – 18 days of gestation) or newborn (12 days postnatal) thymus at the appropriate age showing richest expression of each nAChR subunit. Ten PCR reactions, each containing 100 ng of total RNA-derived cDNA template, were aliquoted from a master mixture and were terminated (for nAChR subunits) after 20, 24, 26, 28, 30, 32, 34, 36, 38 or 40 amplification cycles. Onetenth of each of these PCR products was then resolved electrophoretically on a 1% agarose gel and subjected to Southern hybridization. For Southern hybridization, DNA was transferred to a ZetaProbek-GT membrane (BioRad) via an LKB 2016 Vacugene vacuum blotter using a 0.4 N NaOH solution, fixed by UV cross-linking using the GS GeneLinkerk (BioRad) at 125 mJ/cm2, and hybridized with 5V 32P-end-labeled, nested oligonucleotide probe. Signals were visualized and quantified using an InstantImagerk (Packard Instrument, Downers Grove, IL) electronic detector. A similar amplification cycle study was conducted for GAPDH message at 16, 18, 20, 22, 24, 26 cycles. These studies showed that cDNA amplification remained exponential for at least 6 cycles and typically over 8 cycles (i.e., over a 64– 256-fold range of input RNA), and 35 (for nAChR subunits) or 20 (for GAPDH) cycles of amplification were chosen to maintain proportionality between input RNA and Southern blot signal (i.e., to ensure that saturation of the Southern blot signal did not occur even for samples most abundant in target message). Second, for subsequent developmental profile studies, aliquots of a master RT reaction mixture (representing 10, 20, 30 ng of RNA-derived, first-strand cDNA) were subjected to nAChR subunit-specific or GAPDH gene amplification. RT-PCR products were analyzed by Southern analysis as described above, and proportionality between input RNA

144

Y.-P. Kuo et al. / Journal of Neuroimmunology 130 (2002) 140–154

and Southern blot signal for nAChR subunits and for GAPDH was confirmed. Third, nAChR subunit RT-PCR product signals were normalized against signals for GAPDH for samples derived from the same RT reaction in order to account for any variations in template RNA input. This level of analysis represents ‘‘relative RT-PCR’’ allowing comparisons across developmental time of levels of nAChR subunit message expression normalized through GAPDH controls to input RNA. Fourth, RT-PCR analysis was done in parallel for mouse brain RNA, and proportionality between input brain RNA and Southern blot signal was confirmed for nAChR subunits and GAPDH (i.e., to ensure sub-saturation of Southern blot signal). Fifth, GAPDH-normalized thymic RT-PCR product signal was expressed as a percentage of GAPDH-normalized mouse brain RT-PCR signal for samples run in parallel and for the same subunit. These doubly normalized results thus represent a ‘‘relative– quantitative RT-PCR’’ analysis comparing levels of thymic nAChR subunit message to a mouse brain standard containing full-length target message in a mixture of other messages. Doubly normalized results, typically obtained from three replicate RT experiments, each involving two to four repeats of PCR analysis using varying amounts of cDNA template, were then expressed as mean F SEM (analysis done using Prism, GraphPad Software, San Diego, CA).

3. Results 3.1. Detection of nACHR subunit transcripts in mouse brain via RT-PCR using custom-designed primers RT-PCR with total RNA from mouse brain was conducted first to test whether custom-designed oligonucleotides could prime specific amplification of murine nAChR subunit gene transcripts. While some sets of primers gave expected PCR products under standard PCR conditions, some failed to perform, and others required adjustment of [Mg2 + ] or primer-template annealing temperature for optimal specificity and sensitivity. Table 1 lists the primer sets that successfully amplified specific nAChR subunit gene transcripts from mouse brain. Special PCR buffer conditions required for successful use of some primers are 1 mM Mg2 + for nAChR a2 subunits and 2 mM Mg2 + for h4 subunits; other primer pairs amplified specific products at standard (1.5 mM) Mg2 + . Fig. 1 presents a nAChR subunit RT-PCR product profile for mouse brain using the primers listed in Table 1. Each RT-PCR product derived from mouse brain matched the predicted size (Table 1) indicating successful detection of all examined nAChR subunit gene transcripts. These primers were then used for studies of thymic nAChR subunit gene expression. Note that two sets of a3 primers performed equally well, but results obtained using only one of these (498 bp product) are shown in Fig. 1.

Fig. 1. RT-PCR products for nAChR subunits from mouse brain. RT-PCRs were carried out using gene-specific oligonucleotide primers listed in Table 1. The procedure was performed as described in the Materials and methods section except that each individual RT reaction contained only one genespecific anti-sense primer. Each RT assay contained 4 Ag of total RNA derived from whole brain, and one-tenth of the RT-derived cDNA product was subjected to PCR. One-fifth of the nAChR subunit and one-twentyfifth of GAPDH PCR products were electrophoretically resolved on a 1% agarose gel along with a 100-bp DNA ladder (M) as a molecular size marker. Lanes loaded with nAChR subunit or GAPDH PCR products are so labeled at the top. Arrowheads indicate the expected partial cDNA products, and the 100- and 600-bp molecular size bands in the marker lanes are labeled accordingly. A separate gel with molecular size markers was used in analysis of nAChR h3 subunit PCR product.

3.2. Confirmation of mouse nACHR subunit RT-PCR products by sequence analysis Mouse sequences for several nAChR subunits had not been reported when our studies began, requiring that we obtain such information to confirm identities of PCR products and to guide creation of nested oligonucleotide probes for reliable detection of mouse nAChR subunit PCR products using Southern hybridization. Partial length cDNA products of RT-PCR reactions conducted using total RNA from mouse brain were sequenced from both strands (novel results were submitted to GenBank; accession numbers AF325345 – AF325351) and compared with their human or rat counterparts or with published mouse sequences as these became available. Fig. 2 shows partial alignment results for each nAChR subunit in the region containing the nested oligonucleotide (sequence in bold print) used for Southern hybridization. Southern hybridization with nested probes increased the sensitivity of transcript detection, which was especially important for studies of subunits whose message levels were comparatively low, and was used along with determination of product size to establish identity of a specific RT-PCR product, which was particularly important in instances when different sized products were obtained. For the mouse nAChR a2 subunit, a novel 249-bp sequence encoding part of the large cytoplasmic domain was identified (GenBank accession number AF325345).

Y.-P. Kuo et al. / Journal of Neuroimmunology 130 (2002) 140–154

Fig. 2 sequence I shows a partial alignment of the mouse a2 subunit sequence with a rat a2 subunit sequence and a partial translation of the mouse a2 subunit. Interestingly, a conserved glutamic acid repeat is shared between the rat (seven amino acids) and mouse (eight amino acids) sequences. Although such a motif is absent in a human nAChR a2 subunit gene, information in a tandem repeat data bank (http://www.ncl-india.org) analyzing all SWISS-PROT DataBase entries indicates that such repeats (ranging from 10 to 17 amino acids) also are present in a chick nAChR a2 subunit and in many other voltage-gated ion channels or adrenergic receptors in mice, rats or humans. However, to our knowledge, no specific biological function has yet been assigned to this motif. For the mouse nAChR a3 subunit gene, a 1058-bp fragment encoding from the 5V-untranslated region through the M3 transmembrane domain-large cytoplasmic loop region was sequenced (GenBank accession number AF325346). Comparison between this novel sequence (shown in part as Fig. 2 sequence II) and the rat a3 cDNA sequence reveals that, with the exception of 2 amino acids in the signal peptide (region not shown), mouse and rat a3 subunits share the first 341 amino acids. While a complete cDNA sequence has been reported for the mouse a4 subunit (GenBank accession number AF225912), alignment with our 722-bp sequence (GenBank accession number AF325347; shown in part as Fig. 2 sequence III) encoding a region spanning from the N-terminal extracellular domain to the large cytoplasmic loop documents a polymorphism (N134 ! D substitution in sequence III; all amino acid residue numbering begins with the translation initiation methionine). Such a finding is not surprising as both human and rat (GenBank accession number L35901 and AF007212, respectively) a4 subunits have aspartic acid residues at the same position. Mouse nAChR a5 and a6 RTPCR fragment sequences obtained in our studies (shown in part as Fig. 2 sequences IV and V) share 100% sequence identities at the nucleotide level with mouse a5 and a6 sequences that were published after we began our work. Comparison of our 346-bp sequence (GenBank accession number AF325348; encoding the large N-terminal extracellular domain) derived from a7 RT-PCR product (shown in part as Fig. 2 sequence VI) with the published mouse a7 cDNA sequence reveals three nucleotide discrepancies with one resulting in a conserved serine for threonine substitution at the 58th residue (not shown). Three nAChR h subunit RT-PCR products, h2, h3, and h4 were also sequenced (GenBank accession numbers AF325349, AF325350, and AF325351, respectively; shown in part as Fig. 2 sequences VII, VIII, and IX, respectively). A 463-bp h2 subunit fragment, encoding some of the signal peptide and a large portion of the N-terminal extracellular domain, displays two amino acid polymorphisms in this region when compared with the published mouse h2 sequence (GenBank accession number AF299083). A codon for a leucine residue at the 11th amino acid of the published h2 sequence is absent in our sequence and in a rat h2 cDNA

145

sequence. Furthermore, our h2 sequence has a valine for aspartic acid substitution at the predicted 27th residue. Our novel 422-bp h3 sequence encodes a large portion of the Nterminal extracellular domain and shares more than 98% protein sequence identity with rat h3 in this region. For h4, our novel 829-bp sequence encodes a region including a portion of the N-terminal extracellular domain through the first 46 residues of the cytoplasmic domain. The predicted mouse h4 amino acid sequence shares 100% identity with its rat counterpart before reaching the cytoplasmic domain. However, among the 46 residues located in the cytoplasmic domain, 10 residues (approximately 22%) are divergent from the rat sequence. In summary, sequencing information and alignment analyses confirmed identities of our RT-PCR products as specific, mouse nAChR subunit cDNAs. Thus, the oligonucleotide primers and the RT-PCR conditions used were applied in subsequent studies to detect nAChR transcripts from murine thymus. Moreover, we have reported here novel sequences for mouse nAChR a2, a3, h3 and h4 subunits; we indicate polymorphisms in mouse nAChR a4, a7 and h2 subunits; and we confirm recently derived sequences for mouse nAChR a5 and a6 subunits. 3.3. Mouse thymus displays a wide array of nACHR subunit messages that are developmentally regulated Extensive pilot studies established PCR conditions ensuring that target cDNA amplification remained in the exponential phase and that Southern blot signal obtained using nested oligonucleotide probes was proportional to input RNA (see Materials and methods). Results from these pilot studies for PCR reactions containing first-strand cDNA derived from 100 ng of total RNA (data not shown) indicated that both prenatal and newborn thymus tissues express nAChR a2, a3, a4, a5, a7, h2 and h4, but not a6, subunit messages. nAChR h3 subunit signal could only be detected if the PCR reaction was carried out for 38 cycles or more; even then, detection of h3 subunit PCR product was not reproducible. Therefore, h3 subunit transcripts are likely absent from the thymus RNA samples examined, and any products obtained were likely derived from non-specific PCR amplification. Hence, a6 and h3 messages were not carefully examined in the developing thymus. PCR amplification through 30– 38 cycles for all of the other nAChR subunits remained in exponential phase. We chose 35 cycles for the bulk of our studies to provide high detection sensitivity while avoiding conditions that would yield saturation of amplification. These pilot studies of fetal and neonatal mouse thymus RNAs revealed not only that mouse thymus displays expression of a wide array of nAChR subunits, but also that nAChR subunit gene expression is developmentally regulated. Several strategies were used in subsequent studies to further characterize profiles of nAChR subunit expression in the developing thymus.

146

Y.-P. Kuo et al. / Journal of Neuroimmunology 130 (2002) 140–154

One approach involved comparisons (Figs. 3 – 5) to determine if there was a difference in expression of nAChR subunits in normal (regular) C57BL/6 and C57BL/6J scid/

scid (scid) developing thymus. The former tissue contained mostly developing, immature T cells [CD4
CD8
‘‘double negative’’ (DN) T cell receptor negative (TCRneg) T cells

Y.-P. Kuo et al. / Journal of Neuroimmunology 130 (2002) 140–154

and CD4 + CD8 + ‘‘double positive’’ (DP) T cell receptor low-negative (TCRlo/neg) T cells] plus a small number of more mature T cells [CD4 + or CD8 + ‘‘single positive’’ (SP) T cells and DN T cell receptor high (TCRhigh) T cells], as well as thymic stromal elements. The scid/scid tissue contained thymic stromal cells as well as very immature T cells (DN, SP or DP) that were incapable of development beyond the T cell receptor expression stage (i.e., remained TCRneg) due to the loss of TCR ligating capability in these animals. Fetal and neonatal thymus tissues from regular or scid mice were extracted beginning at 12 –14 days postgestation through birth. Thymus RNA samples from each time point were subjected to three RT reactions. Each cDNA preparation was then diluted properly and used for a whole profile of nAChR subunit and GAPDH PCRs at two to three different template concentrations. In another approach to help determine differences in nAChR subunit expression between thymic stromal cells and lymphoid cells, we also examined 5-day FTOC of 13 and 14 days post-gestation, regular or scid mouse thymi treated with D2P (Table 2). Thymi at the end of the 5-day culture period are regarded as being temporal equivalents of 18 or 19 days post-gestation thymi. D2P selectively destroys dividing hematopoietic cells and leaves some epithelial cells intact in the thymus tissue. Consequently, this tissue consists of epithelial cells that are relatively pure (a maximum of 5% of cells are T cells; Kingston et al., 1985). Both of these FTOC are also useful for eliminating influences imposed by thymic innervation, which probably does not take place in vivo until 17 – 18 days post-gestation (Singh, 1984; Singh et al., 1987). In the third approach (Table 3), we determined levels of expression of nAChR subunit genes in human peripheral lymphocytes, largely to help construct a table that would aid review of the literature, in part to confirm published findings for expression of some subunits, but also to allow insight into contributions of mature T cells to nAChR subunit gene expression observed in mouse thymus and FTOC and to facilitate discussion of cellular origins of nAChR subunit expression. Here, to simplify presentation of results and their discussion, we present our findings plus first-order interpretations for each subunit gene examined, leaving further elaboration on the results for the Discussion section. When

147

we comment below on degrees of ‘‘maturity’’ of T cells, we make reference to differences in T cell maturity within the period of fetal or early postnatal life addressed in this study, but not necessarily to fully mature T cells found in the periphery of older animals. 3.3.1. a2 subunit As shown in Fig. 3A, there is a steady induction of nAChR a2 subunit message leading to a sharply higher level at birth in both scid and regular mouse thymus. Thus, a2 subunits appear to be mainly expressed by thymic stromal cells, as lymphoid cell development would not be expected to occur in the scid tissue. In addition, regular thymus tissue expresses a higher level of a2 subunit message than does scid thymus after 17 days post-gestation. This suggests that there may be a small percentage of a2 subunits expressed by more mature lymphocytes and/or that the expression of a2 subunits on stromal cells might be upregulated by cytokines released from mature T cells (Carding et al., 1991). The latter possibility is supported by many indications (reviewed in Ritter and Boyd, 1993) suggesting that there exists intrathymic symbiosis between T cells and their microenvironment. The possibility that more mature T cells account for some of the thymic a2 subunit expression during later ontogeny is supported by the D2P-FTOC data (Table 2). After depletion of T cells by D2P treatment, there is no time-dependent increase in a2 subunit expression in cultures temporally equivalent to 18 and 19 days postgestation, and there is no significant difference in levels of expression between regular and scid samples. Possible expression of a2 subunits by more mature T cells is consistent with a report of a2 subunit expression in human peripheral lymphocytes (Sato et al., 1999) and with the results of our RT-PCR study of human peripheral lymphocyte nAChR subunit expression (Table 3). Furthermore, the sharp increase of a2 message at birth (Fig. 3A; PN1) in both normal and scid thymus could be a result of thymic cholinergic innervation (Singh et al., 1987). 3.3.2. a3 subunit Particularly striking is the transiently much higher level of nAChR a3 subunit expression at 15 days post-gestation in scid tissue than in normal fetal thymus (Fig. 3B). After birth (Fig. 3B; PN1), the situation is reversed, with normal

Fig. 2. Partial nucleotide sequence alignments and translations for nAChR subunit RT-PCR products containing sequences used as nested oligonucleotides probes for Southern hybridizations. Using the primers listed in Table 1, RT-PCRs were conducted to yield mouse nAChR subunit cDNAs of the sizes indicated in Table 1 and Fig. 1. These PCR products were then sequenced. Novel sequences for mouse nAChR a2, a3, a4, a7, h2, h3, and h4 subunits were submitted to GenBank and given accession numbers AF325345 – AF325351, respectively. Partial sequences from these PCR products are shown here, labeled with Roman numerals I to IX. Bold print indicates sequences for nested oligonucleotide probes used in Southern hybridization studies. Complete sequences of the mouse RT-PCR products obtained from this study were aligned with their rat or mouse counterparts using the Clustal method (MegAlign program of the DNASTAR Lasergene package), and partial alignment results are indicated (see text for more details). The names of the referenced genes and their accession numbers are as follows: rat a2 (L10077), rat a3 (L31621), mouse a4 (AF225912), mouse a5 (AF204689), mouse a6 (AJ245706), mouse a7 (AF225980), mouse h2 (NM_009602), rat h3 (J04636), and rat h4 (U42976). The corresponding amino acid translation for each putative mouse cDNA sequence is shown, and the numbers indicate predicted positions for these residues counting the translation initiation methionine as the first residue. Asterisks for the a2 and a4 sequences shown (see text for other differences identified) indicate amino acids that differ from the translated reference sequence. Sequences shown for nAChR a2 and a6 subunits are located within their putative large cytoplasmic loops. Sequences shown for nAChR a3, a4, a5, a7, h2, and h3 subunits are located within their putative large N-extracellular domains. The sequence shown for the nAChR h4 subunit is located within its putative M3 transmembrane domain.

148

Y.-P. Kuo et al. / Journal of Neuroimmunology 130 (2002) 140–154

Table 2 nAChR subunit expression from fetal thymus organ culture (FTOC) with 5 days D2P treatment Mean F SEM (n) a2

a3

a4

a5

a7

h2

h4

Normal Day 18 Day 19

0.77 F 0.25(5) 0.52 F 0.16(3)

0.21 F 0.02(5) 0.30 F 0.11(4)

1.56 F 0.76(5) 3.02 F 2.17(4)

0.21 F 0.07(5) 1.10 F 0.39(5)

7.18 F 1.13(4) 9.18 F 4.01(4)

4.97 F 2.05(4) 4.92 F 1.68(5)

0.58 F 0.21(5) 1.16 F 0.27(4)

SCID Day 18 Day 19

1.02 F 0.33(5) 0.73 F 0.14(5)

0.80 F 0.16(4) 1.23 F 0.45(5)

0.82 F 0.10(5) 1.22 F 0.14(3)

0.96 F 0.12(5) 0.75 F 0.16(5)

2.06 F 0.44(5) 4.08 F 2.18(3)

2.23 F 0.72(4) 3.24 F 2.24(3)

0.43 F 0.08(4) 0.79 F 0.14(4)

Signals for nAChR subunit RT-PCR products were quantified using Southern hybridization and normalized to a GAPDH input RNA control. Signals for the indicated FTOC samples for each subunit were then again normalized to those derived from a separate, reference FTOC sample not treated with D2P (signal for reference sample set = 1.0). Signals are indicated as means F SEM for the total number of PCR reactions indicated in parentheses and from at least two separate RT reactions.

tissue having higher expression of a3. One possible explanation for these changes is that a3 is normally expressed on lymphoid cells at all stages of development, including on the immature T cells that predominate in scid tissue at 15 days post-gestation as well as on more mature T cells produced in the normal tissue after birth. Alternatively, a3 may be expressed in both thymic stromal cells and lymphoid cells with the expression by stromal cells up-regulated by cytokines released from mature T cells (Carding et al., 1991). Organ culture results (Table 2) indicate that cultures from regular thymus, with dividing T cell precursors depleted by D2P treatment, have levels of a3 subunit expression significantly lower than expression in scid D2P-FTOC. Moreover, there is no time-dependent increase in a3 subunit expression in regular thymus D2P organ cultures temporally equivalent to 18 and 19 days postgestation. These data also are consistent with predominant expression of a3 subunits by immature lymphoid cells in scid tissue and, in regular thymus, with an influence of mature T cells on levels of stromal cell a3 subunit expression and/or expression of a3 subunits by mature T cells. Interestingly, levels of a3 subunit expression in D2P-FTOC are higher in scid than in regular thymus cultures, perhaps reflecting persistence of non-dividing, immature T cells that resist D2P-mediated depletion and express high levels of a3 message in scid FTOC. Our findings are consistent with a report (Mihovilovic et al., 1997; Table 3) of expression of both a3 and h4 transcripts in fresh DP and SP human thymocytes (however, both a3 and h4 levels are lower in CD4 + SP thymocytes and lowest in CD8 + SP thymocytes and are further down-regulated after a 3-day culture) and in stromal epithelial cells. Furthermore, results from our study and from other groups (Mihovilovic et al., 1997; Sato et al., 1999; Table 3) have ruled out the presence of a3 transcripts in peripheral lymphocytes from at least some human individuals. Although there is a report (Hiemke et al., 1996) arguing for the expression of a3 (and a4) transcripts in human peripheral lymphocytes as detected by in situ hybridization, we suspect that the use of cRNA probes in that study might have contributed to non-specific hybridization with other nAChR a subunit transcripts.

3.3.3. a4 subunit It is likely that thymic epithelial cells are responsible for the production of a4, because this nAChR subunit is expressed in high absolute levels (note that a4 subunit is very rich in brain) in both normal and scid tissue very early in gestation (Fig. 3C), just at the beginning of colonization of the thymus with hematopoietic cell precursors. Comparisons on postnatal day 1 reveals f 2-fold higher levels of a4 subunit expression in regular than in scid thymus. This suggests that a4 message may be produced by T cells, may be up-regulated in stromal elements by cytokine secretion from mature T cells, and/or may be up-regulated upon innervation. However, data from the D2P-FTOC study also shows higher levels of a4 subunit expression in regular compared to scid organ cultures depleted of dividing T cells and their precursors. Moreover, neither our study nor another report (Sato et al., 1999; Table 3) found a4 Table 3 Summary of studies detecting nAChR subunit messages in thymic tissue or lymphoid cells Thymic stromal cells Immature T cell

Peripheral lymphocytes

This study Others This study Others This studya (murine) (human) (murine) (human) (human) a2 + a3 + a4 + a5 ?/ + a7 + h2 ?/ + h4 +

+

c

+c +e +c

? + ? + + + +

+

c

+c
e +c

+

+ +



Others (human) +b
b,c + d
b+d + b,c +b Fb
b,c

Findings are summarized from studies examining nAChR subunit message expression in thymic stromal cells, immature T cells, and peripheral lymphocytes from this current study or from the indicated other study. Methods employed in each study to detect gene expression are also listed. See text for details and interpretations from this current study. ‘‘?’’ or ‘‘?/ + ’’ indicates that assignment of subunit expression to the indicated cell population is tentative. a Human peripheral lymphocyte study; RT-PCR; preliminary data from one female, 40 yr old, non-smoker. b Human; RT-PCR (Sato et al., 1999). c Human; RT-PCR (Mihovilovic et al., 1997). d Human; in-situ hybridization (Hiemke et al., 1996). e Human; RT-PCR (Navaneetham et al., 1997).

Y.-P. Kuo et al. / Journal of Neuroimmunology 130 (2002) 140–154

149

expression on human mature lymphocytes. Thus, T cells may modulate a4 subunit expression by thymic stromal elements, but stromal elements seem to be a major source of expression of this subunit. 3.3.4. a5 subunit Fig. 4A shows that scid tissue produced nAChR a5 subunit messages at levels nearly equal to or greater than normal thymus. These results suggest that this subunit is expressed on immature T cells that are left in the scid tissue and, perhaps, on non-lymphoid thymic stromal cells that are present in roughly equal amounts in each of these tissues. This is consistent with another report (Mihovilovic et al., 1997) in which a5 expression was found in thymic stromal cells and in DP and SP thymocytes. Furthermore, the fact that a5 expression is also up-regulated at birth (Fig 4A; PN1) in both kinds of thymus tissue suggests that cholinergic input might play a role in late ontogeny of a5 expression. In the D2P-FTOC study (Table 2), where the thymus tissue was harvested before innervation took place, no significant difference in a5 levels was observed between normal and scid tissues. This observation could point to a predominance of stromal expression of a5 subunits. However, abundant human a5 message also was detected in both our peripheral lymphocyte RT-PCR survey and in another study (Sato et al., 1999; Table 3). 3.3.5. a7 subunit As seen for the nAChR a4 subunit expression profile (Fig. 3C), a7 subunits also are expressed at high levels in both normal and scid tissue very early in gestation (Fig. 4B). This makes it likely that thymic stromal cells are responsible for the production of a7 subunits, at least early in ontogeny. In addition, scid tissue also consistently produced greater amounts of a7 subunit than did normal thymus tissue. This could indicate that a7 subunits are expressed by immature lymphoid cells, which would be consistent with the higher level of expression in the scid 15 day gestation thymus. In Fig. 3. Expression of nAChR a2, a3, or a4 subunit transcripts in prenatal and neonatal mouse thymus. Southern analysis of the RT-PCR products for nAChR a2 (A), a3 (B), or a4 (C) subunits or for GAPDH transcripts (each panel) was executed and quantified as described in Materials and methods. Signals for each nAChR subunit from brain or thymus samples were normalized to GAPDH signal to adjust for amounts of input RNA, and results for thymus samples were again normalized to signals from brain samples. Levels of nAChR subunit expression (ordinate; % of mouse brain subunit expression) are presented for regular (closed bars) or scid (open bars) thymus as a function of prenatal (post-gestational days 12 – 18) or neonatal (postnatal day 1; PN1) age (abscissa). Results presented in the bar graphs represent means F SEM for three sets of RT reactions each subjected to three PCR studies using cDNA derived from 10, 20, or 30 ng of total RNA. Under each bar graph, representative Southern blot results for each specific subunit and its GAPDH control are shown. Blot exposure times were different for every subunit or control blot, so signal intensities do not reflect absolute levels of gene expression or allow for quantitative comparisons between subunits. However, signal intensity for a given subunit normalized to loading control across samples allows the developmental course of subunit gene expression to be determined.

150

Y.-P. Kuo et al. / Journal of Neuroimmunology 130 (2002) 140–154

thymus. On the other hand, RT-PCR results from our human peripheral lymphocyte study detected a7 transcripts, consistent with work from Sato et al. (1999) (Table 3). Whereas Navaneetham et al. (1997) reported the presence of a7 transcripts in whole thymus but not in thymocytes (Table 3), they used a less aggressive RT-PCR approach, relying on

Fig. 4. Expression of nAChR a5 and a7 subunit transcripts in prenatal and neonatal mouse thymus. Southern analysis of the RT-PCR products for nAChR a5 (A) or a7 (B) subunits or for GAPDH transcripts (each panel) was executed and quantified as described in Materials and methods. Levels of nAChR subunit expression (ordinate; % of mouse brain subunit expression) are presented for regular (closed bars) or scid (open bars) thymus as a function of prenatal (post-gestational days 12 – 18) or neonatal (postnatal day 1; PN1) age (abscissa). Results presented in the bar graphs represent means F SEM for 3 sets of RT reactions (except for one RT reaction for gestational days 12 – 13 for the nAChR a5 subunit) each subjected to three PCR studies using cDNA derived from 10, 20, or 30 ng of total RNA. Under each bar graph, representative Southern blot results for each specific subunit and its GAPDH control are shown (see Fig. 3).

the D2P-FTOC study (Table 2), we also observed significantly higher levels of a7 subunit expression in normal thymus than in scid thymus. Perhaps removal of proliferating T cells by D2P results in an over-representation of RNAs derived from a7-expressing stromal cells in normal

Fig. 5. Expression of nAChR h2 and h4 subunit transcripts in prenatal and neonatal mouse thymus. Southern analysis of the RT-PCR products for nAChR h2 (A) or h4 (B) subunits and GAPDH transcripts (each panel) was executed and quantified as described in Materials and methods. Levels of nAChR subunit expression (ordinate; % of mouse brain subunit expression) are presented for regular (closed bars) or scid (open bars) thymus as a function of prenatal (post-gestational days 12 – 18) or neonatal (postnatal day 1; PN1) age (abscissa). Results presented in the bar graphs represent means F SEM for three sets of RT reactions (except nAChR h4 subunit scid thymus gestation days 14 and 15 samples; one RT-PCR result) each subjected to three PCR studies using cDNA derived from 10, 20, or 30 ng of total RNA. Representative Southern blot results for each specific subunit and its GAPDH control are also shown (see Fig. 3).

Y.-P. Kuo et al. / Journal of Neuroimmunology 130 (2002) 140–154

only 30 cycles of amplification and detection using ethidium staining of PCR products in agarose gels, which may have been inadequate to detect a7 subunit messages. We suggest that a7 subunits are expressed by many cell types in the thymus during ontogeny. 3.3.6. b2 subunit The expression profile for nAChR h2 subunits (Fig. 5A) mimics that of a5 subunits, being equal or higher in scid thymus than in normal thymus and rising to its highest level at birth. This profile suggests that h2 message might be expressed by immature T cells and/or thymic stromal cells. Cholinergic innervation also might up-regulate thymic h2 expression. Consistent with this idea, in the D2P-FTOC study (Table 2) of uninnervated tissue, there is no evidence for time-dependent up-regulation of h2 subunit expression in either regular or scid samples equivalent to 18 and 19 days post-gestation. Furthermore, stromal element expression of h2 subunit message is supported by high levels of detection in D2P-FTOC. Unlike the result for nAChR a5 subunits, our peripheral lymphocyte study (Table 3) failed to detect any human nAChR h subunit messages. Sato et al. (1999) found h2 message in only three out of seven human subjects’ peripheral lymphocytes. These findings suggest that expression of h2 message in mature T cells may be differentially regulated across individuals. 3.3.7. b4 subunit The h4 subunit expression profile (Fig. 5B) mimics that for the a3 subunit (a transient peak at 15 days post-gestation in scid tissue, and a rise to highest levels at birth in regular thymus). This suggests that h4 is expressed by immature lymphoid cells and, perhaps, also by stromal cells in which h4 expression can be up-regulated by the presence of mature T cells. However, unlike the a3 subunit, regular and scid thymus tissue express similar amounts of h4 subunit in the D2P-FTOC study, suggesting that the h4 subunit is probably expressed predominantly by immature T cells rather than by stromal cells as for a3 subunit. Again, h4 subunit transcripts are absent in human peripheral lymphocytes according to two reports (Mihovilovic et al., 1997; Sato et al., 1999) and our peripheral lymphocyte study (Table 3).

4. Discussion Cholinergic modulation of thymic function can occur through both direct innervation (Kendall and al-Shawaf, 1991) and local production of acetylcholine (Rinner and Schauestein, 1993). Despite increasing evidence that chronic nicotine exposure/smoking behavior can result in immunosuppression (Geng et al., 1995, 1996; Sopori and Kozak, 1998; Ouyang et al., 2000), few reports are available to date examining the expression of nAChR, targets of nicotine molecules, in the developing thymus. Many pre-

151

vious studies sought links between the thymus and muscle related to the autoimmune disorder, myasthenia gravis, and therefore concerned thymic expression of a1, h1, g, y and q subunits from muscle-type nAChR (e.g., see Navaneetham et al., 2001), or examined thymic expression of selected nAChR subunits found in the nervous system (e.g., see Kaminski et al., 1993; Mihovilovic et al., 1993, 1997; Hiemke et al., 1996; Navaneetham et al., 1997; Toyabe et al., 1997; Sato et al., 1999). Here we present for the first time a comprehensive profile of nAChR subunit (a2 –a7, h2– h4) expression in fetal thymus. In order to study nAChR subunit gene expression based on an RT-PCR approach, novel oligonucleotide primers were designed, and new partial cDNA sequences for mouse nAChR subunits were obtained based on messages from mouse brain. Among the seven new cDNA sequences, submitted under GenBank accession numbers AF325345– AF325351, nAChR a2, a3, h3 and h4 subunit sequences are novel, and a4, a7 and h2 subunit sequences reveal polymorphisms compared to other sequences published earlier in GenBank. Generation of these sequences was critical for us to evaluate specificities of primers and to determine optimum RT-PCR conditions for the chosen primers and subunit messages. In addition, these sequences allowed us to design nested oligonucleotide probes for Southern analysis of RT-PCR products. The nested probebased Southern analysis provided a second level of specificity (hybridization between product and nested probe) for detection of authentic RT-PCR products provisionally identified as correct based on RT-PCR product size. It also provided higher detection sensitivity for quantification of nAChR subunit RT-PCR products from the thymus. We examined C57BL/6J regular and scid fetal mouse thymi extracted on 13 to 18 days post-gestation or thymi extracted on the day of birth. The scid thymus, due to a defect in recombinase activity, lacks medullary lymphocytes. Thus, comparisons of nAChR expression profiles between C57BL/6J regular and scid thymi illuminate participation of maturing T cells in nAChR gene expression. Furthermore, FTOC studies beginning with fetal thymus explants at 13 – 14 days post-gestation and involving 5 days of treatment with D2P to deplete lymphoid cells, thereby temporally matched to thymus samples of 18 and 19 days post-gestation, also allowed us to interpret our results considering influences of T cell maturation and innervation on nAChR subunit expression. Major findings in our study pertaining to patterns of expression of nAChR subunit genes and associated, firstorder interpretations of these findings were presented in the Results section and will not be reiterated here. However, other principal findings were confirmation of the expression of nAChR a3, a5, a7 and h4 subunits in thymus and/or T cells or their precursors (Mihovilovic et al., 1997; Sato et al., 1999) and include the first report of thymic (stromal and/ or hematopoietic) expression of nAChR a2, a4 and h2 subunits. Developmental profiles suggest that these receptor

152

Y.-P. Kuo et al. / Journal of Neuroimmunology 130 (2002) 140–154

subunits are differentially expressed at different stages of fetal thymus development. As summarized in Table 3, stromal cells appear to express nAChR a2, a3, a4, a7 and h4 subunits, perhaps in addition to a5 and h2 subunits; immature T cells appear to express a3, a5, a7, h2 and h4 subunits; and peripheral T cells seem to express a2, a5 and a7 subunits. Therefore, both stromal and lymphoid elements of the thymus are candidate targets for nicotinic signaling. The expression pattern in stromal elements is interesting because nAChR a3, a4, a7, h2 and h4 subunits are expressed at important junctures in the developing brain (Lukas, 1998). The nAChR subunit expression pattern in immature T cells is exactly like that of post-ganglionic autonomic neurons and adrenal chromaffin cells, both of which are of neural crest origin and are targets for preganglionic cholinergic innervation (Lukas, 1998). Perhaps immature T cells are similarly designed to respond to autonomic cholinergic innervation signals in the thymus, although responsiveness to locally released ACh is also a possibility. The pattern of nAChR subunit expression in mature T cells (although not yet done using pure T cell subsets) is curious for several reasons. a3 and a4 subunits, which are predominant a subunits in heteromeric nAChR in the nervous system, seem not to be expressed by peripheral lymphocytes. a2 and a5 subunits seem to lack assembly partners found with them in the nervous system. Whereas a3 and h4 subunits have comparable expression patterns temporally and across cell types, consistent with localization of their genes in the same cluster and in the same orientation, they are expressed by immature T cells but not by peripheral lymphocytes. Perhaps the subset of thymocytes that expresses these subunits undergoes apoptosis during negative/positive selection and/or their expression in mature lymphocytes is down-regulated. It is also interesting that peripheral lymphocytes from at least some human individuals express none of the h subunits examined (h2, h4). Functional nAChR receptors in mature T cells might have unique subunit compositions or contain yet-to-be-identified assembly partners, although nicotinic responsiveness through homomeric nAChR composed of a7 subunits could occur. Whereas these findings provide a foundation for studies of nAChR function in the immune system, our interpretations are advanced cautiously. Complexity in the developmental process and cellular heterogeneity within the developing thymus sometimes makes it difficult to assign nAChR subunit gene expression to thymic stromal or lymphoid elements when experiments are done using the whole thymus (see Table 3: a2, a4, a5, and h2). However, cell-sorting, in situ hybridization, and extended FTOC studies could be used to identify sources of nAChR expression. Changes in expression of some nAChR subunits are explosive at about the time of birth. Thus, further studies extending the developmental timeline would be warranted. Innervation probably plays an important role in regulation of nAChR subunit expression, and absolute levels of some

nAChR subunit transcripts appear to differ between intact thymus and FTOC. Therefore, an extended and systematic analysis of age-matched thymi harvested directly or maintained in organ culture may be instructive. Our assessments of origin of nAChR expression sometimes involve comparisons between findings obtained using mouse and human cells or tissues, and studies to eliminate reliance on crossspecies comparisons would be useful. Functional studies show effects of nicotinic ligand actions on thymic development (Middlebrook et al., 2000, 2002), but it is yet to be determined whether thymic stromal and/or hematopoietic nAChR are involved and whether these or novel nAChR act conventionally as ion channels or perhaps through new signaling cascades, such as those promoting release of peptides/cytokines. As another example, recent studies indicate that some nAChR subtypes may be targets for lynx-1, which is a polypeptide naturally expressed in murine brain, kidney, heart, and thymus (Miwa et al., 1999). Lynx-1 belongs to a gene family that includes snake curaremimetic a-neurotoxins that act as nAChR subtype-specific antagonists and the Ly-6 membrane-linked family of immune system molecules that are thought to play roles in diverse functions including lymphocyte homing, leukocyte migration, and T cell activation through recognition and adhesive functions (Miwa et al., 1999). Perhaps immune system nAChR play roles not only in receipt of messages from acetylcholine, but also in mediation of signals from membrane-associated or detached (after cleavage of glycosyl – phosphatidylinositol links) lynx-1 or related molecules. In summary, our results complement several lines of evidence (see Introduction, also) suggesting that nAChR play important and dynamic roles in immune system function. nAChR agonists/antagonists can affect apoptosis and proportions of double negative, double positive, and single positive T cells in cocultured fetal thymus (Rinner et al., 1994). Nicotine can induce the impairment of T cell signal transduction (Geng et al., 1995, 1996) and activation of cytokines (Zhang and Petro, 1996; Petro et al., 1999). Other studies from our group are further documenting effects of nicotinic ligands on thymus and T cell fate (Middlebrook et al., 2000, 2002). In addition, nAChR are up-regulated on lymphocytes during inflammatory responses (Maslinski et al., 1992), and our studies clearly show that nAChR subunit gene expression is developmentally regulated in ways sensitive to the state of the thymic environment. Thus, like h-adrenergic receptors (Radojcic et al., 1991) and vasoactive intestinal peptide receptors (Delgado et al., 1996a,b) on lymphocytes and/or macrophages, nAChR have levels of expression that are sensitive to the state of cell maturation and function, and nAChR activity can influence cell maturation and function. Collectively, strong evidence is building that immune cells can modulate their responses to signals from the nervous system, from the endocrine system, and within the immune system, and that nAChR can play important roles in these effects, perhaps also illuminating effects of

Y.-P. Kuo et al. / Journal of Neuroimmunology 130 (2002) 140–154

nicotine exposure and tobacco use on neuroimmune interactions.

Acknowledgements Work in Phoenix toward this project, part of which was conducted in the Charlotte and Harold Simensky Neurochemistry of Alzheimer’s Disease Laboratory, was supported by endowment and/or capitalization funds from the Men’s and Women’s Boards of the Barrow Neurological Foundation, the Robert and Gloria Wallace Foundation, and Epi-Hab Phoenix, Inc. Work at both sites was principally supported by a grant from the Arizona Disease Control Research Commission (9910). The contents of this report are solely the responsibility of the authors and do not necessarily represent the views of the aforementioned awarding agencies.

References Basta, P.V., Basham, K.B., Ross, W.P., Brust, M.E., Navarro, H.A., 2000. Gestational nicotine exposure alone or in combination with ethanol down-modulates offspring immune function. International Journal of Immunopharmacology 22, 159 – 169. Borovikova, L.V., Ivanova, S., Zhang, M., Yang, H., Botchkina, G.I., Watkins, L.R., Wang, H., Abumrad, N., Eaton, J.W., Tracey, K.J., 2000. Vagus nerve stimulation attenuates the systemic inflammatory response to endotoxin. Nature 405, 458 – 462. Bulloch, K., Pomerantz, W., 1984. Autonomic nervous system innervation of thymic-related lymphoid tissue in wildtype and nude mice. Journal of Comparative Neurology 228, 57 – 68. Carding, S.R., Hayday, A.C., Bottomly, K., 1991. Cytokines in T-cell development. Immunology Today 12, 239 – 245. Carlson, N.G., Bacchi, A., Rogers, S.W., Gahring, L.C., 1998. Nicotine blocks TNF-alpha-mediated neuroprotection to NMDA by an alphabungarotoxin-sensitive pathway. Journal of Neurobiology 35, 29 – 36. Carlson, N.G., Wieggel, W.A., Chen, J., Bacchi, A., Rogers, S.W., Gahring, L.C., 1999. Inflammatory cytokines IL-1 alpha, IL-1 beta, IL-6, and TNF-alpha impart neuroprotection to an excitotoxin through distinct pathways. Journal of Immunology 163, 3963 – 3968. Davis, D.M., Chiu, I., Fassett, M., Cohen, G.B., Mandelboim, O., Strominger, J.L., 1999. The human natural killer cell immune synapse. Proceedings of the National Academy of Sciences of the United States of America 96, 15062 – 15067. Delgado, M., Martinez, C., Johnson, M.C., Gomariz, R.P., Ganea, D., 1996a. Differential expression of vasoactive intestinal peptide receptors 1 and 2 (VIP-R1 and VIP-R2) mRNA in murine lymphocytes. Journal of Neuroimmunology 68, 27 – 38. Delgado, M., Pozo, D., Martinez, C., Garrido, E., Leceta, J., Calvo, J.R., Gomariz, R.P., 1996b. Characterization of gene expression of VIP and VIP1-receptor in rat peritoneal lymphocytes and macrophages. Regulatory Peptides 62, 161 – 166. Delon, J., 2000. The immunological synapse. Current Biology 10, R214. DeLuca, D., Bluestone, J.A., Shultz, L.D., Sharrow, S.O., Tatsumi, Y., 1995. Programmed differentiation of murine thymocytes during fetal thymus organ culture. Journal of Immunological Methods 178, 13 – 29. Felten, D.L., 1993. Direct innervation of lymphoid organs: substrate for neurotransmitter signaling of cells of the immune system. Neuropsychobiology 28, 110 – 112.

153

Felten, D.L., 2000. Neural influence on immune responses: underlying suppositions and basic principles of neural-immune signaling. Progress in Brain Research 122, 381 – 389. Fields, K.L., Currie, D.N., Dutton, G.R., 1982. Development of Thy-1 antigen on cerebellar neurons in culture. Journal of Neuroscience 2, 663 – 673. Fujii, T., Tsuchiya, T., Yamada, S., Fujimoto, K., Suzuki, T., Kasahara, T., Kawashima, K., 1996. Localization and synthesis of acetylcholine in human leukemic T cell lines. Journal of Neuroscience Research 44, 66 – 72. Geng, Y., Savage, S.M., Johnson, L.J., Seagrave, J., Sopori, M.L., 1995. Effects of nicotine on the immune response: I. Chronic exposure to nicotine impairs antigen receptor-mediated signal transduction in lymphocytes. Toxicology and Applied Pharmacology 135, 268 – 278. Geng, Y., Savage, S.M., Razanai-Boroujerdi, S., Sopori, M.L., 1996. Effects of nicotine on the immune response: II. Chronic nicotine treatment induces T cell anergy. Journal of Immunology 156, 2384 – 2390. Grakoui, A., Bromley, S.K., Sumen, C., Davis, M.M., Shaw, A.S., Allen, P.M., Dustin, M.L., 1999. The immunological synapse: a molecular machine controlling T cell activation. Science 285, 221 – 227. Hiemke, C., Stolp, M., Reuss, S., Wevers, A., Reinhardt, S., Maelicke, A., Schlegel, S., Schroder, H., 1996. Expression of alpha subunit genes of nicotinic acetylcholine receptors in human lymphocytes. Neuroscience Letters 214, 171 – 174. Huh, G.S., Boulanger, L.M., Du, H., Riquelme, P.A., Brotz, T.M., Shatz, C.J., 2000. Functional requirement for class I MHC in CNS development and plasticity. Science 290, 2155 – 2159. Kaminski, H.J., Fenstermaker, R.A., Abdul-Karim, F.W., Clayman, J., Ruff, R.L., 1993. Acetylcholine receptor subunit gene expression in thymic tissue. Muscle & Nerve 16, 1332 – 1337. Kawashima, K., Fujii, T., 2000. Extraneuronal cholinergic system in lymphocytes. Pharmacology & Therapeutics 86, 29 – 48. Kawashima, K., Fujii, T., Watanabe, Y., Misawa, H., 1998. Acetylcholine synthesis and muscarinic receptor subtype mRNA expression in T-lymphocytes. Life Sciences 62, 1701 – 1705. Keiger, C.J., Walker, J.C., 2000. Individual variation in the expression profiles of nicotinic receptors in the olfactory bulb and trigeminal ganglion and identification of alpha2, alpha6, alpha9, and beta3 transcripts. Biochemical Pharmacology 59, 233 – 240. Kendall, M.D., al-Shawaf, A.A., 1991. Innervation of the rat thymus gland. Brain Behavior and Immunity 5, 9 – 28. Kingston, R., Jenkinson, E.J., Owen, J.J., 1985. A single stem cell can recolonize an embryonic thymus, producing phenotypically distinct Tcell populations. Nature 317, 811 – 813. Kuo, Y.-P., Lucero, L., Michaels, J., DeLuca, D., Lukas, R.J., 2000. Expression of mouse nicotinic acetylcholine receptor (nAChR) genes in the developing thymus. Soc. Neurosci. 30th Annual Meeting. New Orleans, LA. Lindstrom, J., 1996. Neuronal nicotinic acetylcholine receptors. In: Narahashi, T. (Ed.), Ion Channels. Plenum, New York, pp. 377 – 450. Lukas, R.J., 1995. Diversity and patterns of regulation of nicotinic receptor subtypes. Annals of the New York Academy of Sciences 757, 153 – 168. Lukas, R.J., 1998. Neuronal nicotinic acetylcholine receptors. In: Barrantes, F.J. (Ed.), The Nicotinic Acetylcholine, Receptors: Current Views and Future Trends. Springer Verlag, Georgetown, TX and Landes Publishing, Berlin, pp. 145 – 173. Lukas, R.J., Changeux, J.P., Le Novere, N., Albuquerque, E.X., Balfour, D.J., Berg, D.K., Bertrand, D., Chiappinelli, V.A., Clarke, P.B., Collins, A.C., Dani, J.A., Grady, S.R., Kellar, K.J., Lindstrom, J.M., Marks, M.J., Quik, M., Taylor, P.W., Wonnacott, S., 1999. International Union of Pharmacology: XX. Current status of the nomenclature for nicotinic acetylcholine receptors and their subunits. Pharmacological Reviews 51, 397 – 401. Maslinski, W., 1989. Cholinergic receptors of lymphocytes. Brain, Behavior, and Immunity 3, 1 – 14. Maslinski, W., Grabczewska, E., Laskowska-Bozek, H., Ryzewski, J., 1987. Expression of muscarinic cholinergic receptors during T cell

154

Y.-P. Kuo et al. / Journal of Neuroimmunology 130 (2002) 140–154

maturation in the thymus. European Journal of Immunology 17, 1059 – 1063. Maslinski, W., Laskowska-Bozek, H., Ryzewski, J., 1992. Nicotinic receptors of rat lymphocytes during adjuvant polyarthritis. Journal of Neuroscience Research 31, 336 – 340. McAllister-Sistilli, C.G., Caggiula, A.R., Knopf, S., Rose, C.A., Miller, A.L., Donny, E.C., 1998. The effects of nicotine on the immune system. Psychoneuroendocrinology 23, 175 – 187. Middlebrook, A.J., Michaels, J., Lukas, R.J., DeLuca, D., 2000. Effects of nicotine exposure on developing murine and human thymocytes in fetal thymus organ culture. FASEB Conference on Neuroimmunology, Copper Mountain, CO. Middlebrook, A.J., Martina, C., Chang, Y., Lukas, R.J., DeLuca, D., 2002. Low level nicotine exposure arrests T cell maturation: murine fetal thymus organ cultures treated with nicotine exhibit a reduction in mature thymocytes and expanded populations of immature thymocytes. Journal of Immunology, in press. Mihovilovic, M., Roses, A.D., 1993. Expression of alpha-3, alpha-5, and beta-4 neuronal acetylcholine receptor subunit transcripts in normal and myasthenia gravis thymus. Identification of thymocytes expressing the alpha-3 transcripts. Journal of Immunology 151, 6517 – 6524. Mihovilovic, M., Hulette, C., Mittelstaedt, J., Austin, C., Roses, A.D., 1993. Nicotinic neuronal acetylcholine receptor alpha-3 subunit transcription in normal and myasthenic thymus. Annals of the New York Academy of Sciences 681, 83 – 96. Mihovilovic, M., Denning, S., Mai, Y., Whichard, L.P., Patel, D.D., Roses, A.D., 1997. Thymocytes and cultured thymic epithelial cells express transcripts encoding alpha-3, alpha-5 and beta-4 subunits of neuronal nicotinic acetylcholine receptors: preferential transcription of the alpha3 and beta-4 genes by immature CD4 + 8 + thymocytes. Journal of Neuroimmunology 79, 176 – 184. Miwa, J.M., Ibanez-Tallon, I., Crabtree, G.W., Sanchez, R., Sali, A., Role, L.W., Heintz, N., 1999. lynx1, an endogenous toxin-like modulator of nicotinic acetylcholine receptors in the mammalian CNS. Neuron 23, 105 – 114. Navaneetham, D., Penn, A., Howard Jr., J., Conti-Fine, B.M., 1997. Expression of the alpha 7 subunit of the nicotinic acetylcholine receptor in normal and myasthenic human thymuses. Cellular and Molecular Biology 43, 433 – 442. Navaneetham, D., Penn, A.S., Howard Jr., J.F., Conti-Fine, B.M., 2001. Human thymuses express incomplete sets of muscle acetylcholine receptor subunit transcripts that seldom include the delta subunit. Muscle & Nerve 24, 203 – 210. Ouyang, Y., Virasch, N., Hao, P., Aubrey, M.T., Mukerjee, N., Bierer, B.E., Freed, B.M., 2000. Suppression of human IL-1beta, IL-2, IFN-gamma, and TNF-alpha production by cigarette smoke extracts. Journal of Allergy and Clinical Immunology 106, 280 – 287. Petro, T.M., Schwartzbach, S.D., Zhang, S., 1999. Smokeless tobacco and nicotine bring about excessive cytokine responses of murine memory Tcells. International Journal of Immunopharmacology 21, 103 – 114. Rabey, J.M., Shenkman, L., Gilad, G.M., 1986. Cholinergic muscarinic

binding by human lymphocytes: changes with aging, antagonist treatment, and senile dementia of the Alzheimer type. Annals of Neurology 20, 628 – 631. Radojcic, T., Baird, S., Darko, D., Smith, D., Bulloch, K., 1991. Changes in beta-adrenergic receptor distribution on immunocytes during differentiation: an analysis of T cells and macrophages. Journal of Neuroscience Research 30, 328 – 335. Richman, D.P., Antel, J.P., Burns, J.B., Arnason, B.G., 1981. Nicotinic acetylcholine receptor on human lymphocytes. Annals of the New York Academy of Sciences 377, 427 – 435. Rinner, I., Schauestein, K., 1993. Detection of choline-acetyltransferase activity in lymphocytes. Journal of Neuroscience Research 35, 188 – 191. Rinner, I., Kukulansky, T., Felsner, P., Skreiner, E., Globerson, A., Kasai, M., Hirokawa, K., Korsatko, W., Schauenstein, K., 1994. Cholinergic stimulation modulates apoptosis and differentiation of murine thymocytes via a nicotinic effect on thymic epithelium. Biochemical and Biophysical Research Communications 203, 1057 – 1062. Ritter, M.A., Boyd, R.L., 1993. Development in the thymus: it takes two to tango [see comments]. Immunology Today 14, 462 – 469. Rugh, R., 1968. The Mouse, Its Reproduction and Development Burgess Publishing, Minneapolis. Sato, K.Z., Fujii, T., Watanabe, Y., Yamada, S., Ando, T., Kazuko, F., Kawashima, K., 1999. Diversity of mRNA expression for muscarinic acetylcholine receptor subtypes and neuronal nicotinic acetylcholine receptor subunits in human mononuclear leukocytes and leukemic cell lines. Neuroscience Letters 266, 17 – 20. Singh, U., 1984. Sympathetic innervation of fetal mouse thymus. European Journal of Immunology 14, 757 – 759. Singh, U., Fatani, J.A., Mohajir, A.M., 1987. Ontogeny of cholinergic innervation of thymus in mouse. Developmental and Comparative Immunology 11, 627 – 635. Singh, S.P., Kalra, R., Puttfarcken, P., Kozak, A., Tesfaigzi, J., Sopori, M.L., 2000. Acute and chronic nicotine exposures modulate the immune system through different pathways. Toxicology and Applied Pharmacology 164, 65 – 72. Sopori, M.L., Kozak, W., 1998. Immunomodulatory effects of cigarette smoke. Journal of Neuroimmunology 83, 148 – 156. Suzuki, S.T., 1996. Structural and functional diversity of cadherin superfamily: are new members of cadherin superfamily involved in signal transduction pathway? Journal of Cellular Biochemistry 61, 531 – 542. Takeichi, M., 1995. Morphogenetic roles of classic cadherins. Current Opinion in Cell Biology 7, 619 – 627. Toyabe, S., Iiai, T., Fukuda, M., Kawamura, T., Suzuki, S., Uchiyama, M., Abo, T., 1997. Identification of nicotinic acetylcholine receptors on lymphocytes in the periphery as well as thymus in mice. Immunology 92, 201 – 205. Tria, M.A., Vantini, G., Fiori, M.G., Rossi, A., 1992. Choline acetyltransferase activity in murine thymus. Journal of Neuroscience Research 31, 380 – 386. Zhang, S., Petro, T.M., 1996. The effect of nicotine on murine CD4 T cell responses. International Journal of Immunopharmacology 18, 467 – 478.