- Email: [email protected]
Differential gene expression of tropical pumpkin (Cucurbita moschata Duchesne) bush mutant during internode development
Scientia Horticulturae 117 (2008) 219–224
Contents lists available at ScienceDirect
Scientia Horticulturae journal homepage: www.elsevier.com/locate/scihorti
Differential gene expression of tropical pumpkin (Cucurbita moschata Duchesne) bush mutant during internode development Tao Wu, Jiashu Cao * Institute of Vegetable Science, Zhejiang University, 268 Kaixuan Road, Hangzhou 310029, China
A R T I C L E I N F O
A B S T R A C T
Article history: Received 29 October 2007 Received in revised form 23 March 2008 Accepted 2 April 2008
This report described the identification of differentially expressed genes during internode development of a near-isogenic bush mutant of Cucurbita moschata Duchesne (C. moschata) derived from a cultivar of ‘Cga’ using cDNA-amplified fragment length polymorphism (cDNA-AFLP) technique. Seventy transcriptderived fragments (TDFs) were identified. Fifty-eight TDFs have been successfully sequenced and identified. BLAST searching revealed that 30 TDFs were highly homologous to genes with known function. Among them are genes involved in metabolism and energy, stress and defense, cell wall biosynthesis or modification, as well as genes encoding transcription factor and signal transduction. Four of these sequences have been shown to be differentially expressed between bush and vine plants of C. moschata as well as different tissues using reverse transcriptase-PCR (RT-PCR) analysis. Complete cosegregation of the RT-PCR product with the appropriate phenotype also suggested that the four TDFs were bush related genes in C. moschata. Overall, the study’s findings will provide some insights into genetic and molecular understanding of the bush phenotype in C. moschata. This in turn could provide some insight into the regulation of plant stature in horticultural plants. ß 2008 Elsevier B.V. All rights reserved.
Keywords: Cell elongation CDNA-AFLP Near-isogenic lines Transcript-derived fragment (TDF)
1. Introduction Tropical pumpkin is one of the most important vegetables in traditional agricultural systems in the world. The most important use of pumpkin in consumption is mature vegetable fruit. This crop contributes to nutrition though an abundant supply of minerals, vitamin C and especially b-carotene (Gwanama et al., 2001). In order to obtain fruit with best quality and production, it is hypothesized that all potential factors should be investigated. One factor that is critical for pumpkin study is vine length. Plants of Cucurbita traditionally have trailing vines that may spread up to 15 m from the crown of the plants (Maynard et al., 2002), thereby requiring wide planting distances. Some plants of the developed cultivars have short vines, which give them a bushy appearance (Shifriss, 1947; Denna and Munger, 1963; Edelstein et al., 1989; Maynard et al., 2002; Wu et al., 2007). Plants with bush habit permit higher plant populations, easier cultivation, and a more concentrated maturity, which facilitates production (Maynard et al., 2002). The bush genotype was also reported to have a higher harvest index than the vine genotype (Chesney et al., 2004). So, an investigation of the internode gene expression of bush mutant in C.
* Corresponding author. Tel.: +86 571 86971188; fax: +86 571 86971188. E-mail address: [email protected] (J. Cao). 0304-4238/$ – see front matter ß 2008 Elsevier B.V. All rights reserved. doi:10.1016/j.scienta.2008.04.002
moschata may provide insight into the regulation of plant stature in horticultural plants. Plant growth is accomplished by orderly cell division and tightly regulated cell expansion. Coordinate control of plant growth is regulated by both external stimuli and internal mechanisms. The internal components of plant signaling are generally mediated by chemical growth regulators (Klee and Estelle, 1991). Mutants defective in their response to various hormones are often dwarfs. Many dwarf mutants in hormone biosynthesis and signaling have been identified (Hentrich et al., 1985; Noguchi et al., 1999; Symons et al., 2002). This has been particularly so for the Gibberellins (GAs) (Nadhzimov et al., 1988), auxin (IAA) (Symons et al., 2002) and brassinosteroids (BR) (Noguchi et al., 1999). GAs, IAA and BR are plant growth regulators controlling cell and plant size, and mutations impairing their biosynthesis or sensitivity result in dwarfism (Lanahan and Ho, 1988; Nadhzimov et al., 1988; Sponsel et al., 1997; Fukuta et al., 2004). Azpiroz et al. (1998) described an Arabidopsis BR-dependent dwarf mutant, dwf4, which is blocked in cell elongation. Plant cell elongation is a fundamental process of plant tissue development. Many researchers have proposed that cell elongation requires relaxation of the rigid primary cell wall (Cosgrove, 1993; Roberts, 1994). Several mechanisms for defining cell wall relaxation have been proposed including the involvement of xyloglucan endotransglycosylase (Fry et al., 1992) and expansins
220
T. Wu, J. Cao / Scientia Horticulturae 117 (2008) 219–224
(McQueen-Mason et al., 1992). Transgenic Arabidopsis thaliana plants over-expressing poplar EGase were reported to have enhanced growth rate, larger leaves, larger cells, increased biomass, and increased in cellulose content per plant (Park et al., 2003). Transgenic aspen plants over-expressing a a-expansin PttEXPA1 exhibited increased stem internode elongation and leaf expansion, and larger cell sizes in the leaf epidermis (GrayMitsumune et al., 2008). Recently, various techniques for the large-scale analysis of gene expression have been used to elucidate the mechanism of plant development. Gene chips and microarray technologies are the most powerful tools for studying the whole genome transcription (Volokhov et al., 2003; Lee et al., 2007). However, these techniques rely on the prior knowledge of the sequence of genes to be investigated. Despite being a relatively laborious technique and yielding relatively short cDNA fragments, the cDNA-AFLP is a sensitive and reproducible technique that dose not require any prior knowledge of gene sequences and enables the identification of novel genes (Bachem et al., 1996; Ditt et al., 2001). Now, it has been performed on various plant species (Oomen et al., 2003; Yang et al., 2003; Wang et al., 2005). In a related study, Wu et al. (2007) selected a bush-type plant from tropical pumpkin (C. moschata). Shorter internodes, earlier flowering, a higher ratio of female to male flowers, and smaller fruit than vine plants characterized the bush plant. Genetic analysis indicated that the bush plants have a monogenic inheritance in which the bush genotype is dominant (Bu) to the vine genotype (bu). Furthermore, the results of Wu et al. (2007) revealed that the bushy appearance was the result of inhibition of cell elongation. Therefore, the aim of this study was to identify patterns of gene expression in internode related to vine elongation in a near-isogenic line of C. moschata bush mutant using cDNAAFLP technology. This knowledge on differentially regulated gene expression may help to elucidate the molecular alterations associated with the observed morphological and physiological differences between bush and vine phenotype in C. moschata. 2. Materials and methods 2.1. Plant material The near-isogenic line (five backcross generations) of C. moschata bush plants was used in this study. The near-isogenic line of C. moschata segregated approximately one bush: one vine plant. The seedlings of the bush and vine plants could be distinguished at the third leaf stage. Bush plants had short internodes, short vine and small number of internode compared with vine plants. Vine plants produced more male flowers (21.1 4.3) than bush plants (13.7 3.3). In contrast, bush plants flowered 8 days earlier than vine plants. Although bush plants had a higher rate of fruit abortion than vine plants, they had a larger total number of fruit than vine plants in a plant basis (Wu et al., 2007). Seeds were sown in a field nursery on the research farm of the Institute of Vegetable Science at Zhejiang University on 16 March 2006. At the third leaf stage, the 1st internodes of two genotypes were collected and frozen immediately in liquid nitrogen for cDNA-AFLP analysis. For tissue specific RT-PCR analysis, cotyledons, hypocotyls, roots, leaves and flowers of vine plants were also collected at various developmental stages. 2.2. RNA extraction and cDNA synthesis Total RNA was extracted from 500 mg of the frozen tissues by using TrizolTM extraction method (Invitrogen, Carlsbad, CA). The RNA quality, integrity and quantity were determined by running
2 ml of total RNA in a formamide denaturing gel. For cDNA synthesis, total RNA from 15 representative individual plant of each phenotype was pooled. One microgram of total pooled RNA was used initially for first strand synthesis, followed by doublestranded cDNA synthesis using SMARTTM cDNA Library Construction Kit (Clontech, USA) according to the manufacturer’s instructions. 2.3. cDNA-AFLP analysis Double-strand cDNA of internodes were digested and the products ligated to the adaptors in three steps: first, 100 ng of cDNA was incubated with 10 U of TaqI (New England Biolabs) and 4 ml Y+/TangoTM buffer (10) in a total volume of 20 ml solutions, for 2 h at 65 8C. In the second step, the total volume of the reaction was incubated with 10 U of AseI (New England Biolabs) and 1 ml Y+/ TangoTM buffer (10) in a total volume of 30 ml solutions, for 2 h at 37 8C. In the three step, 1 U of T4 DNA ligase (New England Biolabs), 50 pmol of TaqI adaptor, 5 pmol of AseI adaptor, 0.5 ml Y+/TangoTM buffer (10), 0.5 ml 10 mM ATP. The volume was brought to 55 ml with ultrapure water and incubated for 3 h at 37 8C. AseI and TaqI adapters were made by mixing equimolar amounts of complementary oligonucleotides (Integrated DNA Technologies): 50 GCGTAGACTGCGTACC-30 and 50 -TAGGTACGCAGTC-30 for AseI adaptor, and 50 -GACGATGAGTCCTGAC-30 and 50 -CGGTCAGGACTCAT-30 for TaqI adaptor. Twenty microlitres of diluted restriction– ligation mixture was used for preselective amplification using an PTC-100 programmable Thermal Cycler (MJResearch Inc., Waltham, MA) under the following conditions: 100 ng of AseI and TaqI primers (50 -CTCGTAGACTGCGTACCTAAT-30 and 50 -GACGATGAGTCCTGACCGA-30 , respectively), 5 ml 10 PCR Buffer, 4 ml 25 mM Mg2+, 1.25 U of Taq enzyme (Promega), 0.5 ml 25 mM dNTPs. The volume was brought to 50 ml with ultrapure water. The cycling parameters were an initial step of 94 8C for 3 min; 20 cycles of 94 8C for 30 s, 56 8C for 30 s and 72 8C for 1 min; and a final step of 72 8C for 7 min. The reaction mixture was diluted 10-fold, and 4 ml were subsequently used in a second selective amplification with TaqI1NN and AseI1NN primers (where N represents a selective nucleotide), performed with the same reagents as in the preselective amplification. The cycling parameters were an initial step of 94 8C for 3 min; 17 cycles of 94 8C for 30 s, 65 8C to 0.7 8C cycle1 for 30 s and 72 8C for 1 min; 28 cycles of 94 8C for 30 s, 52 8C for 30 s and 72 8C for 1 min; and a final step of 72 8C for 5 min. Amplified products were separated on a 6% denaturing polyacrylamide gel run at 80 W for 90 min, and stained with the Silver Sequence DNA Sequencing System (Promega) according to manufacturer’s instructions. All reactions were replicated twice. 2.4. TDF isolation and reamplification The polymorphic TDFs based on presence, absence or differential intensity were cut from the gel with a sharp razor blade, with maximum care to avoid any contaminating fragment(s), and then eluted in 40 ml of sterile double distilled water initially at 65 8C for 2 h and then hydrated overnight at 4 8C. Two microlitres of the aliquot was used for reamplification in a total volume of 25 ml, using the same set of corresponding selective primers and the same PCR conditions as for the selective amplification, except that an annealing temperature of 52 8C, 28 cycles and a final 5 min extension were used. The PCR products were resolved in a 1.5% 0.5 TBE agarose gel, and each single band was isolated and eluted using the AxyPrepTM DNA Gel Extraction kit (AxyGEN Biosciences). All PCR were performed in a PTC-100 programmable Thermal Cycler (MJResearch Inc., Waltham, MA) and the Taq enzyme and buffer were from Promega Corp., Madison, WI unless otherwise
T. Wu, J. Cao / Scientia Horticulturae 117 (2008) 219–224
221
Table 1 Primers used for RT-PCR analyses TDF
Forward primer (50 -30 )
Reverse primer (50 -30 )
Tm (8C)
Size of amplicon (bp)
A12T19-2 A14T9 A14T19 A17T5-3 A17T5-6 A17T9-2
TGAACAACAAGCAGTGAT TATATTGGTTGCAAGGAAG ATACTTCGGCAGACGCTA GAAGGTCCGTAGTTGTAG TGGTGGAGGAGGAATCA CACTGGGAAAGAGTATAA
GCAGACAGACAAAAACAG GGATTACATGCCCCAA GCTAGACCAGCAGTGTATATG CGTAAGGATTATATTGCC TAAAGAGGAGGCAACGAG CAACTCTCATCAACATAAT
50 43 53 46 47 48
135 110 100 103 188 132
mentioned. TDFs were named as AXXTXX-n where XX represents the randomly selected primer and n the different TDF with the same primer combination.
3. Results and discussion 3.1. cDNA-AFLP analysis of genes differentially expressed in nearisogenic line of C. moschata bush mutant
2.5. Cloning and sequencing of TDFs The eluted TDFs were cloned into the plasmid pGEM-T Easy vector (Promega Corp., Madison, WI) following the manufacturer’s protocol and sequenced (three clones from one band) at Invitrogen Biotechnology Co., Ltd. The sequences of the TDFs (with vector sequences trimmed off, where plasmid was used as the template) were analyzed for their homology against the publicly available non-redundant genes in the database (http://www.ncbi.nlm.nih.gov/BLAST) using the BLASTN and BLASTX algorithms. The functions of function-known genes by BLASTX and TBLASTX searches (E value cutoff = le4) (Ditt et al., 2001) were classified according to the putative function. 2.6. RT-PCR analysis RT-PCR was performed using 1 ml double-strand cDNA prepared as described above. RT-PCR was conducted with genespecific primers (Table 1) and b-actin (forward: 50 -CCACCAATCTTGTACACATCC-30 ; reverse: 50 -AGACCACCAAGTACTACTGCAC-30 ) as a control. PCR reactions of 25 ml were subjected to 30 cycles of 30 s denaturing at 94 8C, 30 s at annealing temperature and 1 min extension at 72 8C. Five microlitres of the product was electrophoresed on an agarose gel alongside a DNA quantification ladder, and the levels of template added to the reaction were altered according to the amount of expected product. The PCR was repeated until the level of product was consistent throughout the time-course. These amounts of template were then used in PCR reactions with the gene-specific primers for analysis of differential expression.
All 256 possible primer combinations were used in PCR reactions to screen differences in gene expression between bush and vine type plants in the near-isogenic line of C. moschata. An example of a cDNA-AFLP comparative expression profile after polyacrylamide gel electrophoresis and staining is shown in Fig. 1A. As a result of cDNA-AFLP analysis, a total of 70 TDFs, ranging in length from 60 to 400 bp, were recognized as differentially expressed fragments. Of the 70 TDFs detected, 41 (58.6%) were differentially expressed in vine plants, and 29 (41.4%) were differentially expressed in bush plants. 3.2. Sequence analysis of differentially expressed transcripts After sequencing, 58 individual clones were successfully identified. These fragments were sequenced with sequence similarity to known genes found for all fragments by BLAST searches. Their length, accession numbers and DNA sequence identities to database entries is shown in Table 2. cDNA sequences obtained ranged in size from 73 to 245 bp. In addition, sequencing failed for several TDFs even after cloning. These fragments were not characterized further. Among these 58 TDFs, 30 (51.7%) showed significant homology to genes with known or putative function, while 16 (27.6%) encoded proteins with unknown function. The remaining 12 (20.7%) TDFs did not show significant matches, which suggested that there were several new genes responsive to the vine elongation of pumpkin. Among the total 30 TDFs with high homology, 18 TDFs showed similarities with metabolism and energy; six TDFs encoded stress- or defense-related genes; four
Fig. 1. (A) Partial detail of a silver-stained cDNA-AFLP gel showing the differential expression of the genes with primer combinations A17T5, A12T19, A14T9, A14T19, and A17T9 in C. moschata. (1) Bush plants in C. moschata; (2) vine plants in C. moschata; (B and C) verification of differential gene expression of cDNA-AFLP fragments (B) by RT-PCR (C). (1) Bush plants in 1st internode of C. moschata; (2) vine plants in1st internode of C. moschata. b-Actin was used as a loading control.
T. Wu, J. Cao / Scientia Horticulturae 117 (2008) 219–224
222
Table 2 Transcription-derived fragments (TDFs) isolated and sequenced following cDNA-AFLP expression profiling of C. moschata TDF
Length (bp)
Phenotype
Similarity
E-value
A11T9 A12T5-1 A12T5-2 A12T5-3 A12T5-4 A12T5-5 A12T19-1 A12T19-2 A14T8 A14T9 A14T12 A14T16 A14T17 A15T9
172 144 84 146 121 168 167 167 87 144 128 124 197 109
Bush Vine Vine Vine Bush Vine Bush Bush Vine Vine Bush Vine Bush Vine
5e14 7e22 3e16 5e29 2e06 5e26 3e12 3e12 1.22 5e72 2e28 0.42 1e11 2e24
A14T19 A15T11 A15T13-1 A15T13-2 A15T13-3 A17T4-1 A17T4-2 A17T5-1 A17T5-2 A17T5-3 A17T5-4 A17T5-5 A17T5-6 A17T5-7 A17T9-1 A17T9-2 A17T10
135 114 123 153 176 73 106 150 120 142 128 150 233 214 199 199 229
Vine Vine Vine Vine Vine Bush Bush Bush Vine Vine Bush Bush Bush Vine Vine Vine Vine
Brassica rapa subsp. pekinensis clone KBrB043M07, complete (AC189355.1) Arabidopsis thaliana isochorismate synthase mRNA, complete cds (AF078080.1) Arabidopsis thaliana selenium binding (AT4G14030) mRNA, complete (NM_117478.3) Brassica oleracea chloroplast ATP synthase CF-0 subunit I (atpF) (U13703.1) Musa acuminata putative beta family G-protein mRNA, partial cds (AY463016.1) Brassica oleracea chloroplast ATP synthase CF-0 subunit I (atpF) (U13703.1) Arabidopsis thaliana late embryogenesis abundant-like protein mRNA (AY879295.1) Arabidopsis thaliana SAG21 (SENESCENCE-ASSOCIATED GENE 21) (NM_116471.2) Sacculina leptodiae cytochrome oxidase subunit I (COI) gene, partial (AY265376.1) Brassica juncea dehydroascorbate reductase (DHAR2) mRNA (AF536329.1) Arabidopsis thaliana alpha-xylosidase precursor (XYL1) mRNA (AF087483.1) Crypthecodinium cohnii clone pCc2.3 cytochrome oxidase subunit 1 (AF182641.1) Arabidopsis thaliana DNA binding/transcription factor (AT1G71130) (NM_105782.2) Arabidopsis thaliana protein binding/ubiquitin-protein ligase/zinc ion binding (AT2G15580) mRNA, complete cds (NM_127119.3) Arabidopsis thaliana putative pectinesterase (At3g43270) mRNA (AY096694.1) Arabidopsis thaliana alpha-mannosidase (AT3G26720) mRNA (NM_113583.2) Pyrus communis monooxygenase-like mRNA, partial sequence (AY436775.1) Arabidopsis thaliana alpha-mannosidase (AT3G26720) mRNA (NM_113583.2) Brassica napus gene for acetolactate synthase (ALS) (EC 4.1.3.18) (X16708.1) Arabidopsis thaliana mRNA for ribosomal protein, complete cds(AK228394.1) Arabidopsis thaliana putative RNA-binding protein (AY059129.1) Arabidopsis thaliana hydro-lyase (AT2G43090) mRNA, complete cds (NM_129870.2) Arabidopsis thaliana mRNA for putative DNA-binding protein (AK227837.1) Brassica oleracea chloroplast ndhJ gene for NADH dehydrogenase subunit (AB213010.1) Brassica rapa mRNA for ribosomal protein, complete cds (D78495.1) Arabidopsis thaliana hydro-lyase (AT2G43090) mRNA, complete cds (NM_129870.2) Arabidopsis thaliana putative hexokinase (At1g50460) mRNA (AY074314.1) Arabidopsis thaliana hydro-lyase (AT2G43090) mRNA, complete cds (NM_129870.2) Arabidopsis thaliana putative 3-isopropylmalate dehydratase, small (AY063029.1) Arabidopsis thaliana hydro-lyase (AT2G43090) mRNA, complete cds (NM_129870.2) O. sativa gene for heat shock protein 82 HSP82 (Z11920.1)
8e12 2e49 0.11 6e50 2e13 1e12 9e05 2e22 3e08 1e63 3e48 7e25 8e63 4e15 6e26 2e23 0.22
Sequence comparisons were performed using BLASTN and TBLASTX in NCBI databases.
TDFs were involved in cell wall biosynthesis or modification; the other two TDFs were related to transcription factor and signal transduction (Fig. 2). Dwarf mutant may have fewer cells (Abbe and Phinney, 1942; Bindloss, 1942) or a combination of shorter and fewer cells (de Haan and Gorter, 1936; Nilson et al., 1957). In Cucurbita pepo, von Maltzahn (1957) found that a large strain had more and longer cells than a small strain. Also, in C. pepo Denna and Munger (1963) found that, for the 10th internode, the vine phenotype had both more (3.8 times) and longer (1.7 times) cells than the bush. However, the results of the study of Cao et al. (2005) revealed that the bush phenotype in C. moschata is, in some reason, due to cell elongation failure. Mori et al. (2002) isolated a BR-defective dwarf mutant of rice, longitudinal sections of the leaf sheaths revealed that the cell length along the longitudinal axis is reduced. One gene, TDF A14T9, was expected to be potentially involved in cell
Fig. 2. Functional distribution of the pooled transcriptomes from 1st internodes of bush and vine plants in C. moschata derived from the cDNA-AFLP on the basis of their homology.
elongation. TDF A14T9 had a high similarity with dehydroascorbate reductase (DHAR, EC 1.8.5.1). It was hypothesized that AsA (ascorbic acid) can stimulate cell elongation via the electron transport across the plasma membrane (Smirnoff, 1996). Ascorbate itself is oxidized to dehydroascorbate during the process of antioxidation, and dehydroascorbate reductase re-reduces the oxidized ascorbate (Ushimaru et al., 2006). Therefore, this enzyme is assumed to be critical for ascorbate recycling and may play a role on the cell elongation of pumpkin plants by providing more unoxidized ascorbate. Cell elongation is initiated by stress relaxation of the cell wall (Lee et al., 2001). The various cell wall polysaccharides have been suggested to assemble into two independent networks. The cellulose–hemicellulose network provides strength to the cell wall while the pectin network is probably an important factor in determining the pore size of the cell wall (Oomen et al., 2003). Transgenic tobacco plant expressing a fungal pectin methylesterase (EC 3.1.1.11) gene showed short internodes, small leaves and a dwarf phenotype. At a cellular level, the longitudinal lengths of stem epidermal cells were shorter than those of control plants (Hasunuma et al., 2004). Derbyshire et al. (2007) presented evidence that the degree of pectin methyl-esterification (DE%) limits cell growth, and that a minimum level of about 60% DE is required for normal cell elongation in Arabidopsis hypocotyls. We identified four genes involved in cell wall biosynthesis or modification, A14T12, A14T19, A15T11 and A15T13-2. They showed similarities with pectinesterase (PE; EC 3.1.1.1.1), alpha-mannosidase and alpha-xylosidase. The role of pectinesterase was thought to be digestion of the pectin at different development stages, especially for the differentiation cells. Alpha-mannosidase is the component of cell wall while alpha-xylosidase play an important role on the cell wall modification. In addition, the vine
T. Wu, J. Cao / Scientia Horticulturae 117 (2008) 219–224
223
Fig. 5. RT-PCR showing differential gene expression of C. moschata in different tissues. (1) Hypocotyls of vine plants; (2) leaves of vine plants; (3) internodes of vine plants; (4) flowers of vine plants; (5) roots of vine plants; (6) cotyledons of vine plants. b-Actin was used as a loading control. Fig. 3. RT-PCR showing differential expression of the four TDFs on 1st internode of 15 individual bush and vine plants in C. moschata. Bu, bush plants in C. moschata; V, vine plants in C. moschata. TDF, transcript derived fragment. b-Actin was used as a loading control.
elongation of pumpkin may have correlation with plant metabolism and energy transduction, which suggested that the vine elongation of pumpkin was a comprehensive and complicated process. In addition, TDFs showed similarities with hormones were not identified. This is consistent with the result of plant hormone sprying experiment, which showed that plant hormone could not restore the vine elongation of bush plants in C. moschata (data not shown). This revealed that plant hormones might not be the ratelimiting factor of the failure of vine elongation in C. moschata. 3.3. RT-PCR analysis and tissue-specific expression of cDNA fragments To confirm whether cDNA-AFLP fragments originate from the plant, we initially attempted reverse Northern hybridization on the selected fragments. However, no hybridization signals were obtained, presumably due to the small sizes of the fragment. The reliability of cDNA-AFLP analysis to detect changes in expression profiles was then demonstrated by RT-PCR analysis. Six TDFs were tested but only four were confirmed using RT-PCR with specific primers. RT-PCR analysis revealed that TDFs A14T9, A14T19, A17T5-3, and A17T9-2 were found having the same expression patterns with the results observed through cDNA-AFLP (Fig. 1B and C). This was not the case for TDFs A12T19-2 and A17T5-
6, presumably because of isolation of the wrong fragments or mutations within primer sites. In order to confirm that the four TDFs that were differentially expressed were actually the result of the bush mutant and not due to differences at other loci which might also be segregating, the RT-PCR assays was also performed on 15 individual bush and vine plants. The result revealed that all the four TDFs were not expressed in 15 individual bush plants. TDF A14T9 and A14T19 were expressed in all of the 15 individual vine plants, while TDF A17T9-2 and A17T5-3 were expressed in 11 and 13 individual vine plants, respectively (Fig. 3). The sequence information of the four interested TDFs was shown in Fig. 4. The expression patterns of the four TDFs were then analyzed by RT-PCR to quantitatively assess the relative abundance of the transcripts in different tissues (Fig. 5). The results from these RTPCR experiments showed clear differences in the expression of the four genes tested. TDF A17T9-2 and A17T5-3 showed a steady state of expression in all of the tissues, while TDF A14T9 was expressed in hypocotyls, leaves and internodes, but was not expressed in flowers, roots and cotyledons of vine plants. The fourth TDF, A14T19, was not expressed in cotyledons, but was expressed in leaves, flowers and strongly expressed in hypocotyls, internodes and roots of vine plants. In summary, the usefulness of the cDNA-AFLP approach to identify genes related to vine development of C. moschata plants was demonstrated in this study. To our knowledge, this study represents the first demonstration of differences in gene
Fig. 4. The nucleotide sequence of TDF A14T9, A14T19, A17T9-2, and A17T5-3.
224
T. Wu, J. Cao / Scientia Horticulturae 117 (2008) 219–224
expression between bush and vine type plants in C. moschata. It should be mentioned that our analysis was restricted to one time point, thus yielding an incomplete picture. Completion of the pumpkin genome project will significantly contribute to obtain a more detailed picture of gene expression related to vine elongation. Further work will now concentrate on the characterization of the identified TDFs thus contributing to the understanding of the genetic basis of the observed phenotypic differences in near-isogenic line of C. moschata. Acknowledgement This work was supported by the Natural Science Foundation of China (No. 30270909). References Abbe, E.C., Phinney, B.O., 1942. The action of the gene dwarf-1 in the ontogeny of the stem in maize. Genetics 27, 129. Azpiroz, R., Wu, Y.W., Locascio, J.C., Feldmann, K.A., 1998. An Arabidopsis brassinosteroid-dependent mutant is blocked in cell elongation. Plant Cell 10, 219– 230. Bachem, C.W.B., Van Der Hoeven, R.S., De Bruijn, S.M., Vreugdenhil, D., Zabeau, M., Visser, R.G.F., 1996. Visualization of differential gene expression using a novel method of RNA fingerprinting based on AFLP: analysis of gene expression during potato tuber development. Plant J. 9, 745–753. Bindloss, E.A., 1942. A developmental analysis of cell length as related to the stem length. Am. J. Bot. 29, 179–188. Cao, J.S., Yu, H.F., Ye, W.Z., Yu, X.L., Liu, L.C., Wang, Y.Q., Xiang, X., 2005. Identification and characterization of a gibberellin-related dwarf mutant in pumpkin (Cucurbita moschata). J. Hortic. Sci. Biotechnol. 80, 29–31. Chesney, P., Linda, W.B., Maynard, D.N., 2004. Both traditional and semi-bush tropical pumpkin can be intercropped with beans or cowpeas. HortScience 39, 525–528. Cosgrove, D.J., 1993. How do plant cells extend? Plant Physiol. 102, 1–6. de Haan, I., Gorter, G.J., 1936. On the difference in longitudinal growth of some varieties of Pisum sativum. Rec. Trav. Bot. Neerl. 33, 434–446. Denna, D.W., Munger, H.M., 1963. Morphology of the bush and vine habits and the allelism of the bush genes in Cucurbita maxima and C. pepo squash. Proc. Am. Soc. Hortic. Sci. 82, 370–377. Derbyshire, P., McCann, M.C., Roberts, K., 2007. Restricted cell elongation in Arabidopsis hypocotyls is associated with a reduced average pectin esterification level. BMC Plant Biol. 7, 31. Ditt, R.F., Nester, E.W., Comai, L., 2001. Plant gene expression response to agrobacterium tumefaciens. In: Proceedings of the National Academy of Sciences of the USA, 98. pp. 10954–10959. Edelstein, M., Paris, H.S., Nerson, H., 1989. Dominance of bush growth habit in spaghetti squash (Cucurbita pepo). Euphytica 43, 253–257. Fry, S.C., Smith, R.C., Renwick, K.F., Martin, D.J., Hodge, S.K., Matthews, K.J., 1992. Xyloglucan endotransglycosylase, a new wall-loosening enzyme activity from plants. Biochem. J. 282, 821–828. Fukuta, N., Fujioka, S., Takatsuto, S., Yoshida, S., Fukuta, Y., Nakayama, M., 2004. ‘Rinrei’, a brassinosteroid-deficient dwarf mutant of faba bean (Vicia faba). Physiol. Plantarum 121, 506–512. Gray-Mitsumune, M., Blomquist, K., McQueen-Mason, S., Teeri, T.T., Sundberg, B., Mellerowicz, E.J., 2008. Ectopic expression of a wood-abundant expansin PttEXPA1 promotes cell expansion in primary and second tissues in aspen. Plant Biotechnol. J. 6, 62–72. Gwanama, C., Botha, A.M., Labuschagne, M.T., 2001. Genetic effects and heterosis of flowering and fruit characteristics of tropical pumpkin. Plant Breed. 120, 271– 272.
Hasunuma, T., Fukusaki, E., Kobayashi, A., 2004. Expression of fungal pectin methylesterase in transgenic tobacco leads to alteration in cell wall metabolism and a dwarf phenotype. J. Biotechnol. 111, 241–251. Hentrich, W., Bergner, C., Sembdner, G., 1985. Characterization of a gibberellin sensitive dwarf mutant of barley (Hordeum vulgare L., Mut. Dornburg 576). Plant Growth Regul. 3, 103–110. Klee, H., Estelle, M., 1991. Molecular genetic approaches to plant hormone biology. Annu. Rev. Plant Physiol. Plant Mol. Biol. 42, 529–551. Lanahan, M.B., Ho, T.H.D., 1988. Slender barley: a constitutive gibberellin–response mutant. Planta 175, 107–114. Lee, D.J., Park, J.Y., Ku, S.J., Ha, Y.M., Kim, S., Kim, M.D., Oh, K.M.H., Kim, J., 2007. Genome-wide expression profiling of ARABIDOPSIS RESPONSE REGULATOR 7 (ARR7) overexpression in cytokinin response. Mol. Genet. Genomics 277, 115–137. Lee, Y., Choi, D., Kende, H., 2001. Expansins: ever-expanding numbers and functions. Curr. Opin. Plant Biol. 4, 527–532. Maynard, D.N., Elmstrom, G.W., Carle, R.B., 2002. ‘EI Dorado’ and ‘La Estrella’: compact plant tropical pumpkin hybrids. HortScience 37, 831–833. McQueen-Mason, S.J., Durachko, D.M., Cosgrove, D.J., 1992. Two endogenous proteins that induce cell wall extension in plants. Plant Cell 4, 1425–1433. Mori, M., Nomura, T., Ooka, H., Ishizaka, M., Yokota, T., Sugimoto, K., Okabe, K., Kajiwara, H., Satoh, K., Yamamoto, K., Hirochika, H., Kikuchi, S., 2002. Isolation and characterization of a rice dwarf mutant with a defect in brassinosteroid biosynthesis. Plant Physiol. 130, 1152–1161. Nadhzimov, U.K., Jupe, S.C., Jones, M.G., Scott, I.M., 1988. Growth and gibberellin relations of the extreme dwarf dx tomato mutant. Physiol. Plantarum 73, 252– 256. Nilson, E.B., Johnson, V.A., Gardner, C.O., 1957. Parenchyma and epidermal cell length in relation to plant height in winter wheat. Bot. Gaz. 119, 38–43. Noguchi, T., Fujioka, S., Choe, S., Takatsuto, S., Yoshida, S., Yuan, H., Feldmann, K.A., Tax, F.E., 1999. Brassinosteroid-insensitive dwarf mutants of Arabidopsis accumulate brassinosteroids. Plant Physiol. 121, 743–752. Oomen, R.J.F.J., Bergervoet, M.J.E.M., Bachem, C.W.B., Visser, V.R.G.F., Vincken, J.P., 2003. Exploring the use of cDNA-AFLP with leaf protoplasts as a tool to study primary cell wall biosynthesis in potato. Plant Physiol. Biochem. 41, 965–971. Park, Y.W., Tominaga, R., Sugiyama, J., Furuta, Y., Tanimoto, E., Samejima, M., Sakai, F., Hayashi, T., 2003. Enhancement of growth by expression of polar cellulase in Arabidopsis thaliana. Plant J. 33, 1099–1106. Roberts, K., 1994. The plant extracellular matrix: in a new expansive mood. Curr. Opin. Cell. Biol. 6, 688–694. Shifriss, O., 1947. Developmental reversal of dominance in Cucurbita pepo. Proc. Am. Soc. Hortic. Sci. 50, 330–346. Smirnoff, N., 1996. The function and metabolism of ascorbic acid in plants. Ann. Bot. 78, 661–669. Sponsel, V.M., Schmidt, F.W., Porter, S.G., Nakayama, M., Kohlstruk, S., Estelle, M., 1997. Characterization of new gibberellin-responsive semidwarf mutants of Arabidopsis. Plant Physiol. 115, 1009–1020. Symons, G.M., Ross, J.J., Murfet, I.C., 2002. The bushy pea mutant is IAA-deficient. Physiol. Plantarum 116, 389–397. Ushimaru, T., Nakagawa, T., Fujioka, Y., Daicho, K., Naito, M., Yamauchi, Y., Nonaka, H., Amako, K., Yamawakik, K., Murata, N., 2006. Transgenic Arabidopsis plants expressing the rice dehydroascorbate reductase gene are resistant to salt stress. J. Plant Physiol. 163, 1179–1184. Volokhov, D., Chizhikov, V., Chumakov, K., Rasooly, A., 2003. Microarray analysis of erythromycin resistance determinants. J. Appl. Microbiol. 95, 787–798. von Maltzahn, K.E., 1957. Study of size differences in two strains of Cucurbita pepo L. Can. J. Bot. 35, 809–843. Wang, Y.Q., Ye, W.Z., Cao, J.S., Yu, X.L., Xiang, X., Lu, G., 2005. Cloning and characterization of the microspore development-related gene BCMF2 in Chinese cabbage pak-choi (Brassica campestris L. ssp. chinensis Makino). J. Integr. Plant Biol. 47, 863–872. Wu, T., Zhou, J.H., Zhang, Y.F., Cao, J.S., 2007. Characterization and inheritance of a bush-type in tropical pumpkin (Cucurbita moschata Duchesne). Scientia Horticulturae 114, 1–4. Yang, L., Zheng, B.S., Mao, C.Z., Yi, K.K., Liu, F.Y., Wu, Y.R., Tao, Q.N., Wu, P., 2003. cDNA-AFLP analysis of inducible gene expression in rice seminal root tips under a water deficit. Gene 314, 141–148.
Contents lists available at ScienceDirect
Scientia Horticulturae journal homepage: www.elsevier.com/locate/scihorti
Differential gene expression of tropical pumpkin (Cucurbita moschata Duchesne) bush mutant during internode development Tao Wu, Jiashu Cao * Institute of Vegetable Science, Zhejiang University, 268 Kaixuan Road, Hangzhou 310029, China
A R T I C L E I N F O
A B S T R A C T
Article history: Received 29 October 2007 Received in revised form 23 March 2008 Accepted 2 April 2008
This report described the identification of differentially expressed genes during internode development of a near-isogenic bush mutant of Cucurbita moschata Duchesne (C. moschata) derived from a cultivar of ‘Cga’ using cDNA-amplified fragment length polymorphism (cDNA-AFLP) technique. Seventy transcriptderived fragments (TDFs) were identified. Fifty-eight TDFs have been successfully sequenced and identified. BLAST searching revealed that 30 TDFs were highly homologous to genes with known function. Among them are genes involved in metabolism and energy, stress and defense, cell wall biosynthesis or modification, as well as genes encoding transcription factor and signal transduction. Four of these sequences have been shown to be differentially expressed between bush and vine plants of C. moschata as well as different tissues using reverse transcriptase-PCR (RT-PCR) analysis. Complete cosegregation of the RT-PCR product with the appropriate phenotype also suggested that the four TDFs were bush related genes in C. moschata. Overall, the study’s findings will provide some insights into genetic and molecular understanding of the bush phenotype in C. moschata. This in turn could provide some insight into the regulation of plant stature in horticultural plants. ß 2008 Elsevier B.V. All rights reserved.
Keywords: Cell elongation CDNA-AFLP Near-isogenic lines Transcript-derived fragment (TDF)
1. Introduction Tropical pumpkin is one of the most important vegetables in traditional agricultural systems in the world. The most important use of pumpkin in consumption is mature vegetable fruit. This crop contributes to nutrition though an abundant supply of minerals, vitamin C and especially b-carotene (Gwanama et al., 2001). In order to obtain fruit with best quality and production, it is hypothesized that all potential factors should be investigated. One factor that is critical for pumpkin study is vine length. Plants of Cucurbita traditionally have trailing vines that may spread up to 15 m from the crown of the plants (Maynard et al., 2002), thereby requiring wide planting distances. Some plants of the developed cultivars have short vines, which give them a bushy appearance (Shifriss, 1947; Denna and Munger, 1963; Edelstein et al., 1989; Maynard et al., 2002; Wu et al., 2007). Plants with bush habit permit higher plant populations, easier cultivation, and a more concentrated maturity, which facilitates production (Maynard et al., 2002). The bush genotype was also reported to have a higher harvest index than the vine genotype (Chesney et al., 2004). So, an investigation of the internode gene expression of bush mutant in C.
* Corresponding author. Tel.: +86 571 86971188; fax: +86 571 86971188. E-mail address: [email protected] (J. Cao). 0304-4238/$ – see front matter ß 2008 Elsevier B.V. All rights reserved. doi:10.1016/j.scienta.2008.04.002
moschata may provide insight into the regulation of plant stature in horticultural plants. Plant growth is accomplished by orderly cell division and tightly regulated cell expansion. Coordinate control of plant growth is regulated by both external stimuli and internal mechanisms. The internal components of plant signaling are generally mediated by chemical growth regulators (Klee and Estelle, 1991). Mutants defective in their response to various hormones are often dwarfs. Many dwarf mutants in hormone biosynthesis and signaling have been identified (Hentrich et al., 1985; Noguchi et al., 1999; Symons et al., 2002). This has been particularly so for the Gibberellins (GAs) (Nadhzimov et al., 1988), auxin (IAA) (Symons et al., 2002) and brassinosteroids (BR) (Noguchi et al., 1999). GAs, IAA and BR are plant growth regulators controlling cell and plant size, and mutations impairing their biosynthesis or sensitivity result in dwarfism (Lanahan and Ho, 1988; Nadhzimov et al., 1988; Sponsel et al., 1997; Fukuta et al., 2004). Azpiroz et al. (1998) described an Arabidopsis BR-dependent dwarf mutant, dwf4, which is blocked in cell elongation. Plant cell elongation is a fundamental process of plant tissue development. Many researchers have proposed that cell elongation requires relaxation of the rigid primary cell wall (Cosgrove, 1993; Roberts, 1994). Several mechanisms for defining cell wall relaxation have been proposed including the involvement of xyloglucan endotransglycosylase (Fry et al., 1992) and expansins
220
T. Wu, J. Cao / Scientia Horticulturae 117 (2008) 219–224
(McQueen-Mason et al., 1992). Transgenic Arabidopsis thaliana plants over-expressing poplar EGase were reported to have enhanced growth rate, larger leaves, larger cells, increased biomass, and increased in cellulose content per plant (Park et al., 2003). Transgenic aspen plants over-expressing a a-expansin PttEXPA1 exhibited increased stem internode elongation and leaf expansion, and larger cell sizes in the leaf epidermis (GrayMitsumune et al., 2008). Recently, various techniques for the large-scale analysis of gene expression have been used to elucidate the mechanism of plant development. Gene chips and microarray technologies are the most powerful tools for studying the whole genome transcription (Volokhov et al., 2003; Lee et al., 2007). However, these techniques rely on the prior knowledge of the sequence of genes to be investigated. Despite being a relatively laborious technique and yielding relatively short cDNA fragments, the cDNA-AFLP is a sensitive and reproducible technique that dose not require any prior knowledge of gene sequences and enables the identification of novel genes (Bachem et al., 1996; Ditt et al., 2001). Now, it has been performed on various plant species (Oomen et al., 2003; Yang et al., 2003; Wang et al., 2005). In a related study, Wu et al. (2007) selected a bush-type plant from tropical pumpkin (C. moschata). Shorter internodes, earlier flowering, a higher ratio of female to male flowers, and smaller fruit than vine plants characterized the bush plant. Genetic analysis indicated that the bush plants have a monogenic inheritance in which the bush genotype is dominant (Bu) to the vine genotype (bu). Furthermore, the results of Wu et al. (2007) revealed that the bushy appearance was the result of inhibition of cell elongation. Therefore, the aim of this study was to identify patterns of gene expression in internode related to vine elongation in a near-isogenic line of C. moschata bush mutant using cDNAAFLP technology. This knowledge on differentially regulated gene expression may help to elucidate the molecular alterations associated with the observed morphological and physiological differences between bush and vine phenotype in C. moschata. 2. Materials and methods 2.1. Plant material The near-isogenic line (five backcross generations) of C. moschata bush plants was used in this study. The near-isogenic line of C. moschata segregated approximately one bush: one vine plant. The seedlings of the bush and vine plants could be distinguished at the third leaf stage. Bush plants had short internodes, short vine and small number of internode compared with vine plants. Vine plants produced more male flowers (21.1 4.3) than bush plants (13.7 3.3). In contrast, bush plants flowered 8 days earlier than vine plants. Although bush plants had a higher rate of fruit abortion than vine plants, they had a larger total number of fruit than vine plants in a plant basis (Wu et al., 2007). Seeds were sown in a field nursery on the research farm of the Institute of Vegetable Science at Zhejiang University on 16 March 2006. At the third leaf stage, the 1st internodes of two genotypes were collected and frozen immediately in liquid nitrogen for cDNA-AFLP analysis. For tissue specific RT-PCR analysis, cotyledons, hypocotyls, roots, leaves and flowers of vine plants were also collected at various developmental stages. 2.2. RNA extraction and cDNA synthesis Total RNA was extracted from 500 mg of the frozen tissues by using TrizolTM extraction method (Invitrogen, Carlsbad, CA). The RNA quality, integrity and quantity were determined by running
2 ml of total RNA in a formamide denaturing gel. For cDNA synthesis, total RNA from 15 representative individual plant of each phenotype was pooled. One microgram of total pooled RNA was used initially for first strand synthesis, followed by doublestranded cDNA synthesis using SMARTTM cDNA Library Construction Kit (Clontech, USA) according to the manufacturer’s instructions. 2.3. cDNA-AFLP analysis Double-strand cDNA of internodes were digested and the products ligated to the adaptors in three steps: first, 100 ng of cDNA was incubated with 10 U of TaqI (New England Biolabs) and 4 ml Y+/TangoTM buffer (10) in a total volume of 20 ml solutions, for 2 h at 65 8C. In the second step, the total volume of the reaction was incubated with 10 U of AseI (New England Biolabs) and 1 ml Y+/ TangoTM buffer (10) in a total volume of 30 ml solutions, for 2 h at 37 8C. In the three step, 1 U of T4 DNA ligase (New England Biolabs), 50 pmol of TaqI adaptor, 5 pmol of AseI adaptor, 0.5 ml Y+/TangoTM buffer (10), 0.5 ml 10 mM ATP. The volume was brought to 55 ml with ultrapure water and incubated for 3 h at 37 8C. AseI and TaqI adapters were made by mixing equimolar amounts of complementary oligonucleotides (Integrated DNA Technologies): 50 GCGTAGACTGCGTACC-30 and 50 -TAGGTACGCAGTC-30 for AseI adaptor, and 50 -GACGATGAGTCCTGAC-30 and 50 -CGGTCAGGACTCAT-30 for TaqI adaptor. Twenty microlitres of diluted restriction– ligation mixture was used for preselective amplification using an PTC-100 programmable Thermal Cycler (MJResearch Inc., Waltham, MA) under the following conditions: 100 ng of AseI and TaqI primers (50 -CTCGTAGACTGCGTACCTAAT-30 and 50 -GACGATGAGTCCTGACCGA-30 , respectively), 5 ml 10 PCR Buffer, 4 ml 25 mM Mg2+, 1.25 U of Taq enzyme (Promega), 0.5 ml 25 mM dNTPs. The volume was brought to 50 ml with ultrapure water. The cycling parameters were an initial step of 94 8C for 3 min; 20 cycles of 94 8C for 30 s, 56 8C for 30 s and 72 8C for 1 min; and a final step of 72 8C for 7 min. The reaction mixture was diluted 10-fold, and 4 ml were subsequently used in a second selective amplification with TaqI1NN and AseI1NN primers (where N represents a selective nucleotide), performed with the same reagents as in the preselective amplification. The cycling parameters were an initial step of 94 8C for 3 min; 17 cycles of 94 8C for 30 s, 65 8C to 0.7 8C cycle1 for 30 s and 72 8C for 1 min; 28 cycles of 94 8C for 30 s, 52 8C for 30 s and 72 8C for 1 min; and a final step of 72 8C for 5 min. Amplified products were separated on a 6% denaturing polyacrylamide gel run at 80 W for 90 min, and stained with the Silver Sequence DNA Sequencing System (Promega) according to manufacturer’s instructions. All reactions were replicated twice. 2.4. TDF isolation and reamplification The polymorphic TDFs based on presence, absence or differential intensity were cut from the gel with a sharp razor blade, with maximum care to avoid any contaminating fragment(s), and then eluted in 40 ml of sterile double distilled water initially at 65 8C for 2 h and then hydrated overnight at 4 8C. Two microlitres of the aliquot was used for reamplification in a total volume of 25 ml, using the same set of corresponding selective primers and the same PCR conditions as for the selective amplification, except that an annealing temperature of 52 8C, 28 cycles and a final 5 min extension were used. The PCR products were resolved in a 1.5% 0.5 TBE agarose gel, and each single band was isolated and eluted using the AxyPrepTM DNA Gel Extraction kit (AxyGEN Biosciences). All PCR were performed in a PTC-100 programmable Thermal Cycler (MJResearch Inc., Waltham, MA) and the Taq enzyme and buffer were from Promega Corp., Madison, WI unless otherwise
T. Wu, J. Cao / Scientia Horticulturae 117 (2008) 219–224
221
Table 1 Primers used for RT-PCR analyses TDF
Forward primer (50 -30 )
Reverse primer (50 -30 )
Tm (8C)
Size of amplicon (bp)
A12T19-2 A14T9 A14T19 A17T5-3 A17T5-6 A17T9-2
TGAACAACAAGCAGTGAT TATATTGGTTGCAAGGAAG ATACTTCGGCAGACGCTA GAAGGTCCGTAGTTGTAG TGGTGGAGGAGGAATCA CACTGGGAAAGAGTATAA
GCAGACAGACAAAAACAG GGATTACATGCCCCAA GCTAGACCAGCAGTGTATATG CGTAAGGATTATATTGCC TAAAGAGGAGGCAACGAG CAACTCTCATCAACATAAT
50 43 53 46 47 48
135 110 100 103 188 132
mentioned. TDFs were named as AXXTXX-n where XX represents the randomly selected primer and n the different TDF with the same primer combination.
3. Results and discussion 3.1. cDNA-AFLP analysis of genes differentially expressed in nearisogenic line of C. moschata bush mutant
2.5. Cloning and sequencing of TDFs The eluted TDFs were cloned into the plasmid pGEM-T Easy vector (Promega Corp., Madison, WI) following the manufacturer’s protocol and sequenced (three clones from one band) at Invitrogen Biotechnology Co., Ltd. The sequences of the TDFs (with vector sequences trimmed off, where plasmid was used as the template) were analyzed for their homology against the publicly available non-redundant genes in the database (http://www.ncbi.nlm.nih.gov/BLAST) using the BLASTN and BLASTX algorithms. The functions of function-known genes by BLASTX and TBLASTX searches (E value cutoff = le4) (Ditt et al., 2001) were classified according to the putative function. 2.6. RT-PCR analysis RT-PCR was performed using 1 ml double-strand cDNA prepared as described above. RT-PCR was conducted with genespecific primers (Table 1) and b-actin (forward: 50 -CCACCAATCTTGTACACATCC-30 ; reverse: 50 -AGACCACCAAGTACTACTGCAC-30 ) as a control. PCR reactions of 25 ml were subjected to 30 cycles of 30 s denaturing at 94 8C, 30 s at annealing temperature and 1 min extension at 72 8C. Five microlitres of the product was electrophoresed on an agarose gel alongside a DNA quantification ladder, and the levels of template added to the reaction were altered according to the amount of expected product. The PCR was repeated until the level of product was consistent throughout the time-course. These amounts of template were then used in PCR reactions with the gene-specific primers for analysis of differential expression.
All 256 possible primer combinations were used in PCR reactions to screen differences in gene expression between bush and vine type plants in the near-isogenic line of C. moschata. An example of a cDNA-AFLP comparative expression profile after polyacrylamide gel electrophoresis and staining is shown in Fig. 1A. As a result of cDNA-AFLP analysis, a total of 70 TDFs, ranging in length from 60 to 400 bp, were recognized as differentially expressed fragments. Of the 70 TDFs detected, 41 (58.6%) were differentially expressed in vine plants, and 29 (41.4%) were differentially expressed in bush plants. 3.2. Sequence analysis of differentially expressed transcripts After sequencing, 58 individual clones were successfully identified. These fragments were sequenced with sequence similarity to known genes found for all fragments by BLAST searches. Their length, accession numbers and DNA sequence identities to database entries is shown in Table 2. cDNA sequences obtained ranged in size from 73 to 245 bp. In addition, sequencing failed for several TDFs even after cloning. These fragments were not characterized further. Among these 58 TDFs, 30 (51.7%) showed significant homology to genes with known or putative function, while 16 (27.6%) encoded proteins with unknown function. The remaining 12 (20.7%) TDFs did not show significant matches, which suggested that there were several new genes responsive to the vine elongation of pumpkin. Among the total 30 TDFs with high homology, 18 TDFs showed similarities with metabolism and energy; six TDFs encoded stress- or defense-related genes; four
Fig. 1. (A) Partial detail of a silver-stained cDNA-AFLP gel showing the differential expression of the genes with primer combinations A17T5, A12T19, A14T9, A14T19, and A17T9 in C. moschata. (1) Bush plants in C. moschata; (2) vine plants in C. moschata; (B and C) verification of differential gene expression of cDNA-AFLP fragments (B) by RT-PCR (C). (1) Bush plants in 1st internode of C. moschata; (2) vine plants in1st internode of C. moschata. b-Actin was used as a loading control.
T. Wu, J. Cao / Scientia Horticulturae 117 (2008) 219–224
222
Table 2 Transcription-derived fragments (TDFs) isolated and sequenced following cDNA-AFLP expression profiling of C. moschata TDF
Length (bp)
Phenotype
Similarity
E-value
A11T9 A12T5-1 A12T5-2 A12T5-3 A12T5-4 A12T5-5 A12T19-1 A12T19-2 A14T8 A14T9 A14T12 A14T16 A14T17 A15T9
172 144 84 146 121 168 167 167 87 144 128 124 197 109
Bush Vine Vine Vine Bush Vine Bush Bush Vine Vine Bush Vine Bush Vine
5e14 7e22 3e16 5e29 2e06 5e26 3e12 3e12 1.22 5e72 2e28 0.42 1e11 2e24
A14T19 A15T11 A15T13-1 A15T13-2 A15T13-3 A17T4-1 A17T4-2 A17T5-1 A17T5-2 A17T5-3 A17T5-4 A17T5-5 A17T5-6 A17T5-7 A17T9-1 A17T9-2 A17T10
135 114 123 153 176 73 106 150 120 142 128 150 233 214 199 199 229
Vine Vine Vine Vine Vine Bush Bush Bush Vine Vine Bush Bush Bush Vine Vine Vine Vine
Brassica rapa subsp. pekinensis clone KBrB043M07, complete (AC189355.1) Arabidopsis thaliana isochorismate synthase mRNA, complete cds (AF078080.1) Arabidopsis thaliana selenium binding (AT4G14030) mRNA, complete (NM_117478.3) Brassica oleracea chloroplast ATP synthase CF-0 subunit I (atpF) (U13703.1) Musa acuminata putative beta family G-protein mRNA, partial cds (AY463016.1) Brassica oleracea chloroplast ATP synthase CF-0 subunit I (atpF) (U13703.1) Arabidopsis thaliana late embryogenesis abundant-like protein mRNA (AY879295.1) Arabidopsis thaliana SAG21 (SENESCENCE-ASSOCIATED GENE 21) (NM_116471.2) Sacculina leptodiae cytochrome oxidase subunit I (COI) gene, partial (AY265376.1) Brassica juncea dehydroascorbate reductase (DHAR2) mRNA (AF536329.1) Arabidopsis thaliana alpha-xylosidase precursor (XYL1) mRNA (AF087483.1) Crypthecodinium cohnii clone pCc2.3 cytochrome oxidase subunit 1 (AF182641.1) Arabidopsis thaliana DNA binding/transcription factor (AT1G71130) (NM_105782.2) Arabidopsis thaliana protein binding/ubiquitin-protein ligase/zinc ion binding (AT2G15580) mRNA, complete cds (NM_127119.3) Arabidopsis thaliana putative pectinesterase (At3g43270) mRNA (AY096694.1) Arabidopsis thaliana alpha-mannosidase (AT3G26720) mRNA (NM_113583.2) Pyrus communis monooxygenase-like mRNA, partial sequence (AY436775.1) Arabidopsis thaliana alpha-mannosidase (AT3G26720) mRNA (NM_113583.2) Brassica napus gene for acetolactate synthase (ALS) (EC 4.1.3.18) (X16708.1) Arabidopsis thaliana mRNA for ribosomal protein, complete cds(AK228394.1) Arabidopsis thaliana putative RNA-binding protein (AY059129.1) Arabidopsis thaliana hydro-lyase (AT2G43090) mRNA, complete cds (NM_129870.2) Arabidopsis thaliana mRNA for putative DNA-binding protein (AK227837.1) Brassica oleracea chloroplast ndhJ gene for NADH dehydrogenase subunit (AB213010.1) Brassica rapa mRNA for ribosomal protein, complete cds (D78495.1) Arabidopsis thaliana hydro-lyase (AT2G43090) mRNA, complete cds (NM_129870.2) Arabidopsis thaliana putative hexokinase (At1g50460) mRNA (AY074314.1) Arabidopsis thaliana hydro-lyase (AT2G43090) mRNA, complete cds (NM_129870.2) Arabidopsis thaliana putative 3-isopropylmalate dehydratase, small (AY063029.1) Arabidopsis thaliana hydro-lyase (AT2G43090) mRNA, complete cds (NM_129870.2) O. sativa gene for heat shock protein 82 HSP82 (Z11920.1)
8e12 2e49 0.11 6e50 2e13 1e12 9e05 2e22 3e08 1e63 3e48 7e25 8e63 4e15 6e26 2e23 0.22
Sequence comparisons were performed using BLASTN and TBLASTX in NCBI databases.
TDFs were involved in cell wall biosynthesis or modification; the other two TDFs were related to transcription factor and signal transduction (Fig. 2). Dwarf mutant may have fewer cells (Abbe and Phinney, 1942; Bindloss, 1942) or a combination of shorter and fewer cells (de Haan and Gorter, 1936; Nilson et al., 1957). In Cucurbita pepo, von Maltzahn (1957) found that a large strain had more and longer cells than a small strain. Also, in C. pepo Denna and Munger (1963) found that, for the 10th internode, the vine phenotype had both more (3.8 times) and longer (1.7 times) cells than the bush. However, the results of the study of Cao et al. (2005) revealed that the bush phenotype in C. moschata is, in some reason, due to cell elongation failure. Mori et al. (2002) isolated a BR-defective dwarf mutant of rice, longitudinal sections of the leaf sheaths revealed that the cell length along the longitudinal axis is reduced. One gene, TDF A14T9, was expected to be potentially involved in cell
Fig. 2. Functional distribution of the pooled transcriptomes from 1st internodes of bush and vine plants in C. moschata derived from the cDNA-AFLP on the basis of their homology.
elongation. TDF A14T9 had a high similarity with dehydroascorbate reductase (DHAR, EC 1.8.5.1). It was hypothesized that AsA (ascorbic acid) can stimulate cell elongation via the electron transport across the plasma membrane (Smirnoff, 1996). Ascorbate itself is oxidized to dehydroascorbate during the process of antioxidation, and dehydroascorbate reductase re-reduces the oxidized ascorbate (Ushimaru et al., 2006). Therefore, this enzyme is assumed to be critical for ascorbate recycling and may play a role on the cell elongation of pumpkin plants by providing more unoxidized ascorbate. Cell elongation is initiated by stress relaxation of the cell wall (Lee et al., 2001). The various cell wall polysaccharides have been suggested to assemble into two independent networks. The cellulose–hemicellulose network provides strength to the cell wall while the pectin network is probably an important factor in determining the pore size of the cell wall (Oomen et al., 2003). Transgenic tobacco plant expressing a fungal pectin methylesterase (EC 3.1.1.11) gene showed short internodes, small leaves and a dwarf phenotype. At a cellular level, the longitudinal lengths of stem epidermal cells were shorter than those of control plants (Hasunuma et al., 2004). Derbyshire et al. (2007) presented evidence that the degree of pectin methyl-esterification (DE%) limits cell growth, and that a minimum level of about 60% DE is required for normal cell elongation in Arabidopsis hypocotyls. We identified four genes involved in cell wall biosynthesis or modification, A14T12, A14T19, A15T11 and A15T13-2. They showed similarities with pectinesterase (PE; EC 3.1.1.1.1), alpha-mannosidase and alpha-xylosidase. The role of pectinesterase was thought to be digestion of the pectin at different development stages, especially for the differentiation cells. Alpha-mannosidase is the component of cell wall while alpha-xylosidase play an important role on the cell wall modification. In addition, the vine
T. Wu, J. Cao / Scientia Horticulturae 117 (2008) 219–224
223
Fig. 5. RT-PCR showing differential gene expression of C. moschata in different tissues. (1) Hypocotyls of vine plants; (2) leaves of vine plants; (3) internodes of vine plants; (4) flowers of vine plants; (5) roots of vine plants; (6) cotyledons of vine plants. b-Actin was used as a loading control. Fig. 3. RT-PCR showing differential expression of the four TDFs on 1st internode of 15 individual bush and vine plants in C. moschata. Bu, bush plants in C. moschata; V, vine plants in C. moschata. TDF, transcript derived fragment. b-Actin was used as a loading control.
elongation of pumpkin may have correlation with plant metabolism and energy transduction, which suggested that the vine elongation of pumpkin was a comprehensive and complicated process. In addition, TDFs showed similarities with hormones were not identified. This is consistent with the result of plant hormone sprying experiment, which showed that plant hormone could not restore the vine elongation of bush plants in C. moschata (data not shown). This revealed that plant hormones might not be the ratelimiting factor of the failure of vine elongation in C. moschata. 3.3. RT-PCR analysis and tissue-specific expression of cDNA fragments To confirm whether cDNA-AFLP fragments originate from the plant, we initially attempted reverse Northern hybridization on the selected fragments. However, no hybridization signals were obtained, presumably due to the small sizes of the fragment. The reliability of cDNA-AFLP analysis to detect changes in expression profiles was then demonstrated by RT-PCR analysis. Six TDFs were tested but only four were confirmed using RT-PCR with specific primers. RT-PCR analysis revealed that TDFs A14T9, A14T19, A17T5-3, and A17T9-2 were found having the same expression patterns with the results observed through cDNA-AFLP (Fig. 1B and C). This was not the case for TDFs A12T19-2 and A17T5-
6, presumably because of isolation of the wrong fragments or mutations within primer sites. In order to confirm that the four TDFs that were differentially expressed were actually the result of the bush mutant and not due to differences at other loci which might also be segregating, the RT-PCR assays was also performed on 15 individual bush and vine plants. The result revealed that all the four TDFs were not expressed in 15 individual bush plants. TDF A14T9 and A14T19 were expressed in all of the 15 individual vine plants, while TDF A17T9-2 and A17T5-3 were expressed in 11 and 13 individual vine plants, respectively (Fig. 3). The sequence information of the four interested TDFs was shown in Fig. 4. The expression patterns of the four TDFs were then analyzed by RT-PCR to quantitatively assess the relative abundance of the transcripts in different tissues (Fig. 5). The results from these RTPCR experiments showed clear differences in the expression of the four genes tested. TDF A17T9-2 and A17T5-3 showed a steady state of expression in all of the tissues, while TDF A14T9 was expressed in hypocotyls, leaves and internodes, but was not expressed in flowers, roots and cotyledons of vine plants. The fourth TDF, A14T19, was not expressed in cotyledons, but was expressed in leaves, flowers and strongly expressed in hypocotyls, internodes and roots of vine plants. In summary, the usefulness of the cDNA-AFLP approach to identify genes related to vine development of C. moschata plants was demonstrated in this study. To our knowledge, this study represents the first demonstration of differences in gene
Fig. 4. The nucleotide sequence of TDF A14T9, A14T19, A17T9-2, and A17T5-3.
224
T. Wu, J. Cao / Scientia Horticulturae 117 (2008) 219–224
expression between bush and vine type plants in C. moschata. It should be mentioned that our analysis was restricted to one time point, thus yielding an incomplete picture. Completion of the pumpkin genome project will significantly contribute to obtain a more detailed picture of gene expression related to vine elongation. Further work will now concentrate on the characterization of the identified TDFs thus contributing to the understanding of the genetic basis of the observed phenotypic differences in near-isogenic line of C. moschata. Acknowledgement This work was supported by the Natural Science Foundation of China (No. 30270909). References Abbe, E.C., Phinney, B.O., 1942. The action of the gene dwarf-1 in the ontogeny of the stem in maize. Genetics 27, 129. Azpiroz, R., Wu, Y.W., Locascio, J.C., Feldmann, K.A., 1998. An Arabidopsis brassinosteroid-dependent mutant is blocked in cell elongation. Plant Cell 10, 219– 230. Bachem, C.W.B., Van Der Hoeven, R.S., De Bruijn, S.M., Vreugdenhil, D., Zabeau, M., Visser, R.G.F., 1996. Visualization of differential gene expression using a novel method of RNA fingerprinting based on AFLP: analysis of gene expression during potato tuber development. Plant J. 9, 745–753. Bindloss, E.A., 1942. A developmental analysis of cell length as related to the stem length. Am. J. Bot. 29, 179–188. Cao, J.S., Yu, H.F., Ye, W.Z., Yu, X.L., Liu, L.C., Wang, Y.Q., Xiang, X., 2005. Identification and characterization of a gibberellin-related dwarf mutant in pumpkin (Cucurbita moschata). J. Hortic. Sci. Biotechnol. 80, 29–31. Chesney, P., Linda, W.B., Maynard, D.N., 2004. Both traditional and semi-bush tropical pumpkin can be intercropped with beans or cowpeas. HortScience 39, 525–528. Cosgrove, D.J., 1993. How do plant cells extend? Plant Physiol. 102, 1–6. de Haan, I., Gorter, G.J., 1936. On the difference in longitudinal growth of some varieties of Pisum sativum. Rec. Trav. Bot. Neerl. 33, 434–446. Denna, D.W., Munger, H.M., 1963. Morphology of the bush and vine habits and the allelism of the bush genes in Cucurbita maxima and C. pepo squash. Proc. Am. Soc. Hortic. Sci. 82, 370–377. Derbyshire, P., McCann, M.C., Roberts, K., 2007. Restricted cell elongation in Arabidopsis hypocotyls is associated with a reduced average pectin esterification level. BMC Plant Biol. 7, 31. Ditt, R.F., Nester, E.W., Comai, L., 2001. Plant gene expression response to agrobacterium tumefaciens. In: Proceedings of the National Academy of Sciences of the USA, 98. pp. 10954–10959. Edelstein, M., Paris, H.S., Nerson, H., 1989. Dominance of bush growth habit in spaghetti squash (Cucurbita pepo). Euphytica 43, 253–257. Fry, S.C., Smith, R.C., Renwick, K.F., Martin, D.J., Hodge, S.K., Matthews, K.J., 1992. Xyloglucan endotransglycosylase, a new wall-loosening enzyme activity from plants. Biochem. J. 282, 821–828. Fukuta, N., Fujioka, S., Takatsuto, S., Yoshida, S., Fukuta, Y., Nakayama, M., 2004. ‘Rinrei’, a brassinosteroid-deficient dwarf mutant of faba bean (Vicia faba). Physiol. Plantarum 121, 506–512. Gray-Mitsumune, M., Blomquist, K., McQueen-Mason, S., Teeri, T.T., Sundberg, B., Mellerowicz, E.J., 2008. Ectopic expression of a wood-abundant expansin PttEXPA1 promotes cell expansion in primary and second tissues in aspen. Plant Biotechnol. J. 6, 62–72. Gwanama, C., Botha, A.M., Labuschagne, M.T., 2001. Genetic effects and heterosis of flowering and fruit characteristics of tropical pumpkin. Plant Breed. 120, 271– 272.
Hasunuma, T., Fukusaki, E., Kobayashi, A., 2004. Expression of fungal pectin methylesterase in transgenic tobacco leads to alteration in cell wall metabolism and a dwarf phenotype. J. Biotechnol. 111, 241–251. Hentrich, W., Bergner, C., Sembdner, G., 1985. Characterization of a gibberellin sensitive dwarf mutant of barley (Hordeum vulgare L., Mut. Dornburg 576). Plant Growth Regul. 3, 103–110. Klee, H., Estelle, M., 1991. Molecular genetic approaches to plant hormone biology. Annu. Rev. Plant Physiol. Plant Mol. Biol. 42, 529–551. Lanahan, M.B., Ho, T.H.D., 1988. Slender barley: a constitutive gibberellin–response mutant. Planta 175, 107–114. Lee, D.J., Park, J.Y., Ku, S.J., Ha, Y.M., Kim, S., Kim, M.D., Oh, K.M.H., Kim, J., 2007. Genome-wide expression profiling of ARABIDOPSIS RESPONSE REGULATOR 7 (ARR7) overexpression in cytokinin response. Mol. Genet. Genomics 277, 115–137. Lee, Y., Choi, D., Kende, H., 2001. Expansins: ever-expanding numbers and functions. Curr. Opin. Plant Biol. 4, 527–532. Maynard, D.N., Elmstrom, G.W., Carle, R.B., 2002. ‘EI Dorado’ and ‘La Estrella’: compact plant tropical pumpkin hybrids. HortScience 37, 831–833. McQueen-Mason, S.J., Durachko, D.M., Cosgrove, D.J., 1992. Two endogenous proteins that induce cell wall extension in plants. Plant Cell 4, 1425–1433. Mori, M., Nomura, T., Ooka, H., Ishizaka, M., Yokota, T., Sugimoto, K., Okabe, K., Kajiwara, H., Satoh, K., Yamamoto, K., Hirochika, H., Kikuchi, S., 2002. Isolation and characterization of a rice dwarf mutant with a defect in brassinosteroid biosynthesis. Plant Physiol. 130, 1152–1161. Nadhzimov, U.K., Jupe, S.C., Jones, M.G., Scott, I.M., 1988. Growth and gibberellin relations of the extreme dwarf dx tomato mutant. Physiol. Plantarum 73, 252– 256. Nilson, E.B., Johnson, V.A., Gardner, C.O., 1957. Parenchyma and epidermal cell length in relation to plant height in winter wheat. Bot. Gaz. 119, 38–43. Noguchi, T., Fujioka, S., Choe, S., Takatsuto, S., Yoshida, S., Yuan, H., Feldmann, K.A., Tax, F.E., 1999. Brassinosteroid-insensitive dwarf mutants of Arabidopsis accumulate brassinosteroids. Plant Physiol. 121, 743–752. Oomen, R.J.F.J., Bergervoet, M.J.E.M., Bachem, C.W.B., Visser, V.R.G.F., Vincken, J.P., 2003. Exploring the use of cDNA-AFLP with leaf protoplasts as a tool to study primary cell wall biosynthesis in potato. Plant Physiol. Biochem. 41, 965–971. Park, Y.W., Tominaga, R., Sugiyama, J., Furuta, Y., Tanimoto, E., Samejima, M., Sakai, F., Hayashi, T., 2003. Enhancement of growth by expression of polar cellulase in Arabidopsis thaliana. Plant J. 33, 1099–1106. Roberts, K., 1994. The plant extracellular matrix: in a new expansive mood. Curr. Opin. Cell. Biol. 6, 688–694. Shifriss, O., 1947. Developmental reversal of dominance in Cucurbita pepo. Proc. Am. Soc. Hortic. Sci. 50, 330–346. Smirnoff, N., 1996. The function and metabolism of ascorbic acid in plants. Ann. Bot. 78, 661–669. Sponsel, V.M., Schmidt, F.W., Porter, S.G., Nakayama, M., Kohlstruk, S., Estelle, M., 1997. Characterization of new gibberellin-responsive semidwarf mutants of Arabidopsis. Plant Physiol. 115, 1009–1020. Symons, G.M., Ross, J.J., Murfet, I.C., 2002. The bushy pea mutant is IAA-deficient. Physiol. Plantarum 116, 389–397. Ushimaru, T., Nakagawa, T., Fujioka, Y., Daicho, K., Naito, M., Yamauchi, Y., Nonaka, H., Amako, K., Yamawakik, K., Murata, N., 2006. Transgenic Arabidopsis plants expressing the rice dehydroascorbate reductase gene are resistant to salt stress. J. Plant Physiol. 163, 1179–1184. Volokhov, D., Chizhikov, V., Chumakov, K., Rasooly, A., 2003. Microarray analysis of erythromycin resistance determinants. J. Appl. Microbiol. 95, 787–798. von Maltzahn, K.E., 1957. Study of size differences in two strains of Cucurbita pepo L. Can. J. Bot. 35, 809–843. Wang, Y.Q., Ye, W.Z., Cao, J.S., Yu, X.L., Xiang, X., Lu, G., 2005. Cloning and characterization of the microspore development-related gene BCMF2 in Chinese cabbage pak-choi (Brassica campestris L. ssp. chinensis Makino). J. Integr. Plant Biol. 47, 863–872. Wu, T., Zhou, J.H., Zhang, Y.F., Cao, J.S., 2007. Characterization and inheritance of a bush-type in tropical pumpkin (Cucurbita moschata Duchesne). Scientia Horticulturae 114, 1–4. Yang, L., Zheng, B.S., Mao, C.Z., Yi, K.K., Liu, F.Y., Wu, Y.R., Tao, Q.N., Wu, P., 2003. cDNA-AFLP analysis of inducible gene expression in rice seminal root tips under a water deficit. Gene 314, 141–148.