Differential expression of SV2A in hippocampal glutamatergic and GABAergic terminals during postnatal development

Brain Research 1715 (2019) 73–83

Contents lists available at ScienceDirect

Brain Research journal homepage: www.elsevier.com/locate/brainres

Research report

Differential expression of SV2A in hippocampal glutamatergic and GABAergic terminals during postnatal development América Vanoye-Carloa, Gisela Gómez-Lirab, a b

T

⁎

Laboratory of Neurosciences, Instituto Nacional de Pediatría, Secretaria de Salud, Mexico City 04530, Mexico Department of Pharmacobiology, Centro de Investigación y Estudios Avanzados del Instituto Politécnico Nacional, Mexico City, Mexico

H I GH L IG H T S

and glutamatergic terminals express SV2A in a layer-dependent manner. • GABAergic and glutamatergic terminals express SV2A in an age-dependent manner. • GABAergic • The SV2A protein may improve the excitatory/inhibitory balance in the hippocampus.

A R T I C LE I N FO

A B S T R A C T

Keywords: SV2A Hippocampus GABAergic terminal Glutamatergic terminal Development

The function of synaptic vesicle protein 2A (SV2A) has not been clearly identified, although it has an essential role in normal neurotransmission. Changes in SV2A expression have been linked to several diseases that could implicate an imbalance between excitation and inhibition, such as epilepsy. Although it is known that SV2A expression is necessary for survival, SV2A expression and its relationship with γ-aminobutyric acid (GABA) and glutamate neurotransmitter systems along development has not been addressed. This report follows SV2A expression levels in the rat hippocampus and their association with glutamatergic and GABAergic terminals along postnatal development. Total SV2A expression was assessed by real time PCR and western blot, while immunofluorescence was used to identify SV2A protein in the different hippocampal layers and its co-localization with GABA or glutamate vesicular transporters. SV2A was dynamically regulated along development and its association with GABA or glutamate transporters varied in the different hippocampal layers. In the principal cells layers (granular and pyramidal), SV2A protein was preferentially localized to GABAergic terminals, while in the hilus and stratum lucidum SV2A was associated mainly to glutamatergic terminals. Although SV2A was ubiquitously expressed in the entire hippocampus, it established a differential association with excitatory or inhibitory terminals, which could contribute to the maturation of excitatory/inhibitory balance.

1. Introduction The synaptic vesicle protein 2A (SV2A) was identified as a transmembrane glycoprotein present in neuronal secretory vesicles (Buckley and Kelly, 1985). It is a member of the synaptic vesicle glycoprotein 2 (SV2) family together with SV2B and SV2C (Bajjalieh et al., 1993; Janz and Südhof, 1999). SV2A mRNA is expressed in GABAergic or glutamatergic neurons throughout all the hippocampal layers while the protein is found mainly in the synaptic layers (Bajjalieh et al., 1994). The exact function of SV2A is unknown, since it is not necessary for exocytosis or vesicular endocytosis but is essential to maintain normal neurotransmission dependent on action potentials (Crowder et al.,

1999; Janz et al., 1999). Electrophysiological studies have shown that animals lacking SV2A protein show alterations in the evoked release of GABA and glutamate in the hippocampus. These animals also present spontaneous seizures after the first post-natal week. In addition, SV2A overexpression in hippocampal neuronal cultures has been related to a reduction of evoked postsynaptic excitatory current amplitude as well as a decrease of glutamate synaptic release probability (Nowack et al., 2011). The studies suggest that changes in SV2A expression are related to seizures and epilepsy development by changing the balance between excitation and inhibition (E/I) (Crowder et al., 1999; Janz et al., 1999; Custer, 2006; Chang and Sudhof, 2009). In patients with hippocampal sclerosis and intractable epilepsy,

⁎ Corresponding author at: Department of Pharmacobiology, Centro de Investigación y Estudios Avanzados del Instituto Politécnico Nacional, Calzada de los Tenorios No. 235, Mexico City 14330, Mexico. E-mail address: [email protected] (G. Gómez-Lira).

https://doi.org/10.1016/j.brainres.2019.03.021 Received 3 December 2018; Received in revised form 8 March 2019; Accepted 20 March 2019 Available online 21 March 2019 0006-8993/ © 2019 Elsevier B.V. All rights reserved.

Brain Research 1715 (2019) 73–83

A. Vanoye-Carlo and G. Gómez-Lira

layer and hilus of the dentate gyrus, stratum radiatum and stratum lacunosum moleculare of CA3 and CA1 (Fig. 2A). At P15 and P30, SV2A was scattered in all synaptic layers, moreover around neuronal bodies of granular and pyramidal cells but not in the soma. An intense protein signal was observed in the hilus, stratum lucidum and around the pyramidal zone of CA3 (Fig. 2A), similar to a previous report in adult healthy rats (van Vliet et al., 2009). At P5 VGAT expression was observed mainly in the molecular layer of dentate gyrus, stratum lacunosum-moleculare and stratum oriens of CA3 and CA1 regions (Fig. 2B), while VGLUT-1 expression was low in all hippocampal layers (Fig. 2C). Starting at P15, VGAT and VGLUT-1 expression patterns were similar to previous reports (Chaudhry et al., 1998; Bellocchio et al., 1998; Kaneko et al., 2002).

SV2A expression is abnormally decreased in all hippocampal and cortical layers (van Vliet et al., 2009; Toering et al., 2009; Feng et al., 2009). Moreover, SV2A expression gradually decreases in almost all hippocampal layers during epileptogenesis in the tetanic stimulation model (van Vliet et al., 2009). In agreement, SV2A gene expression is transiently down-regulated after status epilepticus in the entorhinal cortex in the same model (Gorter et al., 2006). Changes in SV2A expression related to alterations in glutamatergic and GABAergic systems have been reported in other animal models of epilepsy. In the hippocampus of electrically kindled rats, SV2A protein expression is up-regulated associated to an increase in the amplitude of spontaneous glutamate transients (Matveeva et al., 2007, 2012). In adult mice after PTZ-kindling, SV2A protein expression is increased in the hilar region of the dentate gyrus during epilepsy (Ohno et al., 2009). In this case, SV2A is co-expressed with GAD67 in the hilus and CA3 pyramidal layer, suggesting a selective elevation of SV2A expression in hilar GABAergic interneurons. This could be a compensatory response to the over excitation of the hippocampal circuit (Ohno et al., 2009, 2012). In agreement, transgenic rats carrying a missense SV2A mutation are more susceptible to kindling due to reduced GABA release in the hippocampus. These reports suggest that changes in SV2A protein expression mainly affect GABAergic transmission (Tokudome et al., 2016). The expression of SV2A protein throughout postnatal life seems to be critical for survival. Mice lacking SV2A are no different from their littermates without the mutation until postnatal day (P) 7. However, after P7 their growth rate decreases and around P9 their size is half that of their littermates. Moreover, they experience generalized seizures from P6 and die around P16 (Crowder et al., 1999). Despite the importance of SV2A for maturation, its expression during development (Crèvecœur et al., 2013) and its relationship with glutamatergic and GABAergic systems has not been extensively studied Thus, SV2A gene and protein expression was analyzed as well as its co-localization with the vesicular GABA (VGAT) and glutamate (VGLUT-1) transporters in the rat hippocampus during postnatal development.

2.3. Changes in SV2A protein expression and its co-localization with GABAergic and glutamatergic terminals during hippocampal development SV2A protein expression in GABAergic or glutamatergic terminals during development of the rat hippocampus was assessed. This was done by a systematic quantification of immunofluorescence puncta for SV2A, VGAT and VGLUT in the different hippocampal layers and their spatial overlap detection (co-localization, Fig. 2E and F). The percentage of GABAergic or glutamatergic terminals that co-localized with SV2A was also analyzed. Finally, the ratio of excitation to inhibition was calculated for each hippocampal layer. The data revealed a pattern of expression and association between SV2A and VGLUT or VGAT in the different hippocampal layers. 2.3.1. Puncta in dentate gyrus layers The analysis of puncta in the dentate gyrus showed that SV2A did not change drastically along development in any of its cell layers (Fig. 3A). For VGAT-positive terminals, no differences in puncta along development were detected in the molecular or granular layers. However, VGAT puncta significantly decreased compared to the other ages in the hilus at P30 (Fig. 3A). In contrast, VGLUT-1 puncta increased significantly in the molecular layer and hilus along development (Fig. 3A1 and A3), while in the granular layer the changes were not significant (Fig. 3A2). The number of GABAergic terminals co-expressing SV2A increased in the granular layer at P15 and P30, but decreased in the hilus at P30. On the other hand, glutamatergic terminals co-expressing SV2A increase at P15 and P30 in the molecular layer and the hilus, while in the granular layer the co-localization did not present changes along development (Fig. 3B1–B3).

2. Results 2.1. SV2A gene and protein expression We analyzed SV2A mRNA and protein expression in the rat hippocampus during development (P5, 15 and 30). The results showed no significant differences in SV2A mRNA levels between P5, P15 and P30 (Fig. 1A and B). In contrast, quantitative analysis of protein expression showed that the levels of SV2A change in an age-dependent manner, increasing during development and reaching their highest level at 30 days (Fig. 1E and F). VGAT and VGLUT-1 mRNA and protein expression were also explored. VGAT mRNA expression was highest at P5 and significantly decreased about 50% at P15 and P30 (Fig. 1A and C). In contrast, VGLUT-1 mRNA levels showed a constant and significant increase along development, reaching their maximum at P30 (Fig. 1A and D). VGAT and VGLUT-1 mRNA expression changed in an age dependent manner in opposite directions. VGAT expression decreased, while VGLUT-1 expression increased (Fig. 1A, C, D). The VGAT protein did not change along development, on the other hand VGLUT protein expression increased significantly along development (Fig. 1E, G, H). 2.2. Spatiotemporal expression pattern of SV2A protein in the hippocampus

2.3.2. Puncta in CA3 layers The analysis of SV2A puncta in CA3 layers showed a heterogeneous pattern. However, at P30 there was a general and significant decrease in the number of SV2A puncta (Fig. 4A1–3). The number of VGATpositive terminals remained unchanged at the 3 ages in the stratum pyramidale and lucidum (Fig. 4A2 and A3). However, there was a higher number of VGAT terminals in the stratum oriens and radiatum at P15 compared to the other ages (Fig. 4A1 and 4A4). VGLUT puncta significantly increased at P15 in all synaptic strata, but decreased in the stratum pyramidale at P30 (Fig. 4A). The number of terminals that showed co-localization of VGAT and SV2A increased significantly in the pyramidal layer along development (Fig. 4B2). A constant and significant increase of VGLUT and SV2A co-localized puncta was observed with age in the stratum lucidum (Fig. 4B2 and B3).

The spatiotemporal expression pattern of SV2A in the rat hippocampus and its relationship with either GABAergic or glutamatergic terminals was assessed along development by immunofluorescent detection of SV2A, VGAT and VGLUT-1 proteins in tissue sections from P5, P15 and P30 animals (Fig. 2). SV2A expression was detected in hippocampal synaptic layers at P5, scattered mostly in the molecular

2.3.3. Puncta in CA1 layers In the stratum oriens and pyramidale of CA1, SV2A puncta did not change along development. However, in the stratum radiatum SV2A puncta at P15 were decreased with respect to P5; while in the laconosum moleculare, SV2A puncta increased mainly at P30 (Fig. 5A1–4). VGAT puncta did not change in the stratum pyramidale, but in the 74

Brain Research 1715 (2019) 73–83

A. Vanoye-Carlo and G. Gómez-Lira

Fig. 1. SV2A, VGAT and VGLUT expression along hippocampal development. A) RT-qPCR of SV2A, VGAT and VGLUT at P5, P15 and P30. Neg: without RNA in the reaction; HPRT was used to normalize the data. B, C, D) Quantification of relative mRNA levels for SV2A, VGAT and VGLUT along postnatal development. Error bars indicate SEM; one-way analysis of variance was used to determine significant differences (*p < 0.001 vs P5, n = 7 rats for each age). E) Western blot of SV2A, VGAT and VGLUT at P5, P15 and P30. β-actin was the loading control; the molecular weight is indicated in kDa. F, G, H) Densitometric quantification of relative protein levels for SV2A, VGAT and VGLUT during hippocampal development. Error bars indicate SEM; one-way analysis of variance was used to determine the significant differences (*p < 0.001 vs P5, &p < 0.001 vs P15, n = 4 rats for each age).

increased along development reaching 80%. On the other hand, only between 20 and 30% of VGLUT positive puncta expressed SV2A; however, a tendency to increase with age was observed (Fig. 6A and B). In the next synapse, formed by CA3 pyramidal cell axons (Schaffer collaterals) and CA1 pyramidal cells, SV2A was mainly associated with GABAergic terminals especially at P30. In the stratum radiatum of CA3 and CA1, there was a similar proportion of VGAT and VGLUT positive puncta co-expressing SV2A (about 50%) at P5. At P15, the percentage of GABA and glutamate terminals that contain SV2A significantly decreased. SV2A significantly increased at P30; however, only GABAergic terminals reached a level similar to P5 (Fig. 6A and B). Finally, GABAergic terminals showed a constant and significant increase in SV2A expression in the stratum pyramidale similarly to the other principal layers (Fig. 6A and B).

stratum oriens and radiatum a significant increase at P15 versus P5 was observed. In the lacunosum moleculare layer, there was a constant and significant increase along development of VGAT puncta (Fig. 5A1–4). Interestingly, the number of VGLUT positive terminals in CA1 was increased along development, between P5 and P15 in all layers, and this was maintained until P30 (Fig. 5A1–4). The number of SV2A puncta that co-localized with GABAergic or glutamatergic terminals reached its maximum at P30 in all CA1 layers (Fig. 5B1–4). 2.4. Percentage of GABAergic or glutamatergic terminals that co-localized with SV2A The percentage of GABAergic or glutamatergic terminals that expressed SV2A was determined from individual and co-localized puncta data, as described above. We focused on the trisynaptic excitatory circuit from the dentate gyrus to CA3 to CA1 pyramidal cells and inhibitory networks present in this circuit. In the molecular layer, where the first excitatory synapse is formed between the perforant pathway and granule cell dendrites, SV2A puncta were co-localized similarly in GABAergic or glutamatergic positive puncta along development. However, at P5 more than 50% of both terminals expressed SV2A, this proportion significantly decreased at P15 and at P30 significantly increased again to 50–60% (Fig. 6A and B). In the granular layer, where granule cell somas are located, the percentage of VGLUT positive terminals decreased from 60% to 50% along development. In contrast, the association between VGAT and SV2A puncta showed a constant and significant increase from 50% to 80% (P5 to P30; Fig. 6A and B). In the hilus and stratum lucidum of CA3, where mossy fibers and their terminals pass and establish the second synapse of the circuit, SV2A was associated mainly with VGLUT positive puncta. In both regions, a constant increase in the percentage of VGLUT terminals that expressed SV2A was observed from 60% at P5 to 80% (hilus) or 100% (stratum lucidum) at P30. While the proportion of GABAergic terminals that contained SV2A remained around 50% along development in both layers (Fig. 6A and B). In the stratum pyramidale, the proportion of GABAergic terminals that co-localized with SV2A significantly

2.5. Excitation/inhibition ratio in the developing hippocampus The ratio of excitatory to inhibitory puncta was analyzed taking into consideration the total puncta (VGLUT/VGAT) and co-localized puncta (VGLUT-SV2A/VGAT-SV2A). In the granular layer and CA3 stratum pyramidale, VGLUT/VGAT ratios were negative (red dotted lines) because VGAT-positive terminals were more numerous than VGLUT-positive terminals (Fig. 6C). While in the CA1 stratum pyramidale, VGLUT/VGAT ratios were positive after P5 (red dotted lines), reflecting the fact that at P15 and P30 there were more glutamatergic than GABAergic terminals (Fig. 5A2). However, when only SV2A-associated terminals were considered (red solid lines, Fig. 6C), the ratio was significantly more negative at P15 and P30 in the three principal cell layers (Fig. 6C). This suggests that SV2A improves inhibition around cell bodies of the principal hippocampal neurons. In the hilus and CA3 stratum lucidum, where excitatory mossy fibers are located, the association of glutamatergic terminals with SV2A favored positive values (green solid lines, Fig. 6C). There was a significant difference between VGLUT/VGAT puncta (green dotted lines) and VGLUT-SV2A/ VGAT-SV2A puncta (green solid lines) at P15 and P30 (Fig. 6C). 75

Brain Research 1715 (2019) 73–83

A. Vanoye-Carlo and G. Gómez-Lira

(caption on next page)

76

Brain Research 1715 (2019) 73–83

A. Vanoye-Carlo and G. Gómez-Lira

Fig. 2. Spatiotemporal expression of SV2A, VGAT and VGLUT varied during hippocampal maturation. A, B, C, D) Stitched confocal images of the hippocampus at P5, P15 and P30 showing SV2A (blue), VGAT (red) and VGLUT (green) expression, as well as the merged image. Scale bar: 200 µm. E) Higher magnification of the CA3 pyramidal zone showing SV2A (blue), VGAT (red) and VGLUT (green), as well as SV2A-VGAT (magenta) or SV2A-VGLUT (turquoise) co-localized puncta. SV2A puncta and VGAT puncta are around pyramidal cell bodies (dotted lines), while VGLUT and SV2A puncta are in the giant boutons of mossy fibers (asterisks). The arrows indicate puncta without co-localization of each protein. F) Examples of the puncta detected for each protein (black) and its co-localization (magenta and turquoise) with ImageJ plugin. Scale bar 5 µm.

terminals expressed SV2A preferentially in the hilus and CA3 stratum lacunosum. These relations were reinforced throughout hippocampal maturation. Finally, in hippocampal synaptic layers both terminals, GABAergic and glutamatergic, contained SV2A in a similar proportion. The data suggest that although the SV2A protein is expressed ubiquitously in the hippocampus, there is a differential and preferential expression in excitatory and inhibitory terminals, which can contribute to the balance between excitation and inhibition.

The analysis of excitation/inhibition in the molecular layer and CA3-CA1 stratum radiatum showed values closer to zero after P5 (black solid lines, Fig. 6C), suggesting a balance between excitation and inhibition in these synaptic layers. The difference between VGLUT/VGAT (dotted lines) and VGLUT-SV2A/VGAT-SV2A (solid lines) was significant in the stratum radiatum of CA3 and CA1 (Fig. 6C). 3. Discussion

3.1. SV2A mRNA and protein expression in the hippocampus during development

In order to understand the participation of SV2A in GABAergic and glutamatergic transmission along development, SV2A expression in GABAergic and glutamatergic terminals along postnatal development of the rat hippocampus was studied. SV2A expression was dynamically regulated by age in each hippocampal layer. The data indicate that SV2A is preferentially co-localized in GABA terminals in principal cell layers (granular and pyramidal). In contrast, mossy fiber glutamatergic

SV2A mRNA levels were previously reported in the rat brain from embryonic day 14 to adulthood (Bajjalieh et al., 1994). We demonstrated that SV2A mRNA expression remains stable in the entire hippocampus during development, with a slight increase at P15.

Fig. 3. Quantification of SV2A, VGAT and VGLUT (A1, A2, A3) as well as SV2A-VGAT and SV2A-VGLUT co-localized puncta (B1, B2, B3) in dentate gyrus layers. Each bar represents the average puncta across 50 confocal images, collected from five rats of each age. Error bars indicate SEM; one-way analysis of variance was used to determine significant differences (*p < 0.001 vs. P5, &p < 0.001 vs. P15). 77

Brain Research 1715 (2019) 73–83

A. Vanoye-Carlo and G. Gómez-Lira

Fig. 4. Quantification of SV2A, VGAT and VGLUT (A1, A2, A3) as well as SV2A-VGAT and SV2A-VGLUT co-localized puncta (B1, B2, B3) in CA3 layers. Each bar represents the average puncta across 50 confocal images, collected from five rats of each age. Error bars indicate SEM; one-way analysis of variance was used to determine the significant differences (*p < 0.001 vs. P5, &p < 0.001 vs. P15).

1973; De Felipe et al., 1997). We also analyzed VGAT and VGLUT mRNA and protein expression in the rat hippocampus during postnatal development. VGLUT mRNA and protein expression were similar to prior reports in the rodent and human brain (Minelli et al., 2003; Boulland et al., 2004; Fung et al., 2011). For example, VGLUT1 mRNA and protein expression were almost absent at P5 but increased progressively during postnatal development until P30. VGAT mRNA levels decreased along development, but the expression of the protein increased slightly with age. This could imply that the regulation of VGAT protein expression may be related to preferential translation or to a long-lasting protein, but not to mRNA

Something similar was reported in the hippocampus of postnatal mice (Crèvecœur et al., 2013), SV2A expression increased at P7-P10. The authors suggested that this increase could be associated to synaptic plasticity and a protective effect of SV2A against epileptic seizures at this age. SV2A protein expression in the developing rat hippocampus increased in an age-dependent manner, similar to other vesicular proteins such as synapsin, synaptophysin, synaptobrevin and synaptotagmin (Fletcher et al., 1991; Shimohama et al., n.d.). This pattern of expression reflects the process of synaptogenesis, since it is most active in the rat brain during the second and third weeks after birth (Crain et al., 78

Brain Research 1715 (2019) 73–83

A. Vanoye-Carlo and G. Gómez-Lira

Fig. 5. Quantification of SV2A, VGAT and VGLUT (A1, A2, A3) as well as SV2A-VGAT and SV2A-VGLUT co-localized puncta (B1, B2, B3) in CA1 layers. Each bar represents the average puncta across 50 confocal images, collected from five rats of each age. Error bars indicate SEM; one-way analysis of variance was used to determine the significant differences (*p < 0.001 vs. P5, &p < 0.001 vs. P15).

addressed SV2A expression and its association to GABA or glutamate vesicles in the developing rat hippocampus. Our data showed that SV2A was expressed in both types of neurons; however, not all VGAT or VGLUT terminals co-localize with SV2A. The proportion of inhibitory or excitatory terminals that contained SV2A was different in each hippocampal layer and the pattern varied as the hippocampus matured. SV2A is the only SV2 isoform that is expressed in most GABAergic cells (Bajjalieh et al., 1994), so mainly GABAergic terminals were expected to express SV2A. During the development, there was a wide range of SV2A expression in GABAergic interneurons. The terminals of basket cells and axo-axonic cells (interneurons located adjacent to

expression. Nonetheless, the increase in VGAT expression during development agrees with previous reports (Marty et al., 2002; Boulland and Chaudhry, 2012). 3.2. SV2A spatiotemporal expression in hippocampal glutamatergic and GABAergic terminals Previous studies reported the expression pattern of the SV2A protein in the hippocampus of adult rats. SV2A protein expression was observed in both GABAergic and glutamatergic neurons of the hippocampus (Bajjalieh et al., 1994; Van Vliet et al., 2009). However, no study had 79

Brain Research 1715 (2019) 73–83

A. Vanoye-Carlo and G. Gómez-Lira

Fig. 6. Co-localization of SV2A with VGAT or VGLUT changed along development in the different hippocampal layers. A) Confocal images of SV2A-VGAT (magenta) and SV2A-VGLUT (turquoise) puncta in each hippocampal layer. B) Percentage of total VGAT or VGLUT puncta that co-localized with SV2A in each layer and age. C) Ratio of excitatory/inhibitory puncta (VGLUT/ VGAT, dotted line) and co-localized puncta (VGLUT-SV2A/VGAT-SV2A, solid lines) in each layer and age. The data are expressed as log10(VGLUT puncta/ VGAT puncta; dotted line) and log10(VGLUT-SV2A puncta/VGAT-SV2A puncta; solid line). Values above zero indicate more excitatory than inhibitory terminals, whereas values below zero indicate the opposite. Error bars indicate SEM; one-way analysis of variance was used to determine the significant differences between ages (***p < 0.001, n = 5 rats for each age). The t-test was used to determine significant differences between the excitatory/inhibitory ratio with or without SV2A (&p < 0.001).

80

Brain Research 1715 (2019) 73–83

A. Vanoye-Carlo and G. Gómez-Lira

et al., 2002). At the same time, there is a switch in the electrophysiological properties of GABAergic neurotransmission from depolarization to hyperpolarization that is from excitation to inhibition (Ben-Ari et al., 1989). The ratio of total VGLUT/VGAT puncta was used as a parameter of the excitation/inhibition balance. However, it was reported that VGAT can be expressed in the cytoplasm of interneurons (Chaudhry et al., 1998) and that VGLUT was located in some dendritic spines and isolated glial processes (Bellocchio et al., 1998). Thus, the VGLUT/VGAT ratio can overestimate the phenomena in synaptic terminals. To determine if co-localization with SV2A has any effect on the excitation/ inhibition balance in the developing hippocampus, we calculated the ratio of co-localized VGLUT-SV2A/VGAT-SV2A. This should result in a better estimate of synaptic terminal phenomena since SV2A is associated to functional synaptic currents. The results demonstrated that the relationship with SV2A changed the excitation/inhibition balance, reinforcing inhibition in principal cell layers (ratio values were more negative) and excitation of mossy fiber terminals (ratio values were more positive). Furthermore, co-localization with SV2A balanced the excitation/inhibition relationship in synaptic layers (ratio values were near zero). It has been documented that SV2A is necessary to maintain the normal amplitude and frequency of evoked and spontaneous inhibitory and excitatory synaptic currents at the cellular level. However, the main effect of SV2A function seems to be at the tissue level, where its absence significantly decreases inhibitory synaptic currents while increasing excitatory current frequency (Mendoza-Torreblanca et al., 2013; Bartholome et al., 2017). SV2A expression and its association with either GABA or glutamate terminals along development could be related to the fine tuning of synaptic activity. Along development there are important changes in synaptic activity; short-term facilitation is one of them (Pan and Zucker, 2009; Jackman and Regehr, 2017; Kaeser and Regehr, 2017). Short-term facilitation occurs in CA1 (Speed and Dobrunz, 2009) and in mossy fibers (Torborg et al., 2010). The mechanism that has been proposed includes an increase of the ready releasable vesicular pool and a high sensitivity to changes in calcium concentration. In this sense, SV2A could regulate the releasable vesicular pool due to its interaction with synaptotagmine and its putative calcium domain (Imig et al., 2014; Li and Kavalali, 2017; Kaeser and Regehr, 2017), facilitating neurotransmitter release at lower calcium concentrations mainly in GABA terminals. The increase in SV2A expression associated with GABAergic or glutamatergic vesicle transporters could reflect fine tuning of inhibitory and excitatory neurotransmission during synaptic maturation in the hippocampus. If SV2A improves neurotransmitter release depending on action potentials (Crowder et al., 1999; Janz et al., 1999; Custer, 2006), we suggest that SV2A makes GABA and glutamate terminals more efficient during hippocampal development in accord with synaptic response maturation (Tyzio et al., n.d.; Hennou et al., 2002). In summary, we determined that SV2A is ubiquitously expressed in the hippocampus since the first days of life. In addition, its expression in GABAergic or glutamatergic terminals was modified during development. Moreover, we showed that SV2A likely affects the excitatory/ inhibitory balance in the different hippocampal layers.

principal cells), expressed 40–80% SV2A from P5 to P30. In contrast, GABAergic terminals of other hippocampal interneurons co-expressed only 50% SV2A. This suggest that the modification of SV2A levels differentially affects the diverse types of hippocampal interneurons and partly explains why GABAergic transmission is not fully eliminated if SV2A is absent (Crowder et al., 1999; Chang and Sudhof, 2009) or its function is lost (Tokudome et al., 2016). On the other hand, SV2A protein was preferentially co-localized in VGLUT-positive terminals in the hilus and CA3 stratum lacunosum, this association increased during development from 60% to 100% from P5 to P30. This phenomenon could be related to an improvement of glutamatergic release along development. It is important to mention that during the first fifty days of postnatal life granule cells also express the SV2B isoform in addition to SV2A (Bajjalieh et al., 1994). During this period, in granule cell glutamatergic mossy fibers of the hilus and stratum lucidum the two SV2 isoforms may work in a redundant manner; similar to what occurs in pyramidal cells (Janz et al., 1999). However, 100% of mossy fiber terminals express SV2A at P30, implying that any change in its expression level would impact glutamatergic transmission in this area, reducing EPSC amplitude and decreasing synaptic release probability (Custer, 2006; Nowack et al., 2011). Since the main target of granule cells are CA3 interneurons, changes in SV2A expression in mossy fibers may trigger disinhibition in this hippocampal area. It would be interesting to explore changes in SV2A expression during development in an epilepsy model, to establish if these changes affect the ratio between excitation and inhibition. In the other excitatory synapse, formed by CA3 pyramidal cell axons (Schaffer collaterals) and CA1 pyramidal cells, only 40–50% of glutamatergic terminals co-localized with SV2A. In this case, it is possible to suggest that the co-localization percentage reflects the fact that CA3 pyramidal cells also express SV2B mRNA in addition to SV2A (Bajjalieh et al., 1994) and that in their terminals both proteins work synergistically, as demonstrated previously (Janz et al., 1999). 3.3. SV2A and the excitation/inhibition balance in the developing hippocampus The balance between excitatory and inhibitory activity changes along development, and the relevance of SV2A as a regulator of this balance has been shown by SV2A knockout mice (Crowder et al., 1999). They present one of the most severe epileptic phenotypes, which results in death, indicating that a circuit failure may be responsible for this phenotype (Janz et al., 1999). Two ages seem crucial in these mice, the age of seizure onset (starting at P6) and the age of death by seizures (from P12 to P23). In this study, we analyzed the excitation/inhibition balance at similar ages in rats (P5 and P15). We also analyzed P30, when VGAT and VGLUT expression is similar to the adult (Minelli et al, 2003; Boulland et al., 2004). The ratio of excitatory to inhibitory terminals that was observed showed generally more GABA than glutamate terminals in the hippocampus at P5, after that a switch was observed in all layers. This was reflected in VGLUT/VGAT ratio values. At P5, ratio values were negative in almost all hippocampal layers (except CA3 stratum radiatum). This indicates that GABA is the principal neurotransmitter during the first week of age in the hippocampus, with a depolarizing effect on its target cells (Ben-Ari et al., 1989). In agreement, GABAergic interneurons divide and differentiate prior to principal cells; likewise, they establish connections before non-GABAergic cells (Seress and Ribak, 1990; Cherubini et al., 1991). At these early stages, GABAergic neurotransmission could modulate cell growth, differentiation and synaptogenesis of hippocampal principal neurons; since excitatory glutamatergic connections are poorly developed (Cherubini et al., 1991). After the first week of life, VGLUT puncta increased significantly and VGLUT/VGAT ratio values became positive. This reflects the sequential maturation of GABA and glutamate systems in the hippocampus, as has been previously reported (Tyzio et al., n.d.; Hennou

4. Experimental procedure 4.1. Animals and treatments For all experiments, male Sprague-Dawley rats of 5, 15 and 30 postnatal days were used in strict adherence to the NIH Guide for the Care and Use of Experimental Animals. All experimental procedures were approved by the local Animal Right's Committee.

81

Brain Research 1715 (2019) 73–83

A. Vanoye-Carlo and G. Gómez-Lira

410208) for 2 h and finally treated with streptavidin pacific blue (1:100, Molecular probes; S11222). Negative controls were performed by omission of some or all primary antibodies and result in the absence of immunofluorescence (data not shown). Sections were mounted and preserved using Vectashield mounting medium (Vector Labs., H-1000) and cover-slipped. Sections were analyzed using a confocal microscope (LSM 800 with airyscan, Zeiss, Germany, see below).

4.2. RT-qPCR To evaluate the expression of SV2A, VGAT and VGLUT genes in the rat hippocampus, seven rats of each age were used, the brains were rapidly removed and put in ice-cold HBSS medium. The entire hippocampus was dissected and total RNA was isolated using TRIzol™ (Invitrogen). Real time quantitative PCR was performed using KiCqStart One-Step Probe RT-qPCR ReadyMix (Sigma, KCQS07) on the PikoReal real-time PCR System (Thermo Scientific). The reactions were performed using 50 ng/µl of total RNA in a final volume of 10 µl, as follows: 5 µl of KiCqStart one-step 2X buffer, 450 nM of each primer and 150 nM of the dual-labeled probes (Sigma). SV2A primers: Forward 5′-GACCAATAATTTCTTTTATCCCT, Reverse 5′-CCCAAACATGGGACA AAG, Probe 5′-[6FAM]CTGCTGTCCTGGTCCTA[TAM]; VGAT primers: Forward 5′- AGGTGAAGTTCTACATCGA, Reverse 5′-GTGTCCAGTTCA TCATGC, Probe 5′-[Cyanine5]TCTCCATCGGCATCATCGTGT[BHQ3]; VGLUT primers Forward 5′-ACACCTCTAGCCTAAACG, Reverse 5′-GCAGTTGAGAAGGAGAGA, Probe 5′-[HEX]CCACTCCTCTCCTGCCT CAG[BHQ1]. The protocol was as follows: 10 min at 50 °C, 1 min at 95 °C, 10 s at 95 °C and 30 s at 60 °C (40 cycles). The reactions were performed by triplicate. The ΔΔCT method was used to determine SV2A, VGAT and VGLUT mRNA levels in all groups. The data are presented as fold change in SV2A, VGAT and VGLUT normalized to hypoxanthine phosphoribosyltransferase (HPRT) mRNA expression and relative to the P5 group.

4.5. Confocal image acquisition and quantitative analysis A general overview of SV2A, VGAT and VGLUT-1 distribution in the entire rat hippocampus was obtained using an EC Plan-Neofluar 20X/ 0.50 M27 objective lens on a confocal laser-scanning microscope (LSM 800 with airyscan, Zeiss). Data acquisition was performed using tiles function; all images were aligned using the stitching method (Zen Software, Zeiss). Higher-resolution images from hippocampal cell layers were acquired sequentially using a Plan-Apochromat 63x/1.40 Oil DIC M27 objective, the image size was: 101.4X101.4 µm (0.10 µm per pixel, pixel dwell time 33 µs, pinhole 1 Airy units). The used excitation wavelengths were: 402 nm for streptavidin pacific blue, 493 nm for anti-mouse Dylight 488 and 577 nm for anti-rabbit Alexa Fluor-568, respectively. The number of presynaptic co-localized puncta was quantified using the synapse counter plugin (Dzyubenko et al., 2016) of the ImageJ software package (NIH, Bethesda, Maryland). This plugin provides rapid and unbiased quantification by identifying and refining immunofluorescent puncta, followed by spatial overlap in high magnification images (Dzyubenko et al., 2016). The total number of SV2A, VGTA and VGLUT puncta and their co-localization are shown by hippocampal layer. The percentage of total VGAT or VGLUT puncta colocalized with SV2A and finally the ratio of excitatory to inhibitory (VGLUT/VGAT and VGLUT-SV2A/VGAT-SV2A) puncta were calculated.

4.3. Western blot To quantify SV2A, VGAT and VGLUT protein levels hippocampal tissue from four rats of each age was obtained as described. The tissues were washed using PBS and lysed with RIPA buffer (0.05 M Tris; 0.15 M NaCl; 1% NP-40; 3% Glycerol and 0.1% SDS) supplemented with a protease inhibitor (Complete, Roche). Hippocampal tissue was homogenized using a Potter-Elvehjem type tissue grinder with a PTFE pestle, followed by sonication (3 times, 20 s each). Total protein (30 μg of each sample) was quantified using the bicinconinic acid method. Protein samples were separated by SDS-PAGE in 12% poly-acrylamide gels and transferred to polyvinylidene fluoride membranes (MilliPore) at 90 V for 1 h. The membranes were incubated (1:100 in PBS) with primary antibodies overnight at 4 °C. The primary antibodies were: VGLUT-1 (Santa Cruz; sc-377425), VGAT (Sigma, V5764) and SV2A (Santa Cruz; sc-11936). Membranes were washed and exposed to horseradish peroxidase-conjugated secondary antibodies (1:10,000) against rabbit IgG (Santa Cruz, sc-2005), mouse IgG (Santa Cruz, sc-2004) and goat IgG (Santa Cruz, sc-2922) during 1 h at room temperature. HRP activity was visualized by enhanced chemifluorescence on the Chemidoc imaging system and quantified using the Quantity-one program (Biorad). Anti βactin (1:3000, Santa Cruz; sc-47778) was used to detect actin as a loading control.

4.6. Statistical analysis Statistical analyses were performed using Sigma Plot Software (v. 12.0; Systat Software, Germany). Data are expressed as mean ± SEM. ANOVAs followed by Holm-Sidaḱs post hoc tests were used to analyzed: 1) the change in the puncta number along development in the different layers (Figs. 3–5), and 2) the percentage of GABAergic and/or glutamatergic terminals that co-localized whith SV2A (Fig. 6B). Studentś ttests were used to compare the ratios of excitation/inhibition with or without SV2A at each age (Fig. 6C). Significance was considered as p ≤ 0.05. Conflicts of interest The authors declare no conflicts of interest.

4.4. Immunofluoresence

Acknowledgements

For immunodetection of SV2A, VGAT and VGLUT proteins in the hippocampus, five rats of each group were sacrificed and perfused transcardially with PFA (4%). Brains were post-fixed overnight in 4% PFA and then transferred to serial sucrose solutions (20 and 30%). Serial coronal sections were obtained at 20 µm using a cryostat (Leica CM1510-3) and one out of every eight sections was selected for immunostaining. Sections from P5, P15 and P30 rats were processed in parallel and incubated in a mixture of primary antibodies: SV2A (1:500, Santa Cruz; sc-11936), VGAT (1:1000, Sigma; V5764) and VGLUT-1 (1:1000, Santa Cruz; sc-377425) in PBS with 5% BSA overnight at room temperature. After rinsing, the sections were incubated with the appropriate secondary antibody: anti-goat biotinylated IgG (1:250, Vector Labs.; BA-9500), Alexa Fluor-568 anti-rabbit (1:500, Molecular probes; A10042) and Dylight 488 horse anti-mouse (1:500, Vector Labs.;

This work was supported by Grants from CONACYT (CB-2012-01178567 to GGL) and INP (09/2017 to AVC). We thank Dr. Bryan Phillips Farfán for language revision and edition, as well as Miguel Morales for technical support. References Bajjalieh, S.M., Peterson, K., Linial, M., Scheller, R.H., 1993. Brain contains two forms of synaptic vesicle protein 2. Proc. Natl. Acad. Sci. U.S.A. 90, 2150–2154. https://doi. org/10.1073/pnas.90.6.2150. Bajjalieh, S.M., Frantz, G.D., Weimann, J.M., McConnell, S.K., Scheller, R.H., 1994. Differential expression of synaptic vesicle protein 2 (SV2) isoforms. J. Neurosci. 14, 5223–5235. Bartholome, O., Van den Ackerveken, P., Sánchez Gil, J., de la Brassinne Bonardeaux, O., Leprince, P., Franzen, R., Rogister, B., 2017. Puzzling out synaptic vesicle 2 family

82

Brain Research 1715 (2019) 73–83

A. Vanoye-Carlo and G. Gómez-Lira

facilitation. Neuron 94, 447–464. https://doi.org/10.1016/j.neuron.2017.02.047. Janz, R., Goda, Y., Geppert, M., Missler, M., Südhof, T.C., 1999. SV2A and SV2B function as redundant Ca2+regulators in neurotransmitter release. Neuron 24, 1003–1016. https://doi.org/10.1016/S0896-6273(00)81046-6. Janz, R., Südhof, T.C., 1999. SV2C is a synaptic vesicle protein with an unusually restricted localization: anatomy of a synaptic vesicle protein family. Neuroscience 94, 1279–1290. https://doi.org/10.1016/S0306-4522(99)00370-X. Kaeser, P.S., Regehr, W.G., 2017. The readily releasable pool of synaptic vesicles. Curr. Opin. Neurobiol. 43, 63–70. https://doi.org/10.1016/j.conb.2016.12.012. Kaneko, T., Fujiyama, F., Hioki, H., 2002. Immunohistochemical localization of candidates for vesicular glutamate transporters in the rat brain. J. Comp. Neurol. 444, 39–62. https://doi.org/10.1002/cne.10129. Li, Y.C., Kavalali, E.T., 2017. Synaptic vesicle-recycling machinery components as potential therapeutic targets. Pharmacol. Rev. 69, 141–160. https://doi.org/10.1124/ pr.116.013342. Marty, S., Wehrlé, R., Alvarez-Leefmans, F.J., Gasnier, B., Sotelo, C., 2002. Postnatal maturation of Na+, K+, 2Cl- cotransporter expression and inhibitory synaptogenesis in the rat hippocampus: an immunocytochemical analysis. Eur. J. Neurosci. 15. https://doi.org/10.1046/j.0953-816x.2001.01854.x. Matveeva, E.A., Davis, V.A., Whiteheart, S.W., Vanaman, T.C., Gerhardt, G.A., Slevin, J.T., 2012. Kindling-induced asymmetric accumulation of hippocampal 7S SNARE complexes correlates with enhanced glutamate release. Epilepsia 53, 157–167. https://doi.org/10.1111/j.1528-1167.2011.03345.x. Matveeva, E.A., Vanaman, T.C., Whiteheart, S.W., Slevin, J.T., 2007. Asymmetric accumulation of hippocampal 7S SNARE complexes occurs regardless of kindling paradigm. Epilepsy Res. 73, 266–274. https://doi.org/10.1016/j.eplepsyres.2006.11.003. Mendoza-Torreblanca, J.G., Vanoye-Carlo, A., Phillips-Farfán, B.V., Carmona-Aparicio, L., Gómez-Lira, G., 2013. Synaptic vesicle protein 2A: basic facts and role in synaptic function. Eur. J. Neurosci. 38. https://doi.org/10.1111/ejn.12360. Minelli, A., Alonso-Nanclares, L., Edwards, R.H., Defelipe, J., Conti, F., 2003. Postnatal development of the vesicular GABA transporter in rat cerebral cortex. Neuroscience 117, 337–346. https://doi.org/10.1016/S0306-4522(02)00864-3. Nowack, A., Malarkey, E.B., Yao, J., Bleckert, A., Hill, J., Bajjalieh, S.M., 2011. Levetiracetam reverses synaptic deficits produced by overexpression of sV2A. PLoS One 6, 1–8. https://doi.org/10.1371/journal.pone.0029560. Ohno, Y., Ishihara, S., Terada, R., Kikuta, M., Sofue, N., Kawai, Y., Serikawa, T., Sasa, M., 2009. Preferential increase in the hippocampal synaptic vesicle protein 2A (SV2A) by pentylenetetrazole kindling. Biochem. Biophys. Res. Commun. 390, 415–420. https://doi.org/10.1016/j.bbrc.2009.09.035. Ohno, Y., Okumura, T., Terada, R., Ishihara, S., Serikawa, T., Sasa, M., 2012. Kindlingassociated SV2A expression in hilar GABAergic interneurons of the mouse dentate gyrus. Neurosci. Lett. 510, 93–98. https://doi.org/10.1016/j.neulet.2012.01.009. Pan, B., Zucker, R.S., 2009. A general model of synaptic transmission and short-term plasticity. Neuron 62, 539–554. https://doi.org/10.1016/j.neuron.2009.03.025. Seress, L., Ribak, C., 1990. Postnatal development of the light and electron microscopic features of basket cells in the hippocampal dentate gyrus of the rat. Anat. Embryol. (Berl) 181, 547–565. https://doi.org/10.1007/BF00174627. Shimohama, S., Fujimoto, S., Sumida, Y., Akagawa, K., Shirao, T., Matsuoka, Y., Taniguchi, T., n.d. Differential expression of rat brain synaptic proteins in development and aging. Speed, H.E., Dobrunz, L.E., 2009. Developmental changes in short-term facilitation are opposite at temporoammonic synapses compared to schaffer collateral synapses onto CA1 pyramidal cells. Hippocampus 19, 187–204. https://doi.org/10.1002/hipo. 20496. Toering, S.T., Boer, K., De Groot, M., Troost, D., Heimans, J.J., Spliet, W.G.M., Van Rijen, P.C., Jansen, F.E., Gorter, J.A., Reijneveld, J.C., Aronica, E., 2009. Expression patterns of synaptic vesicle protein 2A in focal cortical dysplasia and TSC-cortical tubers. Epilepsia 50, 1409–1418. https://doi.org/10.1111/j.1528-1167.2008.01955.x. Tokudome, K., Okumura, T., Shimizu, S., Mashimo, T., Takizawa, A., Serikawa, T., Terada, R., Ishihara, S., Kunisawa, N., Sasa, M., Ohno, Y., 2016. Synaptic vesicle glycoprotein 2A (SV2A) regulates kindling epileptogenesis via GABAergic neurotransmission. Sci. Rep. 6, 27420. https://doi.org/10.1038/srep27420. Torborg, C.L., Nakashiba, T., Tonegawa, S., McBain, C.J., 2010. Control of CA3 output by feedforward inhibition despite developmental changes in the excitation-inhibition balance. J. Neurosci. 30, 15628–15637. https://doi.org/10.1523/JNEUROSCI.309910.2010. Tyzio, R., Represa, A., Jorquera, I., Ben-Ari, Y., Gozlan, H., Aniksztejn, L., n.d. The Establishment of GABAergic and Glutamatergic Synapses on CA1 Pyramidal Neurons is Sequential and Correlates with the Development of the Apical Dendrite. Van Vliet, E.A., Aronica, E., Redeker, S., Boer, K., Gorter, J.A., 2009. Decreased expression of synaptic vesicle protein 2A, the binding site for levetiracetam, during epileptogenesis and chronic epilepsy. Epilepsia 50, 422–433. https://doi.org/10.1111/j. 1528-1167.2008.01727.x.

members functions. Front. Mol. Neurosci. 10, 148. https://doi.org/10.3389/fnmol. 2017.00148. Bellocchio, E.E., Hu, H., Pohorille, A., Chan, J., Pickel, V.M., Edwards, R.H., 1998. The localization of the brain-specific inorganic phosphate transporter suggests a specific presynaptic role in glutamatergic transmission. J. Neurosci. 18, 8648–8659. https:// doi.org/10.1523/jneurosci.2073-11.2011. Ben-Ari, Y., Cherubini, E., Corradetti, R., Gaiarsa, J.L., 1989. Giant synaptic potentials in immature rat CA3 hippocampal neurones. J. Physiol. 416. https://doi.org/10.1113/ jphysiol.1989.sp017762. Boulland, J.L., Chaudhry, F.A., 2012. Ontogenetic changes in the distribution of the vesicular GABA transporter VGAT correlate with the excitation/inhibition shift of GABA action. Neurochem. Int. 61, 506–516. https://doi.org/10.1016/j.neuint.2012.03.018. Boulland, J.L., Qureshi, T., Seal, R.P., Rafiki, A., Gundersen, V., Bergersen, L.H., Fremeau, R.T., Edwards, R.H., Storm-Mathisen, J., Chaudhry, F.A., 2004. Expression of the vesicular glutamate transporters during development indicates the widespread corelease of multiple neurotransmitters. J. Comp. Neurol. 480, 264–280. https://doi. org/10.1002/cne.20354. Buckley, K., Kelly, R.B., 1985. Identification of a transmembrane glycoprotein specific for secretory vesicles of neural and endocrine cells. J. Cell Biol. 100, 1284–1294. https:// doi.org/10.1083/jcb.100.4.1284. Chang, W.-P., Sudhof, T.C., 2009. SV2 renders primed synaptic vesicles competent for Ca2+-induced exocytosis. J. Neurosci. 29, 883–897. https://doi.org/10.1523/ JNEUROSCI.4521-08.2009. Chaudhry, F.A., Reimer, R.J., Bellocchio, E.E., Danbolt, N.C., Osen, K.K., Edwards, R.H., Storm-Mathisen, J., 1998. The vesicular GABA transporter, VGAT, localizes to synaptic vesicles in sets of glycinergic as well as GABAergic neurons. J. Neurosci. 18, 9733–9750. https://doi.org/10.1002/iub.128. Cherubini, E., Gaiarsa, J.L., Ben-Ari, Y., 1991. GABA: an excitatory transmitter in early postnatal life. Trends Neurosci. 14, 515–519. https://doi.org/10.1016/01662236(91)90003-D. Crain, B., Cotman, C., Taylor, D., Lynch, G., 1973. A quantitative electron microscopic study of synaptogenesis in the dentate gyrus of the rat. Brain Res. 63, 195–204. https://doi.org/10.1016/0006-8993(73)90088-7. Crèvecœur, J., Foerch, P., Doupagne, M., Thielen, C., Vandenplas, C., Moonen, G., Deprez, M., Rogister, B., 2013. Expression of SV2 isoforms during rodent brain development. BMC Neurosci. 14, 87. https://doi.org/10.1186/1471-2202-14-87. Crowder, K.M., Gunther, J.M., Jones, T.A., Hale, B.D., Zhang, H.Z., Peterson, M.R., Scheller, R.H., Chavkin, C., Bajjalieh, S.M., 1999. Abnormal neurotransmission in mice lacking synaptic vesicle protein 2A (SV2A). Proc. Natl. Acad. Sci. U.S.A. 96, 15268–15273. https://doi.org/10.1073/pnas.96.26.15268. Custer, K.L., 2006. Synaptic vesicle protein 2 enhances release probability at quiescent synapses. J. Neurosci. 26, 1303–1313. https://doi.org/10.1523/JNEUROSCI.269905.2006. De Felipe, J., Marco, P., Fairén, A., Jones, E.G., 1997. Inhibitory synaptogenesis in mouse somatosensory cortex. Cereb. Cortex 7, 619–634. https://doi.org/10.1093/cercor/7. 7.619. Dzyubenko, E., Rozenberg, A., Hermann, D.M., Faissner, A., 2016. Colocalization of synapse marker proteins evaluated by STED-microscopy reveals patterns of neuronal synapse distribution in vitro. J. Neurosci. Methods 273, 149–159. https://doi.org/10. 1016/j.jneumeth.2016.09.001. Feng, G., Xiao, F., Lu, Y., Huang, Z., Yuan, J., Xiao, Z., Xi, Z., Wang, X., 2009. Downregulation synaptic vesicle protein 2A in the anterior temporal neocortex of patients with intractable epilepsy. J. Mol. Neurosci. 39, 354–359. https://doi.org/10.1007/ s12031-009-9288-2. Fletcher, T.L., Cameron, P., De Camilli, P., Banker, G., 1991. The distribution of synapsin I and synaptophysin in hippocampal neurons developing in culture. J. Neurosci. 11, 1617–1626. https://doi.org/10.1103/PhysRevLett. 114.173002. Fung, S.J., Webster, M.J., Weicker, C.S., 2011. Expression of VGluT1 and VGAT mRNAs in human dorsolateral prefrontal cortex during development and in schizophrenia. Brain Res. 1388, 22–31. https://doi.org/10.1016/j.brainres.2011.03.004. Gorter, J.A., Van Vliet, E.A., Aronica, E., Breit, T., Rauwerda, H., Lopes Da Silva, F.H., Wadman, W.J., 2006. Neurobiology of disease potential new antiepileptogenic targets indicated by microarray analysis in a rat model for temporal lobe epilepsy. J. Neurosci. https://doi.org/10.1523/JNEUROSCI.2766-06.2006. Hennou, S., Khalilov, I., Diabira, D., Ben-Ari, Y., Gozlan, H., 2002. Early sequential formation of functional GABAAand glutamatergic synapses on CA1 interneurons of the rat foetal hippocampus. Eur. J. Neurosci. 16, 197–208. https://doi.org/10.1046/j. 1460-9568.2002.02073.x. Imig, C., Min, S.W., Krinner, S., Arancillo, M., Rosenmund, C., Südhof, T.C., Rhee, J.S., Brose, N., Cooper, B.H., 2014. The morphological and molecular nature of synaptic vesicle priming at presynaptic active zones. Neuron 84, 416–431. https://doi.org/10. 1016/j.neuron.2014.10.009. Jackman, S.L., Regehr, W.G., 2017. The mechanisms and functions of synaptic

83