Differential expression of tuberoinfundibular peptide 38 and glucose-6-phosphatase in tilapia

General and Comparative Endocrinology 146 (2006) 186–194 www.elsevier.com/locate/ygcen

Communications in Genomics and Proteomics

Differential expression of tuberoinfundibular peptide 38 and glucose-6-phosphatase in tilapia Justin M. Shoemaker a, Larry G. Riley b, Tetsuya Hirano b, E. Gordon Grau b, David A. Rubin a,* a b

Department of Biological Sciences, Illinois State University, Normal, IL 61790, USA Hawaii Institute of Marine Biology, University of Hawaii, Kaneohe, HI 96744, USA Received 25 May 2005; revised 2 September 2005; accepted 22 October 2005 Available online 20 December 2005

Abstract A new parathyroid hormone (PTH)-like endocrine system has been identified in mammals and fishes consisting of the PTH type-2 receptor (PTH2R) and tuberoinfundibular peptide 39 (TIP39). Although the mammalian PTH2R-TIP39 system is involved in nociception and pituitary regulation, the function(s) of this system in fishes is undetermined. Using degenerate primers based on conserved zebrafish and fugu TIP39 nucleotide sequences, 3 0 -RACE reactions isolated the coding region of a putative TIP38 cDNA in the Nile tilapia (Oreochromis niloticus). Tilapia-specific primers were subsequently used in 5 0 -RACE reactions to isolate the remaining portion of the transcript. The cDNA encoding O. niloticus TIP (OnTIP38) was determined to yield a 38 amino acid secreted hormone. A second tilapia TIP38 cDNA was isolated from the euryhaline Mozambique tilapia (OmTIP38). Except for the 39th residue, both tilapia cDNA sequences showed significant identity to human, bovine, murine, fugu, and zebrafish TIP39. To determine the tissue-specific expression of OnTIP38 and OmTIP38, real-time quantitative RT-PCR (rQRT-PCR) was performed on skin, gill, kidney, testis, heart, and brain. In freshwater (FW)-acclimated Nile tilapia, OnTIP38 showed highest levels of expression in kidney and lowest levels in skin and gill. In Mozambique tilapia tissues, expression of OmTIP38 and G6Pase (glucose-6 phosphatase) were higher in salt water (SW)-acclimated fish than in FW-acclimated fish. G6Pase expression, and not OmTIP38, showed significant differences among various tissues in FW- and SW-acclimated fish. Results of the present study clearly indicate that the TIP38/39-PTH2R system shows considerable conservation in sequence identity and tissue-specific expression in mammals and fishes. Ó 2005 Elsevier Inc. All rights reserved. Keywords: Tuberoinfundibular peptide 38; Euryhaline; Tilapia

1. Introduction The parathyroid hormone (PTH) family consists of three ligands, PTH, PTH-related peptide (PTHrP), and tuberoinfundibular peptide 39 (TIP39) (Papasani et al., 2004). Due to structural and functional conservation, it is believed that these peptides and receptors are phylogenetically related (Papasani et al., 2004). Although PTH and PTHrP stimulate the PTH1 receptor (PTH1R) and PTH3 receptor (PTH3R) (Gensure et al., 2004; Rubin and Ju¨ppner, 1999), TIP39 appears to be the endogenous ligand for *

Corresponding author. Fax: +1 309 438 3722. E-mail address: [email protected] (D.A. Rubin).

0016-6480/$ - see front matter Ó 2005 Elsevier Inc. All rights reserved. doi:10.1016/j.ygcen.2005.10.009

the PTH2 receptor (PTH2R) (Hoare et al., 2000; Penna et al., 2003; Papasani et al., 2004; Rubin et al., 1999). Little is known about the functions of TIP39 and PTH2R in mammals and fishes, although PTH, PTHrP, and the PTH1R have been extensively investigated in mammals (Mannstadt et al., 1999). In mammals, PTH is an endocrine hormone involved in regulating blood calcium levels and mineral ion homeostasis, while PTHrP is an autocrine/paracrine peptide involved in the tissue-specific patterning of bone, teeth, cartilage, pancreas, and other tissues (Kronenberg and Chung, 2001). The PTH1R is expressed in tissues of the liver, brain, lung, and smooth muscle, as well as numerous other tissues, with the highest expression levels in the kidney, bone, and growth plate

J.M. Shoemaker et al. / General and Comparative Endocrinology 146 (2006) 186–194

chondrocytes (Jonsson et al., 2001; Tian et al., 1993). The TIP39-PTH2R system, however, does not appear to be involved in either calcium regulation or the patterning of tissues (Hoare et al., 2000). Anatomically, the PTH2R is expressed in highest concentrations in hypothalamus and spinal cord in mammals and zebrafish (Papasani et al., 2004), and in lesser amounts in mammalian arterial and cardiac endothelium, kidney, pancreas, testis, sperm, and vascular smooth muscle tissues (John et al., 2002; Usdin et al., 1996, 1999b). The TIP39 ligand, on the other hand, is expressed in highest concentrations in hypothalamus and spinal cord and cardiac endothelium in mammals and zebrafish (Papasani et al., 2004), and in lesser amounts in renal vessels of the kidney, testis, and liver (Usdin et al., 2003). Functionally, mammalian and teleost TIP39 equipotently activate the human and zebrafish PTH2R (Papasani et al., 2004), and the PTH2R is expressed in somatostatin-expressing hypothalamic periventricular neurons, thus suggesting a possible role of TIP39 regulating growth hormone (GH) release (John et al., 2002). In addition, rat TIP39 has been shown to regulate the hypothalamo–pituitary–adrenal and hypothalamo–pituitary–gonadal axes (Ward et al., 2001), spermatogenesis (John et al., 2002), and renal hemodynamics (Eichinger et al., 2002). Thus, the TIP39-PTH2R system shows considerable in vitro conservation and shared tissue-specific expression patterns indicating that this system may be functionally conserved between mammals and teleosts. Because the TIP39-PTH2R system has been implicated in regulating mammalian renal and cardiovascular hemodynamics and osmoregulation (Eichinger et al., 2002; Ross et al., 2005; Sugimura et al., 2003), it is plausible that this system may also be involved in teleost osmoregulation. The Mozambique tilapia, Oreochromis mossambicus, are native to southern African rivers and coastal estuaries from north of the Zambezi delta south to Bushman’s River (Lobel, 1980). O. mossambicus have spread from their native range to invade at least 80 other countries throughout the world by introductions for aquaculture, aquatic weed control, mosquito control, and as baitfish (Eldredge, 2000; Snoeks, 2004). Because O. mossambicus is able to survive and reproduce in both fresh water (FW) and saltwater (SW) (Courtenay et al., 1974; Dial and Wainright, 1983; Lobel, 1980), it is the most widely introduced fish in the Pacific region causing devastation in fragile island ecosystems by competition with native animals and by altering habitat (Eldredge, 2000; Randall, 1987). Therefore, studies on hormones which regulate SW and FW adaptation become crucial to better understand the plasticity which allows euryhaline species to adapt to various salinities and niches. The full-length cDNA sequences encoding O. mossambicus and O. niloticus TIP were isolated and the secreted form of TIP in tilapia is deduced to be 38 amino acid residues. In addition, a partial cDNA sequence encoding G6Pase (glucose-6 phosphatase) was isolated as a control gene to

187

examine the relative expression of TIP38 in FW- and SW-adapted tilapia by real-time quantitative RT-PCR (rQRT-PCR). To check the possible occurrence of altered expression of TIP38 and G6Pase under different salinity environments, rQRT-PCR was performed on different tissues of FW- and SW-adapted O. mossambicus. 2. Materials and methods 2.1. Animal maintenance Both tilapia species (O. niloticus and O. mossambicus) were maintained in Institutional Animal Care and Use Committee (IACUC) approved facilities and euthanized according to IACUC guidelines and protocols (20-2001 Illinois State University, and 00-018-5 University of Hawaii). O. niloticus were housed in an indoor-intensive FW aquaculture facility at Illinois State University, while O. mossambicus were maintained in either FW- or SW (35 ppt)-holding pens for at least 2 weeks prior to use. Although six juvenile O. niloticus (weighing 50–75 g each) were used for the initial part of the study, six adult male O. mossambicus (weighing 400–500 g each) were subsequently used.

2.2. Oreochromis niloticus—TIP38 cDNA isolation by 5 0 -RACE and 3 0 -RACE Total RNA was isolated from juvenile O. niloticus head using a microRNA isolation kit according to previous protocols and manufacturer instructions (Papasani et al., 2004; Promega, Madison, WI). In duplicate and independent reactions, total RNA was converted into cDNA with superscript II reverse transcriptase (Invitrogen, Carlsbad, CA) and an oligo(dTTP) adapter-anchor primer (Table 1). In three independent reactions, the cDNA was amplified by PCR using forward fish TIP1 (Table 1), Abridged Universal Amplification Primer (AUAP, Table 1), and Platinum Taq DNA polymerase (Invitrogen). A 1:100 dilution of this amplicon was subsequently amplified by nested PCR (nPCR) with forward fish TIP2 (Table 1), AUAP, and Platinum Taq DNA polymerase. These 3 0 -RACE amplicons were electrophoresed through a 1.0% agarose gel containing ethidium bromide. Amplicons of the desired size were excised from the gel, purified, ligated to pGEM-Teasy (Promega) and used to transform E. coli TOP10 cells (Invitrogen). Plasmid DNA containing a sequence encoding a putative O. niloticus TIP38 (OnTIP38) cDNA was purified using Concert Miniprep (Life Technologies, Grand Island, NY) and sequenced using Big Dye 3.0 according to manufacturer protocols (ABI, Perkin-Elmer, Foster City, CA). The OnTIP38 3 0 -RACE sequence information was used to design OnTIP38-specific primers for 5 0 -RACE according to previous protocols and manufacturer instructions (Papasani et al., 2004; Invitrogen, Table 1). In duplicate and independent reactions, total head RNA was amplified by 5 0 -RACE (Invitrogen, Table 1) to obtain cDNAs encoding a 5 0 amplicon which was named OnTIP38/5 0 /GEMT. Accession number for fulllength consensus sequence of OnTIP38 is AY963628.

2.3. Oreochromis niloticus—G6Pase cDNA isolation by RT-PCR G6Pase primer pairs were designed from a previously isolated O. mossambicus G6Pase sequence (Accession No. AY094487; Rodgers et al., 2003) and used to isolate a partial cDNA sequence of O. niloticus G6Pase (OnG6Pase). In duplicate and independent reactions, cDNAs encoding OnG6Pase were generated using total liver RNA, superscript II reverse transcriptase, and reverse tilapia G6Pase1 (Table 1). Subsequently, a PCR was performed with reverse tilapia G6Pase1 and forward G6Pase2 (Table 1). The PCR products were electrophoresed on a 1.0% agarose gel containing ethidium bromide. The purified amplicons containing a putative cDNA sequence encoding OnG6Pase were ligated and transformed as previously described. Plasmid DNA containing a sequence encoding OnG6Pase cDNA was purified and sequenced as described

188

J.M. Shoemaker et al. / General and Comparative Endocrinology 146 (2006) 186–194

Table 1 Primers used in the cDNA isolation of O. niloticus and O. mossambicus TIP38 and O. niloticus G6Pase. As well as primers used in the rQRT-PCR experiments for both species Primer

Sequence 5 0 –3 0

Oreochromis niloticus-TIP38 sequence isolation 3 0 -RACE Oligo(dTTP) adapter primer GGCCACGCGTCGACTAGTACTT TTTTTTTTTTTTTTT AUAP GGCCACGCGTCGACTAGTAC Forward fish TIP1 GCSTTYAGAGAGAAGAGTAAGMT Forward fish TIP2 AAATGGCTSAACTCCTAYATGCA 5 0 -RACE Reverse tilapia TIP5 Forward tilapia TIP7 Reverse tilapia TIP4

ACCAGATTCCAGCTTCTGATG TCGTCTCCGGGAGCCGGGAT ATTTCTGGGAGTTTGGAGGC

Oreochromis niloticus-G6Pase sequence isolation Reverse tilapia G6Pase1 CTCGCGCTGTAGATCCATTTC Forward tilapia G6Pase2 AAGTCCTTCAGGTCATGCCATG Oreochromis mossambicus-TIP38 sequence isolation 3 0 -RACE Forward tilapia TIP5 TGGAGCATCCAAATGATGTCA Forward tilapia TIP6 ATGAGGGAGGCGTGGCTATTTACT 5 0 -RACE Reverse tilapia TIP4 ATTTCTGGGAGTTTGGAGGC Forward tilapia TIPY ATGTCTCAGCTTCCTGTTTTTC Reverse mossambicus TIPA CATGTACGAGTTGAGCCAC Quantitative PCR G6Pase Reverse tilapia G6Pase0 Forward tilapia G6Pase2 Reverse tilapia G6Pase1

AAGAAGTACTTCTTCAGGCTC AAGTCCTTCAGGTCATGCCATG CTCGCGCTGTAGATCCATTTC

TIP38 Reverse tilapia TIP5 Forward tilapia TIP7 Reverse tilapia TIP4

ACCAGATTCGAGCTTCTGATG TCGTCTCCGGGAGCCGGGAT ATTTCTGGGAGTTTGGAGGC

pGEMTeasy Sp6 T7

GATTTAGGTGACACTATAG TAATACGACTCACTATA

above. OnG6Pase was used as a ‘house-keeping’ gene to assess the interassay variation of TIP38 by rQRT-PCR (Rodgers et al., 2003). Accession number for OnG6Pase is AY963627.

2.4. Oreochromis mossambicus—TIP38 cDNA isolation by 5 0 -RACE and 3 0 -RACE Total brain RNA was isolated from adult O. mossambicus using a microRNA isolation kit. In duplicate and independent reactions, the total RNA was converted into cDNA with superscript II reverse transcriptase and an oligo(dTTP) adapter-anchor primer (Table 1). The cDNA was amplified by PCR in three independent reactions using forward tilapia TIP5 (Table 1), AUAP, and Platinum Taq DNA polymerase. A 1:100 dilution of this amplicon was subsequently amplified by nPCR with forward tilapia TIP6 (Table 1), AUAP, and Platinum Taq DNA polymerase. The 3 0 -RACE amplicons were electrophoresed through a 1.0% agarose gel containing ethidium bromide. Amplicons of the desired size were excised from the gel, purified, ligated to pGEM-Teasy and used to transform E. coli TOP10 cells. Plasmid DNA containing a sequence encoding a putative O. mossambicus TIP38 (OmTIP38) cDNA was purified and

sequenced as described above. The OmTIP38 3 0 -RACE sequence information was used to design OmTIP38-specific primers for 5 0 -RACE (Invitrogen, Table 1). In duplicate and independent reactions, total brain RNA was amplified by 5 0 -RACE (Invitrogen, Table 1) to obtain cDNAs encoding a 5 0 amplicon which was named OmTIP38/5 0 /GEMT. Accession number for full-length consensus sequence of OmTIP38 is AY963629.

2.5. Real-time quantitative PCR (rQRT-PCR) on tilapia tissues Standard curves were constructed for evaluating concentrations of TIP38 or G6Pase transcript expression by real-time quantitative PCR (rQRT-PCR) using SYBR Green PCR on a Gene Amp 5700 Sequence Detection System (PE Applied Biosystems). To construct a TIP38 rQRT-PCR standard curve, a 225 bp amplicon was produced in a 50 ll PCR with forward tilapia TIP7, reverse tilapia TIP5 (Table 1), and a 5:1000 dilution of OnTIP38/5 0 /GEMT. The amplicon was electrophoresed on a 1.0% agarose gel containing ethidium bromide, excised, purified, and resuspended in 150 ll of Tris-EDTA buffer. The concentration of the purified amplicon (stock) was obtained using the following formula: ððsample OD260 Þðdilution factorÞð50 lg=mlÞð106 pg=lgÞ  ðpmol=660 pgÞÞ=ð225 bpÞ ¼ X pmol. A series of 1:10 dilutions of this stock was made with glycogen water (Roche, Indianapolis) in the construction of a standard curve expressed in zeptomoles. The Ct value (threshold cycle) was used to evaluate standard curves and samples for O. niloticus and O. mossambicus TIP38 and G6Pase. The parameter Ct is the fractional cycle number at which the florescence passes the fixed threshold that is set at the midpoint of exponential template increase during the rQRT-PCR (Caelers et al., 2004). This was determined by observing the plot of the log of change in florescence versus cycle number. To assess the interassay variability, all TIP38 and G6Pase standard curve slopes and intercepts were evaluated by coefficient of variation (Sokal and Rohlf, 1981). Using a standardized input of 5.0 lg of total RNA from each tissue, RT-PCR was performed with reverse tilapia TIP5 (Table 1) in duplicate from three to four pooled O. niloticus brain, gill, heart, kidney, skin, liver, and testis. Subsequently, 2.0 lg of each cDNA was analyzed by rQRT-PCR using SYBR Green PCR Reagents (PE Applied Biosystems) in duplicate or triplicate with FW- and SW-samples being assayed in a randomized fashion to minimize interassay variation. The reactions were performed repeatedly and independently using gene-specific primers for tilapia TIP38 and G6Pase (Table 1). Ct values obtained from the tissues were compared to the standard curves to determine the amount of tilapia TIP38 and G6Pase transcript. In addition, validation experiments to show parallel amplification of TIP38 and G6Pase sample and standard by rQRT-PCR were performed using 4-fold dilutions of either sample cDNA or purified cDNAs (Bustin, 2002; Caelers et al., 2004; Rubin et al., 2000). In short, approximately 225 bp cDNAs for tilapia TIP38 and G6Pase were obtained from highly conserved regions, respectively, and used to determine parallelism and production of a single amplicon by rQRT-PCR. The slopes and intercepts for all TIP38 or G6Pase standard curves produced were robustly similar (y = mx + b; where m = slope and b = intercept). The coefficient of variation for all TIP38 rQRT-PCR slopes and intercepts were 8.92 and 12.19%, respectively, while the coefficient of variation for all G6Pase rQRT-PCR slopes and intercepts were 7.04 and 12.24%, respectively. The coefficient of variation values were generated from the curves of 21 total rQRT-PCR assays for TIP38 and 15 for G6Pase (R2 values for all curves averaged 0.99). A 4-fold dilution of O. niloticus total RNA was analyzed by rQRT-PCR and indicated parallel amplifications of samples and standards for both TIP38 and G6Pase; thus indicating similarity of amplification efficiencies and reliability of the standard curves utilized (Bustin, 2002; Caelers et al., 2004; Rubin et al., 2000). Furthermore, the TIP38 standard and sample dilutions produced similar slopes (3.934 and 3.971, respectively) indicating similar amplification efficiencies of the standard dilutions and the total RNA samples. G6Pase showed similar amplification reliability.

J.M. Shoemaker et al. / General and Comparative Endocrinology 146 (2006) 186–194 Using the OnTIP38 cDNA sequence as a guide, ‘‘tilapia’’-specific primers were designed to isolate O. mossambicus TIP38 (OmTIP38) cDNA for use in rQRT-PCR. Thereafter, O. mossambicus specific-primers were used (Table 1). Real-time QRT-PCR was performed with O. mossambicus (N = 6, from the Hawaii Institute of Marine Biology), which had been acclimated to either FW or SW for 2 weeks. Brain, gill, heart, kidney, skin, and testis were analyzed in triplicate from six male tilapia.

189

substitution between mammalian TIP39 and teleosts TIP38/39 is at position 23 of the mature peptide (mammals have Arg while teleosts have Gln). No studies have been performed to evaluate this charged substitution on ligand binding or activation of the PTH2R. 3.2. G6Pase cDNA isolation and analysis

2.6. Statistical design and analysis The O. niloticus FW TIP38 and G6Pase rQRT-PCR data were analyzed using a one-way ANOVA with tissue as treatment followed by pair-wise comparisons of means (Ryan–Einot–Gabriel–Welsch multiple range test for product) using SAS (significance, P < 0.05). The O. mossambicus TIP38 and G6Pase rQRT-PCR data were analyzed by ANOVA using a split plot design, with FW and SW as whole plot treatments applied to fish, and tissues within fish as subplot factors. Fish nested in treatment was a random effect and was used as the whole plot error term for testing the treatment effect. A test for interaction of treatment and tissue was used to determine if treatments had tissue-specific effects. Subsequently, a Tukey post hoc test was used to evaluate potentially significant differences among all possible pairs of means (Sokal and Rohlf, 1981).

3. Results 3.1. Tilapia TIP38 cDNA isolation and analysis Two tilapia (O. niloticus and O. mossambicus) TIP38 cDNA sequences were isolated by 5 0 and 3 0 RACE reactions (Fig. 1). Compared to zebrafish TIP39 (Papasani et al., 2004), OnTIP38 and OmTIP38 are highly conserved and lack the 39th amino acid residue of the mature expressed hormone. Furthermore, OnTIP38 shares 97% amino acid sequence similarity and 83% nucleotide sequence identity with zebrafish TIP(1–39) and 91% amino acid sequence similarity and 69% nucleotide sequence identity with murine TIP(1–39), while OmTIP38 shares 97% amino acid sequence similarity and 82% nucleotide sequence identity with zebrafish TIP(1–39) and 91% amino acid sequence similarity and 68% nucleotide sequence identity with murine TIP(1–39) (Fig. 2, John et al., 2002). Thus, the tilapia are the first species to have a gene encoding a TIP38 cDNA sequence encoding a TIP(1–38) polypeptide. Although OnTIP38 and OmTIP38 cDNAs share 97% nucleotide sequence identity of the mature hormone, they share 94% nucleotide sequence identity of the coding region, which reflects the appearance of eight additional amino acids in the region encoding the prohormone (Fig. 1). To verify that the OnTIP38 sequence was not an artifact of the RT-PCR or PCRs, the insert of 24 extra nucleotides in the OnTIP38 cDNA sequence was confirmed by performing several additional and independent RTPCRs with multiple primer pairs. The alignment of all currently isolated TIP38/39 ligands showed a substantial conservation of amino acid sequence among both species of tilapia as well as other species (Fig. 2). Of the 38 or 39 amino acids which constitute the mature TIP peptide among all species, 19 are identical and 18 represent conserved amino acid substitutions. The only non-conserved

In addition to OnTIP38, a partial cDNA sequence encoding G6Pase was isolated from O. niloticus (Fig. 3). The partial O. niloticus G6Pase sequence is 291 bp in length and the alignment of O. niloticus with O. mossambicus G6Pase showed a 98.6% sequence identity (287/291 bp) (Fig. 3). 3.3. Tilapia TIP38 and G6Pase rQRT-PCR Real-time QRT-PCR was performed to determine the levels of TIP38 and G6Pase transcript expression in O. niloticus (Fig. 4) and O. mossambicus tissues (Fig. 5 and Table 2). The rQRT-PCR results for O. niloticus TIP38 indicated a significantly higher level of OnTIP38 expression in kidney than other tissues (Fig. 4), with high amounts of OnTIP38 also shown in heart, liver, and testis. Results for O. niloticus G6Pase by rQRT-PCR indicated a nearly constant level of expression between all tissues; gill tissue did not yield detectable amounts (Fig. 4). In Mozambique tilapia, expression of OmTIP38 by rQRT-PCR was robustly higher in SW-acclimated fish than in FW-acclimated fish in all tissues examined (P = 0.06), with an average of a 34-fold increased expression in SW-acclimated fish. Within each treatment (FW and SW), there are significant differences among tissues of TIP38 expression with skin being lower than both kidney and testis. The G6Pase rQRT-PCR data indicated a significant effect of treatment (P = 0.018) with an increased expression of G6Pase in SW-acclimated fish tissues compared to FW-acclimated fish in all tissues examined (Table 2). Furthermore, FW and SW treatments appeared to be affecting tissues differentially. Gill, heart, and skin tissues showed a larger difference between FW and SW treatments with regards to G6Pase expression while a smaller effect was observed in brain, kidney, and testis. Tissues also differed amongst the treatments, with skin and gill low in FW-acclimated fish while kidney and testis were significantly higher. 4. Discussion The full-length O. niloticus TIP38 (OnTIP38) and O. mossambicus TIP38 (OmTIP38) cDNA sequences encoded a mature 1–38 amino acid peptide which showed considerable conservation at the nucleotide and amino acid level (Figs. 1 and 2), and the mature TIP38/39 from all species exhibited a high degree of sequence conservation. The lack of a 39th amino acid residue encoded by OnTIP38 and OmTIP38 is unlikely to affect receptor activation since

190

J.M. Shoemaker et al. / General and Comparative Endocrinology 146 (2006) 186–194

Fig. 1. Alignment of O. niloticus (OnTIP38) and O. mossambicus (OmTIP38) cDNAs encoding TIP38. The deduced TIP38 amino acid sequences of the preprosequence are indicated either above (O. niloticus, On) or below (O. mossambicus, Om) the corresponding nucleotide sequence. The putative secreted peptide is shown in bold. Nucleotides in the putative preproTIP38 sequence are capitalized, nucleotides in the 5 0 and 3 0 untranslated regions are lowercase. The ATG in bold represents the putative initial methionine and start of the signal peptide. After the dibasic residues K R, the first residue of the translated mature TIP(1–38) sequence is N, the stop codon has * below its corresponding nucleotide sequence, and the polyadenylation sequence is underlined. Boxes with nucleotides underlined indicate nucleotide changes, while boxes without underlining indicate gaps between OnTIP38 and OmTIP38.

there appears to be no conservation of this residue among any TIP38/39 sequences isolated to date. Although the mature TIP38/39 hormone showed considerable amino acid conservation (Papasani et al., 2004), the signal peptide is poorly conserved among all the species examined (Fig. 2). Thus, it was not surprising that the two tilapia species showed limited conservation within the signal peptide with O. niloticus having eight additional amino acids 5 0 of the mature peptide (Figs. 1 and 2). A similar trend in peptide variation can be demonstrated between O. niloticus

GH (Accession No. M26916) and O. mossambicus GH (Accession No. AF033805) where the O. niloticus GH showed an additional 11 amino acids in the coding region. To normalize the tissue-specific distribution of tilapiaTIP38 in FW- and SW- acclimated fishes, it was a priori decided to use the highly conserved house keeping gene G6Pase (Rodgers et al., 2003). Thus, to evaluate a normalized tissue-specific expression of OnTIP38 and OmTIP38, a 291 bp partial G6Pase cDNA sequence from O. niloticus was isolated from a highly conserved region (Fig. 3). As

J.M. Shoemaker et al. / General and Comparative Endocrinology 146 (2006) 186–194

191

Fig. 2. Alignment of all known TIP38/39 amino acid sequences. Takifugu rubripes (f), O. niloticus (On), O. mossambicus (Om), zebrafish (z), human (h), and murine (m) TIP38/39 sequences are displayed. T-Coffee and Dialign algorithms were used to align all available TIP38/39 sequences since they allow for a more accurate alignment compared to ClustalW for sequences with less than 30% identity (Lassmann and Sonnhammer, 2002; Morgenstern, 1999; Notredame et al., 2000). Only uppercase letters are considered to be aligned. The thick black bar depicts the secreted TIP38/39 amino acid polypeptide with the first residue denoted as ‘‘1,’’ the lengths of each prepro amino acid sequence are displayed after the 39th residue. *, identical residues; :, conservative substitutions.

Fig. 3. Alignment of the partial O. niloticus G6Pase cDNA sequence (Accession No. AY963627) with O. mossambicus G6Pase cDNA sequence (Accession No. AY094487). Underlined nucleotides indicate nucleotide substitutions of G6Pase cDNA between the two species. Within this region of the cDNA, the percent identity between OnG6Pase and OmG6Pase is 98.6% out of 291 nucleotides.

hypothesized, the O. niloticus G6Pase cDNA showed a significant sequence conservation compared to O. mossambicus G6Pase (98.6% sequence identify, 287 identical nucleotides out of 291). The rQRT-PCR results indicated that OnTIP38 is expressed in the brain as well as the gill, heart, kidney, liver, skin, and testis (Fig. 4). These results are consistent with the tissue-specific expression of murine TIP39 as assessed by Northern blot analyses (John et al., 2002). Furthermore, studies by Usdin and colleagues showed mouse and rat PTH2R expression in the hypothalamus and spinal cord, as well as, in cardiac and aorta endothelial cells and renal glomeruli (Usdin et al., 1996, 1999a,b, 2003; Wang et al., 2000). These studies have implicated murine TIP39 for regulating hemodynamics and osmoregulation via inhibiting the release of AVP (argenine vasopressin) and activating

the PTH2R to dilate renal vessels to regulate renal hemodynamics (Eichinger et al., 2002; Ross et al., 2005; Sugimura et al., 2003). In view of the considerable conservation of the teleost TIP39 structure and function in vitro (Papasani et al., 2004) and the above data, it is hypothesized that teleost TIP38/39 may also function to regulate hemodynamics and osmoregulation. To test the hypothesis that TIP38/39 can be involved with modulating osmoregulation or hemodynamics in euryhaline fishes, O. mossambicus were acclimated to FW and SW for at least 2 weeks. Subsequent to the 2-week acclimation period, fish were euthanized, tissues removed, total RNA isolated, quantified, and analyzed by rQRTPCR in either duplicate or triplicate randomized runs with standard curves for either G6Pase or tilapia TIP38. By averaging the rQRT-PCR OmTIP38 results for each tissue

192

J.M. Shoemaker et al. / General and Comparative Endocrinology 146 (2006) 186–194

Fig. 4. Amounts of OnTIP38 and OnG6Pase transcript in brain, gill, heart, kidney, liver, skin, and testis from freshwater-acclimated O. niloticus as assessed by rQRT-PCR. Stippled bars represent OnTIP38 and open bars represent G6Pase in zeptomoles/lg total RNA. Data given as means ± SE, N = 3.

from SW- and FW-acclimated tilapia, a non-significant difference was observed (P = 0.06, Fig. 5). When the means of each tissue from SW-acclimated fish are compared to those

from FW-acclimated fish, the following increases are observed, expressed as fold difference (SW/FW): brain  20, gill  45, heart  31, kidney  30, skin  51, and testis  34. Considering that the sample size for each treatment was three fish (three FW and three SW tilapia) for six tissues, the results approached statistical significance. Thus, the O. mossambicus rQRT-PCR results are consistent with the hypothesis that TIP38 can be involved in modulating osmoregulation or hemodynamics either directly or via other hormones such as prolactin (PRL) or growth hormone (GH) (Manzon, 2002; Sakamoto, 2003; Sakamoto et al., 1997). Although it was not known at the onset of this study that differential gene expressions may be associated with euryhalinity (Deane et al., 1999; Deane and Woo, 2004), it was a priori assumed that house-keeping genes (for example, G6Pase) could be used for normalization of rQRT-PCR endocrine data (Lu et al., 2004). G6Pase showed a similar and significant increased expression in SW-acclimated tilapia when compared to FW-acclimated fish (Table 2). By averaging the rQRT-PCR G6Pase results for each tissue, significant differences were observed between SW- and FW-acclimated tilapia (P = 0.05, Table 2). When the means of each tissue from SW-acclimated

Fig. 5. Amounts of OmTIP38 transcript in brain, gill, heart, kidney, skin and testis from O. mossambicus as assessed by rQRT-PCR. Lightly stippled bars represent freshwater (FW) and heavily stippled bars represent saltwater (SW) TIP38 in zeptomoles/lg total RNA. Data presented are means ± SE, N = 3. Values are expressed as zeptomoles/lg RNA and represent means ± SE of two to four independent assays, which included randomized FW and SW total RNA samples from each tissue. Although the effect of water treatment was marginally significant (P = 0.06), the graph indicates a robust trend of increased OmTIP38 expression in SW-acclimated fish compared to FW-acclimated fish.

Table 2 G6Pase values as assessed by rQRT-PCR from SW- and FW-acclimated O. mossambicus

G6Pase FW G6Pase SW SW/FWa P Valuesb

Brain

Gill

Heart

Kidney

Skin

Testis

1.04 ± 0.12 29.09 ± 22.88 27.97 P < 0.002

0.28 ± 0.14 63.07 ± 44.47 225.25 P < 0.001

0.56 ± 0.27 22.34 ± 15.39 39.89 P < 0.001

1.95 ± 0.76 45.28 ± 33.72 23.2 P < 0.004

0.13 ± 0.06 15.03 ± 9.39 115.61 P < 0.0001

2.18 ± 0.86 18.52 ± 8.2 8.49 P < 0.04

rQRT-PCR assays for G6Pase from SW and FW acclimated O. mossambicus from six tissues were performed as described in methods section. Values represent means ± SE of two to four independent assays which included randomized FW and SW total RNA samples from each tissue, and are expressed as zeptomoles/lg total RNA. To determine the P values, a Tukey test was used to evaluate potentially significant differences among all possible pairs of means (Sokal and Rohlf, 1981). a Values are expressed as fold difference (SW/FW). b Significant differences at P < 0.05 (Sokal and Rohlf, 1981).

J.M. Shoemaker et al. / General and Comparative Endocrinology 146 (2006) 186–194

tilapia are compared to those from FW fish, the following increases are observed, expressed as fold difference (SW/ FW): brain  28, gill  225, heart  40, kidney  23, skin  115, and testis  8.5 (Table 2). Because it appeared that G6Pase showed differential levels of expression in SWand FW-acclimated tilapia, the OmTIP38 data was not normalized to G6Pase since it was a variable as well. Although the intent of this preliminary study was to better understand the physiological roles of TIP38/39 in teleosts, the unexpected G6Pase results suggested that there is an energetic cost associated with SW adaptation (SangiaoAlvarellos et al., 2003); house-keeping genes and hormone transcript levels are markedly increased in SW-acclimated tilapia when compared to FW. Thus, Mozambique tilapia, like other euryhaline species, may be a strong invasive species due to its metabolic and endocrine adaptability to extreme salinity changes (Deane et al., 1999; Deane and Woo, 2004; Sangiao-Alvarellos et al., 2003). The ability of O. mossambicus to effectively osmoregulate in various salinities is arguably a key trait in their capability of initially invading various water ecosystems, thus allowing for competition with native species. This is a desirable trait for this species’ use in the aquaculture industry, which has contributed to the spread of this and other invasive tilapia species around the world (Eldredge, 2000). This study provides preliminary evidence that TIP38 is likely involved in osmoregulation of tilapia, but it is yet unclear exactly how the TIP39-PTH2R system modulates osmoregulatory adaptation. Future studies with this newly described TIP38-PTH2R endocrine system will hopefully continue to shed light on its role in osmoregulation, hemodynamics, and pituitary regulation. Acknowledgments We thank Madhu Papasani, Bhaskar Ponugoti, and Drs. Rachel Bowden, Bill Perry and Steven Juliano. This research was supported by National Institutes of Health Grant DK60513 (to D.A.R.), a grant from the Phi Sigma Society (to J.M.S.), and National Science Foundation Grants IBN 01-33714, 04-17250, and 04-36347 (to E.G.G.). References Bustin, S., 2002. Quantification of mRNA using real-time reverse transcription PCR (RT-PCR): trends and problems. J. Mol. Endocrinol. 29, 23–29. Caelers, A., Berishvili, G., Meli, M.L., Eppler, E., Reinecke, M., 2004. Establishment of a real-time RT-PCR for the determination of absolute amounts of IGF-I and IGF-II gene expression in liver and extrahepatic sites of the tilapia. Gen. Comp. Endocrinol. 137, 196–204. Courtenay Jr., W.R., Sahlman, H.F., Miley II, W.W., 1974. Exotic fishes in fresh and brackish waters of Florida. Biol. Conservation 6, 252–259. Deane, E.E., Kelly, S.P., Lo, C.K.M., Woo, N.Y.S., 1999. Effects of GH, prolactin and cortisol on hepatic heat shock protein 70 expression in a marine teleost Sparus sarba. J. Endocrinol. 161, 413–421. Deane, E.E., Woo, N.Y.S., 2004. Differential gene expression associated with euryhalinity in sea bream (Sparus sarba). Am. J. Physiol. 287, R1054–R1063.

193

Dial, R.S., Wainright, S.C., 1983. New distributional records for nonnative fishes in Florida. Florida Scientist 46, 8–15. Eichinger, A., Fiaschi-Taesch, N., Massfelder, T., Fritsch, S., Barthelmebs, M., Helwig, J.-J., 2002. Transcript expression of the tuberoinfundibular peptide (TIP)39/PTH2 receptor system and Non-PTH1 receptor-mediated tonic effects of TIP39 and other PTH2 receptor ligands in renal vessels. Endocrinology 143, 3036–3043. Eldredge, L.G. 2000. Non-indigenous freshwater fishes, amphibians, and crustaceans of the Pacific and Hawaiian Islands. Invasive species in the Pacific: a technical review and draft regional strategy. In: South Pacific Regional Environmental Programme (Samoa), pp. 173–190. Gensure, R., Ponugoti, B., Gunes, Y., Papasani, M., Lanske, B., Bastepe, M., Rubin, D.A., Ju¨ppner, H., 2004. Identification and characterization of two parathyroid hormone-like molecules in zebrafish. Endocrinology 145, 1634–1639. Hoare, S.R.J., Rubin, D.A., Ju¨ppner, H., Usdin, T.B., 2000. Evaluating the ligand specificity of zebrafish parathyroid hormone (PTH) receptors: Comparison of PTH, PTH-related protein, and tuberoinfundibular peptide of 39 residues. Endocrinology 141, 3080–3086. John, M., Arai, M., Rubin, D., Jonsson, K., Ju¨ppner, H., 2002. Identification and characterization of the murine and human gene encoding the tuberoinfundibular peptide of 39 residues (TIP39). Endocrinology 143, 1047–1057. Jonsson, K., John, M., Gensure, R., Gardella, T., Ju¨ppner, H., 2001. Tuberoinfundibular peptide 39 binds to the parathyroid hormone (PTH)/PTH-related peptide receptor, but functions as an antagonist. Endocrinology 142, 704–709. Kronenberg, H., Chung, U.-I., 2001. The parathyroid hormone-related protein and indian hedgehog feedback loop in the growth plate. Novartis Found Symp. 232, 144–157. Lassmann, T., Sonnhammer, E., 2002. Minireview: quality assessment of multiple alignment programs. FEBS Lett. 529, 126–130. Lobel, P.S., 1980. Invasion by the Mozambique tilapia (Sarotherodon mossambicus; Pisces; Cichlidae) of a Pacific atoll marine system. Micronesica 16, 349–355. Lu, W., Dow, L., Gumusgoz, S., Brierley, M.J., Warne, J.M., McCrohan, C.R., Balment, R.J., Riccardi, D., 2004. Coexpression of corticotropinreleasing hormone and urotensin I precursor genes in the caudal neurosecretory system of the euryhaline flounder (Platichthys flesus): a possible shared role in peripheral regulation. Endocrinology 145, 5786–5797. Mannstadt, M., Juppner, H., Gardella, T.J., 1999. Receptors for PTH and PTHrP: their biological importance and functional properties. Am. J. Physiol. 277, F665–F675. Manzon, L.A., 2002. The role of prolactin in fish osmoregulation: a review. Gen. Comp. Endocrinol. 125, 291–310. Morgenstern, B., 1999. Dialign 2: improvement of the segment-tosegment approach to multiple sequence alignment. Bioinformatics 15, 211–218. Notredame, C., Higgins, D., Heringa, J., 2000. T-Coffee: a novel method for fast and accurate multiple sequence alignment. J. Mol. Biol. 302, 205–217. Papasani, M., Gensure, R., Yan, Y.-L., Gunes, Y., Postlethwait, J., Ponugoti, B., John, M., Ju¨ppner, H., Rubin, D., 2004. Identification and characterization of the zebrafish and fugu genes encoding tuberoinfundibular peptide 39. Endocrinology 145, 5294–5304. Penna, K.D., Kinose, F., Sun, H., Koblan, K., Wang, H., 2003. Tuberoinfundibular peptide of 39 residues (TIP39): molecular structure and activity for parathyroid hormone 2 receptor. Neuropharmacology 44, 141–153. Randall, J.E., 1987. Introductions of marine fishes to the Hawaiian Islands. Bull. Marine Sci. 41, 490–502. Rodgers, B., Weber, G., Kelley, K., Levine, M., 2003. Prolonged fasting and cortisol reduce myostatin mRNA levels in tilapia larvae; shortterm fasting elevates. Am. J. Physiol. 284, R1277–R1286. Ross, G., Engel, P., Abdallah, Y., Kummer, W., Schluter, K.D., 2005. Tuberoinfundibular peptide of 39 residues: a new mediator of cardiac

194

J.M. Shoemaker et al. / General and Comparative Endocrinology 146 (2006) 186–194

function via nitric oxide production in the rat heart. Endocrinology 145, 2221–2228. Rubin, D.A., Hellman, P., Zon, L.I., Lobb, C.J., Bergwitz, C., Ju¨ppner, H., 1999. A G protein-coupled receptor from zebrafish is activated by human parathyroid hormone and not by human or teleost parathyroid hormone-related peptide: implications for the evolutionary conservation of calcium-regulating peptide hormones. J. Biol. Chem. 274, 23035–23042. Rubin, D.A., Ju¨ppner, H., 1999. Zebrafish express the common PTH/PTHrP receptor (PTH1R) and a novel receptor (PTH3R) that is preferentially activated by mammalian and fugufish parathyroid hormone-related peptide (PTHrP). J. Biol. Chem. 274, 28185–28190. Rubin, D.A., Eid, K., Yates, K., Mizuno, S., Glowacki, J., 2000. Induction of IGF-1 expression in human dermal fibroblasts grown in a 3-dimensional collagen sponge. J. Bone Miner. Res. 15, S367. Sakamoto, T., 2003. Growth hormone and prolactin in environmental adaptation. Zool. Sci. 20, 1497–1498. Sakamoto, T., Shepherd, B., Madsen, S., Nishioka, R., Siharath III, K.N.R., Grau, E., Bern, H., 1997. Osmoregulatory actions of growth hormone and prolactin in an advanced teleost. Gen. Comp. Endocrinol. 106, 95–101. Sangiao-Alvarellos, S., Laiz-Carrion, R., Guzman, J.M., Rio, M.P.M.d., Miguez, J.M., Mancera, J.M., Soengas, J.L., 2003. Acclimation of S. aurata to various salinities alters energy metabolism of osmoregulatory and nonosmoregulatory organs. Am. J. Physiol. Regul. Integr. Comp. Physiol. 285, R897–R907. Snoeks, J., 2004. Global Invasive Species Database, Oreochromis mossambicus (fish). http://www.invasives.org/database/species.

Sokal, R., Rohlf, F., 1981. Biometry: The Principles and Practice of Statistics in Biological Research, second ed. W.H. Freeman and Company, San Francisco, 880 pp. Sugimura, Y., Murase, T., Ishizaki, S., Tachikawa, K., Arima, H., Miura, Y., Usdin, T., Oiso, Y., 2003. Centrally administered tuberoinfundibular peptide of 39 residues inhibits arginine vasopressin release in conscious rats. Endocrinology 144, 2791–2796. Tian, J., Smorgorzewski, M., Kedes, L., Massry, S.G., 1993. Parathyroid hormone-parathyroid hormone related protein receptor messenger RNA is present in many tissues besides the kidney. Am. J. Nephrol. 13, 210–213. Usdin, T.B., Bonner, T.I., Harta, G., Mezey, E., 1996. Distribution of PTH2 receptor messenger RNA in rat. Endocrinology 137, 4285–4297. Usdin, T., Hoare, S., Wang, T., Mezey, E., Kowalak, J., 1999a. TIP39: a new neuropeptide and PTH2-receptor agonist from hypothalamus. Nat. Neurosci. 2, 941–943. Usdin, T.B., Hilton, J., Vertesi, T., Harta, G., Segre, G., Mezey, E., 1999b. Distribution of the parathyroid hormone 2 receptor in rat: Immunolocalization reveals expression by several endocrine cells. Endocrinology 140, 3363–3371. Usdin, T., Dobolyi, A., Ueda, H., Palkovits, M., 2003. Emerging functions for tuberoinfundibular peptide of 39 residues. Trends Endocrinol. Metabol. 14, 14–19. Wang, T., Palkovits, M., Rusnak, M., Mezey, E., Usdin, T.B., 2000. Distribution of parathyroid hormone-2 receptor-like immunoreactivity and messenger RNA in the rat nervous system. Neuroscience 100, 629–649. Ward, H., Small, C., Murphy, K., Kennedy, A., Ghatei, M., Bloom, S., 2001. The actions of tuberoinfundibular peptide on the hypothalamo– pituitary axes. Endocrinology 142, 3451–3456.