Differential responses of Africanized and European honey bees (Apis mellifera) to viral replication following mechanical transmission or Varroa destructor parasitism

Accepted Manuscript Differential responses of Africanized and European honey bees (Apis mellifera) to viral replication following mechanical transmission or Varroa destructor parasitism Mollah Md. Hamiduzzaman, Ernesto Guzman-Novoa, Paul H. Goodwin, Mariana Reyes-Quintana, Gun Koleoglu, Adriana Correa-Benítez, Tatiana Petukhova PII: DOI: Reference:

S0022-2011(14)00182-7 http://dx.doi.org/10.1016/j.jip.2014.12.004 YJIPA 6619

To appear in:

Journal of Invertebrate Pathology

Received Date: Revised Date: Accepted Date:

23 July 2014 27 October 2014 8 December 2014

Please cite this article as: Hamiduzzaman, M.M., Guzman-Novoa, E., Goodwin, P.H., Reyes-Quintana, M., Koleoglu, G., Correa-Benítez, A., Petukhova, T., Differential responses of Africanized and European honey bees (Apis mellifera) to viral replication following mechanical transmission or Varroa destructor parasitism, Journal of Invertebrate Pathology (2014), doi: http://dx.doi.org/10.1016/j.jip.2014.12.004

This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

Differential responses of Africanized and European honey bees (Apis mellifera) to viral replication following mechanical transmission or Varroa destructor parasitism

Mollah Md. Hamiduzzamana, Ernesto Guzman-Novoaa,d, Paul H. Goodwina, Mariana Reyes-Quintanab, Gun Koleoglua, Adriana Correa-Benítezb, Tatiana Petukhovac

a

School of Environmental Sciences, University of Guelph, Guelph ON, N1G 2W1,

Canada. b

Departamento de Medicina y Zootecnia en Abejas, FMVZ, Universidad Nacional

Autonoma de Mexico, Ciudad Universitaria, Mexico, D.F. 04960, Mexico. c

Department of Mathematics and Statistics, University of Guelph, Guelph ON, N1G

2W1, Canada. d

Corresponding author: Ernesto Guzman-Novoa

School of Environmental Sciences, University of Guelph, Guelph ON N1G 2W1, Canada E-mail: [email protected] Tel: + 1 519-824-4120 Ext. 53609; Fax: 519 837 0442 Short title: Viral replication in Africanized and European bees

1

Abstract For the first time, adults and brood of Africanized and European honey bees (Apis mellifera) were compared for relative virus levels over 48 h following Varroa destructor parasitism or injection of V. destructor homogenate. Rates of increase of deformed wing virus (DWV) for Africanized versus European bees were temporarily lowered for 12 h with parasitism and sustainably lowered over the entire experiment (48 h) with homogenate injection in adults. The rates were also temporarily lowered for 24 h with parasitism but were not affected by homogenate injection in brood. Rates of increase of black queen cell virus (BQCV) for Africanized versus European bees were similar with parasitism but sustainably lowered over the entire experiment with homogenate injection in adults and were similar for parasitism and homogenate injection in brood. Analyses of sac brood bee virus and Israeli acute paralysis virus were limited as detection did not occur after both homogenate injection and parasitism treatment, or levels were not significantly higher than those following control buffer injection. Lower rates of replication of DWV and BQCV in Africanized bees shows that they may have greater viral resistance, at least early after treatment.

Keywords: Africanized bees; European bees; Varroa destructor; honey bee viruses; injection; homogenate

2

1. Introduction The parasitic mite, Varroa destructor, has been linked to numerous cases of honey bee (Apis mellifera L.) damage and colony mortality (De Jong, 1997; Guzman-Novoa et al., 2010; Leconte et al., 2010). V. destructor has piercing mouth parts that penetrate the body of honey bees allowing it to feed on haemolymph, which directly shortens the life span of the bee as well as reduces the bee’s immunity (Genersch and Aubert, 2010). Another contributing factor to the negative impact of V. destructor on honey bee health is the ability of V. destructor to transmit or activate several viruses. Some viruses that have been associated with V. destructor parasitism are also linked to honey bee mortality, such as Kashmir bee virus (KBV), deformed wing virus (DWV), acute bee paralysis virus (ABPV) and more recently, Israeli acute paralysis virus (IAPV) (Ball and Bailey, 1997; Cox-Foster et al., 2007; Berthoud et al., 2010; Dainat et al., 2012a,b). Other viruses associated with V. destructor parasitism, such as black queen cell virus (BQCV) and sac brood virus (SBV), seem to cause little damage to honey bee colonies (Ball and Bailey, 1997). The link between viral transmission and V. destructor parasitism appears to be a result of mite feeding. For example, KBV was detected in the saliva of V. destructor, and it is believed that viral-containing saliva is injected into the bee’s haemolymph during parasitism (Shen et al., 2005). In addition, V. destructor can activate latent viral infections that existed in the honey bees without producing symptoms through suppression of the honey bees immune system during parasitism (Yang and Cox-Foster, 2005). Furthermore, DWV and probably other honey bee viruses, replicate within the body of V. destructor (Genersch and Aubert, 2010) and thus the mite is also a viral host

3

that can accumulate and inoculate large numbers of viral particles when parasitizing honey bees. Honey bee viruses can also be transmitted by other means, such as during mating, through food and faeces, and by mechanical transmission (i.e., injection) in the laboratory (Chen et al., 2006). Variation in susceptibility to V. destructor parasitism and reproduction has been documented in different genotypes and subspecies of western honey bees (Page and Guzman-Novoa, 1997; Emsen et al., 2012). In particular, several studies have demonstrated that Africanized honey bees are more resistant to V. destructor than their European counterparts (Moretto et al., 1991; Guzman-Novoa et al., 1996, 1999; Moretto and Mello, 1999; Arechavaleta-Velasco and Guzman-Novoa, 2001; Medina-Flores et al., 2014). However, no information exists on whether this difference is also reflected in differences in their susceptibility to virus infections transmitted by either V. destructor parasitism or by mechanical transmission. Furthermore, little is known about what stage of the honey bee (brood or adult) is more susceptible to virus transmission and replication for either Africanized or European bees. This is the first study comparing adults and brood of Africanized and European honey bees for the replication of viruses following mechanical transmission by injecting V. destructor homogenate or natural transmission by V. destructor parasitism. In this work, we show that levels of DWV, BQCV, SBV and IAPV can be affected over the first 48 h after treatment by developmental stage (brood versus adults) and/or genotype (Africanized versus European) of the honey bees.

2. Materials and Methods

4

2.1. Source colonies and collection of honey bee adults and brood The experiments with European bees (Buckfast strain) were conducted at the Honey Bee Research Center of the University of Guelph in Guelph, ON, Canada. The experiments with Africanized bees (derived from swarms collected locally) were conducted at the Center for Environmental Education in Xochimilco, Distrito Federal, Mexico. The genotype of Africanized and European honeybees was assessed by morphometric (Sylvester and Rinderer, 1987) and mitochondrial DNA (Nielsen et al., 2000) analyses. Eight randomly selected colonies of each genotype, with no known relationship to each other, were used as source of bees for the experiments. Source colonies of both genotypes were treated with fluvalinate strips (Apistan®, Novartis, Mississauga, ON, CA) 10 weeks prior to initiating the experiments to control V. destructor infestations. To obtain adult bees, frames containing emerging brood were collected from honey bee source colonies and incubated overnight inside screened cages (5 x 28 x 25.5 cm) at 32-35°C, and 60% RH. Newly emerged bees from these frames were used for the experiments with adult bees described below. To collect white-eyed pupae (hereafter referred to as brood), cells of combs with capped brood were opened to observe the brood inside. Frames with abundant white-eyed pupae were selected from source colonies, and placed in an incubator to be used in the experiments described below.

2.2. Source colonies for V. destructor and collection of V. destructor Heavily infested colonies in the Honey Bee Research Center in Guelph and the Center for Environmental Education in Xochimilco were chosen as sources of V.

5

destructor. Infestation rates in each of the V. destructor source colonies were determined using alcohol washes (De Jong et al., 1982). Prior to use, a random collection of 30 V. destructor mites from each location were assessed for haplotype, and all were of the Korean haplotype (Solignac et al., 2005). Adult V. destructor were harvested from adult bees of the infested source colonies as described by Arechavaleta-Velasco and Guzman-Novoa (2001) and temporarily placed into clean Petri dishes (Fisher Scientific, Fair Lawn, NJ, USA). These were used for either parasitism by artificial infestation of bees or preparation of V. destructor homogenate. The V. destructor required for preparation of homogenate were processed immediately, whereas those that were used for artificial infestation of bees were starved for 6 h in the Petri dishes.

2.3. Preparation of V. destructor homogenate Collected V. destructor were transferred from Petri dishes into a 1.5 mL microcentrifuge tube (Fisher Scientific) and washed with PBS (0.038M anhydrous monosodium phosphate, 0.162M disodium phosphate and 0.75M sodium chloride in dH2O, pH 7.4) by vortexing for 15 s at medium setting. After washing, the PBS was removed, and approximately 100 mites were blotted dry on filter paper and placed in a sterile mortar with 5 µL of PBS per mite. The mites were then ground until no visible particles of their exoskeleton remained. The resulting macerate was transferred into new microcentrifuge tubes and centrifuged (AccuSpin Micro 17, Fisher Scientific, Fair Lawn, NJ, USA) at 10,000 rpm for 10 min. After centrifugation, the supernatant was transferred into a new microcentrifuge tube and stored at -20 °C.

6

2.4. Treatments For adult bees, 70 newly emerged workers were subjected to the following procedures. For the control, bees were injected with 2.5 µL of PBS between the second and third tergite using 32 gauge syringe needles (de Miranda et al., 2013). For V. destructor homogenate, bees were injected as described above for PBS, except that they were injected with the homogenate prepared in PBS as previously described. After injection, the bees were incubated in a screened hoarding cage (12.7 x 8.5 x 14.5 cm) and fed with a 50% sucrose solution and ddH2O ad libitum. The cages were placed in an incubator at 32 °C and 60% RH for 48 h (de Miranda et al., 2013). For artificial V. destructor infestation, the newly emerged worker bees were divided equally among 8 Benton queen cages as these type of cages made it easier for mites to locate their host in the more confined space compared to a hoarding cage. Two mites were placed on the body of each bee through the screen of the cages using a fine brush. In these cages, the bees were fed queen candy ad libitum and given water by spreading drops of water on the screen of the cages twice a day. Bees of these treatments were incubated as described above. For the brood, capped cells were carefully sliced open with a sharp razor, and the brood cappings folded upwards. Then the brood was visually examined to confirm that it was of the desired developmental stage (white-eyed pupa). Once exposed, the thorax of the brood was injected with 2.5 µL of PBS as a control or V. destructor homogenate in PBS, or the brood were artificially infested with a single live V. destructor transferred into the cell using a fine brush. Fifty brood were used for each treatment. After the

7

treatment, the capping of each open cell was carefully folded back to its initial position and resealed with a small amount of molten beeswax (Hamiduzzaman et al., 2012). Combs with treated brood were incubated as described above for adult bees. Homogenate injection and artificial infestation of V. destructor for parasitism were selected as they were two different methods of transmitting and/or activating viral infections. Although the initial amounts of the viruses may have differed between the methods, a comparison of the rates of viral increase was possible between the different methods of introducing the viruses into adults or brood of Africanized and European honey bees. All experiments with adult bees and brood were repeated four times.

2.5. Sample collection Brood or adult bees were collected for RNA extraction from the incubators, either before being treated (0 h), and at 2, 12, 24, and 48 h post treatment (hpt). Sampling at 2 hpt was chosen to provide a baseline of the relative amount of virus in the honey bees shortly after treatment, as virus levels in V. destructor used for parasitism or homogenate was not determined prior to treatment. Sampling at 48 hpt was chosen as DWV, BQCV, SBV and IAPV were reliably detectable by RT-PCR by that time in treated adults or brood of at least one honey bee genotype. This indicated that by 48 hpt, V. destructor parasitism or homogenate injection resulted in either an introduction of those viruses or their activation to detectable levels. For each brood sample, three cells were opened as described above, and the three pupae were transferred to a 1.5 mL Eppendorf tube. Live brood subjected to injection treatments presented a discrete melanization spot in the area of injection and were fully

8

developed as pupae. Few injected brood did not appear to be alive, presenting total body melanization and larval morphology; these brood were discarded. For each adult bee sample, three bees were captured with forceps from the cages and then transferred to a 2 mL Eppendorf tube. To each tube, 1200 µL of RNAlater® solution (Life Technologies Inc., Burlington, ON, Canada) was added. The samples were then lightly crushed with sterile forceps to ensure the RNAlater® solution would penetrate the tissues.

2.6. RNA extraction and cDNA synthesis Total RNA was extracted for each sample of three individuals as per Chen et al. (2000) at the University of Guelph. The amount of extracted RNA was determined with a spectrophotometer (Nanovue GE Healthcare, Cambridge, UK) using a CF of 40. For cDNA synthesis, 2 µg of total RNA was reverse-transcribed using Oligo (dT)18 and MMuLV RT with the RevertAidTM H Minus First Strand cDNA Synthesis Kit (Fermentas Life Sciences, Burlington, ON, CA), following the instructions of the manufacturer. The amounts of ABPV, KBV, DWV, BQCV, SBV and IAPV relative to a bee constitutive control gene were determined by a multiplex reverse transcription-PCR (RTPCR). Primers for the constitutive honey bee gene were for the ribosomal protein RpS5 gene described by Thompson et al. (2007). Virus-specific primers were designed based on those reported by Maori et al. (2009), Fedorova et al. (2011) and Tentcheva et al. (2004) for IAPV, ABPV, SBV and KBV, respectively. DWV was detected with the forward primer used by Chen et al. (2005), and a newly designed reverse primer (5’CATAGATATCAGTCAACGGAGC) to obtain a shorter PCR product avoiding potential hairpin loops. To design this primer, the complete genome sequence of DWV

9

(Genbank accession no. NC 004830) was obtained from the National Centre for Biotechnology In formation (NCBI). The primer was designed from the sequence using Gene Runner (Version 3.05, Hastings Software Inc., NY). The primers for BQCV were those reported by Benjeddou et al. (2001) with slight modifications to obtain a shorter PCR product to avoid possible hairpin loops. The forward and reverse primers were 5’GTCAGCTCCCACTACCTTAAAC and 5’CAACAAGAAGAAACGTAAACCAC, respectively. The primers were ordered from Laboratory Services of the University of Guelph (Guelph, ON, CA).

2.7. PCR conditions Multiplex simultaneous reactions were done combining one set of virus-specific primers with the RpS5 primers. All PCR reactions were done with a Mastercycler (Eppendorf, Mississauga, ON, CA). Each 15 µl of reaction contained 1.5 µl of 10x PCR buffer (New England BioLabs, Pickering, ON, CA), 0.5 µl 10 mM of dNTPs (Bio Basic Inc., Markham, ON, CA), 1 µl of 10 µM forward and reverse primers for the RpS5 gene and 10 µM forward and reverse primers for one of the honey bee viruses, 0.2 µl 5U/µl of Taq polymerase (New England BioLabs), 1 µl of the cDNA sample, and 7.8 µl of dd H2O. For IAPV, ABPV, SBV and KBV the PCR conditions were 94º C for 3 min, followed by 35 cycles of 30 s at 94º C, 60 s at 55º C and 60 s at 72º C, and a final extension step at 72º C for 10 min. Amplification conditions for DWV and BQCV were the same, except that the annealing temperature was 58º C.

2.8. Separation and quantification of PCR products

10

PCR products were separated on 1% TBE agarose gels and stained with ethidium bromide. A 100 bp DNA ladder (Bio Basic Inc.) was included in each gel. Images of the gels were captured using a digital camera with a Benchtop UV Transilluminator (BioDoc-It M Imaging System, Upland, CA, USA). For positive identifications, randomly selected PCR products were purified using the EZ-10 Spin Column DNA Gel Extraction Kit (Bio Basic Canada Inc.) and sequenced at the Laboratory Services of the University of Guelph. The sequences were used to search the GenBank nr database of NCBI by BLASTn, and all of them showed ≥ 96% identity to their respective target virus sequence. An alignment of the partial sequence of the putative RNA helicase amplified from DWV from samples from Mexico (DWV-AHB1) and Ontario (DWV-ON1) along with 10 other putative RNA helicase sequences of DWV from Poland, Austria, Hungary, Slovenia, Germany, Nepal, Sri Lanka, United Arab Emirates and Canada (Genbank accession nos. DQ224291.2, DQ224281.2, DQ224298.2, DQ224300.2, DQ224294.2, DQ224305.2, DQ224306.2, DQ224308.2, DQ224310.2 and DQ224311.2, respectively) used by Berényi et al. (2007) to indicate genetic variation associated with a recent global distribution of DWV. The sequences were aligned with MUSCLE sequence alignment software (EMBL- EBI, UK) (http://www.ebi.ac.uk/Tools/msa/muscle/) outputted in ClustalW format to generate a tree from the second interaction. The intensity of the amplified bands was quantified in pixels using the Scion Image (Scion Corporation, Frederick, MD, USA) as per Dean et al. (2002). Semi-quantification was derived from the ratio of intensity between the band of the target virus and the band of the honey bee RpS5 gene to determine the relative quantification units (RQUs) of

11

viral RNA. The intensity of the bands of the RpS5 gene was constant at all time points. To determine whether quantification at 35 amplification cycles was not affected by signal saturation of the band intensities, randomly selected samples with high, medium and low RQUs of DWV were also quantified in the same manner with 25 and 30 amplification cycles, and the RQU values were not significantly different for those samples whether 25, 30 and 35 amplification cycles were used (F2,15 = 0.30, P = 0.75).

2.9. Statistical analysis Statistical analyses were performed with the R-Statistical Program (R Development Core Team 2012). For each time point, the mean and standard errors were calculated from four biological replications. To test for differences in relative amounts of viral RNA between genotypes and between time points, t tests were performed. Analysis of covariance (ANCOVA) was used to assess the homogeneity of regression slopes for changes in relative virus amounts over time, representing the rate of viral increase/replication in the honey bees.

3. Results 3.1. KBV and ABPV Brood and adult European and Africanized honey bees were assayed from 0 hpt (just prior to treatment) to 48 hpt with either V. destructor parasitism, injection of V. destructor homogenate or injection of buffer alone for six bee viruses, ABPV, KBV, DWV, BQCV, SBV and IAPV. However, KBV and ABPV were not detected in the samples, and thus not further examined.

12

3.2. DWV For V. destructor parasitism of adults, DWV levels in Africanized bees were significantly lower (P<0.05) than in European bees at 2 and 12 hpt, indicating that less DWV was introduced or the initiation of DWV replication was delayed in Africanized adults (Figs. 1A and 1B). However, a faster rate of increase in DWV levels between 12 and 24 hpt resulted in DWV levels being similar between the genotypes at 24 and 48 hpt. The lower rate of DWV increase in Africanized adults with parasitism from 2 to 12 hpt could indicate a period of higher resistance to DWV replication compared to European adults, or a lag period due to a lower amount of inoculum. Although this also could be the result of variation in virulence between the DWV isolates from Mexico and from Canada, those isolates did not appear to be atypical. A comparison of the parital RNA helicase sequence amplified from DWV originating from an Ontario or Mexican sample showed that there was more than 98% nt identity. The polymorphic sites between those samples were also polymorphic in other RNA helicase sequences of DWV reported by Berenyi et al. (2007) to have originated from Poland, Austria, Hungary, Slovenia, Germany, Nepal, Sri Lanka, United Arab Emirates as well as other locations in Canada (data not shown). Homogenate treatment resulted in no difference in DWV levels between European and Africanized adults at 2 hpt. From 2 to 48 hpt; however, DWV levels increased more slowly in Africanized than in European adults as indicated by an increase of 0.53 RQU versus 1.10 RQU, respectively. As a result, the rate of increase from 2 to 48 hpt (i.e., the slope of the regression lines of the relative quantification of DWV levels) was

13

significantly less in Africanized adults (F1,28= 4.6, P<0.05). The lower rate of DWV increase in Africanized adults with homogenate from 2 to 48 hpt indicated that they may have had greater resistance to DWV compared to European adults. For V. destructor parasitism of brood, DWV levels were not significantly different (P>0.05) between Africanized and European brood at 2 hpt (Figs. 1C and 1D). However, there was a lower rate of DWV increase in Africanized than in European brood from 2 to 24 hpt (a difference of 0.19 RQU versus 0.86 RQU, respectively), which was also indicated by a significantly lower slope in the increase of DWV levels during that time period (F1,20= 5.0, P<0.05). However, there was a faster rate of increase of DWV between 24 and 48 hpt in Africanized versus European brood (a difference of 1.36 RQU versus 0.40 RQU, respectively). As a result, there was no significant difference in DWV levels between Africanized and European brood at 48 hpt (P>0.05). Thus, it appears that there may have been greater resistance resulting in a slowing of DWV replication in Africanized versus European brood until 24 hpt but that was lost after that time. For homogenate treatment of brood, there were significantly higher DWV levels for Africanized than for European bees at 2 hpt (P<0.01), but the rate of increase in DWV levels between 12 and 48 hpt were similar between the genotypes (a difference of 0.58 RQU versus 0.84 RQU, respectively), which was supported by the slopes of the lines of DWV levels being not significantly different over that time period (F1,20= 0.2, P>0.05). As a result, there was no significant difference in DWV levels by 48 hpt between the two genotypes, and it appears that the rate of replication of DWV was almost identical between the genotypes of brood following injection with homogenate. Overall, while the relative amounts of DWV did not differ between genotypes either

14

at the early or at the final stages of this study following parasitism and homogenate treatments, the rates of increase did differ for varying periods of time within 48 hpt with a temporarily or sustainably lowered rate of DWV increase observed in Africanized bees. No DWV was detected following buffer injection treatment for either brood or adults of either genotype indicating that there was no detectable latent DWV in the bees induced by injecting buffer similar to that of injecting homogenate (Fig. 1).

3.3. BQCV Levels of BQCV following V. destructor parasitism in Africanized adults were undetectable or very low and not significantly different (P>0.05) from those in European adults at 2 and 12 hpt, indicating relatively similar low initial amounts of BQCV in both genotypes (Figs. 2A and B). The rate of increase in BQCV in adults was similar between genotypes from 24 to 48 hpt, and BQCV levels were not significantly different (P>0.05) between the genotypes at either 24 and 48 hpt. Thus, there was no evidence for a difference in resistance to BQCV between adults of the two genotypes with V. destructor parasitism. For homogenate treatment, BQCV levels were not significantly different (P>0.05) between Africanized and European adults at 2 or 12 hpt (Figs. 2A and B). However, the rate of increase in BQCV from 12 to 48 hpt following homogenate treatment was much slower in Africanized than in European adults (a difference of 0.80 RQU versus 2.72 RQU, respectively), which was supported by a significantly lower slope in the increase in BQCV levels over that time period (F1,20= 14.3, P<0.01). Homogenate treatment resulted in a lower rate of increase in Africanized adults from 12 to 48 hpt, indicating

15

greater resistance to BQCV replication compared to European adults. In Africanized brood, BQCV levels following V. destructor parasitism were not significantly different (P>0.05) than those in European brood at any time point tested (Figs. 2C and D). Similar results were observed for the homogenate treatment with no significant differences (P>0.05) in BQCV levels between Africanized and European brood at any time point of the experiment. These results indicate that BQCV replicates very similarly in brood of both genotypes regardless of V. destructor parasitism or homogenate treatment. A comparison of parasitism and homogenate treatments showed that mechanical transmission via homogenate injection consistently resulted in higher BQCV levels than natural transmission via parasitism in both genotypes (Fig. 2). One additional factor for BQCV, however, was that buffer injection of adults activated latent BQCV infections with detectable BQCV levels at 24 and 48 hpt for adults of both genotypes (Figs. 2A and B), implying that there was latent BQCV in the adults activated by the stress of piercing the cuticle, introducing a buffer solution into their haemolymph and caging.

3.4. SBV For V. destructor parasitism of adults, SBV was detected in Africanized but not in European bees, while for homogenate treatment of adults, SBV was detected in European but not in Africanized bees (Figs. 3A and B). The fact that V. destructor parasitism or homogenate treatments, but not both, resulted in detectable SBV in one of the genotypes was surprising because in each case the same collection of V. destructor that was used for parasitism was also used to create the homogenate. This could be due

16

to several factors, such as the ability of SBV to be secreted in saliva during parasitism or to replicate with mite compounds entering the haemolymph of adult bees originating from the mite's body or it's saliva. For V. destructor parasitism of brood, SBV was only detected at 48 hpt in Africanized bees (Figs. 3C and D). However, homogenate treatment resulted in detectable SBV levels in both genotypes with significantly higher SBV levels in Africanized brood at 2 and 12 hpt (P<0.01), but a faster rate of increase between 12 and 24 hpt in European brood resulted in no significant differences in SBV levels between the two genotypes at 24 and 48 hpt (P>0.05) (Figs. 3C and D). The lower rate of SBV increase from 2 to 12 hpt in European brood with homogenate may indicate initial increased resistance than in Africanized adults, which, however, did not persist after 12 hpt. SBV was not detected following buffer injection treatment for either European or Africanized brood or adults indicating that SBV was not latent in the bees and that it could not be activated within 48 hpt by injecting buffer similar to that of injecting homogenate (Fig. 3).

3.5. IAPV For V. destructor parasitism of adults, IAPV levels did not differ between Africanized and European bees at any time point (P>0.05, Figs. 4A and B). Although the levels of IAPV fluctuated over time, it may have been replicating in the European and Africanized adults as the slope of a regression line of IAPV levels was significantly different from zero (i.e., the slope of a horizontal line) between 2 and 48 hpt (F1,20= 0.80,

17

P<0.05). Similar results were observed following homogenate treatment. However, a confounding factor was that IAPV was often detected at similar levels in buffer injection treatment of adults, and the only times that IAPV levels were significantly higher than the buffer injection of adults was for homogenate treatment of European adults at 12 hpt and for V. destructor parasitism of Africanized adults at 48 hpt. This indicates that there were latent IAPV infections in both genotypes. For both European and Africanized brood, the slope of the regression line of IAPV levels following V. destructor parasitism was not significantly different from 0 (F1,20= 0.06, P>0.05) between 2 and 48 hpt, indicating no consistent replication (Figs. 4C and D). For homogenate treatment of brood, IAPV levels clearly increased from 24 to 48 hpt in European brood indicating replication. However, this was not the case for Africanized brood, where IAPV levels fluctuated over time, and the level was not significantly different from that of buffer treated Africanized brood at 48 hpt. There were latent infections of IAPV in both adults and brood of both genotypes as IAPV was detected prior or following buffer treatment for at least one time point in European and Africanized adults and brood (Fig. 4). In fact, the only cases where IAPV levels were significantly higher than in the buffer injection were in Africanized brood at 2 hpt for V. destructor parasitism and for homogenate treatment (P<0.05). While latent infections of BQCV were detected in adults, IAPV was the only virus where the stress of the buffer injection treatment activated the virus in both adults and brood.

4. Discussion The results of this study suggest that Africanized and European honey bees differed

18

in their resistance to several viruses by 48 hpt as observed by significant differences in virus levels or rates of increase in virus levels over particular time periods after potentially activating the viruses by mite parasitism or homogenate injection. However, we did not conduct strand specific RT-PCR to determine if the replicative strand of the different viruses was detectable to confirm that the increases in virus levels over time were due to viral replication. The apparent differences in viral levels between bee genotypes was observed whether the viruses were introduced by V. destructor parasitism or by injection of a homogenate of V. destructor taken from the same collection of mites used for parasitism. DWV was not detected in control brood and adults of both bee genotypes nor was it detected prior to treatment. DWV is reported to be a benign virus causing latent infections when V. destructor is absent (Genersch and Aubert, 2010). If there were latent infections of DWV in the bees used in this study, then the levels were undetectable by RT-PCR until after the bees were treated by V. destructor parasitism or injection of mite homogenate. For European adults and brood, DWV levels progressively increased similarly between V. destructor parasitism and injection with homogenate. Mechanical transmission of DWV had been previously observed by injection of European brood or adults with DWV, which mimicked infection by V. destructor, resulting in viral replication and DWV symptoms in adults that developed from the injected brood (Möckel et al., 2011). Also, using similar methods to parasitize newly emerged honey bees with V. destructor as in this study, DWV levels were positively correlated with the level of V. destructor infestation (Di Prisco et al., 2011).

19

DWV replication was delayed temporarily in Africanized bees. For V. destructor parasitism, almost all the increase in DWV in Africanized adults started after 12 hpt, while increases in DWV started before 2 hpt in European adults. For Africanized brood, a similar delay in DWV levels was also observed with V. destructor parasitism. Resistance to DWV in Africanized adults was more obvious following homogenate treatment with a significantly lower rate of DWV increases throughout the experiment compared to European adults. However, this was not true for Africanized brood. The differences in DWV levels between bee genotypes could have been due to reduced transmission or a temporary slowing of DWV replication. Although DWV has been detected in Africanized bees, an extensive survey of Africanized bees in Brazil showed a much lower prevalence of DWV (20%) in those populations relative to populations of European bees worldwide, implying some degree of resistance of Africanized bee populations (Teixeira et al., 2008) which could be linked to increased resistance of Africanized bees to V. destructor and/or to climatic effects (Moretto and Mello, 1999; Medina-Flores et al., 2014). Additional indirect evidence for DWV resistance comes from an extensive survey of DWV in Mexico, which found that Africanized adults and brood had significantly lower DWV levels than European adults and brood (Anguiano, R., National University of Mexico, Pers. Comm.). The results of this study further support the view that Africanized bees may be more resistant to DWV by demonstrating that DWV levels were lower in Africanized bees than in European bees early after exposure to the virus via V. destructor parasitism. One explanation for the different DWV levels in Africanized and European bees early after exposure to the virus may be the impact of V. destructor on the bee's immune

20

response. Yang and Cox-Foster (2007) suggested that compounds in the saliva of V. destructor immunosuppresses bees, thus activating latent DWV infections. This has only been examined thus far in European adult honey bees, and so it is unknown if other bee genotypes would be similarly affected. However, one possible explanation for the delay in DWV levels in Africanized bees was that Africanized bees were less immunosuppressed by compounds secreted in saliva during V. destructor parasitism allowing for a greater initial immune response. Unlike DWV, BQCV caused latent infections of the Africanized and European adult bees as it could be detected in control bees caged and injected with buffer only. This indicates that the stress of caging and injection facilitated virus replication in adults. However, the brood did not appear to have latent infections. This could be due to the brood not having been infected prior to the experiment, but another possibility is that the brood were treated within their cells, which were re-capped after treatment. This may have caused less stress than caging, and thus not activated a latent BQCV infection over the time period of the study. BQCV levels in European adult bees during V. destructor parasitism were never significantly greater than the control, although virus levels were increasing over time and perhaps may have later become significantly greater than the control. However, for Africanized adults, significant increases in BQCV over the control occurred between 24 to 48 hpt. The apparent limited ability of V. destructor to transmit BQCV was unlikely due to V. destructor not parasitizing the European and Africanized adults, since DWV was transmitted in the same experiments. BQCV can infect both adults and brood and is thought to be naturally transmitted by nurse bees to brood in their food (Allen and Ball,

21

1996). It has also been shown to infect European bees following injection of the virus (Benjeddou et al., 2002). However, this study demonstrates that increased BQCV levels can occur during V. destructor parasitism. There have been no reports on the effects of BQCV on adult bees, but it appears to reach significant levels in the honey bee and so one would expect it to eventually have some negative impact on their health. BQCV levels increased more slowly for Africanized than for European adults following homogenate injection, suggesting greater resistance to BQCV in Africanized adults, but unlike DWV, this resistance was longer lasting (at least for 48 h). BQCV has been reported in Africanized bees, but there was a substantially lower prevalence of BQCV (37%) in Africanized bees in Brazil compared to populations of European bees worldwide (Teixeira et al., 2008). In Uruguay, Mendoza et al. (2014) found that Africanized bees had lower levels of BQCV than Italian bees. This study indicates that such observations could be due to lowered rates of BQCV replication in Africanized than in European bees. Unlike adults, there was no evidence of greater BQCV resistance in Africanized brood, demonstrating the importance of examining different developmental stages when studying honey bee viruses. This could be related to changes in the immune system of bees as they develop, and immunity is strongest in older bees and weakest in younger bees (Wilson-Rich et al., 2008). For both European adult bees and brood, SBV was never detected with V. destructor parasitism, indicating that V. destructor cannot effectively introduce or activate SBV in this bee genotype, but it was detected at high levels with homogenate indicating mechanical transmission. As the same collection of V. destructor was used for both

22

parasitism and the creation of homogenate, transmission would be expected by both homogenate and V. destructor parasitism or by neither. Also, transmission of DWV following exposure to V. destructor indicated that parasitism by the mite was sufficient to transmit/activate bee viruses. Unlike European adults, there was no detectable SBV in Africanized adults with homogenate but detectable SBV with V. destructor parasitism. As previously mentioned, this was unexpected as the same collection of V. destructor was used for both parasitism and creation of the homogenate. In fact, only Africanized brood had both V. destructor parasitism and homogenate injection effectively initiating SBV replication. These results suggest that V. destructor parasitism may transmit SBV more efficiently to Africanized than to European bees. However, it is also possible that SBV was at undetectable levels only in Africanized bees and V. destructor parasitism activated the replication of the virus in this genotype but not in European bees. SBV infects both European brood and adults and is naturally transmitted in their food, although SBV can also be transmitted by injection (Bailey, 1969; Ball and Bailey, 1997). However, SBV may also be transmitted by V. destructor as it has been detected in the mite's saliva (Shen et al., 2005). SBV has also been detected in Africanized bees (Freiberg et al., 2012). The results of this study show that both V. destructor parasitism and injection can initiate SBV replication in honey bees, but this may not be true for all bee genotypes. Latent infections of IAPV were present and generally similar levels of the virus were detected in control brood and adults of both bee genotypes after caging and injection with buffer compared to V. destructor parasitism or injection of homogenate.

23

Thus, it is difficult to make firm conclusions about IAPV levels being affected by bee genotype or developmental stage. IAPV is genetically similar to ABPV and KBV (Genersch and Aubert, 2010). However, IAPV is less well studied as it was relatively only recently discovered in European bees (Maori et al., 2007), but it has also been detected in Africanized bees (Teixeira et al., 2012). IAPV can occur as latent infections, but symptoms develop when the virus reaches high levels, which is related or dependent upon V. destructor parasitism perhaps via transmission in V. destructor saliva (Genersch and Aubert, 2010). IAPV can also be transmitted by injection of V. destructor homogenate resulting in high virus titers (Maori et al., 2007). The increase in IAPV levels over time with homogenate in European brood and homogenate and parasitism treatments for Africanized adult support both modes of transmission. A limitation of this study was that viral levels in the V. destructor homogenate were not standardized between experiments and locations. Instead, collections of V. destructor were made and then the mites were randomly selected for either parasitism or homogenate preparations. This approach was chosen because it is not possible to standardize the amount of virus being transmitted in V. destructor saliva during parasitism, but by randomly selecting mites from the same collection to create homogenate, then there would be proportionally similar levels of the viruses between the mites and the homogenate. However, viral transmission by injection of homogenate cannot be directly compared to that by V. destructor parasitism because they differ in the size of the wound (larger for injection), type of material (saliva versus buffer with homogenate), volume of material (larger for injection), duration of interaction (longer

24

for parasitism) and potential for immnosuppression (possibly greater for saliva compounds with parasitism versus whole body compounds with homogenate). Thus, comparisons were not only made for virus levels at particular time points but also for changes over different time periods to estimate the rates of viral increase. Another limitation of this study was that the mites and the homogenates prepared from them were obtained from Mexico for Africanized bees and from Canada for European bees, and thus may have differed in virulence. However, an examination of the DWV sequences from Ontario and Mexican samples of the PCR products, which was a partial sequence of the RNA helicase gene, were compared to the corresponding sequences for DWV from 10 other locations published by Berényi et al. (2007). These researchers found that DWV sequences were largely clonal and not clustering based on geographic regions. The sequences from Canada and Mexico in this study were highly similar to each other as well as to other sequences from Canada, Europe and Asia. Thus, there was no evidence that the DWV in this study were atypical of the variation in DWV found worldwide. While it is well known that Africanized bees have greater resistance to V. destructor parasitism than European bees (Guzman-Novoa et al., 1996, 1999; Moretto and Mello, 1999; Arechavaleta-Velasco and Guzman-Novoa, 2001; Medina-Flores et al., 2014), this work shows that resistance may also extend to viral replication. Identifying sources of resistance to honey bee viruses and V. destructor is important as Dainat et al. (2012b) and Dainat and Neumann (2013) showed that both a virus (DWV) and V. destructor are predictive markers of winter colony losses, and thus may be major players in the collapse of V. destructor infested colonies. However, this study was designed only to

25

measure the initial stages of virus infection (i.e., up to 48 h after exposure to V. destructor), and thus it is unknown if lower virus levels during that time period would significantly affect the timing or severity of particular viral symptoms or result in longer life spans of the bees. While lower rates of increase of DWV and BCQV may indicate greater resistance, research is needed to determine if the differences in virus levels are actually due to differences in the immune system of different bee genotypes and whether those differences could eventually be transferred between honey bee genotypes through breeding.

Acknowledgments We thank Daniel Prieto in Mexico and Paul Kelly in Canada for their assistance in managing and sampling experimental colonies. This study was partially supported by a NSERC Discovery grant to EGN.

References Allen, M., Ball, B.V., 1996. The incidence and world distribution of honey bee viruses. Bee World 77, 141-162. Arechavaleta-Velasco, M.E., Guzman-Novoa, E., 2001. Relative effect of four characteristics that restrain the population growth of the mite Varroa destructor in honey bee (Apis mellifera) colonies. Apidologie 32, 157-174. Bailey, L., 1969. The multiplication and spread of sacbrood virus of bees. Ann. Appl. Biol. 63, 483-491. Ball, B.V., Bailey, L., 1997. Viruses. In Morse, R; Blottum, K (Eds). Honey bee

26

pests, predators and diseases (3rd Edition). A I Root; Medina Ohio, pp 13-31. Benjeddou, M., Leat, N., Allsopp, M., Davison, S., 2001. Detection of acute bee paralysis virus and black queen cell virus from honeybees by reverse transcriptase PCR. Appl. Environ. Microbiol. 67, 2384-2387. Benjeddou, M., Leat, N., Allsopp, M., Davison, S., 2002. Development of infectious transcripts and genome manipulation of Black queen-cell virus of honey bees. J. Gen. Virol. 83, 3139-3146. Berényi, O., Bakonyi, T., Derakhshifar, I., Koglberger, H., Topolska, G., Ritter, W., Pechhacker, H., Nowotny, N. 2007. Phylogenetic analysis of deformed wing virus genotypes from diverse geographic origins indicates recent global distribution of the virus. Appl. Environ. Microbiol. 73, 3605-3611. Berthoud, H., Imdorf, A., Haueter, M., Radloff, S., Neumann, P., 2010. Virus infections and winter losses of honey bee colonies (Apis mellifera). J. Apic. Res. 49, 60-65. Chen, C.Y.J., Jin, S., Goodwin, P.H., 2000. An improved method for the isolation of total RNA from Malva pusilla tissues infected with Colletotrichum gloeosporioides. J. Phytopath. 148, 57-60. Chen, Y.P., Higgins, J.A., Feldlaufer, M.F., 2005. Quantitative analysis by real-time reverse transcription-PCR of deformed wing virus infection in the honey bee (Apis mellifera L.). Appl. Environ. Microbiol. 71, 436-441. Chen, Y.P., Pettis, J.S., Collins, A., Feldlaufer, M.F., 2006. Prevalence and transmission of honeybee viruses. Appl. Environ. Microbiol. 72, 606-611. Cox-Foster, D.L., Conlan, S., Holmes, E.C., Palacios, G., Evans, J.D., Moran, N.A.,

27

Quan, P.L., Briese, T., Hornig, M., Geiser, D.M., Martinson, V., van Engelsdorp, D., Kalkstein, A.L., Drysdale, A., Hui, J., Zhai, J.H., Cui, L.W., Hutchison, S.K., Simons, J.F., Egholm, M., Pettis, J.S., Lipkin, W.I., 2007. A metagenomic survey of microbes in honey bee Colony Collapse Disorder. Science 318, 283-287 Dainat, B., Evans, J.D., Chen, Y.P., Gauthier, L., Neumann, P., 2012a. Dead or alive: deformed wing virus and Varroa destructor reduce the life span of winter honeybees. Appl. Environ. Microbiol. 78, 981-987. Dainat, B., Evans, J.D., Chen, Y.P., Gauthier, L., Neumann, P., 2012b. Predictive markers of honey bee colony collapse. PLoS One 7, e32151, doi:10.1371/ journal.pone.0032151. Dainat, B., Neumann, P., 2013. Clinical signs of deformed wing virus infection are predictive markers for honey bee colony losses. J. Invertebr. Pathol. 112, 278-280. Dean, J.D., Goodwin, P.H., Hsiang, T., 2002. Comparison of relative RT-PCR and Northern blot analyses to measure expression of ß-1,3-glucanase in Nicotiana benthamiana infected with Colletotrichum destructivum. Plant Mol. Biol. Report 20, 347-356. De Jong, D., 1997. Mites: Varroa and other parasites of brood. In: Morse R.A. and Flottum K. (Eds.), Honey Bee Pests, Predators, and Diseases. Root Pub. Co., Medina, Ohio, pp. 279-327. De Jong, D., De Andrea Roma, D., Goncalves L.S., 1982. A comparative analysis of shaking solutions for the detection of Varroa jacobsoni on adult honeybees. Apidologie 13, 297-303. de Miranda, J.R., Bailey, L., Ball, B.V., Blanchard, P., Budge, G.E., Chejanovsky, N.,

28

Chen, Y.P., Gauthier, L., Genersch, E., de Graaf, D.C., Ribière, M., Ryabov, E., De Smet, L., van der Steen, J.J.M., 2013. Standard methods for virus research in Apis mellifera. J. Apic. Res. 52, doi:10.3896/IBRA.1.52.4.22. Di Prisco, G., Zhang, X., Pennacchio, F., Caprio, E., Li, J., Evans, J.D., DeGrandiHoffman, G., Hamilton, M., Chen, Y.P., 2011. Dynamics of persistent and acute deformed wing virus infections in honey bees, Apis mellifera. Viruses 3, 2425-2441. Emsen, B., Petukhova, T., Guzman-Novoa, E., 2012. Factors limiting the growth of Varroa destructor populations in selected honey bee (Apis mellifera L.) colonies. J. Anim. Vet. Adv. 11, 4519-4525. Fedorova, A.A., Azzami, K., Ryabchikova, E.I., Spitsyna, Y.E., Silnikov, V.N., Ritter, W., Gross, H.J., Tautz, J., Vlassov, V.V., Beier, H., Zenkova, M.A., 2011. Inactivation of a non-enveloped RNA virus by artificial ribonucleases: Honey bees and acute bee paralysis virus as a new experimental model for in vivo antiviral activity assessment. Antiviral Res. 91, 267-277. Freiberg, M., De Jong, D., Message, D., Cox-Foster, D., 2012. First report of sacbrood virus in honey bee (Apis mellifera) colonies in Brazil. Genet. Mol. Res. 11, 33103314. Genersch, E., Aubert, M., 2010. Emerging and re-emerging viruses of the honey bee (Apis mellifera L.). Vet. Res. 41, 54. Guzman-Novoa, E., Sánchez, A., Page, R.E., García, T., 1996. Susceptibility of European and Africanized honeybees (Apis mellifera L.) and their hybrids to Varroa jacobsoni Oud. Apidologie 27, 93-103. Guzman-Novoa, E., Vandame, R., Arechavaleta, M.E., 1999. Susceptibility of European

29

and Africanized honey bees (Apis mellifera L.) to Varroa jacobsoni Oud. in Mexico. Apidologie 30, 173-182. Guzman-Novoa, E., Eccles, L., Calvete, Y., McGowan, J., Kelly, P.G., Correa-Benitez, A., 2010. Varroa destructor is the main culprit for the death and reduced populations of overwintered honey bee (Apis mellifera) colonies in Ontario, Canada. Apidologie 41, 443-450. Hamiduzzaman, M.M., Sinia, A., Guzman-Novoa, E., Goodwin, P.H., 2012. Entomopathogenic fungi as potential biocontrol agents of the ecto-parasitic mite, Varroa destructor, and their effect on the immune response of honey bees (Apis mellifera L.). J. Invertebr. Pathol. 111, 237-243. Le Conte, Y., Ellis, M., Ritter, W., 2010. Varroa mites and honey bee health: can Varroa explain part of the colony losses? Apidologie 41, 353-363. Maori, E., Lavi, S., Mozes-Koch, R., Gantman, Y., Edelbaum, O., Tanne, E., Sela, I., 2007. Isolation and characterization of IAPV, a dicistrovirus affecting honeybees in Israel: evidence for intra- and inter-species recombination. J. Gen. Virol. 88, 34283438. Maori, E., Paldi, N., Shafir, S., Kalev, H., Tsur, E., Glick, E., Sela, I., 2009. IAPV, a beeaffecting virus associated with colony collapse disorder can be silenced by dsRNA ingestion. J. Insect Mol. Biol. 18, 56-60. Medina-Flores, C.A., Guzman-Novoa, E., Hamiduzzaman, M.M., Aréchiga-Flores, C. F., López-Carlos, M.A., 2014. Africanized honey bees (Apis mellifera) have low infestation levels of the mite Varroa destructor in different ecological regions in Mexico. Genet. Mol. Res. Published ahead of print. DOI:

30

10.4238/2014. February.21.10. Mendoza, Y., Antunez, K., Branchiccela, B., Anido, M., Santos, E., Invernizzi, C., 2014. Nosema ceranae and RNA viruses in European and Africanized honeybee colonies (Apis mellifera) in Uruguay. Apidologie 45, 224-234. Mockel, N., Gisder, S., Genersch, E., 2011. Horizontal transmission of deformed wing virus: pathological consequences in adult bees (Apis mellifera) depend on the transmission route. J. Gen. Virol. 92, 370-373. Moretto, G., Mello, L.J., 1999. Varroa jacobsoni infestation of adult Africanized and Italian honey bees (Apis mellifera) in mixed colonies in Brazil. Genet. Mol. Biol. 22, 321-323. Moretto, G., Gonçalves, L.S., De Jong, D., Bichuette, M.Z., 1991. The effects of climate and bee race on Varroa jacobsoni Oud. infestations in Brazil. Apidologie 22, 197-203. Nielsen, D.I., Ebert, P.R., Page, R.E., Hunt, G.J., Guzman-Novoa, E., 2000. Improved polymerase chain reaction-based mitochondrial genotype assay for identification of the Africanized honey bee (Hymenoptera: Apidae). Ann. Entomol. Soc. Am. 93, 1-6. Page, R.E., Guzman-Novoa, E., 1997. The Genetic Basis of Disease Resistance. In: Honey Bee Pests, Predators and Diseases (Morse RA and Flottum K, eds.). AI Root Co., Medina, OH, pp. 469-492. Shen, M., Cui, L., Ostiguy, N., Cox-Foster, D., 2005. Intricate transmission routes and interaction between picorna-like viruses (Kashmir bee virus and sacbrood virus) with the honey bee host and the parasitic varroa mite, J. Gen. Virol. 86, 2281-2289.

31

Solignac, M., Cornuet, J.M., Vautrin, D., Le Conte, Y., Anderson, D., Evans, J., CrosArteil, S., Navjas, M., 2005. The invasive Korea and Japan types of Varroa destructor, ectoparasitic mites of the Western honeybee (Apis mellifera), are two partly isolated clones. Proc. R. Soc. Lond. [Biol.] 272, 411-419. Sylvester, H., Rinderer, T.E., 1987. Fast Africanized bee identification system (FABIS) manual. Am. Bee J. 127, 511-516. Teixeira, E.W., Chen, Y.P., Message, D., Pettis, J.S., Evans, J.D., 2008. Virus infections in Brazilian honey bees. J. Invertebr. Pathol. 99, 117-119. Teixeira, E.W., Chen, Y.P., Message, D., Boncristiani, H.F., Pettis, J.S., Evans, J.D., 2012. Israeli acute paralysis virus in Africanized honey bees in southeastern Brazilian apiaries. J. Apic. Res. 51, 282 – 284. Tentcheva, D., Gauthier, L., Zappulla, N., Dainat, B., Cousserans, F., Colin, M.E., Bergoin, M., 2004. Prevalence and seasonal variations of six bee viruses in Apis mellifera L. and Varroa destructor mite populations in France. Appl. Environ. Microbiol. 70, 7185-7191. Thompson, G.J., Yockey, H., Lim, J., Oldroyd, B.P., 2007. Experimental manipulation of ovary activation and gene expression in honey bee (Apis mellifera) queens and workers: testing hypotheses of reproductive regulation. J. Exp. Zool. 307, 600610. Wilson-Rich, N., Dres, S.T., Starks, P.T., 2008. The ontogeny of immunity: Development of innate immune strength in the honey bee (Apis mellifera). J. Insect Physiol. 54, 1392-1399. Yang, X., Cox-Foster, D.L., 2005. Impact of an ectoparasite on the immunity and

32

pathology of an invertebrate: evidence for host immunosuppression and viral amplification. Proc. Natl. Acad. Sci. USA 102, 7470-7475. Yang, X., Cox-Foster, D., 2007. Effects of parasitization by Varroa destructor on survivorship and physiological traits of Apis mellifera in correlation with viral incidence and microbial challenge. Parasitology 134, 405-412.

Figure captions

33

Fig. 1. Relative RT-PCR product quantification co-amplifying DWV and A. mellifera

RpS5 in brood or adult bees injected with buffer (control), parasitized by V. destructor, or injected with V. destructor homogenate at 2, 12, 24 and 48 hpt. A, European adult bees; B, Africanized adult bees; C, European bee brood; D, Africanized bee brood. Lines are buffer control (—♦—), V. destructor parasitism (− −¾− −) or V. destructor homogenate (∙∙∙∙∙▲∙∙∙∙∙). Values presented are means ± se.

Fig. 2. Relative RT-PCR product quantification co-amplifying BQCV and A. mellifera

RpS5 in brood or adult bees injected with buffer (control), parasitized by V. destructor, or injected with V. destructor homogenate at 2, 12, 24 and 48 hpt. A, European adult bees; B, Africanized adult bees; C, European bee brood; D, Africanized bee brood. Lines are buffer control (—♦—), V. destructor parasitism (− −¾− −) or V. destructor homogenate (∙∙∙∙∙▲∙∙∙∙∙). Values presented are means ± se.

Fig. 3. Relative RT-PCR product quantification co-amplifying SBV and A. mellifera

RpS5 in brood or adult bees injected with buffer (control), parasitized by V. destructor, or injected with V. destructor homogenate at 2, 12, 24 and 48 hpt. A, European adult bees; B, Africanized adult bees; C, European bee brood; D, Africanized bee brood. Lines are buffer control (—♦—), V. destructor parasitism (− −¾− −) or V. destructor homogenate (∙∙∙∙∙▲∙∙∙∙∙). Values presented are means ± se.

Fig. 4. Relative RT-PCR product quantification co-amplifying IAPV and A. mellifera

34

RpS5 in brood or adult bees injected with buffer (control), parasitized by V. destructor, or injected with V. destructor homogenate at 2, 12, 24 and 48 hpt. A, European adult bees; B, Africanized adult bees; C, European bee brood; D, Africanized bee brood. Lines are buffer control (—♦—), V. destructor parasitism (− −¾− −) or V. destructor homogenate (∙∙∙∙∙▲∙∙∙∙∙). Values presented are means ± se.

35

36

37

38

39

40

Highlights · · · ·

Africanized and European bees were compared for virus levels after exposure to Varroa Africanized and European bee virus levels changed after Varroa or homogenate exposure Rates of increase of DWV and BQCV were temporarily lowered in Africanized bees Africanized bees may have greater resistance to some viruses than European bees

41