- Email: [email protected]
Differential gene expression in central nervous system tissues of sheep with natural scrapie
BR AIN RE S EA RCH 1 0 73 –1 0 74 ( 20 0 6 ) 8 8 –9 2
a v a i l a b l e a t w w w. s c i e n c e d i r e c t . c o m
w w w. e l s e v i e r. c o m / l o c a t e / b r a i n r e s
Short Communication
Differential gene expression in central nervous system tissues of sheep with natural scrapie David Garcia-Crespo, Ramón A. Juste, Ana Hurtado ⁎ Department of Animal Health, Instituto Vasco de Investigación y Desarrollo Agrario (NEIKER); Berreaga, 1. 48160 Derio, Bizkaia, Spain
A R T I C LE I N FO
AB S T R A C T
Article history:
The expression of nine genes was analyzed by real-time RT-PCR in the central nervous
Accepted 11 December 2005
system in order to investigate the molecular pathogenesis of natural scrapie. An upregulation of genes related to glial activation (GFAP) and apoptosis (CASP3) was detected in obex and cerebrum, indicating a reactive glia. Another glial activation-related gene (CTSS)
Keywords:
was slightly up-regulated in obex, whereas constitutive expression was detected for SOD1,
Scrapie
YWHAZ, PRNP, and the apoptosis-related genes BCL2, MCL1, and BAX. This differential gene
Glia
expression might reflect a spatial–temporal and tissue-specific molecular pathogenesis of
Apoptosis
scrapie.
Gene expression
© 2005 Elsevier B.V. All rights reserved.
Sheep Prion Abbreviations: Ct, threshold cycle HK, housekeeping Q, raw quantity value for gene expression
Scrapie is a transmissible spongiform encephalopathy (TSE) which occurs in sheep and goats. Like in all TSEs, the hostencoded cellular prion protein (PrPc) suffers a structural modification to become the pathological protease-resistant prion protein (PrPSc), which accumulates mainly in the central nervous system (CNS) forming characteristic insoluble amyloid deposits (Aucouturier et al., 2001; van Keulen et al., 1996). PrPc neuronal expression is therefore necessary for the infection and the spreading of the agent (Brown et al., 1996). The hypothesis that recognizes PrPSc as the only transmissible agent is generally accepted, and susceptibility to scrapie is thought to be associated to several prion protein gene (PRNP) polymorphisms. However, the pathogenesis of scrapie is still
not completely understood. Neuropathological events of TSEs include glial activation, progressive vacuolation of the neuropil, and neuronal degeneration with eventual neuronal loss. Several studies based on experimentally infected animal models have detected up to 121 up-regulated genes (DandoyDron et al., 1998; Xiang et al., 2004), including genes involved in astrocytosis and microglial activation like glial fibrillary acidic protein (GFAP) or cathepsin S (CTSS), and indicators of cellular stress and homeostasis maintenance genes like superoxide dismutase 1 (SOD1). Additionally, the 14-3-3 protein family is being studied as a biomarker of prion diseases since it is differentially detected in cerebral spinal fluid of Creutzfeldt– Jakob-disease-affected patients (Hsich et al., 1996; Van
⁎ Corresponding author. Fax: +34 902540547. E-mail address: [email protected] (A. Hurtado). 0006-8993/$ – see front matter © 2005 Elsevier B.V. All rights reserved. doi:10.1016/j.brainres.2005.12.068
89
BR AIN RE S EA RCH 1 0 73 –1 0 74 ( 20 0 6 ) 8 8 –9 2
Everbroeck et al., 2003). In addition, since apoptosis is the main neuronal death mechanism in TSEs (Fairbairn et al., 1994; Giese et al., 1995), an alteration in the expression of apoptosis-related genes like BCL2, BAX, or CASP3 has been reported in scrapie-infected mice (Park et al., 2000). Although there are many studies in gene expression of experimentally scrapie-infected animal models, few studies on natural scrapie are available. Therefore, the expression of eight genes associated with glial activation, homeostasis maintenance, and apoptosis, as well as the PRNP gene, has been studied in three relevant brain areas of sheep with natural scrapie and healthy animals using real-time RT-PCR technology and relative quantification. Four Latxa ewes from a natural outbreak showing similar clinical signs of late stage scrapie and 22 healthy sheep from flocks with no record of scrapie were included in the study. The age of the animals ranged from 3 to 12 years old. The presence of PrPSc was tested in a sample of obex with the Platelia®BSE kit (Bio-Rad, Hercules, CA, USA), and only the four clinical cases were confirmed as positive. PRNP genotyping performed as previously described (Garcia-Crespo et al., 2004) identified the ARQ/ARQ genotype in the four animals with scrapie and a variety of genotypes in the control animals (Garcia-Crespo et al., 2005). A sample from the same region of cerebrum (neocortex), cerebellum, and obex was aseptically taken from each animal and frozen immediately at −80 °C. RNA extraction and cDNA synthesis were performed as previously described (Garcia-Crespo et al., 2005). The same batch of diluted cDNA was used for all real-time PCR amplifications. Five housekeeping (HK) or endogenous genes (ACTB, GAPDH, RPL19, SDHA, and G6PD) were evaluated for the normalization of the expression of 9 target genes (GFAP, CTSS, PRNP, SOD1, YWHAZ, CASP3, BCL2, MCL1, and BAX). The
sequences of the primers used to amplify the target genes are shown in Table 1, whereas those for the HK genes were described elsewhere (Garcia-Crespo et al., 2005). PCR reactions were performed in triplicate using the conditions previously reported (Garcia-Crespo et al., 2005). For each experiment, a non-template reaction was included as negative control. The specificity of the PCR reactions was assessed by the analysis of the melting curves of the products and size verification and sequencing of the amplicons. The threshold cycle values (Ct) were determined at the same fluorescence threshold line for each gene, and each sample Ct value was calculated by the arithmetic mean of the triplicate values. Ct values were transformed into raw quantity values (Q) according to the equation Q = 2 (Min Ct − Sample Ct), where “Min Ct” is the minimum Ct value for the samples analyzed, and assuming an amplification efficiency of 100%. The assessment of the HK genes stability and the selection of the best reference genes, as well as the normalization, were carried out using the method described by Vandesompele et al. (2002) and the MS Excel application geNorm 3.3. Prior to the analysis of the target genes expression values, a general linear model (GLM) analysis (SAS institute, Cary, NC, USA) was performed to rule out the effect of the age in the gene expression (P N 0.05). The effect of the health status on the expression of the HK genes was also assessed in a similar manner (P N 0.05). Finally, statistical differences between control and scrapie-affected groups were calculated by Mann– Whitney U test using SAS statistical package version 8 (SAS Institute). The analysis of the stability of the five HK genes in the 26 animals using geNorm 3.3 (Vandesompele et al., 2002) indicated the impossibility of using a common set of HK genes for the normalization and the comparison of gene expression in the three tissues. The expression stability
Table 1 – Primers sequences and amplicon parameters Gene a GFAP CTSS PRNP SOD1 YWHAZ CASP3 BCL2 MCL1 BAX
Forward and reverse primers 5′ → 3′
[C]
Amplicon size (bp)
Tm (°C)
TGCCTATCGACAGGAAGCAGAT TGGACGCCACTGCCTCATA AAAGAAGCCGTGGCCAATAAA AGGCCCCAGCTGTTTTTCA GCCAAAAACCAACATGAAGCAT TGCTCATGGCACTTCCCAG GATGAAGAGAGGCATGTTGGAGA TCATTTCCACCTCTGCCCAA TGTAGGAGCCCGTAGGTCATCT TTCTCTCTGTATTCTCGAGCCATCT CCAATGGACCCGTCGATCT GTCTGCCTCAACTGGTATTTTCTGA TTCGCCGAGATGTCCAGTC TTGACGCTCTCCACACACATG CTAGCAGAAAGCATCACAGATGTTCT GCCTTCTAGGTCCTCTACACGGA TGTCTGAAGCGCATTGGAGAT AGGGCCTTGAGCACCAGTTT
300
233
83
300
191
80
300
95
83
300
170
79
100
102
79
300
188
79
300
155
85
300
111
79
300
191
82
[C], concentrations for both primers in nM (only concentrations which showed dimer-free reactions were used for the analysis); Tm, theoretical amplicon melting temperature calculated with Primer Express software (Applied Biosystems, Foster City, CA, USA). a Gene symbols: glial fibrillary acidic protein (GFAP), cathepsin S (CTSS), prion protein (PRNP), superoxide dismutase 1 soluble (SOD1), tyrosine 3monooxygenase zeta polypeptide or 14-3-3 zeta variant (YWHAZ), caspase 3 apoptosis-related cysteine peptidase (CASP3), B-cell CLL/lymphoma 2 (BCL2), myeloid cell leukemia sequence 1 (MCL1), and BCL2-associated X protein (BAX).
90
BR AIN RE S EA RCH 1 0 73 –1 0 74 ( 20 0 6 ) 8 8 –9 2
analysis showed two stability series: one for cerebrum and obex samples with GAPDH and SDHA as the most stable genes followed by G6PD, ACTB, and RPL19 and another series for cerebellum samples with G6PD and ACTB genes at the top followed by RPL19, GAPDH, and SDHA genes. According to the geNorm analysis, while the four most stable HK genes of the cerebrum stability series were required for a correct normalization of the target genes in this tissue (GAPDH, SDHA, G6PD, and ACTB), only the three most stable HK genes of their stability series were needed for cerebellum (G6PD, ACTB, and RPL19) and obex (GAPDH, SDHA, and G6PD) samples. The normalized target gene expression results obtained are graphically represented in Fig. 1. Differences in the expression levels of GFAP, CTSS, and CASP3 genes between healthy and scrapie-affected animals were found in at least one of the three tissues analyzed (Table 2). Conversely, differences in the expression levels of PRNP, SOD1, YWHAZ, BCL2, MCL1, and BAX genes were not significant in any of the tissues (Table 2). GFAP is the major component of the astroglial intermediate filament, and it is used as a histological marker of astrocytic activation. Astrocytes have been implicated in the formation and replication of the scrapie agent (Diedrich et al., 1991; Ye et al., 1998), and the time-course and spatial distribution of astrocytic activation resemble the pattern of PrPSc depositions (Giese et al., 1998). An increase in GFAP gene expression has been reported in brain homogenates of scrapie-infected mice (Dandoy-Dron et al., 1998; Xiang et al., 2004). In fact, it has been suggested that a 2 kb regulatory region of the GFAP gene promoter has the target elements required for its activation mediated by PrPSc (Titeux et al., 2002). In the present work, a highly significant up-regulation of GFAP gene expression was
observed in cerebrum and obex samples of scrapie-affected animals (4.8-fold increase, P = 0.0022, and a 2.1-fold increase, P = 0.0069, respectively), indicating the presence of reactive astrocytes. These GFAP mRNA increments correlated with the spatial PrPSc detection by immunohistochemistry, which revealed PrPSc deposits in cerebrum and in obex but not in cerebellum (data not shown). However, other authors (Georgsson et al., 1993; Lefrancois et al., 1994) have reported an altered expression of this gene also in cerebellum of sheep with natural scrapie. Further analyses are needed to determine if these differences could be attributed to the stage of the disease, the scrapie strain, and/or the detection methods used. Cathepsin S is a glial cell lysosomal protease, which is essential for the turnover of intracellular proteins, and it is implicated in processes involving tissue destruction and remodeling. Additionally, cathepsin S has been implicated in the development of amyloid plaques (Lemere et al., 1995; Munger et al., 1995). An up-regulation in the mRNA levels of CTSS gene has been observed in animal models of scrapie and Creutzfeldt–Jakob disease (Dandoy-Dron et al., 1998; Xiang et al., 2004). The present study is the first in finding an upregulation of CTSS gene expression in obex (1.9-fold increase, P = 0.0230) in scrapie. This suggests an involvement of the proteolytic activity of this enzyme in clearing the cellular debris resulting from the neuronal cell death that takes place in scrapie. Moreover, the hypothetical modulatory role proposed for cathepsin S in the formation and persistence of β-amyloid fibrils in senile plaque disorders might also apply to scrapie. The results on GFAP and CTSS genes expression profiles obtained in this study suggest the presence of a more reactive glia in obex than in cerebrum of scrapie-affected animals.
Fig. 1 – Normalized mRNA values of the target genes from scrapie-affected (black column) and control animals (gray column). y axis represents normalized mRNA levels in arbitrary units obtained by relative quantification real-time RT-PCR analysis using the most stables HK genes within each tissue. Error bars represent standard deviation. (*) Indicates marginally significant differences P b 0.10; (**) significant differences P b 0.05; and (***) high significant differences P b 0.01 (Mann–Whitney U test).
91
BR AIN RE S EA RCH 1 0 73 –1 0 74 ( 20 0 6 ) 8 8 –9 2
Table 2 – Relative mRNA levels between control and natural scrapie-affected sheep Tissue Cerebrum Cerebellum Obex
GFAP
CTSS
PRNP
SOD1
YWHAZ
CASP3
BCL2
MCL1
BAX
↑4.8 P = 0.0022 ↑1.1 P = 0.4344 ↑2.1 P = 0.0069
↑1.3 P = 0.1179 ↑1.2 P = 0.4344 ↑1.9 P = 0.0230
↓1.2 P = 0.3198 ↑1.3 P = 0.0129 ↑1.1 P = 0.2008
↓1.3 P = 0.3556 ↑1.3 P = 0.0393 ↓1.5 P = 0.6698
↓2.0 P = 0.0550 ↑1.3 P = 0.0646 ↓1.4 P = 0.0393
↓2.6 P = 0.0069 ↑1.1 P = 0.1552 ↓1.2 P = 0.7223
↓1.3 P = 0.2387 ↑1.3 P = 0.1021 ↑1.4 P = 0.2555
↑1.2 P = 0.1029 ↑1.3 P = 0.1356 ↑1.4 P = 0.1179
↑1.1 P = 0.9433 ↓1.1 P = 0.5224 ↓1.1 P = 0.7762
Numbers indicate the average n-fold up-regulation (↑) or down-regulation (↓) between natural scrapie-affected animals and control animals. In bold are those considered physiologically significant. P values were calculated by Mann–Whitney U test.
Although the biological function of PrPc remains unclear, a neuroprotective role has been suggested (Roucou and LeBlanc, 2005). In this sense, an up-regulation of PRNP gene has been reported under injurious conditions in mice (McLennan et al., 2004) and human brain (Esiri et al., 2000). In scrapie-infected mice, whereas no alteration was found using Northern blot analysis (Dandoy-Dron et al., 1998; Lazarini et al., 1992), Li and Bolton (1997) reported an up-regulation using RT-PCR. In the present study, a small up-regulation of the PRNP gene was observed in the cerebellum of natural scrapie (1.3-fold increase, P = 0.0129). The same up-regulation was also found for SOD1 gene in cerebellum of scrapie sheep (1.3-fold increase, P = 0.0393). In fact, the main anti-oxidative role attributed to PrPc is mediated by the regulation of the activity of the antioxidant enzyme SOD1 (Brown and Besinger, 1998; Sakudo et al., 2005). The up-regulation at the transcript level of both PRNP and SOD1 genes found in cerebellum samples of scrapie animals in this study was, however, too small (1.3-fold) to clearly support a physiological significance. The family of 14-3-3 proteins comprise a group of highly conserved regulatory proteins that are involved in various cellular processes such as promoting survival against apoptosis (Dougherty and Morrison, 2004; Masters et al., 2002). Although their function in TSEs remains unknown, some 14-3-3 isoforms have been detected in the cerebral spinal fluid of humans and animals with TSEs, and they are being considered as possible markersof disease(Hsichetal.,1996;VanEverbroecketal.,2003). In the present study, only a marginal down-regulation of the 143-3 zeta coding gene (YWHAZ) occurred in cerebrum samples of scrapie-affected animals (2.0-fold decrease, P = 0.0550). Several studies have shown strong evidence supporting the idea that neurons in TSEs die mainly via apoptosis (Fairbairn et al., 1994; Giese et al., 1995). There is a complex signaling pathway which leads to cell apoptosis via pro-apoptotic stimuli like TNF, FAS, BAX, and caspase 3 or to survival via cytokines, growth factors, and anti-apoptotic genes like BCL2 and MCL1. The present work revealed an altered gene expression profile of the proapoptotic CASP3 gene in cerebrum of natural scrapie (2.6-fold down-regulation, P = 0.0069), whereas no significant differences were observed for BCL2, MCL1, and BAX genes. Many apoptotic signals converge at caspase 3 which is responsible for morphological and biochemical changes in apoptotic cell death. Although apoptotic induction by PrPSc has been shown to be dependent on caspase 3 activation (Jamieson et al., 2001), alternative pathways cannot be ruled out (Saez-Valero et al., 2000). An association between caspase 3 activation and β-amyloid fibrils formation has also been proposed (Gervais et al., 1999; Rohn et al., 2001). Additionally, caspase 3 can cause the cleavage of BCL2 and MCL1
deleting their anti-apoptotic properties and causing the release of apoptotic signals similar to BAX (Cheng et al., 1997; Weng et al., 2005). The down-regulation of CASP3 gene expression found in cerebrum samples of scrapie-affected animals could be translated into low levels of caspase 3 susceptible to be activated. In this manner, the apoptotic outcome of this pathway would be delayed probably as a neuroprotective response to the toxic effects of PrPSc. Taking these results as a whole, the differential gene expression profiles observed in the three brain areas of scrapie-affected animals studied might reflect the spatial– temporal and tissue-specific molecular pathogenesis of scrapie. Thus, while no alteration in gene expression was detected in cerebellum, glial activation was observed in cerebrum (GFAP) and in the obex (GFAP and CTSS), where neuropathological lesions were detected. In addition, the down-regulation of CASP3 detected in cerebrum would suggest a delay in apoptosis. Therefore, cerebellum might show an earlier stage of the disease as compared to cerebrum and obex. In conclusion, the results presented here provide additional information to understand the complexity of scrapie molecular pathogenesis.
Acknowledgments Financial support was provided by the Department of Education, Universities and Research (Projects PI-00-20 and EC2001-3) and Department of Agriculture, Fisheries and Food of the Basque Country Government. D. Garcia-Crespo was the recipient of a Predoctoral Fellowship from the Department of Education, Universities and Research of the Basque Government. The authors thank Dr. N. Elguezabal for helpful comments on the manuscript.
REFERENCES
Aucouturier, P., Geissmann, F., Damotte, D., Saborio, G.P., Meeker, H.C., Kascsak, R., Carp, R.I., Wisniewski, T., 2001. Infected splenic dendritic cells are sufficient for prion transmission to the CNS in mouse scrapie. J. Clin. Invest. 108 (5), 703–708. Brown, D.R., Besinger, A., 1998. Prion protein expression and superoxide dismutase activity. Biochem. J. 334 (2), 423–429. Brown, D.R., Schmidt, B., Kretzschmar, H.A., 1996. Role of microglia and host prion protein in neurotoxicity of a prion protein fragment. Nature 380 (6572), 345–347. Cheng, E.H., Kirsch, D.G., Clem, R.J., Ravi, R., Kastan, M.B., Bedi, A., Ueno, K., Hardwick, J.M., 1997. Conversion of Bcl-2 to a Bax-like death effector by caspases. Science 278 (5345), 1966–1968.
92
BR AIN RE S EA RCH 1 0 73 –1 0 74 ( 20 0 6 ) 8 8 –9 2
Dandoy-Dron, F., Guillo, F., Benboudjema, L., Deslys, J.P., Lasmezas, C., Dormont, D., Tovey, M.G., Dron, M., 1998. Gene expression in scrapie. Cloning of a new scrapieresponsive gene and the identification of increased levels of seven other mRNA transcripts. J. Biol. Chem. 273 (13), 7691–7697. Diedrich, J.F., Bendheim, P.E., Kim, Y.S., Carp, R.I., Haase, A.T., 1991. Scrapie-associated prion protein accumulates in astrocytes during scrapie infection. Proc. Natl. Acad. Sci. U. S. A. 88 (2), 375–379. Dougherty, M.K., Morrison, D.K., 2004. Unlocking the code of 14-3-3. J. Cell Sci. 117 (10), 1875–1884. Esiri, M.M., Carter, J., Ironside, J.W., 2000. Prion protein immunoreactivity in brain samples from an unselected autopsy population: findings in 200 consecutive cases. Neuropathol. Appl. Neurobiol. 26 (3), 273–284. Fairbairn, D.W., Carnahan, K.G., Thwaits, R.N., Grigsby, R.V., Holyoak, G.R., O'Neill, K.L., 1994. Detection of apoptosis induced DNA cleavage in scrapie-infected sheep brain. FEMS Microbiol. Lett. 115 (2–3), 341–346. Garcia-Crespo, D., Oporto, B., Gomez, N., Nagore, D., Benedicto, L., Juste, R.A., Hurtado, A., 2004. PrP polymorphisms in Basque sheep breeds determined by PCR-restriction fragment length polymorphism and real-time PCR. Vet. Rec. 154 (23), 717–722. Garcia-Crespo, D., Juste, R.A., Hurtado, A., 2005. Selection of ovine housekeeping genes for normalisation by real-time RT-PCR. Analysis of PrP gene expression and genetic susceptibility to scrapie. BMC Vet. Res. 1, 3. Georgsson, G., Gisladottir, E., Arnadottir, S., 1993. Quantitative assessment of the astrocytic response in natural scrapie of sheep. J. Comp. Pathol. 108 (3), 229–240. Gervais, F.G., Xu, D., Robertson, G.S., Vaillancourt, J.P., Zhu, Y., Huang, J., LeBlanc, A., Smith, D., Rigby, M., Shearman, M.S., Clarke, E.E., Zheng, H., Van Der Ploeg, L.H., Ruffolo, S.C., Thornberry, N.A., Xanthoudakis, S., Zamboni, R.J., Roy, S., Nicholson, D.W., 1999. Involvement of caspases in proteolytic cleavage of Alzheimer's amyloid-beta precursor protein and amyloidogenic A beta peptide formation. Cell 97 (3), 395–406. Giese, A., Groschup, M.H., Hess, B., Kretzschmar, H.A., 1995. Neuronal cell death in scrapie-infected mice is due to apoptosis. Brain Pathol. 5 (3), 213–221. Giese, A., Brown, D.R., Groschup, M.H., Feldmann, C., Haist, I., Kretzschmar, H.A., 1998. Role of microglia in neuronal cell death in prion disease. Brain Pathol. 8 (3), 449–457. Hsich, G., Kenney, K., Gibbs, C.J., Lee, K.H., Harrington, M.G., 1996. The 14-3-3 brain protein in cerebrospinal fluid as a marker for transmissible spongiform encephalopathies. N. Engl. J. Med. 335 (13), 924–930. Jamieson, E., Jeffrey, M., Ironside, J.W., Fraser, J.R., 2001. Activation of Fas and caspase 3 precedes PrP accumulation in 87 V scrapie. NeuroReport 12 (16), 3567–3572. Lazarini, F., Deslys, J.P., Dormont, D., 1992. Variations in prion protein and glial fibrillary acidic protein mRNAs in the brain of scrapie-infected newborn mouse. J. Gen. Virol. 73 (7), 1645–1648. Lefrancois, T., Fages, C., Brugere-Picoux, J., Tardy, M., 1994. Astroglial reactivity in natural scrapie of sheep. Microb. Pathog. 17 (5), 283–289. Lemere, C.A., Munger, J.S., Shi, G.P., Natkin, L., Haass, C., Chapman, H.A., Selkoe, D.J., 1995. The lysosomal cysteine protease, cathepsin S, is increased in Alzheimer's disease and Down syndrome brain. An immunocytochemical study. Am. J. Pathol. 146 (4), 848–860.
Li, G., Bolton, D.C., 1997. A novel hamster prion protein mRNA contains an extra exon: increased expression in scrapie. Brain Res. 751 (2), 265–274. Masters, S.C., Subramanian, R.R., Truong, A., Yang, H., Fujii, K., Zhang, H., Fu, H., 2002. Survival-promoting functions of 14-3-3 proteins. Biochem. Soc. Trans. 30 (4), 360–365. McLennan, N.F., Brennan, P.M., McNeill, A., Davies, I., Fotheringham, A., Rennison, K.A., Ritchie, D., Brannan, F., Head, M.W., Ironside, J.W., Williams, A., Bell, J.E., 2004. Prion protein accumulation and neuroprotection in hypoxic brain damage. Am. J. Pathol. 165 (1), 227–235. Munger, J.S., Haass, C., Lemere, C.A., Shi, G.P., Wong, W.S., Teplow, D.B., Selkoe, D.J., Chapman, H.A., 1995. Lysosomal processing of amyloid precursor protein to A beta peptides: a distinct role for cathepsin S. Biochem. J. 311 (1), 299–305. Park, S.K., Choi, S.I., Jin, J.K., Choi, E.K., Kim, J.I., Carp, R.I., Kim, Y.S., 2000. Differential expression of Bax and Bcl-2 in the brains of hamsters infected with 263 K scrapie agent. NeuroReport 11 (8), 1677–1682. Rohn, T.T., Head, E., Su, J.H., Anderson, A.J., Bahr, B.A., Cotman, C.W., Cribbs, D.H., 2001. Correlation between caspase activation and neurofibrillary tangle formation in Alzheimer's disease. Am. J. Pathol. 158 (1), 189–198. Roucou, X., LeBlanc, A.C., 2005. Cellular prion protein neuroprotective function: implications in prion diseases. J. Mol. Med. 83 (1), 3–11. Saez-Valero, J., Angeretti, N., Forloni, G., 2000. Caspase-3 activation by beta-amyloid and prion protein peptides is independent from their neurotoxic effect. Neurosci. Lett. 293 (3), 207–210. Sakudo, A., Lee, D.C., Nishimura, T., Li, S., Tsuji, S., Nakamura, T., Matsumoto, Y., Saeki, K., Itohara, S., Ikuta, K., Onodera, T., 2005. Octapeptide repeat region and N-terminal half of hydrophobic region of prion protein (PrP) mediate PrP-dependent activation of superoxide dismutase. Biochem. Biophys. Res. Commun. 326 (3), 600–606. Titeux, M., Galou, M., Gomes, F.C., Dormont, D., Neto, V.M., Paulin, D., 2002. Differences in the activation of the GFAP gene promoter by prion and viral infections. Brain Res. Mol. Brain Res. 109 (1–2), 119–127. Vandesompele, J., De Preter, K., Pattyn, F., Poppe, B., Van Roy, N., De Paepe, A., Speleman, F., 2002. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 3 (7), research0034.1–research0034.11. Van Everbroeck, B., Quoilin, S., Boons, J., Martin, J.J., Cras, P., 2003. A prospective study of CSF markers in 250 patients with possible Creutzfeldt–Jakob disease. J. Neurol. Neurosurg. Psychiatry 74 (9), 1210–1214. van Keulen, L.J., Schreuder, B.E., Meloen, R.H., Mooij-Harkes, G., Vromans, M.E., Langeveld, J.P., 1996. Immunohistochemical detection of prion protein in lymphoid tissues of sheep with natural scrapie. J. Clin. Microbiol. 34 (5), 1228–1231. Weng, C., Li, Y., Xu, D., Shi, Y., Tang, H., 2005. Specific cleavage of MCL-1 by caspase-3 in trail-induced apoptosis in jurkat leukemia T cells. J. Biol. Chem. 280 (5), 10490–10500. Xiang, W., Windl, O., Wunsch, G., Dugas, M., Kohlmann, A., Dierkes, N., Westner, I.M., Kretzschmar, H.A., 2004. Identification of differentially expressed genes in scrapie-infected mouse brains by using global gene expression technology. J. Virol. 78 (20), 11051–11060. Ye, X., Scallet, A.C., Kascsak, R.J., Carp, R.I., 1998. Astrocytosis and amyloid deposition in scrapie-infected hamsters. Brain Res. 809 (2), 277–287.
a v a i l a b l e a t w w w. s c i e n c e d i r e c t . c o m
w w w. e l s e v i e r. c o m / l o c a t e / b r a i n r e s
Short Communication
Differential gene expression in central nervous system tissues of sheep with natural scrapie David Garcia-Crespo, Ramón A. Juste, Ana Hurtado ⁎ Department of Animal Health, Instituto Vasco de Investigación y Desarrollo Agrario (NEIKER); Berreaga, 1. 48160 Derio, Bizkaia, Spain
A R T I C LE I N FO
AB S T R A C T
Article history:
The expression of nine genes was analyzed by real-time RT-PCR in the central nervous
Accepted 11 December 2005
system in order to investigate the molecular pathogenesis of natural scrapie. An upregulation of genes related to glial activation (GFAP) and apoptosis (CASP3) was detected in obex and cerebrum, indicating a reactive glia. Another glial activation-related gene (CTSS)
Keywords:
was slightly up-regulated in obex, whereas constitutive expression was detected for SOD1,
Scrapie
YWHAZ, PRNP, and the apoptosis-related genes BCL2, MCL1, and BAX. This differential gene
Glia
expression might reflect a spatial–temporal and tissue-specific molecular pathogenesis of
Apoptosis
scrapie.
Gene expression
© 2005 Elsevier B.V. All rights reserved.
Sheep Prion Abbreviations: Ct, threshold cycle HK, housekeeping Q, raw quantity value for gene expression
Scrapie is a transmissible spongiform encephalopathy (TSE) which occurs in sheep and goats. Like in all TSEs, the hostencoded cellular prion protein (PrPc) suffers a structural modification to become the pathological protease-resistant prion protein (PrPSc), which accumulates mainly in the central nervous system (CNS) forming characteristic insoluble amyloid deposits (Aucouturier et al., 2001; van Keulen et al., 1996). PrPc neuronal expression is therefore necessary for the infection and the spreading of the agent (Brown et al., 1996). The hypothesis that recognizes PrPSc as the only transmissible agent is generally accepted, and susceptibility to scrapie is thought to be associated to several prion protein gene (PRNP) polymorphisms. However, the pathogenesis of scrapie is still
not completely understood. Neuropathological events of TSEs include glial activation, progressive vacuolation of the neuropil, and neuronal degeneration with eventual neuronal loss. Several studies based on experimentally infected animal models have detected up to 121 up-regulated genes (DandoyDron et al., 1998; Xiang et al., 2004), including genes involved in astrocytosis and microglial activation like glial fibrillary acidic protein (GFAP) or cathepsin S (CTSS), and indicators of cellular stress and homeostasis maintenance genes like superoxide dismutase 1 (SOD1). Additionally, the 14-3-3 protein family is being studied as a biomarker of prion diseases since it is differentially detected in cerebral spinal fluid of Creutzfeldt– Jakob-disease-affected patients (Hsich et al., 1996; Van
⁎ Corresponding author. Fax: +34 902540547. E-mail address: [email protected] (A. Hurtado). 0006-8993/$ – see front matter © 2005 Elsevier B.V. All rights reserved. doi:10.1016/j.brainres.2005.12.068
89
BR AIN RE S EA RCH 1 0 73 –1 0 74 ( 20 0 6 ) 8 8 –9 2
Everbroeck et al., 2003). In addition, since apoptosis is the main neuronal death mechanism in TSEs (Fairbairn et al., 1994; Giese et al., 1995), an alteration in the expression of apoptosis-related genes like BCL2, BAX, or CASP3 has been reported in scrapie-infected mice (Park et al., 2000). Although there are many studies in gene expression of experimentally scrapie-infected animal models, few studies on natural scrapie are available. Therefore, the expression of eight genes associated with glial activation, homeostasis maintenance, and apoptosis, as well as the PRNP gene, has been studied in three relevant brain areas of sheep with natural scrapie and healthy animals using real-time RT-PCR technology and relative quantification. Four Latxa ewes from a natural outbreak showing similar clinical signs of late stage scrapie and 22 healthy sheep from flocks with no record of scrapie were included in the study. The age of the animals ranged from 3 to 12 years old. The presence of PrPSc was tested in a sample of obex with the Platelia®BSE kit (Bio-Rad, Hercules, CA, USA), and only the four clinical cases were confirmed as positive. PRNP genotyping performed as previously described (Garcia-Crespo et al., 2004) identified the ARQ/ARQ genotype in the four animals with scrapie and a variety of genotypes in the control animals (Garcia-Crespo et al., 2005). A sample from the same region of cerebrum (neocortex), cerebellum, and obex was aseptically taken from each animal and frozen immediately at −80 °C. RNA extraction and cDNA synthesis were performed as previously described (Garcia-Crespo et al., 2005). The same batch of diluted cDNA was used for all real-time PCR amplifications. Five housekeeping (HK) or endogenous genes (ACTB, GAPDH, RPL19, SDHA, and G6PD) were evaluated for the normalization of the expression of 9 target genes (GFAP, CTSS, PRNP, SOD1, YWHAZ, CASP3, BCL2, MCL1, and BAX). The
sequences of the primers used to amplify the target genes are shown in Table 1, whereas those for the HK genes were described elsewhere (Garcia-Crespo et al., 2005). PCR reactions were performed in triplicate using the conditions previously reported (Garcia-Crespo et al., 2005). For each experiment, a non-template reaction was included as negative control. The specificity of the PCR reactions was assessed by the analysis of the melting curves of the products and size verification and sequencing of the amplicons. The threshold cycle values (Ct) were determined at the same fluorescence threshold line for each gene, and each sample Ct value was calculated by the arithmetic mean of the triplicate values. Ct values were transformed into raw quantity values (Q) according to the equation Q = 2 (Min Ct − Sample Ct), where “Min Ct” is the minimum Ct value for the samples analyzed, and assuming an amplification efficiency of 100%. The assessment of the HK genes stability and the selection of the best reference genes, as well as the normalization, were carried out using the method described by Vandesompele et al. (2002) and the MS Excel application geNorm 3.3. Prior to the analysis of the target genes expression values, a general linear model (GLM) analysis (SAS institute, Cary, NC, USA) was performed to rule out the effect of the age in the gene expression (P N 0.05). The effect of the health status on the expression of the HK genes was also assessed in a similar manner (P N 0.05). Finally, statistical differences between control and scrapie-affected groups were calculated by Mann– Whitney U test using SAS statistical package version 8 (SAS Institute). The analysis of the stability of the five HK genes in the 26 animals using geNorm 3.3 (Vandesompele et al., 2002) indicated the impossibility of using a common set of HK genes for the normalization and the comparison of gene expression in the three tissues. The expression stability
Table 1 – Primers sequences and amplicon parameters Gene a GFAP CTSS PRNP SOD1 YWHAZ CASP3 BCL2 MCL1 BAX
Forward and reverse primers 5′ → 3′
[C]
Amplicon size (bp)
Tm (°C)
TGCCTATCGACAGGAAGCAGAT TGGACGCCACTGCCTCATA AAAGAAGCCGTGGCCAATAAA AGGCCCCAGCTGTTTTTCA GCCAAAAACCAACATGAAGCAT TGCTCATGGCACTTCCCAG GATGAAGAGAGGCATGTTGGAGA TCATTTCCACCTCTGCCCAA TGTAGGAGCCCGTAGGTCATCT TTCTCTCTGTATTCTCGAGCCATCT CCAATGGACCCGTCGATCT GTCTGCCTCAACTGGTATTTTCTGA TTCGCCGAGATGTCCAGTC TTGACGCTCTCCACACACATG CTAGCAGAAAGCATCACAGATGTTCT GCCTTCTAGGTCCTCTACACGGA TGTCTGAAGCGCATTGGAGAT AGGGCCTTGAGCACCAGTTT
300
233
83
300
191
80
300
95
83
300
170
79
100
102
79
300
188
79
300
155
85
300
111
79
300
191
82
[C], concentrations for both primers in nM (only concentrations which showed dimer-free reactions were used for the analysis); Tm, theoretical amplicon melting temperature calculated with Primer Express software (Applied Biosystems, Foster City, CA, USA). a Gene symbols: glial fibrillary acidic protein (GFAP), cathepsin S (CTSS), prion protein (PRNP), superoxide dismutase 1 soluble (SOD1), tyrosine 3monooxygenase zeta polypeptide or 14-3-3 zeta variant (YWHAZ), caspase 3 apoptosis-related cysteine peptidase (CASP3), B-cell CLL/lymphoma 2 (BCL2), myeloid cell leukemia sequence 1 (MCL1), and BCL2-associated X protein (BAX).
90
BR AIN RE S EA RCH 1 0 73 –1 0 74 ( 20 0 6 ) 8 8 –9 2
analysis showed two stability series: one for cerebrum and obex samples with GAPDH and SDHA as the most stable genes followed by G6PD, ACTB, and RPL19 and another series for cerebellum samples with G6PD and ACTB genes at the top followed by RPL19, GAPDH, and SDHA genes. According to the geNorm analysis, while the four most stable HK genes of the cerebrum stability series were required for a correct normalization of the target genes in this tissue (GAPDH, SDHA, G6PD, and ACTB), only the three most stable HK genes of their stability series were needed for cerebellum (G6PD, ACTB, and RPL19) and obex (GAPDH, SDHA, and G6PD) samples. The normalized target gene expression results obtained are graphically represented in Fig. 1. Differences in the expression levels of GFAP, CTSS, and CASP3 genes between healthy and scrapie-affected animals were found in at least one of the three tissues analyzed (Table 2). Conversely, differences in the expression levels of PRNP, SOD1, YWHAZ, BCL2, MCL1, and BAX genes were not significant in any of the tissues (Table 2). GFAP is the major component of the astroglial intermediate filament, and it is used as a histological marker of astrocytic activation. Astrocytes have been implicated in the formation and replication of the scrapie agent (Diedrich et al., 1991; Ye et al., 1998), and the time-course and spatial distribution of astrocytic activation resemble the pattern of PrPSc depositions (Giese et al., 1998). An increase in GFAP gene expression has been reported in brain homogenates of scrapie-infected mice (Dandoy-Dron et al., 1998; Xiang et al., 2004). In fact, it has been suggested that a 2 kb regulatory region of the GFAP gene promoter has the target elements required for its activation mediated by PrPSc (Titeux et al., 2002). In the present work, a highly significant up-regulation of GFAP gene expression was
observed in cerebrum and obex samples of scrapie-affected animals (4.8-fold increase, P = 0.0022, and a 2.1-fold increase, P = 0.0069, respectively), indicating the presence of reactive astrocytes. These GFAP mRNA increments correlated with the spatial PrPSc detection by immunohistochemistry, which revealed PrPSc deposits in cerebrum and in obex but not in cerebellum (data not shown). However, other authors (Georgsson et al., 1993; Lefrancois et al., 1994) have reported an altered expression of this gene also in cerebellum of sheep with natural scrapie. Further analyses are needed to determine if these differences could be attributed to the stage of the disease, the scrapie strain, and/or the detection methods used. Cathepsin S is a glial cell lysosomal protease, which is essential for the turnover of intracellular proteins, and it is implicated in processes involving tissue destruction and remodeling. Additionally, cathepsin S has been implicated in the development of amyloid plaques (Lemere et al., 1995; Munger et al., 1995). An up-regulation in the mRNA levels of CTSS gene has been observed in animal models of scrapie and Creutzfeldt–Jakob disease (Dandoy-Dron et al., 1998; Xiang et al., 2004). The present study is the first in finding an upregulation of CTSS gene expression in obex (1.9-fold increase, P = 0.0230) in scrapie. This suggests an involvement of the proteolytic activity of this enzyme in clearing the cellular debris resulting from the neuronal cell death that takes place in scrapie. Moreover, the hypothetical modulatory role proposed for cathepsin S in the formation and persistence of β-amyloid fibrils in senile plaque disorders might also apply to scrapie. The results on GFAP and CTSS genes expression profiles obtained in this study suggest the presence of a more reactive glia in obex than in cerebrum of scrapie-affected animals.
Fig. 1 – Normalized mRNA values of the target genes from scrapie-affected (black column) and control animals (gray column). y axis represents normalized mRNA levels in arbitrary units obtained by relative quantification real-time RT-PCR analysis using the most stables HK genes within each tissue. Error bars represent standard deviation. (*) Indicates marginally significant differences P b 0.10; (**) significant differences P b 0.05; and (***) high significant differences P b 0.01 (Mann–Whitney U test).
91
BR AIN RE S EA RCH 1 0 73 –1 0 74 ( 20 0 6 ) 8 8 –9 2
Table 2 – Relative mRNA levels between control and natural scrapie-affected sheep Tissue Cerebrum Cerebellum Obex
GFAP
CTSS
PRNP
SOD1
YWHAZ
CASP3
BCL2
MCL1
BAX
↑4.8 P = 0.0022 ↑1.1 P = 0.4344 ↑2.1 P = 0.0069
↑1.3 P = 0.1179 ↑1.2 P = 0.4344 ↑1.9 P = 0.0230
↓1.2 P = 0.3198 ↑1.3 P = 0.0129 ↑1.1 P = 0.2008
↓1.3 P = 0.3556 ↑1.3 P = 0.0393 ↓1.5 P = 0.6698
↓2.0 P = 0.0550 ↑1.3 P = 0.0646 ↓1.4 P = 0.0393
↓2.6 P = 0.0069 ↑1.1 P = 0.1552 ↓1.2 P = 0.7223
↓1.3 P = 0.2387 ↑1.3 P = 0.1021 ↑1.4 P = 0.2555
↑1.2 P = 0.1029 ↑1.3 P = 0.1356 ↑1.4 P = 0.1179
↑1.1 P = 0.9433 ↓1.1 P = 0.5224 ↓1.1 P = 0.7762
Numbers indicate the average n-fold up-regulation (↑) or down-regulation (↓) between natural scrapie-affected animals and control animals. In bold are those considered physiologically significant. P values were calculated by Mann–Whitney U test.
Although the biological function of PrPc remains unclear, a neuroprotective role has been suggested (Roucou and LeBlanc, 2005). In this sense, an up-regulation of PRNP gene has been reported under injurious conditions in mice (McLennan et al., 2004) and human brain (Esiri et al., 2000). In scrapie-infected mice, whereas no alteration was found using Northern blot analysis (Dandoy-Dron et al., 1998; Lazarini et al., 1992), Li and Bolton (1997) reported an up-regulation using RT-PCR. In the present study, a small up-regulation of the PRNP gene was observed in the cerebellum of natural scrapie (1.3-fold increase, P = 0.0129). The same up-regulation was also found for SOD1 gene in cerebellum of scrapie sheep (1.3-fold increase, P = 0.0393). In fact, the main anti-oxidative role attributed to PrPc is mediated by the regulation of the activity of the antioxidant enzyme SOD1 (Brown and Besinger, 1998; Sakudo et al., 2005). The up-regulation at the transcript level of both PRNP and SOD1 genes found in cerebellum samples of scrapie animals in this study was, however, too small (1.3-fold) to clearly support a physiological significance. The family of 14-3-3 proteins comprise a group of highly conserved regulatory proteins that are involved in various cellular processes such as promoting survival against apoptosis (Dougherty and Morrison, 2004; Masters et al., 2002). Although their function in TSEs remains unknown, some 14-3-3 isoforms have been detected in the cerebral spinal fluid of humans and animals with TSEs, and they are being considered as possible markersof disease(Hsichetal.,1996;VanEverbroecketal.,2003). In the present study, only a marginal down-regulation of the 143-3 zeta coding gene (YWHAZ) occurred in cerebrum samples of scrapie-affected animals (2.0-fold decrease, P = 0.0550). Several studies have shown strong evidence supporting the idea that neurons in TSEs die mainly via apoptosis (Fairbairn et al., 1994; Giese et al., 1995). There is a complex signaling pathway which leads to cell apoptosis via pro-apoptotic stimuli like TNF, FAS, BAX, and caspase 3 or to survival via cytokines, growth factors, and anti-apoptotic genes like BCL2 and MCL1. The present work revealed an altered gene expression profile of the proapoptotic CASP3 gene in cerebrum of natural scrapie (2.6-fold down-regulation, P = 0.0069), whereas no significant differences were observed for BCL2, MCL1, and BAX genes. Many apoptotic signals converge at caspase 3 which is responsible for morphological and biochemical changes in apoptotic cell death. Although apoptotic induction by PrPSc has been shown to be dependent on caspase 3 activation (Jamieson et al., 2001), alternative pathways cannot be ruled out (Saez-Valero et al., 2000). An association between caspase 3 activation and β-amyloid fibrils formation has also been proposed (Gervais et al., 1999; Rohn et al., 2001). Additionally, caspase 3 can cause the cleavage of BCL2 and MCL1
deleting their anti-apoptotic properties and causing the release of apoptotic signals similar to BAX (Cheng et al., 1997; Weng et al., 2005). The down-regulation of CASP3 gene expression found in cerebrum samples of scrapie-affected animals could be translated into low levels of caspase 3 susceptible to be activated. In this manner, the apoptotic outcome of this pathway would be delayed probably as a neuroprotective response to the toxic effects of PrPSc. Taking these results as a whole, the differential gene expression profiles observed in the three brain areas of scrapie-affected animals studied might reflect the spatial– temporal and tissue-specific molecular pathogenesis of scrapie. Thus, while no alteration in gene expression was detected in cerebellum, glial activation was observed in cerebrum (GFAP) and in the obex (GFAP and CTSS), where neuropathological lesions were detected. In addition, the down-regulation of CASP3 detected in cerebrum would suggest a delay in apoptosis. Therefore, cerebellum might show an earlier stage of the disease as compared to cerebrum and obex. In conclusion, the results presented here provide additional information to understand the complexity of scrapie molecular pathogenesis.
Acknowledgments Financial support was provided by the Department of Education, Universities and Research (Projects PI-00-20 and EC2001-3) and Department of Agriculture, Fisheries and Food of the Basque Country Government. D. Garcia-Crespo was the recipient of a Predoctoral Fellowship from the Department of Education, Universities and Research of the Basque Government. The authors thank Dr. N. Elguezabal for helpful comments on the manuscript.
REFERENCES
Aucouturier, P., Geissmann, F., Damotte, D., Saborio, G.P., Meeker, H.C., Kascsak, R., Carp, R.I., Wisniewski, T., 2001. Infected splenic dendritic cells are sufficient for prion transmission to the CNS in mouse scrapie. J. Clin. Invest. 108 (5), 703–708. Brown, D.R., Besinger, A., 1998. Prion protein expression and superoxide dismutase activity. Biochem. J. 334 (2), 423–429. Brown, D.R., Schmidt, B., Kretzschmar, H.A., 1996. Role of microglia and host prion protein in neurotoxicity of a prion protein fragment. Nature 380 (6572), 345–347. Cheng, E.H., Kirsch, D.G., Clem, R.J., Ravi, R., Kastan, M.B., Bedi, A., Ueno, K., Hardwick, J.M., 1997. Conversion of Bcl-2 to a Bax-like death effector by caspases. Science 278 (5345), 1966–1968.
92
BR AIN RE S EA RCH 1 0 73 –1 0 74 ( 20 0 6 ) 8 8 –9 2
Dandoy-Dron, F., Guillo, F., Benboudjema, L., Deslys, J.P., Lasmezas, C., Dormont, D., Tovey, M.G., Dron, M., 1998. Gene expression in scrapie. Cloning of a new scrapieresponsive gene and the identification of increased levels of seven other mRNA transcripts. J. Biol. Chem. 273 (13), 7691–7697. Diedrich, J.F., Bendheim, P.E., Kim, Y.S., Carp, R.I., Haase, A.T., 1991. Scrapie-associated prion protein accumulates in astrocytes during scrapie infection. Proc. Natl. Acad. Sci. U. S. A. 88 (2), 375–379. Dougherty, M.K., Morrison, D.K., 2004. Unlocking the code of 14-3-3. J. Cell Sci. 117 (10), 1875–1884. Esiri, M.M., Carter, J., Ironside, J.W., 2000. Prion protein immunoreactivity in brain samples from an unselected autopsy population: findings in 200 consecutive cases. Neuropathol. Appl. Neurobiol. 26 (3), 273–284. Fairbairn, D.W., Carnahan, K.G., Thwaits, R.N., Grigsby, R.V., Holyoak, G.R., O'Neill, K.L., 1994. Detection of apoptosis induced DNA cleavage in scrapie-infected sheep brain. FEMS Microbiol. Lett. 115 (2–3), 341–346. Garcia-Crespo, D., Oporto, B., Gomez, N., Nagore, D., Benedicto, L., Juste, R.A., Hurtado, A., 2004. PrP polymorphisms in Basque sheep breeds determined by PCR-restriction fragment length polymorphism and real-time PCR. Vet. Rec. 154 (23), 717–722. Garcia-Crespo, D., Juste, R.A., Hurtado, A., 2005. Selection of ovine housekeeping genes for normalisation by real-time RT-PCR. Analysis of PrP gene expression and genetic susceptibility to scrapie. BMC Vet. Res. 1, 3. Georgsson, G., Gisladottir, E., Arnadottir, S., 1993. Quantitative assessment of the astrocytic response in natural scrapie of sheep. J. Comp. Pathol. 108 (3), 229–240. Gervais, F.G., Xu, D., Robertson, G.S., Vaillancourt, J.P., Zhu, Y., Huang, J., LeBlanc, A., Smith, D., Rigby, M., Shearman, M.S., Clarke, E.E., Zheng, H., Van Der Ploeg, L.H., Ruffolo, S.C., Thornberry, N.A., Xanthoudakis, S., Zamboni, R.J., Roy, S., Nicholson, D.W., 1999. Involvement of caspases in proteolytic cleavage of Alzheimer's amyloid-beta precursor protein and amyloidogenic A beta peptide formation. Cell 97 (3), 395–406. Giese, A., Groschup, M.H., Hess, B., Kretzschmar, H.A., 1995. Neuronal cell death in scrapie-infected mice is due to apoptosis. Brain Pathol. 5 (3), 213–221. Giese, A., Brown, D.R., Groschup, M.H., Feldmann, C., Haist, I., Kretzschmar, H.A., 1998. Role of microglia in neuronal cell death in prion disease. Brain Pathol. 8 (3), 449–457. Hsich, G., Kenney, K., Gibbs, C.J., Lee, K.H., Harrington, M.G., 1996. The 14-3-3 brain protein in cerebrospinal fluid as a marker for transmissible spongiform encephalopathies. N. Engl. J. Med. 335 (13), 924–930. Jamieson, E., Jeffrey, M., Ironside, J.W., Fraser, J.R., 2001. Activation of Fas and caspase 3 precedes PrP accumulation in 87 V scrapie. NeuroReport 12 (16), 3567–3572. Lazarini, F., Deslys, J.P., Dormont, D., 1992. Variations in prion protein and glial fibrillary acidic protein mRNAs in the brain of scrapie-infected newborn mouse. J. Gen. Virol. 73 (7), 1645–1648. Lefrancois, T., Fages, C., Brugere-Picoux, J., Tardy, M., 1994. Astroglial reactivity in natural scrapie of sheep. Microb. Pathog. 17 (5), 283–289. Lemere, C.A., Munger, J.S., Shi, G.P., Natkin, L., Haass, C., Chapman, H.A., Selkoe, D.J., 1995. The lysosomal cysteine protease, cathepsin S, is increased in Alzheimer's disease and Down syndrome brain. An immunocytochemical study. Am. J. Pathol. 146 (4), 848–860.
Li, G., Bolton, D.C., 1997. A novel hamster prion protein mRNA contains an extra exon: increased expression in scrapie. Brain Res. 751 (2), 265–274. Masters, S.C., Subramanian, R.R., Truong, A., Yang, H., Fujii, K., Zhang, H., Fu, H., 2002. Survival-promoting functions of 14-3-3 proteins. Biochem. Soc. Trans. 30 (4), 360–365. McLennan, N.F., Brennan, P.M., McNeill, A., Davies, I., Fotheringham, A., Rennison, K.A., Ritchie, D., Brannan, F., Head, M.W., Ironside, J.W., Williams, A., Bell, J.E., 2004. Prion protein accumulation and neuroprotection in hypoxic brain damage. Am. J. Pathol. 165 (1), 227–235. Munger, J.S., Haass, C., Lemere, C.A., Shi, G.P., Wong, W.S., Teplow, D.B., Selkoe, D.J., Chapman, H.A., 1995. Lysosomal processing of amyloid precursor protein to A beta peptides: a distinct role for cathepsin S. Biochem. J. 311 (1), 299–305. Park, S.K., Choi, S.I., Jin, J.K., Choi, E.K., Kim, J.I., Carp, R.I., Kim, Y.S., 2000. Differential expression of Bax and Bcl-2 in the brains of hamsters infected with 263 K scrapie agent. NeuroReport 11 (8), 1677–1682. Rohn, T.T., Head, E., Su, J.H., Anderson, A.J., Bahr, B.A., Cotman, C.W., Cribbs, D.H., 2001. Correlation between caspase activation and neurofibrillary tangle formation in Alzheimer's disease. Am. J. Pathol. 158 (1), 189–198. Roucou, X., LeBlanc, A.C., 2005. Cellular prion protein neuroprotective function: implications in prion diseases. J. Mol. Med. 83 (1), 3–11. Saez-Valero, J., Angeretti, N., Forloni, G., 2000. Caspase-3 activation by beta-amyloid and prion protein peptides is independent from their neurotoxic effect. Neurosci. Lett. 293 (3), 207–210. Sakudo, A., Lee, D.C., Nishimura, T., Li, S., Tsuji, S., Nakamura, T., Matsumoto, Y., Saeki, K., Itohara, S., Ikuta, K., Onodera, T., 2005. Octapeptide repeat region and N-terminal half of hydrophobic region of prion protein (PrP) mediate PrP-dependent activation of superoxide dismutase. Biochem. Biophys. Res. Commun. 326 (3), 600–606. Titeux, M., Galou, M., Gomes, F.C., Dormont, D., Neto, V.M., Paulin, D., 2002. Differences in the activation of the GFAP gene promoter by prion and viral infections. Brain Res. Mol. Brain Res. 109 (1–2), 119–127. Vandesompele, J., De Preter, K., Pattyn, F., Poppe, B., Van Roy, N., De Paepe, A., Speleman, F., 2002. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 3 (7), research0034.1–research0034.11. Van Everbroeck, B., Quoilin, S., Boons, J., Martin, J.J., Cras, P., 2003. A prospective study of CSF markers in 250 patients with possible Creutzfeldt–Jakob disease. J. Neurol. Neurosurg. Psychiatry 74 (9), 1210–1214. van Keulen, L.J., Schreuder, B.E., Meloen, R.H., Mooij-Harkes, G., Vromans, M.E., Langeveld, J.P., 1996. Immunohistochemical detection of prion protein in lymphoid tissues of sheep with natural scrapie. J. Clin. Microbiol. 34 (5), 1228–1231. Weng, C., Li, Y., Xu, D., Shi, Y., Tang, H., 2005. Specific cleavage of MCL-1 by caspase-3 in trail-induced apoptosis in jurkat leukemia T cells. J. Biol. Chem. 280 (5), 10490–10500. Xiang, W., Windl, O., Wunsch, G., Dugas, M., Kohlmann, A., Dierkes, N., Westner, I.M., Kretzschmar, H.A., 2004. Identification of differentially expressed genes in scrapie-infected mouse brains by using global gene expression technology. J. Virol. 78 (20), 11051–11060. Ye, X., Scallet, A.C., Kascsak, R.J., Carp, R.I., 1998. Astrocytosis and amyloid deposition in scrapie-infected hamsters. Brain Res. 809 (2), 277–287.