Differential expression of PACAP receptors in postnatal rat brain

Neuropeptides 44 (2010) 509–514

Contents lists available at ScienceDirect

Neuropeptides journal homepage: www.elsevier.com/locate/npep

Differential expression of PACAP receptors in postnatal rat brain Yevgenia Shneider a,b, Yael Shtrauss a, Gal Yadid b, Albert Pinhasov a,⇑ a b

Department of Molecular Biology, Ariel University Center of Samaria, Ariel 40700, Israel Leslie Susan Gonda (Goldschmied) Multidisciplinary Brain Research Center, Bar-Ilan University, Ramat-Gan 52900, Israel

a r t i c l e

i n f o

Article history: Received 8 January 2010 Accepted 14 September 2010 Available online 23 October 2010 Keywords: PACAP VIP PAC1 VPAC1 VPAC2 Postnatal development Cortex Hippocampus Striatum

a b s t r a c t Pituitary Adenylate Cyclase Activating Polypeptide (PACAP) is a multi-functional neuropeptide that acts through activation of three common G-protein coupled receptors (VPAC1, VPAC2 and PAC1). In this study, we have investigated the gene expression profile of PAC1 isoforms (Hop1, Hip, Hip–Hop) and VPAC1, VPAC2 receptors in distinct brain regions during different stages of rat postnatal development. Using quantitative real time PCR approach we found that PAC1 isoforms were highly expressed in the cortex of newborns with marked decrease in expression during later stages of development. In contrast, mRNA levels of VPAC1, VPAC2 receptors were markedly lower in newborns in comparison to later developmental stages. Expression of PAC1 isoforms predominated in the hippocampus, while expression of VPAC1 was more prominent in the cortex and VPAC2 in the striatum and hippocampus. In addition we found that during early stages of postnatal development the expression of PAC1 receptor in the hippocampus was significantly higher in females than in males. No sex dependent differences in expression were observed for the VPAC1 and VPAC2 receptors. In summary, differential expression of PAC1, VPAC1 and VPAC2 receptors during postnatal development as well as gender dependent differences of PAC1 receptor expression in the hippocampus, will contribute to our understanding of the role of PACAP/VIP signaling system in normal brain development and function. Ó 2010 Elsevier Ltd. All rights reserved.

1. Introduction PACAP belongs to the VIP-glucagon-GRF-secretin superfamily of structurally related peptides. Two classes of high affinity receptors mediate PACAP’s effect. The first class, the PAC1 receptor, exhibits high affinity (Kd  0.5 nM) for PACAP and a much lower affinity (Kd  500 nM) for VIP (Spengler et al. 1993; Dickson and Finlayson 2009). The second class, which consists of the VPAC1 and VPAC2 receptors, possess similar affinity (Kd  1 nM) for PACAP and VIP (Dickson and Finlayson 2009). Both PAC1 and VPAC1/VPAC2 are seven-transmembrane domain, G-protein-coupled receptors. Several splice variants of PAC1 receptor, coupled to the activation of both adenylate cyclase and inositol phosphate/phospholipase C systems have been described (Spengler et al. 1993; Journot et al. 1994; Dautzenberg et al. 1999; Daniel et al. 2001; Vaudry et al. 2009). Most of PAC1 isoforms identified in rat result from alternative splicing in the third intracellular loop (IC3) (Spengler et al. 1993; Journot et al. 1994; Vaudry et al. 2009). The splice variants are characterized by the absence or presence of either one (Hip or Hop1 variant) or two (Hip–Hop) cassettes of 28 or 27 (Hop2 vari-

⇑ Corresponding author. Tel.: +972 54 7740271; fax: +972 3 9371422. E-mail address: [email protected] (A. Pinhasov). 0143-4179/$ - see front matter Ó 2010 Elsevier Ltd. All rights reserved. doi:10.1016/j.npep.2010.09.001

ant) amino acids (Spengler et al. 1993; Journot et al. 1994). The IC3 domain is widely accepted to be important in determining the selectivity of receptor-G protein coupling, particularly PAC1 receptor signaling. PACAP and its receptors are widely distributed in the organism (Vaudry et al. 2009, 2000). The expression of PAC1, VPAC1 and VPAC2 receptors is not cell-specific, thus tissues possess various proportions of each receptor (Vaudry et al. 2000; Tatsuno et al. 1990; Usdin et al., 1994; Nguyen et al., 1993). High levels of PAC1 binding sites have been found in the hypothalamic area, pituitary and chromaffin cells of adrenal glands (Miyata et al. 1989; Arimura et al. 1991). Studies in vitro and in vivo indicate PACAP’s protective properties against a variety of toxic elements such as beta amyloid (Onoue et al. 2002) and glutamate induced toxicity (Babai et al. 2006), as well as oxidative stress (Pilzer and Gozes 2006). PACAP is also reported to protect against stroke and ischemia (Ohtaki et al. 2008; Stumm et al. 2007). In addition, PACAP and its receptors’ expression are upregulated after stroke and various types of ischemia (Ohtaki et al. 2008; Chen et al. 2006). In the current study, the gene expression profile of three PAC1 isoforms resulting from alternative splicing in the IC3, as well as the expression profile of VPAC1 and VPAC2 receptors, has been examined by quantitative real time PCR analysis during rat postnatal development.

510

Y. Shneider et al. / Neuropeptides 44 (2010) 509–514 Table 1 Primer sequences and features. R- reverse, F – forward, Universal – common forwards primer for Hip, Hop and Hip-Hop splice variants. Primer

Length

tm

GC%

Product size (bp)

Sequence

PAC-1(F) PAC-1(R) Universal (F) Hip (R) Hop1 (R) Hip-Hop (R) VPAC-1(F) VPAC-1(R) VPAC-2(F) VPAC-2(R) HPRT (F) HPRT (R)

21 20 22 24 21 22 20 20 20 20 20 20

59.89 60.15 60.18 59.23 61.81 59.36 60.03 60.16 59.97 59.82 59.40 60.10

52.00 50.00 45.45 41.67 52.38 45.45 55.00 55.00 55.00 55.00 45.00 45.00

197

GGTGAGATGGTCCTTGTAAGC CCCACAAGCATCGAAGTAGT AGGATGCTGGGATATGAATGAC CTTGGGGACTCTCAGTCTTAAATT TTCTGCACGCAGCTGAAGTAG TTTCTTGGGGACTCTCAGTCTT CAAGGATATGGCCCTCTTCA TGATGAACACACTGGGCACT CAGATGTTGGTGGCAATGAC CCTGGAAGGAACCAACACAT AGGCCAGACTTTGTTGGATT GCTTTTCCACTTTCGCTGAT

2. Materials and methods

– 180 180 196 230 165 158

in PAC1 hippocampal mRNA expression between genders were analyzed using student t-test.

2.1. Animals and tissue preparation Newborn, one-, six- and nine months-old Sprague–Dawley rats (Harlan Laboratories) were used for this study. The experiments were conducted in compliance with the NIH/USDA guidelines, under the approved Institutional Animal Care and Use Committee (Protocol number IL-13-10-06). Each group of animals consists of 6 animals. Newborn rats were killed by decapitation; adult rats were anesthetized in a CO2 chamber and decapitated immediately after. Brain regions (prefrontal cortex, hippocampus, striatum and cerebellum) were removed, placed in cryogenic tubes, frozen immediately in liquid nitrogen and stored at 80 °C until use. 2.2. RNA extraction and reverse transcription (RT) Total RNA was isolated using 50 prime RNA isolation kit (50 prime, MD, USA, Cat. No.400800). Purity, integrity and concentration of the isolated RNA samples were determined by spectrophotometric absorbance at 260 nm. RNA (1 lg) was reverse transcribed in a final volume of 20 ll, using reverse transcription system (Promega, USA, Cat No. #A3500) with oligo(dT) 18primers, according to the manufacturer’s instructions. 2.3. Quantitative PCR mRNA levels were examined using quantitative real time PCR (QPCR) analysis. Primers for PAC1, its splice variants, VPAC1 and VPAC2 were synthesized by Sigma Aldrich Ltd. (Table 1). QPCRs were carried out in 12 ll triplicates consisting of 2 PCR Sybr green master mix (RovaLab, Cat No. VAR-STR-S200B), 125 nM of forward and reverse primers and 12 ng of cDNA. Reactions were carried out in the MxPro3000 apparatus (Stratagene, USA) according to the following thermal profile: 5 min at 95 °C, followed by 35 cycles of: 20 s at 95 °C, 30 sec at 60 °C and 30 sec at 72 °C. The specificity of each primer set was monitored by dissociation curve analysis according to the following profile: 1 min at 95 °C, 30 sec at 55 °C and 30 sec at 95 °C. Transcript levels of the HPRT gene were used as an endogenous normalization factor (Table 1). 2.4. Statistical analyses Data are presented as the mean ± SEM from three independent experiments performed in triplicate. Statistical analyses were performed on PrismPad software using one-way ANOVA followed by Bonferoni-corrected post hoc analysis. Statistical differences are shown as * at p < 0.05, ** at p < 0.01 and *** at p < 0.001. Differences

3. Results 3.1. Expression of PAC1 splice variants, VPAC1 and VPAC2 receptors in the cortex of newborn, juvenile and adult rats Levels of Hop1 (Fig. 1B) were significantly higher in the cortex of newborn (NB) rats in comparison to one (p < 0.001, df = 3, t = 5.45), six (p < 0.001, df = 3, t = 5.321) and nine month (p < 0.001, df = 3, t = 5.372) old rats. A similar pattern was observed in expression of Hip (Fig. 1A, p < 0.001, df = 3, with t values from 7.617 to 7.913) and Hip-Hop (Fig. 1C, p < 0.001, df = 3, with t values from 8.401 to 8.645). No significant differences were observed among adult rats for all analyzed splice variants. Three fold differences have been observed in gene expression of Hip and Hip-Hop splice variants of NB versus older animals, while a two fold difference was observed between NB and older animals’ expression of Hop isoform. In contrast, VPAC1 and VPAC2 expression showed an opposite profile. Expression of both receptors was markedly low in newborns in comparison to one month old animals (Fig. 1D and 1E, p < 0.001, df = 3, with t values from 5.127 to 5.33 for VPAC1 and from 3.94 to 4.609 for VPAC2). This level of expression was sustained during other tested periods, although a non-significant reduction in expression of VPAC1 and VPAC2 has been observed in the cortexes of nine month old animals. 3.2. Expression of PAC1 splice variants and VPAC1, VPAC2 receptors in the different parts of the brain Expression of PAC1 isoforms Hip, Hop1, Hip-Hop, as well as VPAC1 and VPAC2 receptors in the cortex, hippocampus, striatum and cerebellum of one month old rats were examined. No significant difference in the expression of the Hip-Hop isoform (Fig. 2A) was detected in the tested brain regions, although levels of expression were higher in hippocampus in comparison to other tested regions. The expression profile of the Hip splice variant was almost identical (Fig. 2B). In contrast, the expression profile of Hop1 splice variant showed a significantly lower level in the striatum in comparison to the hippocampus (Fig. 2C, p < 0.05, df = 3, t = 3.488). Expression profile of VPAC1 was markedly varied among the different brain regions (Fig. 2D), with significantly higher expression in the cortex than in the hippocampus (p < 0.01, df = 3, t = 3.733), cerebellum (p < 0.001, df = 3, t = 14.33), and striatum (p < 0.001, df = 3, t = 10.733). VPAC1 expression in the cerebellum was hardly observed. Expression of VPAC2 receptor (Fig. 2E) had a similar pattern of expression to that of PAC1 isoforms, with significant differences detected in comparison of the hippocampus to the cerebellum

511

9

6

1

M on th

0 th

th

25

9

M on

***

***

***

HIP-HOP1

100 75

***

***

***

50 25

th on 9

25

*** th M 9

on M 6

on

th

0 th

on th M 9

on th M 6

1

M

on

th

B

*** N

0

50

on

25

75

M

50

100

1

75

VPAC2

B

100

E

N

VPAC1

Normalized quantity mean (r. u.)

D

M

on th 6

1

M

M

on

th

B

0

N

Normalized quantity mean (r. u.)

th M on

1

6

M on

B

th

0

50

M on

25

75

th

50

C

Normalized quantity mean (r. u.)

***

***

***

100

M on

75

HOP1

B

100

B

N

HIP

Normalized quantity mean (r. u.)

A

N

Normalized quantity mean (r. u.)

Y. Shneider et al. / Neuropeptides 44 (2010) 509–514

Fig. 1. Expression profile of Hip, Hop1, Hip-Hop and VPAC1/VPAC2 mRNA in the whole cortex during postnatal development. RNA was extracted, reverse transcribed and subjected to real time PCR analysis. HPRT gene was used as external control. Statistical significance has been analyzed using one-way ANOVA followed by Bonferoni-corrected post hoc analysis. Data points marked (***) are significant at p < 0.001. Relative expression of PAC1 splice variants (1A–C) and VPAC1, VPAC2 receptors’ mRNA (1D-E) in correlation with age of Sprague-Dawly rats. n = 6 for each age group. NB – newborns.

(p < 0.05, df = 3, t = 3.245) and of the cerebellum to the striatum (p < 0.05, df = 3, t = 3.541). 3.3. Effect of gender on PAC1 expression in the hippocampus of NB, 1 and 3 month old rats mRNA expression of Hip, Hop1, Hip-Hop and VPAC1 and VPAC2 was examined in the hippocampus of NB and one month old males and females. Analysis of PAC1 splice variants did not reveal significant differences in expression between males and females,

although mRNA levels were higher in females than in males. Analysis of PAC1 mRNA expression, using primers for amplification of the region common to all splice variants, revealed that in the hippocampus of NB males PAC1 levels were significantly lower in comparison to female rats (Fig. 3A, p < 0.001, df = 10, t = 5.027). The same differential expression profile was observed in the hippocampus of one month old (Fig. 3B, p < 0.05, df = 10, t = 3.262) and three month old (Fig. 3C, p < 0.05, df = 10, t = 2.796) animals. No significant difference between the genders has been observed in VPAC1 and VPAC2 expression.

Y. Shneider et al. / Neuropeptides 44 (2010) 509–514

10

re

ria tu m st

pu s

be l lu m

0 po ca m

ri a tu m

20

hi p

st

pu s am po c hi p

ce re be llu m

0

30

rte x

10

HIP

co

20

Normalized quantity mean (r. u.)

30

C

HOP1

75 60 45

*

30 15

m st

ri a

tu

m

hi

pp

ce

oc

re

be

am

llu

pu

rte

s

x

0 co

Normalized quantity mean (r. u.)

B

HIP-HOP1

co rte x

Normalized quantity mean (r. u.)

A

ce

512

20

m tu ria st

be re

am oc hi

pp

llu

pu

m

s

0 x

m tu ria st

m re be ce

am pu oc hi

pp

llu

s

x rte

40

rte

*** 0

*

*

60

co

***

20

Normalized quantity mean (r. u.)

**

co

Normalized quantity mean (r. u.)

60

40

VPAC2

E

ce

VPAC1

D

Fig. 2. Relative expression of PAC1 splice variants and VPAC1/VPAC2 mRNA in brain regions of Sprague-Dawely rats. Statistical significance has been analyzed using one-way ANOVA followed by Bonferoni-corrected post hoc analysis. Data points marked (*) are significant at p < 0.05, (**) at p < 0.01 and (***) at p < 0.001; n = 6 for each brain region.

4. Discussion There are numerous studies indicating the involvement of PACAP/VIP receptors in various physiological systems (Chen et al. 2006; Waschek 2002; Reichenstein et al., 2008; Rangon et al. 2005). Neuroprotective properties of PACAP have been thoroughly investigated (Stumm et al. 2007; Chen et al. 2006; Waschek 2002; Reglodi et al. 2000; Shioda et al. 2006). Recent publications suggest

a possible involvement of PACAP signaling system in the etiology of anxiety and affective disorders (Reichenstein et al. 2008; Hammack et al. 2009; Kamnasaran 2003). Different research groups showed PACAP and its receptors’ expression profiles in distinct brain regions during development using various gene expression approaches (Waschek et al. 1998; Sheward et al., 1996; Zhou et al. 2000; Zhou et al. 1999). It has been also suggested that PACAP and its specific receptor PAC1 participate in the regulation of neu-

Normalized quantity mean (r. u.)

2.5

Normalized quantity mean (r. u.)

Y. Shneider et al. / Neuropeptides 44 (2010) 509–514

2.5

A

2.0

***

1.5 1.0 0.5

N

B

N B

(M

(F )

)

0.0

B *

2.0 1.5 1.0 0.5

(F

)

th

(M

on

th

M

on

1

M 1

C 2.5 2.0

*

1.5 1.0 0.5

M 3

on t M 3

on th

(M

(F

)

)

0.0 h

Normalized quantity mean (r. u.)

)

0.0

Fig. 3. Expression of PAC1 mRNA in the hippocampus of newborn, one month and three months old males and females. Statistical significance has been analyzed using one-way ANOVA followed by Bonferoni-corrected post hoc analysis. Data points marked (*) are significant at p < 0.05 and (***) at p < 0.001; n = 6 for each group. NB – newborns; M – males; F – females.

rodevelopment (Waschek et al. 1998; Vaudry et al. 1999; Watanabe et al. 2006). In this research, we analyzed simultaneously mRNA expression of VPAC1, VPAC2 and several isoforms of the PAC1 receptor during different periods of rat postnatal development using quantitative PCR approach. We found that the expression of tested PAC1 receptor isoforms were high immediately after the birth and dramatically decreased toward one month (Figs. 1A–C). In contrast, expression of VPAC1 and VPAC2 receptors increased considerably during the first month of life (Figs. 1D–E).

513

Recent epidemiological studies link early growth patterns with human behaviors or mental illnesses (O’Hearn et al. 2008; Sanches et al. 2008; Vita et al. 1997). In addition, disturbances during early postnatal development are specifically associated with impaired cognitive function, hyperactivity and psychiatric disorders (O’Hearn et al. 2008; Sanches et al. 2008; Vita et al. 1997). Thus, distinct expression pattern of VPAC1, VPAC2 and PAC1 isoforms during early postnatal development may be coupled to proper brain function. Hashimoto and colleagues showed that mice with PACAP deficiency exhibited altered psychomotor behaviors (Hashimoto et al. 2001). The same group later found association of PACAP and its receptor PAC1 with schizophrenia (Hashimoto et al. 2007). In our study relatively high expression of PACAP receptors was observed in the hippocampus, a brain region that is responsible for the learning and memory (Shen et al. 1994; Nachkebiia and Oniani 1985; Dmitrieva et al., 1977; Jarrard 1993). Studies from the last decade couple impairments in the hippocampus with affective disorders (Duman et al., 1997; Duman and Monteggia 2006). There are numerous reports showing that the volume of the hippocampus is decreased in depressed subjects (Sheline et al., 2003; Bremner et al. 2002). Relatively high expression of PAC1 isoforms in the hippocampus may hint at their importance for hippocampal neurotransmission. This statement is supported by numerous studies in vitro and in vivo indicating the neuroprotective properties of PAC1 receptors (Ohtaki et al. 2008; Chen et al. 2006; Shioda et al. 2006; Atlasz et al. 2008). Analysis of PAC1 receptors’ expression between genders revealed that all tested isoforms showed a tendency towards sexual dimorphism in preference to females (data not shown). Analysis of PAC1 expression using amplicon common for all splice variants, revealed significant upregulation of gene expression in the hippocampus in females as opposed to males. In addition, the inequality in expression of PAC1 receptors between the sexes was higher in newborns than in one month old animals. PACAP belongs to the hypothalamus-pituitary-adrenal (HPA) axis (Miyata et al. 1989; Arimura et al. 1991). The HPA axis is a central control and regulatory mechanism of the organism that connects the central nervous and hormonal systems. Responses of HPA axis to stress are sexually dimorphic (Kudielka and Kirschbaum 2005). The posttranslational processing involves activity of several endoproteases. Deficiency of prohormone convertase 4, which acts exclusively on PACAP precursor in the gonads, exhibited severely impaired fertility with apparent normal spermatogenesis (Li et al., 2000). This finding supports the importance of PACAP signaling system in fertilization and early postnatal development. To conclude, our experiments confirm that both PAC1 and VPAC1/VPAC2 receptors are differentially expressed during postnatal development, suggesting their critical role in early developmental processes. Furthermore, the distinctive expression of the PAC1 receptor in males vs females signifies the developmental differences between the sexes and provides additional confirmation of the importance of PACAP signaling system in early development. All this is strongly girded by the preferential expression of PAC1 and VPAC1/VPAC2 receptors in brain regions that are important to developmental processes including brain formation and sexual differentiation.

References Arimura, A., Somogyvari-Vigh, A., Miyata, A., Mizuno, K., Coy, D.H., Kitada, C., 1991. Tissue distribution of PACAP as determined by RIA: highly abundant in the rat brain and testes. Endocrinology 129, 2787–2789. Atlasz, T., Szabadfi, K., Kiss, P., Babai, N., Koszegi, Z., Tamas, A., Reglodi, D., Gabriel, R., 2008. PACAP-mediated neuroprotection of neurochemically identified cell types in MSG-induced retinal degeneration. J. Mol. Neurosci. 36, 97–104. Babai, N., Atlasz, T., Tamas, A., Reglodi, D., Toth, G., Kiss, P., Gabriel, R., 2006. Search for the optimal monosodium glutamate treatment schedule to study the

514

Y. Shneider et al. / Neuropeptides 44 (2010) 509–514

neuroprotective effects of PACAP in the retina. Ann. N. Y. Acad. Sci. 1070, 149– 155. Bremner, J.D., Vythilingam, M., Vermetten, E., Nazeer, A., Adil, J., Khan, S., Staib, L.H., Charney, D.S., 2002. Reduced volume of orbitofrontal cortex in major depression. Biol. Psychiatry 51, 273–279. Chen, Y., Samal, B., Hamelink, C.R., Xiang, C.C., Chen, M., Vaudry, D., Brownstein, M.J., Hallenbeck, J.M., Eiden, L.E., 2006. Neuroprotection by endogenous and exogenous PACAP following stroke. Regul. Pept. 137, 4–19. Daniel, P.B., Kieffer, T.J., Leech, C.A., Habener, J.F., 2001. Novel alternatively spliced exon in the extracellular ligand-binding domain of the pituitary adenylate cyclase-activating polypeptide (PACAP) type 1 receptor (PAC1R) selectively increases ligand affinity and alters signal transduction coupling during spermatogenesis. J. Biol. Chem. 276, 12938–12944. Dautzenberg, F.M., Mevenkamp, G., Wille, S., Hauger, R.L., 1999. N-terminal splice variants of the type I PACAP receptor: isolation, characterization and ligand binding/selectivity determinants. J. Neuroendocrinol. 11, 941–949. Dickson, L., Finlayson, K., 2009. VPAC and PAC receptors: From ligands to function. Pharmacol. Ther. 121, 294–316. Dmitrieva, N.I., Semenova, T.P., Uteshev, V.K., 1977. Dimensions of the hippocampus, memory, and learning in the ontogenesis of rats. Neurosci. Behav. Physiol. 8, 321–326. Duman, R.S., Monteggia, L.M., 2006. A neurotrophic model for stress-related mood disorders. Biol. Psychiatry 59, 1116–1127. Duman, R.S., Heninger, G.R., Nestler, E.J., 1997. A molecular and cellular theory of depression. Arch. Gen. Psychiatry 54, 597–606. Hammack, S.E., Cheung, J., Rhodes, K.M., Schutz, K.C., Falls, W.A., Braas, K.M., May, V., 2009. Chronic stress increases pituitary adenylate cyclase-activating peptide (PACAP) and brain-derived neurotrophic factor (BDNF) mRNA expression in the bed nucleus of the stria terminalis (BNST): roles for PACAP in anxiety-like behavior. Psychoneuroendocrinology 34, 833–843. Hashimoto, H., Shintani, N., Tanaka, K., Mori, W., Hirose, M., Matsuda, T., Sakaue, M., Miyazaki, J., Niwa, H., Tashiro, F., Yamamoto, K., Koga, K., Tomimoto, S., Kunugi, A., Suetake, S., Baba, A., 2001. Altered psychomotor behaviors in mice lacking pituitary adenylate cyclase-activating polypeptide (PACAP). Proc. Natl Acad. Sci. USA 98, 13355–13360. Hashimoto, R., Hashimoto, H., Shintani, N., Chiba, S., Hattori, S., Okada, T., Nakajima, M., Tanaka, K., Kawagishi, N., Nemoto, K., Mori, T., Ohnishi, T., Noguchi, H., Hori, H., Suzuki, T., Iwata, N., Ozaki, N., Nakabayashi, T., Saitoh, O., Kosuga, A., Tatsumi, M., Kamijima, K., Weinberger, D.R., Kunugi, H., Baba, A., 2007. Pituitary adenylate cyclase-activating polypeptide is associated with schizophrenia. Mol. Psychiatry 12, 1026–1032. Jarrard, L.E., 1993. On the role of the hippocampus in learning and memory in the rat. Behav. Neurol. Biol. 60, 9–26. Journot, L., Spengler, D., Pantaloni, C., Dumuis, A., Sebben, M., Bockaert, J., 1994. The PACAP receptor: generation by alternative splicing of functional diversity among G protein-coupled receptors in nerve cells. Semin. Cell Biol. 5, 263–272. Kamnasaran, D., 2003. Genetic analysis of psychiatric disorders associated with human chromosome 18. Clin. Invest. Med. 26, 285–302. Kudielka, B.M., Kirschbaum, C., 2005. Sex differences in HPA axis responses to stress: a review. Biol. Psychol. 69, 113–132. Li, M., Mbikay, M., Arimura, A., 2000. Pituitary adenylate cyclase-activating polypeptide precursor is processed solely by prohormone convertase 4 in the gonads. Endocrinology 141, 3723–3730. Miyata, A., Arimura, A., Dahl, R.R., Minamino, N., Uehara, A., Jiang, L., Culler, M.D., Coy, D.H., 1989. Isolation of a novel 38 residue-hypothalamic polypeptide which stimulates adenylate cyclase in pituitary cells. Biochem. Biophys. Res. Commun. 164, 567–574. Nachkebiia, N.G., Oniani, T.N., 1985. Effect of functional elimination of the hippocampus on learning and memory. Fiziol. Zh. 31, 385–392. Nguyen, T.D., Heintz, G.G., Wolfe, M.S., 1993. Structural characterization of PACAP receptors on rat liver plasma membranes. Am. J. Physiol. 265, G811–818. O’Hearn, K., Asato, M., Ordaz, S., Luna, B., 2008. Neurodevelopment and executive function in autism. Dev. Psychopathol. 20, 1103–1132. Ohtaki, H., Nakamachi, T., Dohi, K., Shioda, S., 2008. Role of PACAP in ischemic neural death. J. Mol. Neurosci. 36, 16–25. Onoue, S., Endo, K., Ohshima, K., Yajima, T., Kashimoto, K., 2002. The neuropeptide PACAP attenuates beta-amyloid (1–42)-induced toxicity in PC12 cells. Peptides 23, 1471–1478. Pilzer, I., Gozes, I., 2006. VIP provides cellular protection through a specific splice variant of the PACAP receptor: a new neuroprotection target. Peptides 27, 2867–2876.

Rangon, C.M., Goursaud, S., Medja, F., Lelievre, V., Mounien, L., Husson, I., Brabet, P., Jegou, S., Janet, T., Gressens, P., 2005. VPAC2 receptors mediate vasoactive intestinal peptide-induced neuroprotection against neonatal excitotoxic brain lesions in mice. J. Pharmacol. Exp. Ther. 314, 745–752. Reglodi, D., Somogyvari-Vigh, A., Vigh, S., Kozicz, T., Arimura, A., 2000. Delayed systemic administration of PACAP38 is neuroprotective in transient middle cerebral artery occlusion in the rat. Stroke 31, 1411–1417. Reichenstein, M., Rehavi, M., Pinhasov, A., 2008. Involvement of pituitary adenylate cyclase activating polypeptide (PACAP) and its receptors in the mechanism of antidepressant action. J. Mol. Neurosci. 36, 330–338. Sanches, M., Keshavan, M.S., Brambilla, P., Soares, J.C., 2008. Neurodevelopmental basis of bipolar disorder: a critical appraisal. Prog. Neuropsychopharmacol. Biol. Psychiatry 32, 1617–1627. Sheline, Y.I., Gado, M.H., Kraemer, H.C., 2003. Untreated depression and hippocampal volume loss. Am. J. Psychiatry 160, 1516–1518. Shen, Y., Specht, S.M., De Saint Ghislain, I., Li, R., 1994. The hippocampus: a biological model for studying learning and memory. Prog. Neurobiol. 44, 485– 496. Sheward, W.J., Lutz, E.M., Harmar, A.J., 1996. Expression of pituitary adenylate cyclase activating polypeptide receptors in the early mouse embryo as assessed by reverse transcription polymerase chain reaction and in situ hybridisation. Neurosci. Lett. 216, 45–48. Shioda, S., Ohtaki, H., Nakamachi, T., Dohi, K., Watanabe, J., Nakajo, S., Arata, S., Kitamura, S., Okuda, H., Takenoya, F., Kitamura, Y., 2006. Pleiotropic functions of PACAP in the CNS: neuroprotection and neurodevelopment. Ann. N. Y. Acad. Sci. 1070, 550–560. Spengler, D., Waeber, C., Pantaloni, C., Holsboer, F., Bockaert, J., Seeburg, P.H., Journot, L., 1993. Differential signal transduction by five splice variants of the PACAP receptor. Nature 365, 170–175. Stumm, R., Kolodziej, A., Prinz, V., Endres, M., Wu, D.F., Hollt, V., 2007. Pituitary adenylate cyclase-activating polypeptide is up-regulated in cortical pyramidal cells after focal ischemia and protects neurons from mild hypoxic/ischemic damage. J. Neurochem. 103, 1666–1681. Tatsuno, I., Gottschall, P.E., Koves, K., Arimura, A., 1990. Demonstration of specific binding sites for pituitary adenylate cyclase activating polypeptide (PACAP) in rat astrocytes. Biochem. Biophys. Res. Commun. 168, 1027–1033. Usdin, T.B., Bonner, T.I., Mezey, E., 1994. Two receptors for vasoactive intestinal polypeptide with similar specificity and complementary distributions. Endocrinology 135, 2662–2680. Vaudry, D., Gonzalez, B.J., Basille, M., Fournier, A., Vaudry, H., 1999. Neurotrophic activity of pituitary adenylate cyclase-activating polypeptide on rat cerebellar cortex during development. Proc. Natl Acad. Sci. USA 96, 9415–9420. Vaudry, D., Gonzalez, B.J., Basille, M., Yon, L., Fournier, A., Vaudry, H., 2000. Pituitary adenylate cyclase-activating polypeptide and its receptors: from structure to functions. Pharmacol. Rev. 52, 269–324. Vaudry, D., Falluel-Morel, A., Bourgault, S., Basille, M., Burel, D., Wurtz, O., Fournier, A., Chow, B.K., Hashimoto, H., Galas, L., Vaudry, H., 2009. Pituitary adenylate cyclase-activating polypeptide and its receptors: 20 years after the discovery. Pharmacol. Rev. 61, 283–357. Vita, A., Dieci, M., Giobbio, G.M., Tenconi, F., Invernizzi, G., 1997. Time course of cerebral ventricular enlargement in schizophrenia supports the hypothesis of its neurodevelopmental nature. Schizophr. Res. 23, 25–30. Waschek, J.A., 2002. Multiple actions of pituitary adenylyl cyclase activating peptide in nervous system development and regeneration. Dev. Neurosci. 24, 14–23. Waschek, J.A., Casillas, R.A., Nguyen, T.B., DiCicco-Bloom, E.M., Carpenter, E.M., Rodriguez, W.I., 1998. Neural tube expression of pituitary adenylate cyclaseactivating peptide (PACAP) and receptor: potential role in patterning and neurogenesis. Proc. Natl Acad. Sci. USA 95, 9602–9607. Watanabe, J., Ohba, M., Ohno, F., Kikuyama, S., Nakamura, M., Nakaya, K., Arimura, A., Shioda, S., Nakajo, S., 2006. Pituitary adenylate cyclase-activating polypeptide-induced differentiation of embryonic neural stem cells into astrocytes is mediated via the beta isoform of protein kinase C. J. Neurosci. Res. 84, 1645–1655. Zhou, C.J., Shioda, S., Shibanuma, M., Nakajo, S., Funahashi, H., Nakai, Y., Arimura, A., Kikuyama, S., 1999. Pituitary adenylate cyclase-activating polypeptide receptors during development: expression in the rat embryo at primitive streak stage. Neuroscience 93, 375–391. Zhou, C.J., Kikuyama, S., Nakajo, S., Arimura, A., Shioda, S., 2000. Ontogeny of PACAP receptor and its splice variants in the rat brain. Ann. N. Y. Acad. Sci. 921, 375– 376.