Differential host gene expression in cells infected with highly pathogenic H5N1 avian influenza viruses

Available online at www.sciencedirect.com

Veterinary Immunology and Immunopathology 125 (2008) 291–302 www.elsevier.com/locate/vetimm

Differential host gene expression in cells infected with highly pathogenic H5N1 avian influenza viruses Luciana Sarmento, Claudio L. Afonso, Carlos Estevez, Jamie Wasilenko, Mary Pantin-Jackwood * Southeast Poultry Research Laboratory, Agricultural Research Service, United States Department of Agriculture, Athens, GA 30605, USA Received 17 March 2008; received in revised form 7 May 2008; accepted 19 May 2008

Abstract In order to understand the molecular mechanisms by which different strains of avian influenza viruses overcome host response in birds, we used a complete chicken genome microarray to compare early gene expression levels in chicken embryo fibroblasts (CEF) infected with two avian influenza viruses (AIV), A/CK/Hong Kong/220/97 and A/Egret/Hong Kong/757.2/02, with different replication characteristics. Gene ontology revealed that the genes with altered expression are involved in many vital functional classes including protein metabolism, translation, transcription, host defense/immune response, ubiquitination and the cell cycle. Among the immune-related genes, MEK2, MHC class I, PDCD10 and Bcl-3 were selected for further expression analysis at 24 hpi using semi-quantitive RT-PCR. Infection of CEF with A/Egret/Hong Kong/757.2/02 resulted in a marked repression of MEK2 and MHC class I gene expression levels. Infection of CEF with A/CK/Hong Kong/220/97 induced an increase of MEK2 and a decrease in PDCD10 and Bcl-3 expression levels. The expression levels of alpha interferon (IFN-a), myxovirus resistance 1 (Mx1) and interleukin-8 (IL-8) were also analyzed at 24 hpi, showing higher expression levels of all of these genes after infection with A/CK/ Hong Kong/220/97 compared to A/Egret/Hong Kong/757.2/02. In addition, comparison of the NS1 sequences of the viruses revealed amino acid differences that may explain in part the differences in IFN-a expression observed. Microarray gene expression analysis has proven to be a useful tool on providing important insights into how different AIVs affect host gene expression and how AIVs may use different strategies to evade host response and replicate in host cells. Published by Elsevier B.V. Keywords: Avian influenza virus; Gene expression; Immune response; Chicken embryo fibroblasts

1. Introduction Infection of poultry with highly pathogenic avian influenza viruses (AIV) is associated with systemic infection and high mortality (de Jong and Hien, 2006). From the pathophysiological point of view, the mechan-

* Corresponding author. Tel.: +1 706 546 3419; fax: +1 706 546 3161. E-mail address: [email protected] (M. Pantin-Jackwood). 0165-2427/$ – see front matter. Published by Elsevier B.V. doi:10.1016/j.vetimm.2008.05.021

isms that are responsible for severe illness and death with highly pathogenic AIV can vary (Swayne, 2007). In contrast to mammals, there is limited information concerning the molecular pathogenesis of AIV and the regulation of host genes response after AIV infection in avian species. Previous reports have pointed towards the importance of apoptosis as a significant contributor to the pathogenesis of AIV. Induction of apoptosis by AIV has been shown in chickens (Ito et al., 2002; Van Campen et al., 1989) and in an avian lymphocyte cell line (Hinshaw et al., 1994; Van Campen et al., 1989). In

292

L. Sarmento et al. / Veterinary Immunology and Immunopathology 125 (2008) 291–302

addition, chickens infected with a highly pathogenic avian influenza strain exhibited an increase in serum transforming growth factor-b (TGF-b) activity (Suarez and Schultz-Cherry, 2000), which has been associated with influenza A virus-induced apoptosis (SchultzCherry and Hinshaw, 1996). Cytokine responses to influenza A viruses are central to influenza pathogenesis in mammals (de Jong and Hien, 2006). In avian cells, a recent study showed that IFN-stimulated genes (ISG12, LY6E and haemopoiesis related membrane protein 1 gene) were up-regulated following infection with a highly pathogenic AIV (Zhang et al., 2007). However, AIVs have also been shown to antagonize IFN-a/b production in chicken embryo fibroblasts (CEF) and in chickens (Cauthen et al., 2007; Li et al., 2006). Furthermore, microarray analysis of monocytes/macrophages infected with low pathogenic AIV showed repression of interferon receptor gene expression (Keeler et al., 2007). The ability of AIV’s to antagonize IFN activity has been linked to the viral NS1 protein (Cauthen et al., 2007; Li et al., 2006). Moreover, Li et al. (2006) showed that amino acid residue Ala149 of the NS1 protein correlates with the ability of avian influenza viruses to antagonize IFN induction in CEFs. Other immune response elements, such as the Mx protein, have been shown to play a role in influenza virus infections (Krug et al., 1985; Pavlovic et al., 1992; Ruff, 1983; Staeheli and Haller, 1987). However, the contribution of avian Mx proteins as antiviral elements in AIV infection in birds is not well defined. Transfected chicken cells expressing chicken Mx protein showed no enhanced resistance to several viruses including influenza A virus (Bernasconi et al., 1995). It also has been reported that Mx variations occur in different breeds of chicken; however, in some breeds the Mx gene demonstrated to confer positive antiviral responses to influenza virus while others did not (Ko et al., 2002). To better understand differences in host responses to infection with distinct AIVs, we initially compared levels of gene expression in CEFs infected with AIVs using microarray technology. Microarray-based gene expression profiling technology has proven to be a powerful tool that helps in the identification of several thousands of transcripts and compares the expression patterns between many different samples (Lockhart et al., 1996). It has been used successfully in the investigation of virus–host interactions in many model systems (Almeida et al., 2007; Geiss et al., 2002; Keeler et al., 2007; Li et al., 2008; Mo et al., 2007; Munir et al., 2005; Tong et al., 2004). Over the past few years several chicken microarrays have been developed (Afrakhte

and Schultheiss, 2004; Burnside et al., 2005; Li et al., 2008; Smith et al., 2006; van Hemert et al., 2003). In this study we chose a 60-mer 44K chicken whole genome custom array. This microarray has been previously characterized using different chicken tissues and primary chicken trachea epithelial cells, and has proven to be useful to investigate different biological processes (Li et al., 2008; Zaffuto et al., 2008). In addition to the microarray studies, semi-quantitive RTPCR was performed on specific genes involved in the innate immune response to study their expression later in the course of infection. The results of these studies can greatly enhance our understanding of the molecular mechanisms related to AIV infection. 2. Materials and methods 2.1. Viruses, cells and antibodies Two highly pathogenic avian influenza H5N1 viruses, A/CK/Hong Kong/220/97 (CK/HK/97) and A/Egret/ Hong Kong/757.2/02 (Egret/HK/02), were used in this study. Both viruses produce 100% mortality in chickens after intranasal inoculation; however, CK/HK/97 induces a lower mean death time and replicates to higher titers in tissues than Egret/HK02 (Pantin-Jackwood-unpublished data). Virus stocks were prepared from the second passage in 10-day-old embryonated chicken eggs. The allantoic fluid collected from inoculated eggs was harvested, divided into aliquots, and stored at 80 8C until use. The infectivity of stock viruses was determined in 10-day-old embryonated chicken eggs according to standard procedures described previously (Pantin-Jackwood and Swayne, 2007). Chicken embryo fibroblasts (CEF) were prepared from 10-day-old chicken embryos of specific-pathogen-free (SPF) eggs and were cultured at 37 8C and 5% CO2 in Dulbecco’s modified Eagle’s medium (DMEM) (Gibco (Invitrogen), Carlsbad, CA) supplemented with fetal calf serum (FBS) and antibiotics. Twenty-four hours after preparation of the cells, cells were counted with hemocytometer and adjusted to 1  105 or 1  106 for virus growth kinetics or RNA extraction, respectively. For each experiment, cells for the purpose of virus infection or mock infection were prepared on the same day and under the same conditions. Mouse anti-chicken IFN-a antibody was obtained from AbD Serotec (Raleigh, NC). All experiments using HPAI H5N1 viruses were performed in biosecurity level-3 Ag facilities at the Southeast Poultry Research Laboratory (SEPRL), Agricultural Research Service, United States Department of Agriculture (USDA).

L. Sarmento et al. / Veterinary Immunology and Immunopathology 125 (2008) 291–302

2.2. Virus growth curves The growth curves of the viruses were determined by virus titration of cell culture supernatants at different time points after infection. Virus titers were determined by cytopathic effect (CPE) and reported as tissue culture infectious dose 50% (TCID50). The TCID50 assay end point was calculated by the method of Reed and Muench (1938). Titers obtained from three independent experiments were analyzed statistically by one-way ANOVA (GraphPad Software Inc., San Diego, CA). Briefly, 1  105 CEF were infected with each virus at a multiplicity of infection (MOI) of 0.005 in DMEM containing 10% FBS and antibiotics. Following adsorption for 1 h at 37 8C, nonadsorbed viruses were removed and DMEM was replaced. At 0, 12, 24, 36, 48 and 56 h post-infection (hpi), supernatants were collected and stored at 80 8C until used. 2.3. RNA extraction Primary CEFs (1  106) cultured in 25 cm2 Corning cell culture flasks (Corning, Corning, NY) were infected with either virus at a MOI of 10 in DMEM containing 10% FBS and antibiotics or mock infected by treatment with the same medium alone without the addition of virus. Total RNA was extracted from infected cells at 4 hpi for subsequent microarray hybridization. For the semi-quantitive RT-PCR, total RNA was extracted from infected or mock-infected cells at 24 hpi. For the microarray analysis RNA from four replicates were tested individually and for the RT-PCR, RNA from the four replicates were pooled. In all procedures, cells were lysed with Trizol Reagent (Invitrogen, Carlsbad, CA) according to manufacturer’s instructions with a few modifications. Briefly, cells were lysed with 1.5 ml of Trizol reagent and incubated at room temperature (RT) for 5 min. Cell lysates were then transferred to 15 ml tubes in which 0.26 ml of chloroform was added. After 10 min incubation, samples were centrifuged at 1811  g for 15 min. The aqueous phase was transferred to a fresh tube and RNA was precipitated by adding 0.75 ml of isopropanol. Samples were incubated for 20 min at 20 8C and centrifuged at 16,000  g for 15 min. Pellets were then washed with 100 ml of 70% ethanol for 10 min and dissolved in 50 ml of DEPC-H2O containing 1% RNase inhibitor (Ambion, Austin, TX). Lithium chloride (0.5 volumes of 7.5 M) (Ambion) was added and samples were incubated at 20 8C for 2 h. Samples were then centrifuged at 16,000  g for 15 min and washed three times with 70% ethanol. Finally, RNA

293

was dried and resuspended in DEPC-H2O containing 1% RNase inhibitor and stored at 80 8C. The total RNA concentration was determined by using a Nanodrop spectrophotometer (Nanodrop Technologies, Wilmington, DE) and the RNA quality was assessed with Agilent Technologies 2100 Bioanalyzer (Agilent, Santa Clara, CA). 2.4. Microarray hybridization and analysis For the microarray hybridization, fluorescent (cyanine 3- or cyanine 5) cRNA was prepared from total RNA extracted at 4 hpi from infected cells using the Low RNA Input Linear Amplification kit (Agilent Technologies). Complete chicken genome (44K) microarray slides were purchased from Agilent Technologies (Santa Clara, California, USA) and labelled cDNAs were hybridized for 17 h at 65 8C with gene expression hybridization solution (Agilent Technologies). Differential expression measurements between Egret/HK/02 and CK/HK/97 infected cells based on simultaneous two-color hybridizations were performed with a GenePix professional 4200A scanner and the GenePix Pro 6.1 data acquisition and analysis software (Molecular Devices, Sunnyvale, CA). The intensity ratio of expression for each gene was calculated by dividing the measured virus Egret/HK/ 02 values (test channel) by the intensity of the virus CK/ HK/97 (control channel). Gene Spring GX software (Agilent Technologies) was used for the normalization and statistical analysis of the GenePix output. Geneontology classification and annotations were assessed by the ontology tool Database for Annotation, Visualization, and Integrated Discovery (DAVID) (http://david.abcc.ncifcrf.gov) and searches using the National Center for Biotechnology Information (NCBI) database. 2.5. Reverse transcription PCR (RT-PCR) The presence of chicken MHC I, MEK2, PDCD10, Bcl-3, MX1, IFN-a, IL-8 and b-actin mRNAs in virusinfected and mock-infected CEFs were determined using the Qiagen One step RT-PCR enzyme mix (Qiagen, Valencia, CA) according to manufacturers’ instructions. Primers were synthesized by the Integrated DNA Technologies, Inc. (Coralville, IA) and are listed in Table 1. Sequences of primers for IFN-a, IL-8 and bactin has been previously published (Xing and Schat, 2000). All other primers were designed based on NCBI nucleotide sequences (Table 1). The reactions were carried out in a 50 ml final volume reaction using 100 ng

294

L. Sarmento et al. / Veterinary Immunology and Immunopathology 125 (2008) 291–302

Table 1 Primer sequences for semi-quantitive reverse transcription-PCR assays Gene

50 ! 30 upstream primer

50 ! 30 downstream primer

GeneBank accession no.

MEK2 MHC I PDCD10 BCL-3 Mx1 IFN-a IL-8 b-Actin

CAAAGTGGGAGAGCTGAAGG CTACTTCCTGACCGGGATGA ATCAAGGATATCGCCAGTGC CATGTTTCGAGAGCCAGACA ATCCATGGTCCAACTTCAGC ATGGCTGTGCCTGCAAGCCCA GGCCTCCTCCTGGTTTCAGCTGC CCCCCGTGCTGTGTTCCCATCTATCG

CCCCATAGAAACCCACAATG ACTGATCGTACCCTCGGATG CAGGCCACAGTTTTGAAGGT AGGCTCCAAATCAGAAGCAA GCCTCTTGGACACTTTCTGC AGTGCGCGTGTTGCCTGTCA GCACTCCAGGGGAGCAGG GGGTGCTCCTCAGGGGCTACTCTCAG

L28703 NM001030675.1 NM001006554 XM001233049 NM204609 EU367971 DQ393272.2 EU309690.1

MEK2, mitogen-activated protein kinase kinase 2; MHC I, major histocompatibility complex class I; PDCD10, programmed cell death 10; Bcl-3, Bcell leukemia/lymphoma 3; Mx, myxovirus resistance; IFN, interferon; IL, interleukin.

of total RNA. The following thermal cycler conditions were used: 50 8C for 30 min, 95 8C for 15 min, 94 8C for 30 s, 58 8C for 1 min, 72 8C for 1 min and a final step of 72 8C for 10 min. The PCR products were detected on 1.5% agarose gel and used directly for sequencing in order to confirm the identity of the genes. Sequencing was performed with an ABI 3730XL DNA analyzer. Bands were quantified using the Image Processing and Analysis in Java (ImageJ) (http:// rsb.info.nih.gov/ij/) and normalized to b-actin control. Gene expression of mock-infected cells was arbitrarily set to 1. 2.6. Interferon-a enzyme-linked immunosorbent assay (ELISA) The amount of IFN-a secreted from infected cells at 0, 6, 12, 24, 36, 48 and 56 hpi was analyzed by ELISA. Protein concentrations were determined using Pierce BCA Protein Assay kit according to manufacturer’s instructions (Pierce Biotechnology, Rockford, IL). Briefly, a 96-well plate was coated with 300 ng of each supernatant sample diluted in carbonate solution (0.5 M sodium carbonate, pH 9.6) for 2 h at 37 8C. Next, the plate was washed three times with phosphate buffer saline (PBS) and blocked in blocking solution (5% non-fat dry milk, 1% Tween-20) for 30 min at room temperature (RT). The plate was washed and incubated with a mouse monoclonal anti-chicken IFN antibody specific to IFN-a (Serotec, Raleigh, NC) diluted in blocking solution. After 1 h at RT, the plate was washed with PBS and incubated with horseradish peroxidase-conjugated goat anti-mouse for 1 h at RT. After washing three times with PBS, o-phenylenedianime dihydrochloride (OPD) (Sigma–Aldrich, St. Louis, MO) was added for color development. The absorbance was read at 450 nm in a Multiskan Ascent plate reader (MTX Lab Systems, Inc., Vienna, VA).

2.7. NS1 sequence comparison The NS1 amino acid sequences of Egret/HK/02 and CK/HK/97 (Influenza Sequence Database (ISD), accession no.: AY576371 and AF046083, respectively) were aligned with Clustal V (Lasergene 7.0; DNAStar, Madison, WI). 3. Results 3.1. Growth kinetics of H5N1 viruses Comparison of the growth characteristics of CK/HK/ 97 and Egret/HK/02 in CEF are shown in Fig. 1. CEFs support growth of both viruses with titers increasing until 48 hpi. There were no significant differences in virus titers up to 12 hpi, however at 24, 36, 48, and 56 hpi, statistical differences were observed. The titer of CK/HK/97 was 1000-fold higher at 48 hpi relative to Egret/HK/02. Differences in replication of these two viruses in CEF are consistent with their relative phenotypes in chickens. 3.2. Gene expression profile of Egret/HK/02 versus CK/HK/97 infected CEFs To investigate differences in CEF gene expression upon infection with CK/HK/97 or Egret/HK/02, we used a chicken genomic microarray containing 42,201 oligonucleotides representing the entire chicken genome. In total, we observed changes in the transcription of 6290 cellular genes (P < 0.05) between cells infected with CK/HK/97 and Egret/HK/02. Of these genes, 191 had an altered expression pattern by a factor of 2 or greater. Overall analysis of the microarray data by gene ontology revealed that Egret/HK/02 and CK/HK/97 differentially affected the expression of many transcripts that are important in host defense/immune

L. Sarmento et al. / Veterinary Immunology and Immunopathology 125 (2008) 291–302

295

Fig. 1. Kinetics of CEF infection by Egret/HK/02 and CK/HK/97. Cells were infected with an MOI of 0.005. Supernatants from infected cells were harvested at 0, 12, 24, 36, 48, and 56 h after infection. Virus titers were determined by cytopathic effect (CPE) and reported as tissue culture infectious dose (TCID50). n = 3, *P < 0.05.

response, protein metabolism, translation, transcription, cell cycle and ubiquitination, such as major histocompatibility (MHC class I), proprotein convertase subtilisin/kexin type 7 (PCSK7), eukaryotic translation initiation factor 5A2 (EIF5A2), pre-B-cell leukaemia transcription factor 3 (PBX3), cyclin-dependent kinaselike 1, and ubiquitin carboxyl-terminal hydrolase 5, respectively (Table 2). For genes involved in host defense/immune response, as well as protein metabolism and translation, the majority of the genes identified had decreased expression levels in Egret/HK/02 infected cells compared to CK/HK/97. For genes involved in transcription, the number of genes with increased or decreased expression levels in Egret/HK/ 02 infected cells compared to CK/HK/97 was similar. For genes involved in cell cycle, the majority had increased expression level in Egret/HK/02 infected cells compared to CK/HK/97. Of the 191 genes that presented differential expression with at least twofold difference, 10 were associated with host defense/immune response. Genes in this category included major histocompatibility (MHC) class I gene, macrophage migration inhibitory factor (MIF), matrix metalloproteinase 9 (MMP9) and mitogen-activated protein kinase kinase 2 (MEK2). Analysis of genes that were statistically significant (P < 0.05) but did not exceed the twofold threshold, revealed that several of them were related to immunity (Table 3). These genes included, but were not limited to, interferon regulatory factor 10 (IRF10), interleukin 2 receptor (IL2RG), RNA-specific adenosine deaminase (ADAR), MHC class II, signal transducer and activator of transcription (STAT3), SMAD1 and Janus tyrosine kinase (JAK). Other altered genes of interest included the apoptotic genes programmed cell death (PDCD10),

BCL-3 binding protein, Bcl-2 related ovarian killer (BOK) and DIABLO/Smac. 3.3. Assessment of expression of selected genes at 4 and 24 hpi by semi-quantitive RT-PCR Four differentially expressed genes (P < 0.05) involved in host defense/immune response were selected and gene expression levels were assessed by RT-PCR at 4 and 24 hpi. The transcripts included were MHC class I, MEK2, PDCD10 and BCL-3. The RNA from mock-infected cells was also included in the analyses to better understand the effect of the viruses on the expression of these specific genes. RT-PCR was also performed for the housekeeping gene b-actin with RNA from infected and mock-infected cells. Sequencing data confirmed the identity of all genes amplified. As shown in Fig. 2, differences in gene expression between cells infected with Egret/HK/02 and CK/HK/97 were observed by RT-PCR at 4 hpi, confirming the microarray data. Furthermore, differences in the gene expression levels were clear for the genes analyzed at 24 hpi, especially MEK2, which infection with Egret/ HK/02 completely repressed. Comparing the level of expression of MHC I, there is a clear difference in the expression of this gene between the virus infected samples. Both viruses induced a down-regulation of this gene when compared to its expression in the mockinfected control cells at 24 hpi. However, this effect was most dramatic in cells infected with Egret/HK/02, where at 24 hpi it resulted in a decrease in the expression of MHC class I to almost undetectable levels. For the expression levels of the anti-apoptotic genes PDCD10 and Bcl-3, Egret/HK02 induced an increase in the level of expression of both genes at 4 hpi.

296

L. Sarmento et al. / Veterinary Immunology and Immunopathology 125 (2008) 291–302

Table 2 Functional grouping of genes differentially expressed (2-fold and P < 0.05, n = 4) between Egret/HK/02 and CK/HK/97 infected CEF at 4 hpi Functional groups

GeneBank accession no.

Fold changea

t-test P value

Host defense/immune response Heat shock 70 kDa protein 4-like (HSPA4L) MHC class I antigen Death effector domain-containing protein (DEDD) Matrix metalloproteinase 9 (MMP9) Similar to sphingomyelin phosphodiesterase 1 Macrophage migration inhibitory factor (MIF) Mitogen-activated protein kinase kinase 2 (MEK2) Isocitrate dehydrogenase 3; gamma STIP1 homology and U-box containing protein 1 (STUB1) Flightless I homolog (FLII)

AJ851652 BX935231 CR407323 AF222690 BU437761 A_87P0402 L28703 BX931431 AJ720999 AJ719674

2.028 0.499 0.46 0.46 0.44 0.427 0.42 0.384 0.415 0.41

0.00217 0.00155 0.0108 0.00404 0.0228 0.0416 0.009 0.00222 0.00327 0.0111

Protein/nucleotide metabolism Microsomal signal peptidase 21 kDa (SEC11L3) Similar to F-box only protein 11 (FBXO11) Prolyl endopeptidase (PREP) Dopamine receptor interacting protein (DNAJC14) Cas-Br-M (murine) ecotropic retroviral transforming sequence-like 1 (CBLL1) Proprotein convertase subtilisin/kexin type 7 (PCSK7) Carboxypeptidase A1 (pancreatic) (CPA1) Tissue inhibitor of metalloproteinase 2 (TIMP2)

BX935228 CR391648 AJ719397 CR385098 AJ720990 AJ719509 X64539 AF004664

2.28 2.208 2.177 0.5 0.49 0.39 0.31 0.28

0.0052 0.00536 0.0201 0.0149 0.0242 0.00743 7.65E-05 0.0168

Regulation of transcription cAMP responsive element modulator isoform 18 (ICER) Tryptophanyl-tRNA synthetase (WARS) Polymerase (RNA) I polypeptide D isoform 2 Pre-B-cell leukemia transcription factor 3 (PBX3) WD repeat domain 8 (WDR8) Similar to transcription factor ELYS Similar to engulfment and cell motility 2 (ELMO2) Transcription factor 3 (E12/E47) THO complex 3 (THOC3) Similar to paired-type homeobox Atx (DMBX1) Similar to serum response factor (SRF) Helix-loop-helix protein (ID3)

BX934897 BX933994 BX934581 AJ719751 AJ720648 TC192712 CR353440 AJ719920 CR733192 AF461038 U50596 AY040528

2.405 2.35 2.259 2.138 2.063 2.048 0.473 0.46 0.449 0.393 0.39 0.36

0.0399 0.0046 0.00145 0.0218 0.0124 0.0149 0.0108 0.0163 0.00248 0.00165 0.0142 0.0212

Translation Eukaryotic translation initiation factor 5A2 (EIF5A2) Seryl-tRNA synthetase (SARS) Eukaryotic translation elongation factor 2 (EEF2)

M99499 AJ719509 U46663

0.47 0.31 0.3

0.00205 0.00104 0.00686

Cell cycle SMC2 structural maintenance of chromosomes 2-like 1 (SMC2L1) Inner centromere protein antigens 135/155 kDa (INCENP) THAP domain containing 5 Similar to cyclin-dependent kinase-like 1 (CDC2-related kinase) Coiled-coil domain containing 5 (spindle associated) Glycogen synthase kinase 3 beta

X80792 Z25420 AJ721099 TC193805 CV859326 TC210716

2.752 2.685 2.104 2.028 2.021 0.463

0.0163 0.0217 0.0365 0.00727 0.0473 0.0151

Ubiquitin/proteosome PRP19/PSO4 pre-mRNA processing factor 19 homolog Similar to ubiquitin carboxyl-terminal hydrolase 5 (ubiquitin thiolesterase 5) Similar to ubiquitin-activating enzyme E1-like

AJ719482 A87P038245 CR391623

0.434 0.448 0.483

0.00845 0.0285 0.0272

a

Fold change, in terms of transcription ratios, represents Egret/HK/02-infected CEF cell transcript/CK/HK/97-infected CEF cell transcript at 4 hpi.

Nevertheless, at 24 hpi when comparing Egret/HK/02 to the mock, the expression was very similar, whereas infection with CK/HK/97 clearly caused repression in the expression of these genes. Although the microarray

data showed no differential effect of infection with Egret/HK/02 and CK/HK/97 on expression of IFN-a, Mx1 and IL-8 at 4 hpi, at 24 hpi RT-PCR revealed a down-regulation of Mx1 and IL-8 expression levels

L. Sarmento et al. / Veterinary Immunology and Immunopathology 125 (2008) 291–302

297

Table 3 Partial list of differentially expressed genes (<2-fold and P < 0.05, n = 4) involved in host defense in CEF infected with Egret/HK/02 or CK/HK/97 Gene name and symbol

GeneBank

Fold changea

t-test P value

Transcription factor 8 (represses interleukin 2 expression) Programmed cell death 10 (PDCD10) Rabaptin; RAB GTPase binding effector protein 1 Similar to RAB30 Leukaemia inhibitory factor receptor (LIFR) Interleukin 1 receptor-like (IL1RL) Similar to Nedd4 binding protein 2; BCL-3 binding protein Mitogen-activated protein kinase kinase kinase 5 Interleukin-1 receptor-associated kinase 2 (IRAK2) Similar to interleukin-4 receptor alpha-chain 52 kDa repressor of the inhibitor of the protein kinase (P52rIPK) Toll-like receptor 15 (TLR 15) Similar to interleukin 28 receptor alpha (IL28RA) Similar to suppressor of cytokine signaling 1 (SOCS-1) Tumor necrosis factor receptor member 18 (TNFRSF18) TNF-related apoptosis inducing ligand-like protein Tumor necrosis factor; alpha-induced protein 1 (TNFAIP1) Similar to TNF receptor-associated factor 2 Similar to interferon-induced 35 kDa protein (IFP 35) Similar to SMAD1 MHC class II beta chain Tumor necrosis factor; alpha induced protein 6 (TNFAIP6) Janus tyrosine kinase (JAK) Similar to ATP-dependant interferon response protein 1 Interferon regulatory factor 10 (IRF10) Interleukin 2 receptor; gamma (IL2RG) Mitogen-activated protein kinase 1 (MAPK1) Similar to interleukin 17 receptor (IL17R) Similar to Diablo homolog (Smac/DIABLO) Similar to adenosine deaminase (ADAR) Similar to interleukin enhancer binding factor 2 (ILF2) Signal transducer and activator of transcription 3 (STAT3) Signal transducer and activator of transcription 5B (STAT5) Laminin; beta 2 (LAMB2)

D14313 CR387835 D38038 TC208907 AJ416111 AB041738 CR523668 CF253512 AJ851768 CR407301 CR523742 DQ267901 BX935722 BX932033 AJ719323 BM440520 AJ851702 CV858509 BX934680 AY953143 U76305 DQ275160 AF034576 TC197309 AF380350 AJ419896 AY033635 BX933298 CR353660 AM179858 BX929375 AY641397 AF144565 AF038555

1.984 1.974 1.958 1.891 1.827 1.784 1.765 1.696 1.539 1.448 1.329 1.243 1.242 1.209 1.14 0.871 0.84 0.826 0.802 0.798 0.789 0.788 0.765 0.752 0.719 0.719 0.715 0.631 0.626 0.619 0.619 0.618 0.61 0.518

0.0104 0.00393 0.0346 0.00879 0.00459 0.0203 0.00303 0.0162 0.0393 0.0162 0.0414 0.0086 0.0121 0.0441 0.00616 0.0166 0.031 0.0176 0.00323 0.0126 0.0013 0.0333 0.0218 0.0213 0.0214 0.0386 0.0233 0.0314 0.00173 0.0345 0.000889 0.00842 0.0179 0.0349

a

Fold change, in terms of transcription ratios, represents Egret/HK/02-infected CEF cell transcript/CK/HK/97-infected CEF cell transcript at 4 hpi.

after infection with Egret/HK/02 and an up-regulation of Mx1 and IFN-a expression levels after infection with CK/HK/97 (Fig. 3) when compared to the controls. Sequencing data also confirmed the identity of these genes. 3.4. IFN-a protein levels increased in culture supernatants of CK/HK/97 infected cells To determine if increased IFN-a gene expression resulted in increased protein synthesis, the amount of secreted IFN-a at various time points was measured by ELISA using a monoclonal mouse anti-chicken IFN-a antibody. Consistent with the RT-PCR analysis of IFNa mRNA expression, we found differential levels of IFN-a production between cells infected with Egret/ HK/02 and CK/HK/97, peaking at 24 hpi, in which a twofold increase was observed (Fig. 4). These data

indicate that the increased expression of IFN-a gene in CK/HK/97 infected cells also resulted in increased IFNa protein synthesis. 3.5. Comparison of the NS1 amino acid sequence of Egret/HK/02 and CK/HK/97 The NS1 amino acid sequences of Egret/HK/02 and CK/HK/97 (Influenza Sequence Database (ISD), accession no.: AY576371 and AF046083, respectively) were compared. Based on the analysis, the Egret isolate contains five-amino acid deletions at positions 80–84. Egret/HK/02 also has residues Phe103 and Met106, while CK/HK/97 has Leu103 and Ile106. Comparison of the NS1 sequences also revealed a glutamic acid at position 92 of the CK/HK/ 97 isolate. In contrast, Egret/HK/97 contains aspartic acid at this position.

298

L. Sarmento et al. / Veterinary Immunology and Immunopathology 125 (2008) 291–302

Fig. 3. Expression of genes involved in the innate immune response in CEFs infected with Egret/HK/02 or CK/HK/97. Total RNAs were prepared from 1  106 cells 24 h after infection. One step RT-PCR reactions were carried out in a 50 ml final reaction volume using 100 ng of pooled total RNA from 4 replicates. cDNAs were amplified using primers specific for Mx1, IFN-a, and IL-8. Measurements of band intensities are indicated. Mx1, myxovirus resistance; IFN, interferon; IL, interleukin; M, mock-infected; E, Egret/HK/02; C, CK/HK/97.

Fig. 2. Expression of host response genes in CEFs infected with Egret/HK/02 or CK/HK/97. Total RNA was prepared from 1  106 cells 4 and 24 h after infection. One step RT-PCR reactions were carried out in a 50 ml final reaction volume using 100 ng of pooled total RNA from 4 replicates. cDNAs were amplified using primers specific for MEK2, MHC I, PDCD10, and Bcl-3. Measurements of the band intensities are indicated. MEK2, mitogen-activated protein kinase kinase 2; MHC I, major histocompatibility complex class I; PDCD10, programmed cell death 10; Bcl-3, B-cell leukemia/lymphoma 3; M, mock-infected; E, Egret/HK/02; C, CK/HK/97.

4. Discussion Very early in the infection, viruses are capable of triggering a series of intracellular events which may be accompanied by changes in host gene expression (Iannello et al., 2006; Korth and Katze, 2002). Influenza

viruses in particular have acquired the capability to take advantage and, in many cases, interfere with a wide range of antiviral cellular immune responses to efficiently replicate and propagate (Battcock et al., 2006; Garcia-Sastre, 2001; Hayman et al., 2006; Hinshaw et al., 1994; Kochs et al., 2007; Ludwig et al., 2002, 2006; Pleschka et al., 2001; Schultz-Cherry et al., 2001; Wurzer et al., 2004; Zhirnov et al., 1999). However, recent data indicate that influenza viruses may vary in their ability to induce or suppress the expression of critical host genes involved in the innate immune response (Hayman et al., 2006; Wang et al., 2005). The majority of these studies nevertheless focus on influenza A viruses using mammalian systems. In the present study, we compared the changes in cellular gene expression after infection with two H5N1

Fig. 4. Expression of IFN-a protein in CEFs infected with Egret/HK/02 or CK/HK/97. Supernatants from virus infected cells or mock-infected were harvested at 0, 6, 12, 24, 36, 48 and 56 h after infection. The presence of IFN-a protein was detected by ELISA by using 300 ng of supernatant samples from three replicates for each time points.

L. Sarmento et al. / Veterinary Immunology and Immunopathology 125 (2008) 291–302

highly pathogenic AIVs. For this purpose, we used primary CEFs which are readily used to study AIV infections (Cauthen et al., 2007; Lee et al., 2007; Toroghi and Momayez, 2006) because of its high susceptibility to AIVs. The use of CEFs also provide the opportunity to detect changes in gene expression very early in the course of infection and under controlled conditions. Analysis of the microarray data suggests that the viruses regulate in a different manner several elements of the host response. This was also confirmed by RT-PCR on selected genes although fold changes were not identical in all cases. This was not surprising due to the different nature of the procedures. However, microarray analysis is a very good indicator of global changes in gene expression due to infection with AIVs, and as shown here, can be used to directly compare the effect of different AIVs on the host response. Mitogen-activated protein kinase kinase 2 (MEK2) was one of the genes in which its expression was chosen to be further studied because of its potential role in AIV infections. In mammals, influenza virus-induced Raf/ MEK/ERK signaling cascade is crucial for efficient virus replication. Blockade of this pathway results in nuclear retention of viral ribonucleoprotein complexes and impaired nuclear export protein (NEP/NS2) resulting in reduction of virus production (Pleschka et al., 2001). In our experiment, MEK2 expression was reduced as early as 4 hpi and completely suppressed in Egret/HK/02 infected cells at 24 hpi, whereas MEK2 expression was up-regulated in CK/HK/97 infected cells. We found significant differences in virus growth kinetics in our experiment. Therefore, it is possible that replication of the viruses is associated with their ability to modulate elements of MAPK signaling pathway. This is supported by previous studies in which influenza A viruses that differ substantially in their replication efficiency in tissue culture led to substantial differences in their ability to regulate the Raf/MEK/ERK signaling cascade (Marjuki et al., 2007). Studies have demonstrated that viruses have evolved mechanisms to inhibit MHC class I expression by interfering with the function of the MHC class I assembly machinery in the endoplasmic reticulum and by exploiting endoplasmic-reticulum-associated degradation pathways (Yewdell and Bennink, 1999). In our study, repression of MHC class I mRNA expression by infection with either viruses, yet at different levels, was not surprising, because it has been shown that the ability of influenza viruses to modulate the mRNA expression of MHC class I varies. In one study, an influenza A virus (H3N2) up-regulated MHC class I mRNA expression levels (Tong et al., 2004). In another study, the

299

expression of MHC class I did not increase due to infection of macrophages with a low pathogenic H7N2 AIV (Keeler et al., 2007). Thus, it is possible that highly pathogenic viruses such as the ones used in our study have evolved mechanisms to inhibit MHC class I expression. It has been shown that influenza viruses induce apoptosis both in vitro and in vivo (Fesq et al., 1994; Hinshaw et al., 1994; Ito et al., 2002; Palmai et al., 2007; Price et al., 1997; Takizawa et al., 1999). The effect of infection with CK/HK/97 on expression of PDCD10 and Bcl-3, two inhibitors of apoptosis, was especially clear late in the infection (24 hpi) in which expression of both genes were repressed. The functional role of these two anti-apoptotic genes upon influenza virus infections has not been investigated. However, studies have shown that at least one of the functions of Bcl-3 is to regulate the activity of NF-kB transcription factors (Nolan et al., 1993). NF-kB is known to regulate expression of anti-viral cytokines and to promote the induction of pro-apoptotic factors which, in the case of influenza viruses, may result in enhanced virus propagation (Wurzer et al., 2004). Differences in the expression levels of NF-kB and several caspase members were found in our study, however P-values for these genes were >0.05 in the microarray data analyses (data not shown). Additional experiments are warranted to further investigate their role in the pathogenesis of these viruses and to determine if they impact virus replication. Intriguingly, IFN-a was not listed in our microarray data and IFN-b showed a P-value >0.05. Albeit, genes involved in IFN-mediated signaling and transcription activation were differentially expressed in the infected cell, such as JAK, STAT3 and STAT5. IFN-a/b-induced proteins implicated in the antiviral activities also showed altered expression levels, including, ADAR, and MHC class I. All these genes were expressed less in Egret/HK/02 than in CK/HK/97 infected cells. Although we did not observe differences in the expression of IFN-a at 4 hpi with the two viruses studied, we found that the mRNA expression level at 24 hpi for IFN-a in CK/HK/97 infected cells increased significantly, while IFN-a gene expression remained unchanged upon infection with Egret/HK/02 relative to the negative control. Moreover, at all time points studied, CEFs released more IFN-a protein in response to CK/HK/97 infection compared to Egret/HK/02. These results corroborate that AIVs have a varied ability to induce and inhibit IFN, as does several human influenza viruses and other negative stranded RNA viruses (Hayman et al., 2006; Wang et al., 2005).

300

L. Sarmento et al. / Veterinary Immunology and Immunopathology 125 (2008) 291–302

Similarly to IFN-a, the microarray analyses also did not detect statistically significant differences in the expression of Mx1 and IL-8. Nonetheless, these genes have been reported to have critical roles in influenza virus pathogenesis (Bernasconi et al., 2005; Choi and Jacoby, 1992; Jewell et al., 2007; Jung and Chae, 2006; Turan et al., 2004). Mx proteins are believed to counteract influenza virus infection by interfering in different steps of the influenza virus multiplication cycle (Pavlovic et al., 1992). Interleukin-8, which is strongly dependent on NF-kB and AP-1 for its induction, contributes to influenza virus evasion of the immune system (Fernandez-Sesma et al., 2006). In our study, the expression of Mx1 and IL-8 were significantly down-regulated by infection with Egret/ HK/02. In contrast, the expression of Mx1 increased, while the expression of IL-8 remained unchanged in CEF infected with CK/HK/97. The fact that Egret/HK/ 02 prevented or down-regulated the expression of Mx1 and IL-8, in addition to IFN-a, may be a classic example of how influenza viruses evade the innate immune response; however, this did not seem to confer a replicative advantage to this virus. On the other hand, how CK/HK97 escapes the effects of these proinflammatory factors, especially IFN-a, remains to be uncovered. Nevertheless, as reported for other highly pathogenic 1997 influenza viruses, CK/HK/97 may be resistant to the antiviral effects of cytokines (Seo et al., 2002). Alternatively, CK/HK/97 may evade the innate immune system by multiplying extremely fast, and therefore rendering the host responses ineffective (Grimm et al., 2007). Viral factors that play a key role in influenza virus virulence are the surface glycoproteins hemagglutinin (HA) and neuraminidase (NA), the polymerase complex, and the nonstructural protein NS1 (Neumann and Kawaoka, 2006). Several studies have shown that the NS1 protein is responsible for the antagonistic activity of IFN in mammalian host cell lines (Quinlivan et al., 2005; Solorzano et al., 2005) by suppressing different components of the IFN induction and signaling cascade (Pichlmair et al., 2006; Talon et al., 2000; Wang et al., 2000). NS1 has also been shown to have IFN antagonist activity in chickens and in avian cell culture (Cauthen et al., 2007; Li et al., 2006) and this property was associated with residue Ala149 (Li et al., 2006). Comparison of the NS1 amino acid sequences of Egret/ HK/02 and CK/HK/97 revealed that both viruses have alanine at position 149; however, variation in the IFN induction profiles between Egret/HK/02 and CK/HK/97 were found. Therefore, it is unlikely that the presence of Ala149 in the viruses used in our study is responsible for

the observed differences in IFN regulation. However, comparison of the NS1 sequences did reveal several amino acid differences that have been associated with IFN activity in mammalian systems: residues Phe103 and Met106 in the Egret/HK/02 NS1 and glutamic acid at position 92 of the CK/HK/97 virus. Residues Phe103 and Met106 have recently been described as a new cleavage and polyadenylation specificity factor (CPSF) binding site (Kochs et al., 2007) associated with prevention of IFN-induced antiviral state in vitro (Kochs et al., 2007). Glutamic acid at position 92 has been associated with resistance to the antiviral effects of interferons and tumor necrosis factor a in pigs (Seo et al., 2002). This may explain in part why CK/HK/97 is able to replicate to high titers in cell culture despite inducing high levels of IFN expression. 5. Conclusion Microarray gene expression analysis has proven to be a useful tool for providing clues to the mechanisms involved in pathogenicity of AIVs. While future studies are necessary to better characterize how AIVs differentially affect host response, this study is the first step in understanding the complex events that occur during interactions between cells and AIVs. This study demonstrated that AIVs have varied ability to regulate host genes and this regulation initiates very early in the course of infection. In addition, we showed that avian influenza viruses also have different effects on expression of specific innate immune response genes. The regulation of host cell transcription upon infection with avian influenza viruses is most likely strain dependent and may be due to its specific virulence mechanisms and mode of replication. Therefore, even viruses that are phylogenetically related may have their own signature patterns of altering host responses during their replication process. In addition, differences in the NS1 protein were observed between the viruses studied that could account in part for the differences observed in expression of host genes. Further studies using reverse genetics are presently in progress to identify viral genes that are critical for the differential up-regulation or down-regulation of host genes. Acknowledgements The authors wish to thank Diane Smith, Tracy SmithFaulkner, and Kristin Zaffuto for their technical assistance; Melissa Scott and Joyce Bennett at the SAA sequencing facility at SEPRL for sequencing of host genes. The authors also would like to thank Mark

L. Sarmento et al. / Veterinary Immunology and Immunopathology 125 (2008) 291–302

Jackwood and Aleksandr Lipatov for reviewing this manuscript. This research was supported by USDA/ARS CRIS project # 6612-32000-039. Mention of trade names or commercial products in this manuscript is solely for the purpose of providing specific information and does not imply recommendation or endorsement by the U.S. Department of Agriculture. References Afrakhte, M., Schultheiss, T.M., 2004. Construction and analysis of a subtracted library and microarray of cDNAs expressed specifically in chicken heart progenitor cells. Dev. Dyn. 230, 290–298. Almeida, P.E., Weber, P.S., Burton, J.L., Tempelman, R.J., Steibel, J.P., Zanella, A.J., 2007. Gene expression profiling of peripheral mononuclear cells in lame dairy cows with foot lesions. Vet. Immunol. Immunopathol. 120, 234–245. Battcock, S.M., Collier, T.W., Zu, D., Hirasawa, K., 2006. Negative regulation of the alpha interferon-induced antiviral response by the Ras/Raf/MEK pathway. J. Virol. 80, 4422–4430. Bernasconi, D., Amici, C., La Frazia, S., Ianaro, A., Santoro, M.G., 2005. The IkappaB kinase is a key factor in triggering influenza A virus-induced inflammatory cytokine production in airway epithelial cells. J. Biol. Chem. 280, 24127–24134. Bernasconi, D., Schultz, U., Staeheli, P., 1995. The interferon-induced Mx protein of chickens lacks antiviral activity. J. Interferon Cytokine Res. 15, 47–53. Burnside, J., Neiman, P., Tang, J., Basom, R., Talbot, R., Aronszajn, M., Burt, D., Delrow, J., 2005. Development of a cDNA array for chicken gene expression analysis. BMC Genomics 6, 13. Cauthen, A.N., Swayne, D.E., Sekellick, M.J., Marcus, P.I., Suarez, D.L., 2007. Amelioration of influenza virus pathogenesis in chickens attributed to the enhanced interferon-inducing capacity of a virus with a truncated NS1 gene. J. Virol. 81, 1838–1847. Choi, A.M., Jacoby, D.B., 1992. Influenza virus A infection induces interleukin-8 gene expression in human airway epithelial cells. FEBS Lett. 309, 327–329. de Jong, M.D., Hien, T.T., 2006. Avian influenza A (H5N1). J. Clin. Virol. 35, 2–13. Fernandez-Sesma, A., Marukian, S., Ebersole, B.J., Kaminski, D., Park, M.S., Yuen, T., Sealfon, S.C., Garcia-Sastre, A., Moran, T.M., 2006. Influenza virus evades innate and adaptive immunity via the NS1 protein. J. Virol. 80, 6295–6304. Fesq, H., Bacher, M., Nain, M., Gemsa, D., 1994. Programmed cell death (apoptosis) in human monocytes infected by influenza A virus. Immunobiology 190, 175–182. Garcia-Sastre, A., 2001. Inhibition of interferon-mediated antiviral responses by influenza A viruses and other negative-strand RNA viruses. Virology 279, 375–384. Geiss, G.K., Salvatore, M., Tumpey, T.M., Carter, V.S., Wang, X., Basler, C.F., Taubenberger, J.K., Bumgarner, R.E., Palese, P., Katze, M.G., Garcia-Sastre, A., 2002. Cellular transcriptional profiling in influenza A virus-infected lung epithelial cells: the role of the nonstructural NS1 protein in the evasion of the host innate defense and its potential contribution to pandemic influenza. Proc. Natl. Acad. Sci. U.S.A. 99, 10736–10741. Grimm, D., Staeheli, P., Hufbauer, M., Koerner, I., Martinez-Sobrido, L., Solorzano, A., Garcia-Sastre, A., Haller, O., Kochs, G., 2007. Replication fitness determines high virulence of influenza A virus

301

in mice carrying functional Mx1 resistance gene. Proc. Natl. Acad. Sci. U.S.A. 104, 6806–6811. Hayman, A., Comely, S., Lackenby, A., Murphy, S., McCauley, J., Goodbourn, S., Barclay, W., 2006. Variation in the ability of human influenza A viruses to induce and inhibit the IFN-beta pathway. Virology 347, 52–64. Hinshaw, V.S., Olsen, C.W., Dybdahl-Sissoko, N., Evans, D., 1994. Apoptosis: a mechanism of cell killing by influenza A and B viruses. J. Virol. 68, 3667–3673. Iannello, A., Debbeche, O., Martin, E., Attalah, L.H., Samarani, S., Ahmad, A., 2006. Viral strategies for evading antiviral cellular immune responses of the host. J. Leukoc. Biol. 79, 16–35. Ito, T., Kobayashi, Y., Morita, T., Horimoto, T., Kawaoka, Y., 2002. Virulent influenza A viruses induce apoptosis in chickens. Virus Res. 84, 27–35. Jewell, N.A., Vaghefi, N., Mertz, S.E., Akter, P., Peebles Jr., R.S., Bakaletz, L.O., Durbin, R.K., Flano, E., Durbin, J.E., 2007. Differential type I interferon induction by respiratory syncytial virus and influenza a virus in vivo. J. Virol. 81, 9790–9800. Jung, K., Chae, C., 2006. Expression of Mx protein and interferonalpha in pigs experimentally infected with swine influenza virus. Vet. Pathol. 43, 161–167. Keeler Jr., C.L., Bliss, T.W., Lavric, M., Maughan, M.N., 2007. A functional genomics approach to the study of avian innate immunity. Cytogenet. Genome Res. 117, 139–145. Ko, J.H., Jin, H.K., Asano, A., Takada, A., Ninomiya, A., Kida, H., Hokiyama, H., Ohara, M., Tsuzuki, M., Nishibori, M., Mizutani, M., Watanabe, T., 2002. Polymorphisms and the differential antiviral activity of the chicken Mx gene. Genome Res. 12, 595–601. Kochs, G., Garcia-Sastre, A., Martinez-Sobrido, L., 2007. Multiple anti-interferon actions of the influenza A virus NS1 protein. J. Virol. 81, 7011–7021. Korth, M.J., Katze, M.G., 2002. Unlocking the mysteries of virus–host interactions: does functional genomics hold the key? Ann. N.Y. Acad. Sci. 975, 160–168. Krug, R.M., Shaw, M., Broni, B., Shapiro, G., Haller, O., 1985. Inhibition of influenza viral mRNA synthesis in cells expressing the interferon-induced Mx gene product. J. Virol. 56, 201–206. Lee, C.W., Lee, Y.J., Swayne, D., Senne, D., Linares, D.J., Suarez, D., 2007. Assessing potential pathogenicity of avian influenza virus: current and experimental system. Avian Dis. 51, 260–263. Li, X., Chiang, H.I., Zhu, J., Dowd, S.E., Zhou, H., 2008. Characterization of a newly developed chicken 44K Agilent microarray. BMC Genomics 9, 60. Li, Z., Jiang, Y., Jiao, P., Wang, A., Zhao, F., Tian, G., Wang, X., Yu, K., Bu, Z., Chen, H., 2006. The NS1 gene contributes to the virulence of H5N1 avian influenza viruses. J. Virol. 80, 11115–11123. Lockhart, D.J., Dong, H., Byrne, M.C., Follettie, M.T., Gallo, M.V., Chee, M.S., Mittmann, M., Wang, C., Kobayashi, M., Horton, H., Brown, E.L., 1996. Expression monitoring by hybridization to high-density oligonucleotide arrays. Nat. Biotechnol. 14, 1675– 1680. Ludwig, S., Pleschka, S., Planz, O., Wolff, T., 2006. Ringing the alarm bells: signalling and apoptosis in influenza virus infected cells. Cell. Microbiol. 8, 375–386. Ludwig, S., Wang, X., Ehrhardt, C., Zheng, H., Donelan, N., Planz, O., Pleschka, S., Garcia-Sastre, A., Heins, G., Wolff, T., 2002. The influenza A virus NS1 protein inhibits activation of Jun N-terminal kinase and AP-1 transcription factors. J. Virol. 76, 11166–11171. Marjuki, H., Yen, H.L., Franks, J., Webster, R.G., Pleschka, S., Hoffmann, E., 2007. Higher polymerase activity of a human

302

L. Sarmento et al. / Veterinary Immunology and Immunopathology 125 (2008) 291–302

influenza virus enhances activation of the hemagglutinin-induced Raf/MEK/ERK signal cascade. Virol. J. 4, 134. Mo, X.Y., Ma, W., Zhang, Y., Zhao, H., Deng, Y., Yuan, W., Wang, Y., Li, Y., Zhu, C., Liu, M., Wu, X., 2007. Microarray analyses of differentially expressed human genes and biological processes in ECV304 cells infected with rubella virus. J. Med. Virol. 79, 1783–1791. Munir, S., Sharma, J.M., Kapur, V., 2005. Transcriptional response of avian cells to infection with Newcastle disease virus. Virus Res. 107, 103–108. Neumann, G., Kawaoka, Y., 2006. Host range restriction and pathogenicity in the context of influenza pandemic. Emerg. Infect. Dis. 12, 881–886. Nolan, G.P., Fujita, T., Bhatia, K., Huppi, C., Liou, H.C., Scott, M.L., Baltimore, D., 1993. The bcl-3 proto-oncogene encodes a nuclear I kappa B-like molecule that preferentially interacts with NF-kappa B p50 and p52 in a phosphorylation-dependent manner. Mol. Cell. Biol. 13, 3557–3566. Palmai, N., Erdelyi, K., Balint, A., Marton, L., Dan, A., Deim, Z., Ursu, K., Londt, B.Z., Brown, I.H., Glavits, R., 2007. Pathobiology of highly pathogenic avian influenza virus (H5N1) infection in mute swans (Cygnus olor). Avian Pathol. 36, 245–249. Pantin-Jackwood, M.J., Swayne, D.E., 2007. Pathobiology of Asian highly pathogenic avian influenza H5N1 virus infections in ducks. Avian Dis. 51, 250–259. Pavlovic, J., Haller, O., Staeheli, P., 1992. Human and mouse Mx proteins inhibit different steps of the influenza virus multiplication cycle. J. Virol. 66, 2564–2569. Pichlmair, A., Schulz, O., Tan, C.P., Naslund, T.I., Liljestrom, P., Weber, F., Reis e Sousa, C., 2006. RIG-I-mediated antiviral responses to single-stranded RNA bearing 50 -phosphates. Science (New York, NY) 314, 997–1001. Pleschka, S., Wolff, T., Ehrhardt, C., Hobom, G., Planz, O., Rapp, U.R., Ludwig, S., 2001. Influenza virus propagation is impaired by inhibition of the Raf/MEK/ERK signalling cascade. Nat. Cell Biol. 3, 301–305. Price, G.E., Smith, H., Sweet, C., 1997. Differential induction of cytotoxicity and apoptosis by influenza virus strains of differing virulence. J. Gen. Virol. 78 (Pt 11), 2821–2829. Quinlivan, M., Zamarin, D., Garcia-Sastre, A., Cullinane, A., Chambers, T., Palese, P., 2005. Attenuation of equine influenza viruses through truncations of the NS1 protein. J. Virol. 79, 8431–8439. Reed, L.J., Muench, H., 1938. A simple method of estimating fifty percent endpoints. Am. J. Hyg. 27, 493–497. Ruff, M., 1983. Interferon-mediated development of influenza virus resistance in hybrids between Mx gene-bearing and control mouse embryo fibroblasts. J. Gen. Virol. 64 (Pt 6), 1291–1300. Schultz-Cherry, S., Dybdahl-Sissoko, N., Neumann, G., Kawaoka, Y., Hinshaw, V.S., 2001. Influenza virus ns1 protein induces apoptosis in cultured cells. J. Virol. 75, 7875–7881. Schultz-Cherry, S., Hinshaw, V.S., 1996. Influenza virus neuraminidase activates latent transforming growth factor beta. J. Virol. 70, 8624–8629. Seo, S.H., Hoffmann, E., Webster, R.G., 2002. Lethal H5N1 influenza viruses escape host anti-viral cytokine responses. Nat. Med. 8, 950–954. Smith, J., Speed, D., Hocking, P.M., Talbot, R.T., Degen, W.G., Schijns, V.E., Glass, E.J., Burt, D.W., 2006. Development of a chicken 5 K microarray targeted towards immune function. BMC Genomics 7, 49. Solorzano, A., Webby, R.J., Lager, K.M., Janke, B.H., Garcia-Sastre, A., Richt, J.A., 2005. Mutations in the NS1 protein of swine

influenza virus impair anti-interferon activity and confer attenuation in pigs. J. Virol. 79, 7535–7543. Staeheli, P., Haller, O., 1987. Interferon-induced Mx protein: a mediator of cellular resistance to influenza virus. Interferon 8, 1–23. Suarez, D.L., Schultz-Cherry, S., 2000. Immunology of avian influenza virus: a review. Dev. Comp. Immunol. 24, 269–283. Swayne, D.E., 2007. Understanding the complex pathobiology of high pathogenicity avian influenza viruses in birds. Avian Dis. 51, 242–249. Takizawa, T., Tatematsu, C., Ohashi, K., Nakanishi, Y., 1999. Recruitment of apoptotic cysteine proteases (caspases) in influenza virusinduced cell death. Microbiol. Immunol. 43, 245–252. Talon, J., Horvath, C.M., Polley, R., Basler, C.F., Muster, T., Palese, P., Garcia-Sastre, A., 2000. Activation of interferon regulatory factor 3 is inhibited by the influenza A virus NS1 protein. J. Virol. 74, 7989–7996. Tong, H.H., Long, J.P., Li, D., DeMaria, T.F., 2004. Alteration of gene expression in human middle ear epithelial cells induced by influenza A virus and its implication for the pathogenesis of otitis media. Microb. Pathog. 37, 193–204. Toroghi, R., Momayez, R., 2006. Biological and molecular characterization of Avian influenza virus (H9N2) isolates from Iran. Acta Virol. 50, 163–168. Turan, K., Mibayashi, M., Sugiyama, K., Saito, S., Numajiri, A., Nagata, K., 2004. Nuclear MxA proteins form a complex with influenza virus NP and inhibit the transcription of the engineered influenza virus genome. Nucleic Acids Res. 32, 643–652. Van Campen, H., Easterday, B.C., Hinshaw, V.S., 1989. Virulent avian influenza A viruses: their effect on avian lymphocytes and macrophages in vivo and in vitro. J. Gen. Virol. 70 (Pt 11), 2887–2895. van Hemert, S., Ebbelaar, B.H., Smits, M.A., Rebel, J.M., 2003. Generation of EST and microarray resources for functional genomic studies on chicken intestinal health. Anim. Biotechnol. 14, 133–143. Wang, X., Li, M., Zheng, H., Muster, T., Palese, P., Beg, A.A., GarciaSastre, A., 2000. Influenza A virus NS1 protein prevents activation of NF-kappaB and induction of alpha/beta interferon. J. Virol. 74, 11566–11573. Wang, Z.W., Sarmento, L., Wang, Y., Li, X.Q., Dhingra, V., Tseggai, T., Jiang, B., Fu, Z.F., 2005. Attenuated rabies virus activates, while pathogenic rabies virus evades, the host innate immune responses in the central nervous system. J. Virol. 79, 12554–12565. Wurzer, W.J., Ehrhardt, C., Pleschka, S., Berberich-Siebelt, F., Wolff, T., Walczak, H., Planz, O., Ludwig, S., 2004. NF-kappaB-dependent induction of tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) and Fas/FasL is crucial for efficient influenza virus propagation. J. Biol. Chem. 279, 30931–30937. Xing, Z., Schat, K.A., 2000. Expression of cytokine genes in Marek’s disease virus-infected chickens and chicken embryo fibroblast cultures. Immunology 100, 70–76. Yewdell, J.W., Bennink, J.R., 1999. Mechanisms of viral interference with MHC class I antigen processing and presentation. Annu. Rev. Cell Dev. Biol. 15, 579–606. Zaffuto, K.M., Estevez, C.N., Afonso, C.L., 2008. Primary chicken tracheal cell culture system for the study of infection with avian respiratory viruses. Avian Pathol. 37, 25–31. Zhang, W., Li, H., Cheng, G., Hu, S., Li, Z., Bi, D., 2007. Avian influenza virus infection induces differential expression of genes in chicken kidney. Res. Vet. Sci. 84 (3), 374–381. Zhirnov, O.P., Konakova, T.E., Garten, W., Klenk, H., 1999. Caspasedependent N-terminal cleavage of influenza virus nucleocapsid protein in infected cells. J. Virol. 73, 10158–10163.