- Email: [email protected]
Differential Roles of Fas Ligand in Spontaneous and Actively Induced Autoimmune Encephalomyelitis
Clinical Immunology Vol. 95, No. 3, June, pp. 203–211, 2000 doi:10.1006/clim.2000.4861, available online at http://www.idealibrary.com on
Differential Roles of Fas Ligand in Spontaneous and Actively Induced Autoimmune Encephalomyelitis Tzu-Shang T. Liu, Brendan Hilliard, Elena B. Samoilova, and Youhai Chen Institute for Human Gene Therapy and Department of Molecular and Cellular Engineering, University of Pennsylvania School of Medicine, Philadelphia, Pennsylvania 19104
To determine the roles of Fas/Fas ligand (FasL) in autoimmunity, we studied spontaneous and actively induced autoimmune encephalomyelitis in 541 myelin basic protein-specific T cell receptor transgenic mice. We found that spontaneous autoimmune encephalomyelitis, which was initiated by unidentified microbial factors, was dramatically exacerbated in mice carrying Fas or FasL gene mutation. The exacerbation of autoimmune encephalomyelitis was reflected primarily by an increase in disease incidence and a decrease in spontaneous disease recovery. By contrast, actively induced encephalomyelitis, which was initiated by pertussis toxin, was significantly inhibited by Fas or FasL gene mutation. These results suggest that environmental factors that trigger autoimmune disease may determine not only whether disease will occur but also whether an immune molecule such as FasL will promote or inhibit the autoimmune process. © 2000 Academic Press
Key Words: brain; EAE/MS; autoimmunity; Fas (CD95); apoptosis.
INTRODUCTION
FasL is a type II membrane protein that shares homology with a large number of tumor necrosis factor (TNF) family proteins (1, 2). It is normally expressed by a small number of cell types, including activated lymphocytes and cells of the immune privileged organs (such as eye, testis, brain, and spinal cord). Its receptor Fas (CD95) is a type I membrane protein of the TNFreceptor family. Unlike FasL, Fas is expressed constitutively in most tissues (1, 2) and is dramatically upregulated at sites of inflammation (3–5). Fas/FasL interaction induces trimerization of Fas, which in turn activates the IL-1 converting enzyme (ICE) family of caspases, leading to DNA fragmentation and cell death. However, Fas/FasL interaction does not always lead to apoptosis. Under certain conditions, Fas/FasL interaction can also activate target cells, presumably through the nuclear factor (NF)-B pathway (6). In this case, Fas may transmit activating signals similar to
those of TNF receptors, leading to secretion of proinflammatory cytokines, such as IL-1 and IL-8 (7, 8). Fas/FasL have been reported to both inhibit and promote autoimmune inflammation. Mutations of genes encoding Fas or FasL lead to lymphocytic proliferation and autoimmune inflammatory diseases in both humans and mice (1, 2, 9, 10). Under these conditions, T cells of presumably autoimmune origin accumulate in extremely large numbers and exhibit a peculiar phenotype, i.e., CD4 ⫺CD8 ⫺B220 ⫹ or CD4 ⫹CD8 ⫺B220 ⫹. In the late stages of the disease, these aberrant cells become functionally inactive, or anergic (9, 10). While these observations indicate that Fas and FasL are essential for maintaining self-tolerance, recent studies suggest that Fas/FasL interaction can also contribute to autoimmune inflammation. Thus, unlike FasL expressed in the eye, testis, joints, and certain tumors or transplants that confers immune privilege, FasL expressed in the thyroid gland, pancreatic islets, and some other tumors or transplants enhances inflammation (1, 2, 11–15). It is not known whether these opposing effects of Fas/FasL are due to the intrinsic differences of the Fas signals generated (i.e., apoptotic versus activating or chemotactic signals) or differences in the way that the target tissues respond to apoptosis. Nor is it clear what factor(s) determines whether Fas/FasL interaction will promote or inhibit inflammation in a given tissue. Experimental autoimmune encephalomyelitis (EAE) is an animal model for human multiple sclerosis (MS). In both MS and EAE, high levels of Fas are expressed by various inflammatory cells and neuroglial cells in the central nervous system (CNS) (16, 17). These include lymphocytes, macrophages, granulocytes, microglial cells, astrocytes, as well as oligodendrocytes (16). In vitro, Fas ligation induces rapid oligodendrocyte death, which can be demonstrated by LDH release or trypan blue uptake (16). Similarly, FasL is expressed not only by infiltrating T cells but also by microglial cells and neurons in the CNS (16, 18). A role for Fas/ FasL in MS and EAE is, therefore, strongly suggested. Initial studies showed that mice carrying the Fas or
203
1521-6616/00 $35.00 Copyright © 2000 by Academic Press All rights of reproduction in any form reserved.
204
LIU ET AL.
FasL gene mutations were resistant to the development of actively induced EAE. This was true in both C57BL/6 mice (19 –21) and B10.PL mice (20, 21). Adoptive transfer experiments using activated T cells showed that while FasL expressed by encephalitogenic T cells enhanced encephalomyelitis (20 –22), FasL expressed by neural cells inhibited it (20, 21). Thus, it seems plausible that Fas/FasL can both promote and inhibit autoimmune inflammation in the CNS. To address this Fas/FasL paradox in autoimmunity, we studied the roles of Fas/FasL in spontaneous and actively induced EAE in MBP-specific TCR transgenic mice. We report here that environmental factors may dictate not only whether EAE will occur but also whether it will be promoted or inhibited by Fas/FasL. MATERIALS AND METHODS
Mice Six- to ten-week-old B10.PL mice were purchased from Jackson Laboratory (Bar Harbor, ME). Breeding pairs of MBP-specific TCR transgenic B10.PL mice that carry lymphoproliferation (lpr), generalized lymphoproliferative disease (gld), or recombinase activating gene (RAG)-1 mutation were provided by Drs. S. Marusic and S. Tonegawa (MIT, Cambridge, MA) (23, 24). Mice carrying the TCR transgene were identified by flow cytometry using FITC-labeled anti-V8 mAb as described (23, 24). All mice used in this study have been backcrossed for more than 10 generations onto the B10.PL background, and their lpr or gld mutations were confirmed by PCR using the following specific primers: lpr #1, TGTGCTTCGTCAGCAGGAAT; lpr #2, GATTCCCGCCGAATAATCTC; lpr #3, GAGATGCTAAGCAGCAGCC. gld #1, CTCTGATCAATTTTGAGGAATCTAAGACCT; gld #2, CTCTGATCAATTTTGAGGAATCTAAGACCC; gld #3, TCCATGGACCTCGAGAAAATGAAGGATAG. All mice were housed in the University of Pennsylvania Animal Care Facility under pathogen-free conditions.
ibund or dead. Only mice that developed signs of EAE were included to calculate the maximal disease score and day of onset, which are presented as mean ⫾ SEM in this report. Antigens, Antibodies, Recombinant Cytokines and Enzyme-Linked Immunosorbent Assay (ELISA) Mouse MBP1-11 peptide was synthesized using F moc solid phase methods and purified through HPLC by Research Genetics (Huntsville, AL). Pertussis toxin was purchased from List Biological Laboratories (Campbell, CA). The following reagents were purchased from PharMingen (San Diego, CA): purified rat anti-mouse IL-2 and IFN-␥ mAb; recombinant mouse IL-2 and IFN-␥. Quantitative ELISA for IL-2 and IFN-␥ was performed using paired mAbs specific for corresponding cytokines according to the manufacturer’s recommendations (25). Cell Culture For cytokine assays, splenocytes were cultured at 1.5 ⫻ 10 6 cells/well in 0.2 ml of DMEM containing 10% FBS and various concentrations of MBP1-11 peptide. Culture supernatants were collected 40 h later and cytokine concentrations were determined by ELISA. For proliferation assays, 0.5 ⫻ 10 6 cells/well were used. [ 3H]Thymidine was added to each well at 72 h, and cells were harvested 16 h later. Radioactivity was determined using a flatbed beta counter (Wallac, Gaithersburg, MD). Histology Mice were first perfused with PBS, and their brains and spinal cords harvested, fixed in 10% Formalin, and embedded in paraffin. Five-micrometer-thick paraffin sections were stained with hematoxylin and eosin or Luxol fast blue as described (26).
Induction and Clinical Evaluation of EAE Statistical Analysis For induction of EAE in non-transgenic B10.PL mice, both MBP and pertussis toxin were used. Briefly, mice were first injected subcutaneously on the flanks with 200 g mouse MBP1-11 peptide emulsified in complete Freund’s adjuvant (CFA) containing 4 mg/ml of Mycobacterium tuberculosis H37RA (Difco, St. Louis, MO). Mice were then injected intravenously with 200 ng pertussis toxin 1 and 48 h later. For induction of EAE in MBP-specific TCR transgenic mice, only pertussis toxin was used. Mice were examined daily for signs of EAE and scored as follows (25): 0, no disease; 1, tail paralysis; 2, hind limb weakness; 3, hind limb paralysis; 4, hind limb plus forelimb paralysis; 5, mor-
Disease severity, day of onset, thymidine incorporation, and cytokine concentrations were analyzed by analysis of variance (ANOVA). Disease incidence and recovery rate were analyzed by 2 test. RESULTS
Roles of Fas/FasL in Spontaneous EAE To determine the roles of Fas/FasL in EAE, we first examined the development of spontaneous EAE in MBP-specific TCR transgenic mice that do or do not carry Fas (lpr) or FasL (gld) gene mutations. This
205
FAS LIGAND IN AUTOIMMUNE ENCEPHALOMYELITIS
TABLE 1 Clinical Features of Spontaneous EAE in MBP-Specific TCR Transgenic Mice Mice RAG-1⫹/⫹ Female Fas/FasL⫹/⫹ (n ⫽ 47) Fas⫹/⫺ (n ⫽ 54) Fas⫺/⫺ (n ⫽ 40) FasL⫹/⫺ (n ⫽ 57) FasL⫺/⫺ (n ⫽ 75) RAG-1⫹/⫹ Male Fas/FasL⫹/⫹ (n ⫽ 41) Fas⫹/⫺ (n ⫽ 38) Fas⫺/⫺ (n ⫽ 25) FasL⫹/⫺ (n ⫽ 42) FasL⫺/⫺ (n ⫽ 71) RAG-1⫺/⫺ b FasL⫹/⫹ (n ⫽ 11) FasL⫺/⫺ (n ⫽ 26)
Incidence (%)
Maximal disease score a
Recovery rate (%)
Day of onset a
15 22 40 28 35
2.85 ⫾ 0.59 3.25 ⫾ 0.46 2.63 ⫾ 0.29 2.31 ⫾ 0.31 2.46 ⫾ 0.27
57 42 25 44 46
132 ⫾ 42 122 ⫾ 17 119 ⫾ 15 142 ⫾ 16 134 ⫾ 16
17 16 40 19 36
3.14 ⫾ 0.55 3.17 ⫾ 0.83 2.82 ⫾ 0.40 2.75 ⫾ 0.45 3.04 ⫾ 0.32
57 50 27 50 44
92 ⫾ 15 136 ⫾ 41 110 ⫾ 20 89 ⫾ 22 142 ⫾ 16
45 81
2.80 ⫾ 0.91 2.67 ⫾ 0.27
20 14
86 ⫾ 10 77 ⫾ 4
Note. A total of 527 MBP-specific TCR transgenic B10.PL mice were studied for spontaneous EAE for 13 months. The n values represent the numbers of mice of various genotypes. a Mean ⫾ SEM; only mice with signs of EAE were included. b These mice were observed only for 5 months. For the control RAG-1⫺/⫺ group, 7 male and 4 female mice were studied; for the FasL⫺/⫺ group, 13 male and 13 female mice were studied.
involved daily examinations of a total of 527 TCR transgenic mice over a period of 2 years. All mice used in this study were housed in the same pathogen-free animal facility at the University of Pennsylvania. Table 1 summarizes the results from these experiments, and Figs. 1–3 present disease incidences of individual groups of mice. The most striking finding from these experiments was that the incidence of spontaneous EAE was significantly increased in mice carrying either Fas or FasL gene mutation. Thus, approximately 15–17% of normal TCR transgenic mice developed spontaneous EAE during a period of 13 months. This was increased to 40 and 35–36% in mice carrying Fas and FasL gene mutations, respectively (Table 1, Figs. 1 and 2). The incidence of spontaneous EAE in RAG-1-deficient mice was approximately 45% during the first 5 months of their lives, and this was increased to 81% in mice deficient in FasL (Fig. 3). It is to be noted that most RAG-1-deficient TCR transgenic mice developed and died of EAE after 5– 8 months of age, making it difficult to determine the roles of Fas/FasL at older ages. However, the fact that Fas/FasL deficiency promoted the development of EAE in both normal and RAG-1-deficient TCR transgenic mice suggests that the Fas/FasL effect on EAE may not depend on the presence of non-transgenic T or B lymphocytes. It is also to be noted that while heterozygous Fas/FasL gene mutations had little effect on EAE in most groups, female mice carrying a heterozygous FasL gene mutation developed more spontaneous EAE than the controls (Table 1, Fig. 2). However, aside from this effect of heterozygous FasL gene
mutation in female mice, few or no differences were observed between male and female mice with regard to the incidence of spontaneous EAE and its exacerbation by Fas/FasL gene mutations (Table 1). Another important finding from these experiments was that spontaneous recovery from EAE was significantly prevented by Fas/FasL gene mutations (Table 1). For normal TCR transgenic mice that developed spontaneous EAE, the rate of disease recovery was 57%. This was reduced to 25–27 and 44 – 46% in mice carrying Fas and FasL gene mutations, respectively (Table 1, P ⬍ 0.05 for Fas⫺/⫺ mice when compared with control animals). The differences in recovery rate between lpr (Fas⫺/⫺) and gld (FasL⫺/⫺) mice may be due to the fact that neither lpr nor gld is a null mutation and that the functional consequences of these mutations are not identical (1, 2). Most RAG-1-deficient TCR transgenic mice did not recover from EAE, making it difficult to determine the roles of Fas/FasL in disease recovery in these animals. It is to be noted that despite the differences in incidence and disease recovery between control and Fas/ FasL-deficient mice, Fas/FasL gene mutations did not appear to affect the maximal degree of paralysis in mice with EAE (as judged by maximal disease scores) (Table 1). Nor did the Fas/FasL gene mutations significantly affect the day of disease onset (Table 1). RAG-1-deficient TCR transgenic mice in general developed EAE earlier than regular mice and almost always died of the disease a few weeks after disease onset. By contrast, many RAG-1-competent TCR transgenic mice
206
LIU ET AL.
Fas/FasL-Deficient MBP-Specific TCR Transgenic Cells Are Functionally Competent Increased incidence of EAE in Fas/FasL-deficient mice can be due either to the loss of Fas/FasL function in the diseased organ or intrinsic defects of Fas/FasLdeficient cells. To determine whether Fas/FasL-deficient T cells were functionally competent, we examined whether the activation and differentiation of these cells were comparable to those of normal cells. Splenocytes were, therefore, collected from both control and FasL-deficient mice and tested in vitro for their cytokine production and proliferation in response to MBP1-11 peptide. As shown in Fig. 5, splenocytes from both control and FasL-deficient mice proliferated vigorously in response to MBP peptide and produced sig-
FIG. 1. The effect of Fas deficiency on the development of spontaneous EAE. MBP-specific TCR transgenic mice were monitored for spontaneous EAE for a total of 13 months. The incidences of EAE in control mice (Fas⫹/⫹, filled square) and mice heterozygous (Fas⫺/⫹, filled circle) or homozygous (Fas⫺/⫺, open square) for the lpr mutation are shown. The number of mice in each group is shown in Table 1. The differences between Fas⫺/⫺ group and the other two groups are statistically significant (P ⬍ 0.001).
developed chonic EAE and survived for more than 12 months. Consistent with these clinical findings, histological examination of the CNS tissues revealed severe inflammation and demyelination in mice with clinical signs of EAE. Multiple inflammatory foci were detected in both brain and spinal cord. Hematoxylin and eosin staining revealed various inflammatory cell types in the lesions. These include cells with the morphological characteristics of lymphocytes, granulocytes, macrophages, and microglial cells. Luxol fast blue staining was performed to directly visualize demyelination in the CNS; severe demyelination was observed in mice with chonic as well as acute EAE. Figure 4 shows representive CNS lesions in mice recovering from (A) or chonically inflicted by (B) EAE. Severe demyelination was evident in both cases.
FIG. 2. The effect of FasL deficiency on the development of spontaneous EAE. MBP-specific TCR transgenic mice were monitored for spontaneous EAE for a total of 13 months. The incidences of EAE in control mice (FasL⫹/⫹, filled square) and mice heterozygous (FasL⫺/⫹, filled circle) or homozygous (FasL⫺/⫺, open square) for the gld mutation are shown. The number of mice in each group is shown in Table 1. The differences between the FasL⫺/⫺ and FasL⫹/⫹ groups are statistically significant for both male and female mice (P ⬍ 0.01). The difference between FasL⫺/⫺ and FasL⫺/⫹ group is only statistically significant for male mice (P ⬍ 0.01).
FAS LIGAND IN AUTOIMMUNE ENCEPHALOMYELITIS
207
Roles of Fas/FasL in Actively Induced EAE in Nontransgenic Mice
FIG. 3. The effect of FasL deficiency on the development of spontaneous EAE in RAG-1-deficient mice. MBP-specific TCR transgenic mice carrying the RAG-1 gene mutation were monitored for spontaneous EAE for a total of 5 months. The incidences of EAE in control mice (FasL⫹/⫹, filled square) and mice homozygous (FasL⫺/⫺, open square) for the gld mutation are shown. The number of mice in each group is shown in Table 1. The differences between the two groups are statistically significant (P ⬍ 0.05).
nificant amounts of TH1 cytokines (i.e., IL-2 and IFN␥). Little or no TH2 cytokines (i.e., IL-4 and IL-10) were produced in either group (data not shown). Taken together, these results indicate that Fas/FasL-deficient T cells are capable of developing normal immune responses to specific antigens.
Several groups have reported that actively induced EAE in non-transgenic mice was inhibited by Fas/FasL gene mutations. To ensure that the B10.PL mice generated in our laboratory are comparable to those used by other laboratories, we also examined the effect of Fas/FasL gene mutations on EAE in our non-transgenic B10.PL mice. As shown in Fig. 7 and Table 3, 7 out of 10 control B10.PL mice developed EAE 9 days after immunization, reaching a maximal disease score of 2.5 ⫾ 0.7 two weeks later. Remarkably, in the FasLdeficient group, only 1 of 7 mice developed EAE. The disease severity was also significantly reduced, reaching a disease score of only 1 (Fig. 7, Table 3). Thus, in contrast to spontaneous EAE, actively induced EAE in B10.PL mice was inhibited by Fas/FasL gene mutations. DISCUSSION
Environmental factors have long been known to be crucial for the development of autoimmune diseases.
Roles of Fas/FasL in Actively Induced EAE The results described above are in startling contrast to reports that actively induced EAE is inhibited by Fas/FasL gene mutations. Since the etiological factors involved in spontaneous and actively induced EAE are different, we reasoned that factors responsible for the initiation of EAE may also regulate Fas/FasL function. Although the microbial factors that initiate spontaneous EAE have not yet been defined, pertussis toxin and microbacterium have long been known to be essential for the development of actively induced EAE. We therefore examined the effect of Fas/FasL deficiency in pertussis toxin-induced EAE. MBP-specific TCR transgenic mice were treated twice with pertussis toxin and monitored daily for signs of EAE using the same criteria as those for spontaneous EAE. As shown in Fig. 6 and Table 2, pertussis toxin alone induced EAE in 75% of the control TCR transgenic mice. By contrast, only 33% of Fas-deficient mice developed EAE. The maximal disease scores were also slightly reduced in Fasdeficient mice. However, unlike in spontaneous EAE, Fas deficiency did not appear to significantly alter the rate of disease recovery. Taken together, these results strongly suggest that Fas/FasL may play opposite roles in spontaneous and pertussis toxin-induced EAE.
FIG. 4. Histopathological profiles of spinal cords. MBP-specific TCR transgenic B10.PL mice as shown in Fig. 1 were sacrificed and perfused with PBS. Their spinal cords were harvested, fixed in 10% Formalin, and embedded in paraffin. Five-micrometer tissue sections were stained with Luxol fast blue and examined by light microscopy (original magnifications, ⫻200). (A) Section of a Fas⫹/⫹ female mouse recovering from EAE (disease score, 1). (B) Section of a Fas⫺/⫺ female mouse with chonic EAE (disease score, 2). Myelin is shown in green.
208
LIU ET AL.
FIG. 6. The effect of Fas deficiency on the development of actively induced EAE in MBP-specific TCR transgenic mice. MBPspecific TCR transgenic female mice were injected with pertussis toxin to induce EAE, as described under Materials and Methods, and monitored for signs of EAE for a total of 32 days. The incidences of EAE in mice heterozygous (Fas⫺/⫹, filled circle, n ⫽ 8) or homozygous (Fas⫺/⫺, open square, n ⫽ 6) for the lpr mutation are shown. The differences between the two groups are statistically significant (P ⬍ 0.01).
FIG. 5. MBP-specific proliferation and cytokine production in vitro. MBP-specific TCR transgenic B10.PL mice that had no signs of EAE were sacrificed at 2 months of age. Splenocytes, 1.5 ⫻ 10 6 cells/well, were cultured in DMEM containing 10% fetal bovine serum and 0 –25 g/ml of MBP1-11 peptide. Culture supernatants were collected 40 h later and tested for cytokines by ELISA. For the proliferation assay, 0.5 ⫻ 10 6 cells/well were pulsed with [ 3H]Thymidine and tested as described under Materials and Methods. Results are shown as means ⫾ SEM from a total of 20 mice, with 10 mice per group. The experiments were repeated twice with similar results. Open bar, FasL⫹/⫺ mice. Filled bar, FasL⫺/⫺ mice.
MBP-specific TCR transgenic mice develop spontaneous EAE in a conventional but not a germ-free environment (27). While the environmental factors that initiate spontaneous EAE are yet to be defined, pertussis toxin has long been known to be an initiating factor for actively induced EAE. Our unexpected observation that Fas/FasL gene mutations promote spontaneous EAE but inhibit pertussis toxin-induced EAE suggests that environmental factors such as pertussis toxin may play important roles in regulating Fas/FasL function. Thus, environmental factors may determine not only whether autoimmune diseases will occur but also whether molecules such as FasL will promote or inhibit them. Pertussis toxin is one of the best studied environmental factors that modulate autoimmune diseases. It is a 117-kDa protein consisting of an enzymatic subunit and a membrane-binding oligomer. It binds to,
ribosylates, and inactivates G␣ proteins associated with various membrane receptors. Consequently, pertussis toxin interferes with the signal transduction of a variety of G-protein-coupled receptors, including cytokines, chemokines, hormones, and adhesion molecules. Not surprisingly, pertussis toxin has been reported to modulate a number of biological processes, including permeability of endothelial cells and blood–tissue barriers, as well as migration, anergization, and apoptosis of lymphocytes. Additionally, pertussis toxin has also been reported to synergize antigen-induced T cell activation or directly activate T cells in vitro (28, 29). Our recent studies using MBP-specific TCR transgenic cells indicate that pertussis toxin can directly activate encephalitogenic T cells and induce secretion of cytokines such as IFN-␥, IL-10, and TGF- (unpublished data). Since these effects of pertussis toxin may either diTABLE 2 Clinical Features of Actively Induced EAE in MBP-Specific TCR Transgenic Mice a
Mice
Incidence (%)
Maximal disease score
Recovery rate (%)
Day of onset
Fas⫹/⫺ (n ⫽ 8) Fas⫺/⫺ (n ⫽ 6)
6/8 (75) 2/6 (33)
2.0 ⫾ 0.1 1.3 ⫾ 0.1
3/6 (50) 1/2 (50)
6⫾4 9⫾2
a MBP-specific TCR transgenic B10.PL mice were treated with pertussis toxin as described in Fig. 6. All mice were examined daily for signs of EAE for a total of 32 days.
209
FAS LIGAND IN AUTOIMMUNE ENCEPHALOMYELITIS
FIG. 7. The effect of FasL deficiency on the development of actively induced EAE in non-transgenic mice. Non-transgenic B10.PL female mice were immunized with MBP to induce EAE, as described under Materials and Methods, and monitored for signs of EAE for a total of 28 days. The incidences of EAE in mice heterozygous (FasL⫺/⫹, filled circle, n ⫽ 10) and homozygous (FasL⫺/⫺, open square, n ⫽ 7) for the gld mutation are shown. The differences between the two groups are statistically significant (P ⬍ 0.001).
rectly or indirectly modulate Fas/FasL functions, it is tempting to speculate that they may be responsible for the paradoxical effects of Fas/FasL in different models of EAE. Further studies are needed to address this issue. Although it is well established that Fas/FasL interaction plays an important role in preventing systemic autoimmunity, the roles of Fas/FasL in organ-specific autoimmune diseases have just begun to be appreciated. Kang et al., Chervonsky et al., and Giordano et al. reported that Fas/FasL interaction may contribute to the pathogenesis of autoimmune thyroiditis and diabetes (14, 15, 30). Similarly, Waldner et al. and Sabelko et al. showed that EAE was diminished and apoptosis inhibited in mice carrying the lpr or the gld mutation, suggesting that Fas/FasL interaction may play an active role in the pathogenesis of EAE (19, 20). However, it should be noted that the lpr and gld mice used in these experiments are prone to the development of systemic autoimmune diseases. Thus, it is not clear whether the resistance of lpr or gld mice to organspecific autoimmune diseases is solely due to the lack of Fas/FasL interaction in the diseased organs or indirectly due to the systemic autoimmune diseases present in these mice. This is an important issue since it is well known that lpr and gld mice are relatively hyporesponsive to antigens compared to normal mice (31). To address this issue, we have studied EAE in Fas/FasL-deficient MBP-specific TCR transgenic mice. In TCR transgenic mice deficient in Fas/FasL functions, systemic autoimmune diseases are significantly inhibited due to the presence of transgenic T cells (32).
These experiments led to our unexpected discovery that the roles of Fas/FasL in spontaneous EAE are different from that in actively induced EAE, suggesting that environmental factors responsible for the induction of EAE may also regulate Fas/FasL function. The proinflammatory effect of FasL in EAE may be a result of its direct killing of neural cells. The hallmark of the CNS pathology in EAE and multiple sclerosis is demyelination and loss of oligodendrocytes that produce the myelin sheath. It is, therefore, generally accepted that death of glial cells may contribute to the pathology of the disease. Using an in situ TUNEL technique, a method that sensitively detects apoptosis at the single cell level, we and others have reported large numbers of apoptotic cells in the CNS of animals with EAE (19 –21, 33). Mutations of Fas/FasL genes significantly diminished the number of apoptotic cells in actively induced EAE (19 –21). Using adoptive transfer system, it has been shown that FasL expressed on T cells but not neural cells is involved in destroying neural tissues (21). The anti-inflammatory effect of FasL in spontaneous EAE may be a result of its direct killing of autoreactive cells. This is strongly suggested by the phenotype of lpr and gld mice, i.e., massive accumulation of autoreative cells as a result of Fas/FasL deficiency. Activationinduced cell death, which was initially described by Ashwell and colleagues (34), has now been shown to be mediated by Fas/FasL both in vitro and in vivo (35, 36). Activation-induced cell death of autoreactive T cells may, therefore, be responsible for the anti-inflammatory effect of FasL in autoimmune diseases. Our observation that the incidence of spontaneous EAE was increased while the recovery rate decreased in mice deficient in Fas/FasL function suggests that the antiinflammatory effect of Fas/FasL prevails in the spontaneous disease model. Since most autoimmune diseases in humans are “spontaneous” in nature, these results may have important ramifications for our understanding of the Fas/FasL function in human autoimmune diseases.
TABLE 3 Clinical Features of Actively Induced EAE in Non-transgenic Mice
Mice
Incidence (%)
Maximal disease score
Recovery rate (%)
Day of onset
FasL⫹/⫺ (n ⫽ 10) FasL⫺/⫺ (n ⫽ 7)
7/10 (70) 1/7 (14)
2.5 ⫾ 0.7 1
4/7 (57) ND
9⫾2 7
Note. Six- to ten-week old non-transgenic B10.PL mice were treated with pertussis toxin and MBP/CFA as described in Fig. 7. All mice were examined daily for signs of EAE for a total of 28 days. ND, not determined.
210
LIU ET AL.
In summary, we have discovered that Fas/FasL play distinct roles in spontaneous and actively induced EAE. These results underscore the importance of environmental factors in not only the induction but also the regulation of autoimmune diseases. ACKNOWLEDGMENTS We thank Drs. S. Marusic and S. Tonegawa (MIT, Cambridge, MA) for providing breeding pairs of mice used in this study. This work was supported by grants from the National Institutes of Health (NS53681, NS40188, and AR44914). REFERENCES 1. Nagata, S., and Golstein, P., The Fas death factor. Science 267, 1449, 1995. 2. Suda, T., Okazaki, T., Naito, Y., Yokota, T., Arai, N., Ozaki, S., Nakao, K., and Nagata, S., Expression of the Fas ligand in cells of T cell lineage. J. Immunol. 154, 3806, 1995. 3. Dowling, P., Shang, G., Raval, S., Menonna, J., Cook, S., and Husar, W., Involvement of the CD95 (APO-1/Fas) receptor/ligand system in multiple sclerosis brain. J. Exp. Med. 184, 1513, 1996. 4. Vergelli, M., Hemmer, B., Muraro, P. A., Tranquill, L., Biddison, W. E., Sarin, A., McFarland, H. F., and Martin, R., Human autoreactive CD4⫹ T cell clones use perforin- or Fas/Fas ligandmediated pathways for target cell lysis. J. Immunol. 158, 2756, 1997. 5. Firestein, G. S., Yeo, M., and Zvaifler, N. J., Apoptosis in rheumatoid arthitis synovium. J. Clin. Invest. 96, 1631, 1995. 6. Rensing-Ehl, A., Hess, S., Ziegler-Heitbrock, H. W., Riethmuller, G., and Engelmann, H., Fas/Apo-1 activates nuclear factor kappa B and induces interleukin-6 production. J. Inflammation 45, 161, 1995. 7. Abreu-Martin, M. T., Vidrich, A., Lynch, D. H., and Targan, S. R., Divergent induction of apoptosis and IL-8 secretion in HT-29 cells in response to TNF-alpha and ligation of Fas antigen. J. Immunol. 155, 4147, 1995. 8. Ponton, A., Clement, M. V., and Stamenkovic, I., The CD95 (APO-1/Fas) receptor activates NF-kappaB independently of its cytotoxic function. J. Biol. Chem. 271, 8991, 1996. 9. Cohen, P. L., and Eisenberg, R. A., The lpr and gld genes in systemic autoimmunity: Life and death in the Fas lane. Immunol. Today 13, 427, 1992. 10. Cohen, J. J., Duke, R. C., Fadok, V. A., and Sellins, K. S., Apoptosis and programmed cell death in immunity. Ann. Rev. Immunol. 10, 267, 1992. 11. Griffith, T. S., Brunner, T., Fletcher, S. M., Green, D. R., and Ferguson, T. A., Fas ligand-induced apoptosis as a mechanism of immune privilege. Science 270, 1189, 1995. 12. Zhang, H., Yang, Y., Horton, J. L., Samoilova, E. B., Judge, T., Turka, L. A., Wilson, J. M., and Chen, Y., Amelioration of collagen-induced arthitis by Fas (CD95)-ligand gene transfer. J. Clin. Invest. 100, 1951, 1997. 13. Hahne, M., Rimoldi, D., Schoter, M., Romero, P., Scheier, M., French, L. E., Schneider, P., Bornand, T., Fontana, A., Lienard, D., Cerottini, J., and Tschopp, J., Melanoma cell expression of Fas(Apo-1/CD95) ligand: Implications for tumor immune escape. Science 274, 1363, 1996. 14. Giordano, C., Stassi, G., De Maria, R., Todaro, M., Richiusa, P., Papoff, G., Ruberti, G., Bagnasco, M., Testi, R., and Galluzzo, A., Potential involvement of Fas and its ligand in the pathogenesis of Hashimoto’s thyroiditis. Science 275, 960, 1997.
15. Chervonsky, A. V., Wang, Y., Wong, F. S., Visintin, I., Flavell, R. A., Janeway, C. A., Jr., and Matis, L. A., The role of Fas in autoimmune diabetes. Cell 89, 17, 1997. 16. D’Souza, S. D., Bonetti, B., Balasingam, V., Cashman, N. R., Barker, P. A., Troutt, A. B., Raine, C. S., and Antel, J. P., Multiple sclerosis: Fas signaling in oligodendrocyte cell death. J. Exp. Med. 184, 2361, 1996. 17. Bonetti, B., and Raine, C. S., Multiple sclerosis: Oligodendrocytes display cell death-related molecules in situ but do not undergo apoptosis. Ann. Neurol. 42, 74, 1997. 18. Xerri, L., Devilard, E., Hassoun, J., Mawas, C., and Birg, F., Fas ligand is not only expressed in immune privileged human organs but is also coexpressed with Fas in various epithelial tissues. Mol. Pathol. 50, 87, 1997. 19. Waldner, H., Sobel, R. A., Howard, E., and Kuchroo, V. K., Fasand FasL-deficient mice are resistant to induction of autoimmune encephalomyelitis. J. Immunol. 159, 3100 , 1997. 20. Sabelko, K. A., Kelly, K. A., MNahm, M. H., Cross, A. H., and Russell, J. H., Fas and Fas ligand enhance the pathogenesis of experimental allergic encephalomyelitis, but are not essential for immune privilege in the central nervous system. J. Immunol. 159, 3096, 1997. 21. Sabelko-Downes, K. A., Cross, A. H., and Russell, J. H., Dual role for Fas ligand in the initiation of and recovery from experimental allergic encephalomyelitis. J. Exp. Med. 189, 1195, 1999. 22. Dittel, B. N., Merchant, R. M., and Janeway, C. A., Jr., Evidence for Fas-dependent and Fas-independent mechanisms in the pathogenesis of experimental autoimmune encephalomyelitis. J. Immunol. 162, 6392, 1999. 23. Lafaille, J. J., Keere, F. V., Hsu, A. L., Baron, J. L., Haas, W., Raine, C. S., and Tonegawa, S., Myelin basic protein-specific T helper 2 (Th2) cells cause experimental autoimmune encephalomyelitis in immunodeficient hosts rather than protect them from the disease. J. Exp. Med. 186, 307, 1997. 24. Lafaille, J. J., Nagashima, K., Katsuki, M., and Tonegawa, S., High incidence of spontanous autoimmune encephalomyelitis in immunodeficient anti-myelin basic protein T cell receptor transgenic mice. Cell 78, 399, 1994. 25. Chen, Y., Kuchroo, V. K., Inobe, J.-I., Hafler, D. A., and Weiner, H. L., Regulatory T cell clones induced by oral tolerance: Suppression of autoimmune encephalomyelitis. Science 265, 1237, 1994. 26. Moore, G. R., Traugott, U., Farooq, M., Norton, W. T., and Raine, C. S., Experimental autoimmune encephalomyelitis. Augmentation of demyelination by different myelin lipids. Lab. Invest. 51, 416, 1984. 27. Goverman, J., Woods, A., Larson, L., Weiner, L. P., Hood, L., and Zaller, D. M., Transgenic mice that express a myelin basic protein-specific T cell receptor develop spontaneous autoimmunity. Cell 72, 551, 1993. 28. Ben-Nun, A., Yossefi, S., and Lehmann, D., PPD and pertussis toxin as proteins active in protecting mice against experimental autoimmune encephalomyelitis. Eur. J. Immunol. 23, 689, 1993. 29. Khelef, N., Zychlinsky, A., and Guiso, N., Bordetella pertussis induces apoptosis in macrophages: Role of adenylate cyclasehemolysin. Infect. Immun. 61, 4064, 1993. 30. Kang, S. M., Schneider, D. B., Lin, Z., Hanahan, D., Dichek, D. A., Stock, P. G., and Baekkeskov, S., Fas ligand expression in islets of Langerhans does not confer immune privilege and instead targets them for rapid destruction. Nature Med. 3, 738, 1997.
FAS LIGAND IN AUTOIMMUNE ENCEPHALOMYELITIS 31. Scott, C. F., Jr., Tsurufuji, M., Lu, C. Y., Finberg, R., and Sy, M. S., Comparison of antigen-specific T cell responses in autoimmune MRL/Mp-lpr/lpr and MRL/Mp-⫹/⫹ mice. J. Immunol. 132, 633, 1984. 32. Yui, K., Bhandoola, A., Radic, M. Z., Komori, S., Katsumata, M., and Greene, M. I., Inhibition of abnormal T cell development and autoimmunity in gld mice by transgenic T cell receptor beta chain. Eur. J. Immunol. 22, 1693, 1992. 33. Chen, Y., Hancock, W. W., Marks, R., Gonnella, P., and Weiner, H. L., Mechanisms of recovery from experimental autoimmune encephalomyelitis: T cell deletion and immune deviation in myelin basic protein T cell receptor transgenic mice. J. Neuroimmunol. 82, 149, 1998. Received November 4, 1999; accepted with revision March 7, 2000
211
34. Mercep, M., Weissman, A. M., Frank, S. J., Klausner, R. D., and Ashwell, J. D., Activation-driven programmed cell death and T cell receptor zeta eta expression. Science 246, 1162, 1989. 35. Brunner, T., Mogil, R. J., LaFace, D., Yoo, N. J., Mahboubi, A., Echeverri, F., Martin, S. J., Force, W. R., Lynch, D. H., Ware, C. F., and Green, D. R., Cell-autonomous Fas (CD95)/Fas-ligand interaction mediates activation-induced apoptosis in T-cell hybridomas. Nature 373, 441, 1995. 36. Mogil, R. J., Radvanyi, L., Gonzalez-Quintial, R., Miller, R., Mills, G., Theofilopoulos, A. N., and Green, D. R., Fas (CD95) participates in peripheral T cell deletion and associated apoptosis in vivo. Int. Immunol. 7, 1451, 1995.
Differential Roles of Fas Ligand in Spontaneous and Actively Induced Autoimmune Encephalomyelitis Tzu-Shang T. Liu, Brendan Hilliard, Elena B. Samoilova, and Youhai Chen Institute for Human Gene Therapy and Department of Molecular and Cellular Engineering, University of Pennsylvania School of Medicine, Philadelphia, Pennsylvania 19104
To determine the roles of Fas/Fas ligand (FasL) in autoimmunity, we studied spontaneous and actively induced autoimmune encephalomyelitis in 541 myelin basic protein-specific T cell receptor transgenic mice. We found that spontaneous autoimmune encephalomyelitis, which was initiated by unidentified microbial factors, was dramatically exacerbated in mice carrying Fas or FasL gene mutation. The exacerbation of autoimmune encephalomyelitis was reflected primarily by an increase in disease incidence and a decrease in spontaneous disease recovery. By contrast, actively induced encephalomyelitis, which was initiated by pertussis toxin, was significantly inhibited by Fas or FasL gene mutation. These results suggest that environmental factors that trigger autoimmune disease may determine not only whether disease will occur but also whether an immune molecule such as FasL will promote or inhibit the autoimmune process. © 2000 Academic Press
Key Words: brain; EAE/MS; autoimmunity; Fas (CD95); apoptosis.
INTRODUCTION
FasL is a type II membrane protein that shares homology with a large number of tumor necrosis factor (TNF) family proteins (1, 2). It is normally expressed by a small number of cell types, including activated lymphocytes and cells of the immune privileged organs (such as eye, testis, brain, and spinal cord). Its receptor Fas (CD95) is a type I membrane protein of the TNFreceptor family. Unlike FasL, Fas is expressed constitutively in most tissues (1, 2) and is dramatically upregulated at sites of inflammation (3–5). Fas/FasL interaction induces trimerization of Fas, which in turn activates the IL-1 converting enzyme (ICE) family of caspases, leading to DNA fragmentation and cell death. However, Fas/FasL interaction does not always lead to apoptosis. Under certain conditions, Fas/FasL interaction can also activate target cells, presumably through the nuclear factor (NF)-B pathway (6). In this case, Fas may transmit activating signals similar to
those of TNF receptors, leading to secretion of proinflammatory cytokines, such as IL-1 and IL-8 (7, 8). Fas/FasL have been reported to both inhibit and promote autoimmune inflammation. Mutations of genes encoding Fas or FasL lead to lymphocytic proliferation and autoimmune inflammatory diseases in both humans and mice (1, 2, 9, 10). Under these conditions, T cells of presumably autoimmune origin accumulate in extremely large numbers and exhibit a peculiar phenotype, i.e., CD4 ⫺CD8 ⫺B220 ⫹ or CD4 ⫹CD8 ⫺B220 ⫹. In the late stages of the disease, these aberrant cells become functionally inactive, or anergic (9, 10). While these observations indicate that Fas and FasL are essential for maintaining self-tolerance, recent studies suggest that Fas/FasL interaction can also contribute to autoimmune inflammation. Thus, unlike FasL expressed in the eye, testis, joints, and certain tumors or transplants that confers immune privilege, FasL expressed in the thyroid gland, pancreatic islets, and some other tumors or transplants enhances inflammation (1, 2, 11–15). It is not known whether these opposing effects of Fas/FasL are due to the intrinsic differences of the Fas signals generated (i.e., apoptotic versus activating or chemotactic signals) or differences in the way that the target tissues respond to apoptosis. Nor is it clear what factor(s) determines whether Fas/FasL interaction will promote or inhibit inflammation in a given tissue. Experimental autoimmune encephalomyelitis (EAE) is an animal model for human multiple sclerosis (MS). In both MS and EAE, high levels of Fas are expressed by various inflammatory cells and neuroglial cells in the central nervous system (CNS) (16, 17). These include lymphocytes, macrophages, granulocytes, microglial cells, astrocytes, as well as oligodendrocytes (16). In vitro, Fas ligation induces rapid oligodendrocyte death, which can be demonstrated by LDH release or trypan blue uptake (16). Similarly, FasL is expressed not only by infiltrating T cells but also by microglial cells and neurons in the CNS (16, 18). A role for Fas/ FasL in MS and EAE is, therefore, strongly suggested. Initial studies showed that mice carrying the Fas or
203
1521-6616/00 $35.00 Copyright © 2000 by Academic Press All rights of reproduction in any form reserved.
204
LIU ET AL.
FasL gene mutations were resistant to the development of actively induced EAE. This was true in both C57BL/6 mice (19 –21) and B10.PL mice (20, 21). Adoptive transfer experiments using activated T cells showed that while FasL expressed by encephalitogenic T cells enhanced encephalomyelitis (20 –22), FasL expressed by neural cells inhibited it (20, 21). Thus, it seems plausible that Fas/FasL can both promote and inhibit autoimmune inflammation in the CNS. To address this Fas/FasL paradox in autoimmunity, we studied the roles of Fas/FasL in spontaneous and actively induced EAE in MBP-specific TCR transgenic mice. We report here that environmental factors may dictate not only whether EAE will occur but also whether it will be promoted or inhibited by Fas/FasL. MATERIALS AND METHODS
Mice Six- to ten-week-old B10.PL mice were purchased from Jackson Laboratory (Bar Harbor, ME). Breeding pairs of MBP-specific TCR transgenic B10.PL mice that carry lymphoproliferation (lpr), generalized lymphoproliferative disease (gld), or recombinase activating gene (RAG)-1 mutation were provided by Drs. S. Marusic and S. Tonegawa (MIT, Cambridge, MA) (23, 24). Mice carrying the TCR transgene were identified by flow cytometry using FITC-labeled anti-V8 mAb as described (23, 24). All mice used in this study have been backcrossed for more than 10 generations onto the B10.PL background, and their lpr or gld mutations were confirmed by PCR using the following specific primers: lpr #1, TGTGCTTCGTCAGCAGGAAT; lpr #2, GATTCCCGCCGAATAATCTC; lpr #3, GAGATGCTAAGCAGCAGCC. gld #1, CTCTGATCAATTTTGAGGAATCTAAGACCT; gld #2, CTCTGATCAATTTTGAGGAATCTAAGACCC; gld #3, TCCATGGACCTCGAGAAAATGAAGGATAG. All mice were housed in the University of Pennsylvania Animal Care Facility under pathogen-free conditions.
ibund or dead. Only mice that developed signs of EAE were included to calculate the maximal disease score and day of onset, which are presented as mean ⫾ SEM in this report. Antigens, Antibodies, Recombinant Cytokines and Enzyme-Linked Immunosorbent Assay (ELISA) Mouse MBP1-11 peptide was synthesized using F moc solid phase methods and purified through HPLC by Research Genetics (Huntsville, AL). Pertussis toxin was purchased from List Biological Laboratories (Campbell, CA). The following reagents were purchased from PharMingen (San Diego, CA): purified rat anti-mouse IL-2 and IFN-␥ mAb; recombinant mouse IL-2 and IFN-␥. Quantitative ELISA for IL-2 and IFN-␥ was performed using paired mAbs specific for corresponding cytokines according to the manufacturer’s recommendations (25). Cell Culture For cytokine assays, splenocytes were cultured at 1.5 ⫻ 10 6 cells/well in 0.2 ml of DMEM containing 10% FBS and various concentrations of MBP1-11 peptide. Culture supernatants were collected 40 h later and cytokine concentrations were determined by ELISA. For proliferation assays, 0.5 ⫻ 10 6 cells/well were used. [ 3H]Thymidine was added to each well at 72 h, and cells were harvested 16 h later. Radioactivity was determined using a flatbed beta counter (Wallac, Gaithersburg, MD). Histology Mice were first perfused with PBS, and their brains and spinal cords harvested, fixed in 10% Formalin, and embedded in paraffin. Five-micrometer-thick paraffin sections were stained with hematoxylin and eosin or Luxol fast blue as described (26).
Induction and Clinical Evaluation of EAE Statistical Analysis For induction of EAE in non-transgenic B10.PL mice, both MBP and pertussis toxin were used. Briefly, mice were first injected subcutaneously on the flanks with 200 g mouse MBP1-11 peptide emulsified in complete Freund’s adjuvant (CFA) containing 4 mg/ml of Mycobacterium tuberculosis H37RA (Difco, St. Louis, MO). Mice were then injected intravenously with 200 ng pertussis toxin 1 and 48 h later. For induction of EAE in MBP-specific TCR transgenic mice, only pertussis toxin was used. Mice were examined daily for signs of EAE and scored as follows (25): 0, no disease; 1, tail paralysis; 2, hind limb weakness; 3, hind limb paralysis; 4, hind limb plus forelimb paralysis; 5, mor-
Disease severity, day of onset, thymidine incorporation, and cytokine concentrations were analyzed by analysis of variance (ANOVA). Disease incidence and recovery rate were analyzed by 2 test. RESULTS
Roles of Fas/FasL in Spontaneous EAE To determine the roles of Fas/FasL in EAE, we first examined the development of spontaneous EAE in MBP-specific TCR transgenic mice that do or do not carry Fas (lpr) or FasL (gld) gene mutations. This
205
FAS LIGAND IN AUTOIMMUNE ENCEPHALOMYELITIS
TABLE 1 Clinical Features of Spontaneous EAE in MBP-Specific TCR Transgenic Mice Mice RAG-1⫹/⫹ Female Fas/FasL⫹/⫹ (n ⫽ 47) Fas⫹/⫺ (n ⫽ 54) Fas⫺/⫺ (n ⫽ 40) FasL⫹/⫺ (n ⫽ 57) FasL⫺/⫺ (n ⫽ 75) RAG-1⫹/⫹ Male Fas/FasL⫹/⫹ (n ⫽ 41) Fas⫹/⫺ (n ⫽ 38) Fas⫺/⫺ (n ⫽ 25) FasL⫹/⫺ (n ⫽ 42) FasL⫺/⫺ (n ⫽ 71) RAG-1⫺/⫺ b FasL⫹/⫹ (n ⫽ 11) FasL⫺/⫺ (n ⫽ 26)
Incidence (%)
Maximal disease score a
Recovery rate (%)
Day of onset a
15 22 40 28 35
2.85 ⫾ 0.59 3.25 ⫾ 0.46 2.63 ⫾ 0.29 2.31 ⫾ 0.31 2.46 ⫾ 0.27
57 42 25 44 46
132 ⫾ 42 122 ⫾ 17 119 ⫾ 15 142 ⫾ 16 134 ⫾ 16
17 16 40 19 36
3.14 ⫾ 0.55 3.17 ⫾ 0.83 2.82 ⫾ 0.40 2.75 ⫾ 0.45 3.04 ⫾ 0.32
57 50 27 50 44
92 ⫾ 15 136 ⫾ 41 110 ⫾ 20 89 ⫾ 22 142 ⫾ 16
45 81
2.80 ⫾ 0.91 2.67 ⫾ 0.27
20 14
86 ⫾ 10 77 ⫾ 4
Note. A total of 527 MBP-specific TCR transgenic B10.PL mice were studied for spontaneous EAE for 13 months. The n values represent the numbers of mice of various genotypes. a Mean ⫾ SEM; only mice with signs of EAE were included. b These mice were observed only for 5 months. For the control RAG-1⫺/⫺ group, 7 male and 4 female mice were studied; for the FasL⫺/⫺ group, 13 male and 13 female mice were studied.
involved daily examinations of a total of 527 TCR transgenic mice over a period of 2 years. All mice used in this study were housed in the same pathogen-free animal facility at the University of Pennsylvania. Table 1 summarizes the results from these experiments, and Figs. 1–3 present disease incidences of individual groups of mice. The most striking finding from these experiments was that the incidence of spontaneous EAE was significantly increased in mice carrying either Fas or FasL gene mutation. Thus, approximately 15–17% of normal TCR transgenic mice developed spontaneous EAE during a period of 13 months. This was increased to 40 and 35–36% in mice carrying Fas and FasL gene mutations, respectively (Table 1, Figs. 1 and 2). The incidence of spontaneous EAE in RAG-1-deficient mice was approximately 45% during the first 5 months of their lives, and this was increased to 81% in mice deficient in FasL (Fig. 3). It is to be noted that most RAG-1-deficient TCR transgenic mice developed and died of EAE after 5– 8 months of age, making it difficult to determine the roles of Fas/FasL at older ages. However, the fact that Fas/FasL deficiency promoted the development of EAE in both normal and RAG-1-deficient TCR transgenic mice suggests that the Fas/FasL effect on EAE may not depend on the presence of non-transgenic T or B lymphocytes. It is also to be noted that while heterozygous Fas/FasL gene mutations had little effect on EAE in most groups, female mice carrying a heterozygous FasL gene mutation developed more spontaneous EAE than the controls (Table 1, Fig. 2). However, aside from this effect of heterozygous FasL gene
mutation in female mice, few or no differences were observed between male and female mice with regard to the incidence of spontaneous EAE and its exacerbation by Fas/FasL gene mutations (Table 1). Another important finding from these experiments was that spontaneous recovery from EAE was significantly prevented by Fas/FasL gene mutations (Table 1). For normal TCR transgenic mice that developed spontaneous EAE, the rate of disease recovery was 57%. This was reduced to 25–27 and 44 – 46% in mice carrying Fas and FasL gene mutations, respectively (Table 1, P ⬍ 0.05 for Fas⫺/⫺ mice when compared with control animals). The differences in recovery rate between lpr (Fas⫺/⫺) and gld (FasL⫺/⫺) mice may be due to the fact that neither lpr nor gld is a null mutation and that the functional consequences of these mutations are not identical (1, 2). Most RAG-1-deficient TCR transgenic mice did not recover from EAE, making it difficult to determine the roles of Fas/FasL in disease recovery in these animals. It is to be noted that despite the differences in incidence and disease recovery between control and Fas/ FasL-deficient mice, Fas/FasL gene mutations did not appear to affect the maximal degree of paralysis in mice with EAE (as judged by maximal disease scores) (Table 1). Nor did the Fas/FasL gene mutations significantly affect the day of disease onset (Table 1). RAG-1-deficient TCR transgenic mice in general developed EAE earlier than regular mice and almost always died of the disease a few weeks after disease onset. By contrast, many RAG-1-competent TCR transgenic mice
206
LIU ET AL.
Fas/FasL-Deficient MBP-Specific TCR Transgenic Cells Are Functionally Competent Increased incidence of EAE in Fas/FasL-deficient mice can be due either to the loss of Fas/FasL function in the diseased organ or intrinsic defects of Fas/FasLdeficient cells. To determine whether Fas/FasL-deficient T cells were functionally competent, we examined whether the activation and differentiation of these cells were comparable to those of normal cells. Splenocytes were, therefore, collected from both control and FasL-deficient mice and tested in vitro for their cytokine production and proliferation in response to MBP1-11 peptide. As shown in Fig. 5, splenocytes from both control and FasL-deficient mice proliferated vigorously in response to MBP peptide and produced sig-
FIG. 1. The effect of Fas deficiency on the development of spontaneous EAE. MBP-specific TCR transgenic mice were monitored for spontaneous EAE for a total of 13 months. The incidences of EAE in control mice (Fas⫹/⫹, filled square) and mice heterozygous (Fas⫺/⫹, filled circle) or homozygous (Fas⫺/⫺, open square) for the lpr mutation are shown. The number of mice in each group is shown in Table 1. The differences between Fas⫺/⫺ group and the other two groups are statistically significant (P ⬍ 0.001).
developed chonic EAE and survived for more than 12 months. Consistent with these clinical findings, histological examination of the CNS tissues revealed severe inflammation and demyelination in mice with clinical signs of EAE. Multiple inflammatory foci were detected in both brain and spinal cord. Hematoxylin and eosin staining revealed various inflammatory cell types in the lesions. These include cells with the morphological characteristics of lymphocytes, granulocytes, macrophages, and microglial cells. Luxol fast blue staining was performed to directly visualize demyelination in the CNS; severe demyelination was observed in mice with chonic as well as acute EAE. Figure 4 shows representive CNS lesions in mice recovering from (A) or chonically inflicted by (B) EAE. Severe demyelination was evident in both cases.
FIG. 2. The effect of FasL deficiency on the development of spontaneous EAE. MBP-specific TCR transgenic mice were monitored for spontaneous EAE for a total of 13 months. The incidences of EAE in control mice (FasL⫹/⫹, filled square) and mice heterozygous (FasL⫺/⫹, filled circle) or homozygous (FasL⫺/⫺, open square) for the gld mutation are shown. The number of mice in each group is shown in Table 1. The differences between the FasL⫺/⫺ and FasL⫹/⫹ groups are statistically significant for both male and female mice (P ⬍ 0.01). The difference between FasL⫺/⫺ and FasL⫺/⫹ group is only statistically significant for male mice (P ⬍ 0.01).
FAS LIGAND IN AUTOIMMUNE ENCEPHALOMYELITIS
207
Roles of Fas/FasL in Actively Induced EAE in Nontransgenic Mice
FIG. 3. The effect of FasL deficiency on the development of spontaneous EAE in RAG-1-deficient mice. MBP-specific TCR transgenic mice carrying the RAG-1 gene mutation were monitored for spontaneous EAE for a total of 5 months. The incidences of EAE in control mice (FasL⫹/⫹, filled square) and mice homozygous (FasL⫺/⫺, open square) for the gld mutation are shown. The number of mice in each group is shown in Table 1. The differences between the two groups are statistically significant (P ⬍ 0.05).
nificant amounts of TH1 cytokines (i.e., IL-2 and IFN␥). Little or no TH2 cytokines (i.e., IL-4 and IL-10) were produced in either group (data not shown). Taken together, these results indicate that Fas/FasL-deficient T cells are capable of developing normal immune responses to specific antigens.
Several groups have reported that actively induced EAE in non-transgenic mice was inhibited by Fas/FasL gene mutations. To ensure that the B10.PL mice generated in our laboratory are comparable to those used by other laboratories, we also examined the effect of Fas/FasL gene mutations on EAE in our non-transgenic B10.PL mice. As shown in Fig. 7 and Table 3, 7 out of 10 control B10.PL mice developed EAE 9 days after immunization, reaching a maximal disease score of 2.5 ⫾ 0.7 two weeks later. Remarkably, in the FasLdeficient group, only 1 of 7 mice developed EAE. The disease severity was also significantly reduced, reaching a disease score of only 1 (Fig. 7, Table 3). Thus, in contrast to spontaneous EAE, actively induced EAE in B10.PL mice was inhibited by Fas/FasL gene mutations. DISCUSSION
Environmental factors have long been known to be crucial for the development of autoimmune diseases.
Roles of Fas/FasL in Actively Induced EAE The results described above are in startling contrast to reports that actively induced EAE is inhibited by Fas/FasL gene mutations. Since the etiological factors involved in spontaneous and actively induced EAE are different, we reasoned that factors responsible for the initiation of EAE may also regulate Fas/FasL function. Although the microbial factors that initiate spontaneous EAE have not yet been defined, pertussis toxin and microbacterium have long been known to be essential for the development of actively induced EAE. We therefore examined the effect of Fas/FasL deficiency in pertussis toxin-induced EAE. MBP-specific TCR transgenic mice were treated twice with pertussis toxin and monitored daily for signs of EAE using the same criteria as those for spontaneous EAE. As shown in Fig. 6 and Table 2, pertussis toxin alone induced EAE in 75% of the control TCR transgenic mice. By contrast, only 33% of Fas-deficient mice developed EAE. The maximal disease scores were also slightly reduced in Fasdeficient mice. However, unlike in spontaneous EAE, Fas deficiency did not appear to significantly alter the rate of disease recovery. Taken together, these results strongly suggest that Fas/FasL may play opposite roles in spontaneous and pertussis toxin-induced EAE.
FIG. 4. Histopathological profiles of spinal cords. MBP-specific TCR transgenic B10.PL mice as shown in Fig. 1 were sacrificed and perfused with PBS. Their spinal cords were harvested, fixed in 10% Formalin, and embedded in paraffin. Five-micrometer tissue sections were stained with Luxol fast blue and examined by light microscopy (original magnifications, ⫻200). (A) Section of a Fas⫹/⫹ female mouse recovering from EAE (disease score, 1). (B) Section of a Fas⫺/⫺ female mouse with chonic EAE (disease score, 2). Myelin is shown in green.
208
LIU ET AL.
FIG. 6. The effect of Fas deficiency on the development of actively induced EAE in MBP-specific TCR transgenic mice. MBPspecific TCR transgenic female mice were injected with pertussis toxin to induce EAE, as described under Materials and Methods, and monitored for signs of EAE for a total of 32 days. The incidences of EAE in mice heterozygous (Fas⫺/⫹, filled circle, n ⫽ 8) or homozygous (Fas⫺/⫺, open square, n ⫽ 6) for the lpr mutation are shown. The differences between the two groups are statistically significant (P ⬍ 0.01).
FIG. 5. MBP-specific proliferation and cytokine production in vitro. MBP-specific TCR transgenic B10.PL mice that had no signs of EAE were sacrificed at 2 months of age. Splenocytes, 1.5 ⫻ 10 6 cells/well, were cultured in DMEM containing 10% fetal bovine serum and 0 –25 g/ml of MBP1-11 peptide. Culture supernatants were collected 40 h later and tested for cytokines by ELISA. For the proliferation assay, 0.5 ⫻ 10 6 cells/well were pulsed with [ 3H]Thymidine and tested as described under Materials and Methods. Results are shown as means ⫾ SEM from a total of 20 mice, with 10 mice per group. The experiments were repeated twice with similar results. Open bar, FasL⫹/⫺ mice. Filled bar, FasL⫺/⫺ mice.
MBP-specific TCR transgenic mice develop spontaneous EAE in a conventional but not a germ-free environment (27). While the environmental factors that initiate spontaneous EAE are yet to be defined, pertussis toxin has long been known to be an initiating factor for actively induced EAE. Our unexpected observation that Fas/FasL gene mutations promote spontaneous EAE but inhibit pertussis toxin-induced EAE suggests that environmental factors such as pertussis toxin may play important roles in regulating Fas/FasL function. Thus, environmental factors may determine not only whether autoimmune diseases will occur but also whether molecules such as FasL will promote or inhibit them. Pertussis toxin is one of the best studied environmental factors that modulate autoimmune diseases. It is a 117-kDa protein consisting of an enzymatic subunit and a membrane-binding oligomer. It binds to,
ribosylates, and inactivates G␣ proteins associated with various membrane receptors. Consequently, pertussis toxin interferes with the signal transduction of a variety of G-protein-coupled receptors, including cytokines, chemokines, hormones, and adhesion molecules. Not surprisingly, pertussis toxin has been reported to modulate a number of biological processes, including permeability of endothelial cells and blood–tissue barriers, as well as migration, anergization, and apoptosis of lymphocytes. Additionally, pertussis toxin has also been reported to synergize antigen-induced T cell activation or directly activate T cells in vitro (28, 29). Our recent studies using MBP-specific TCR transgenic cells indicate that pertussis toxin can directly activate encephalitogenic T cells and induce secretion of cytokines such as IFN-␥, IL-10, and TGF- (unpublished data). Since these effects of pertussis toxin may either diTABLE 2 Clinical Features of Actively Induced EAE in MBP-Specific TCR Transgenic Mice a
Mice
Incidence (%)
Maximal disease score
Recovery rate (%)
Day of onset
Fas⫹/⫺ (n ⫽ 8) Fas⫺/⫺ (n ⫽ 6)
6/8 (75) 2/6 (33)
2.0 ⫾ 0.1 1.3 ⫾ 0.1
3/6 (50) 1/2 (50)
6⫾4 9⫾2
a MBP-specific TCR transgenic B10.PL mice were treated with pertussis toxin as described in Fig. 6. All mice were examined daily for signs of EAE for a total of 32 days.
209
FAS LIGAND IN AUTOIMMUNE ENCEPHALOMYELITIS
FIG. 7. The effect of FasL deficiency on the development of actively induced EAE in non-transgenic mice. Non-transgenic B10.PL female mice were immunized with MBP to induce EAE, as described under Materials and Methods, and monitored for signs of EAE for a total of 28 days. The incidences of EAE in mice heterozygous (FasL⫺/⫹, filled circle, n ⫽ 10) and homozygous (FasL⫺/⫺, open square, n ⫽ 7) for the gld mutation are shown. The differences between the two groups are statistically significant (P ⬍ 0.001).
rectly or indirectly modulate Fas/FasL functions, it is tempting to speculate that they may be responsible for the paradoxical effects of Fas/FasL in different models of EAE. Further studies are needed to address this issue. Although it is well established that Fas/FasL interaction plays an important role in preventing systemic autoimmunity, the roles of Fas/FasL in organ-specific autoimmune diseases have just begun to be appreciated. Kang et al., Chervonsky et al., and Giordano et al. reported that Fas/FasL interaction may contribute to the pathogenesis of autoimmune thyroiditis and diabetes (14, 15, 30). Similarly, Waldner et al. and Sabelko et al. showed that EAE was diminished and apoptosis inhibited in mice carrying the lpr or the gld mutation, suggesting that Fas/FasL interaction may play an active role in the pathogenesis of EAE (19, 20). However, it should be noted that the lpr and gld mice used in these experiments are prone to the development of systemic autoimmune diseases. Thus, it is not clear whether the resistance of lpr or gld mice to organspecific autoimmune diseases is solely due to the lack of Fas/FasL interaction in the diseased organs or indirectly due to the systemic autoimmune diseases present in these mice. This is an important issue since it is well known that lpr and gld mice are relatively hyporesponsive to antigens compared to normal mice (31). To address this issue, we have studied EAE in Fas/FasL-deficient MBP-specific TCR transgenic mice. In TCR transgenic mice deficient in Fas/FasL functions, systemic autoimmune diseases are significantly inhibited due to the presence of transgenic T cells (32).
These experiments led to our unexpected discovery that the roles of Fas/FasL in spontaneous EAE are different from that in actively induced EAE, suggesting that environmental factors responsible for the induction of EAE may also regulate Fas/FasL function. The proinflammatory effect of FasL in EAE may be a result of its direct killing of neural cells. The hallmark of the CNS pathology in EAE and multiple sclerosis is demyelination and loss of oligodendrocytes that produce the myelin sheath. It is, therefore, generally accepted that death of glial cells may contribute to the pathology of the disease. Using an in situ TUNEL technique, a method that sensitively detects apoptosis at the single cell level, we and others have reported large numbers of apoptotic cells in the CNS of animals with EAE (19 –21, 33). Mutations of Fas/FasL genes significantly diminished the number of apoptotic cells in actively induced EAE (19 –21). Using adoptive transfer system, it has been shown that FasL expressed on T cells but not neural cells is involved in destroying neural tissues (21). The anti-inflammatory effect of FasL in spontaneous EAE may be a result of its direct killing of autoreactive cells. This is strongly suggested by the phenotype of lpr and gld mice, i.e., massive accumulation of autoreative cells as a result of Fas/FasL deficiency. Activationinduced cell death, which was initially described by Ashwell and colleagues (34), has now been shown to be mediated by Fas/FasL both in vitro and in vivo (35, 36). Activation-induced cell death of autoreactive T cells may, therefore, be responsible for the anti-inflammatory effect of FasL in autoimmune diseases. Our observation that the incidence of spontaneous EAE was increased while the recovery rate decreased in mice deficient in Fas/FasL function suggests that the antiinflammatory effect of Fas/FasL prevails in the spontaneous disease model. Since most autoimmune diseases in humans are “spontaneous” in nature, these results may have important ramifications for our understanding of the Fas/FasL function in human autoimmune diseases.
TABLE 3 Clinical Features of Actively Induced EAE in Non-transgenic Mice
Mice
Incidence (%)
Maximal disease score
Recovery rate (%)
Day of onset
FasL⫹/⫺ (n ⫽ 10) FasL⫺/⫺ (n ⫽ 7)
7/10 (70) 1/7 (14)
2.5 ⫾ 0.7 1
4/7 (57) ND
9⫾2 7
Note. Six- to ten-week old non-transgenic B10.PL mice were treated with pertussis toxin and MBP/CFA as described in Fig. 7. All mice were examined daily for signs of EAE for a total of 28 days. ND, not determined.
210
LIU ET AL.
In summary, we have discovered that Fas/FasL play distinct roles in spontaneous and actively induced EAE. These results underscore the importance of environmental factors in not only the induction but also the regulation of autoimmune diseases. ACKNOWLEDGMENTS We thank Drs. S. Marusic and S. Tonegawa (MIT, Cambridge, MA) for providing breeding pairs of mice used in this study. This work was supported by grants from the National Institutes of Health (NS53681, NS40188, and AR44914). REFERENCES 1. Nagata, S., and Golstein, P., The Fas death factor. Science 267, 1449, 1995. 2. Suda, T., Okazaki, T., Naito, Y., Yokota, T., Arai, N., Ozaki, S., Nakao, K., and Nagata, S., Expression of the Fas ligand in cells of T cell lineage. J. Immunol. 154, 3806, 1995. 3. Dowling, P., Shang, G., Raval, S., Menonna, J., Cook, S., and Husar, W., Involvement of the CD95 (APO-1/Fas) receptor/ligand system in multiple sclerosis brain. J. Exp. Med. 184, 1513, 1996. 4. Vergelli, M., Hemmer, B., Muraro, P. A., Tranquill, L., Biddison, W. E., Sarin, A., McFarland, H. F., and Martin, R., Human autoreactive CD4⫹ T cell clones use perforin- or Fas/Fas ligandmediated pathways for target cell lysis. J. Immunol. 158, 2756, 1997. 5. Firestein, G. S., Yeo, M., and Zvaifler, N. J., Apoptosis in rheumatoid arthitis synovium. J. Clin. Invest. 96, 1631, 1995. 6. Rensing-Ehl, A., Hess, S., Ziegler-Heitbrock, H. W., Riethmuller, G., and Engelmann, H., Fas/Apo-1 activates nuclear factor kappa B and induces interleukin-6 production. J. Inflammation 45, 161, 1995. 7. Abreu-Martin, M. T., Vidrich, A., Lynch, D. H., and Targan, S. R., Divergent induction of apoptosis and IL-8 secretion in HT-29 cells in response to TNF-alpha and ligation of Fas antigen. J. Immunol. 155, 4147, 1995. 8. Ponton, A., Clement, M. V., and Stamenkovic, I., The CD95 (APO-1/Fas) receptor activates NF-kappaB independently of its cytotoxic function. J. Biol. Chem. 271, 8991, 1996. 9. Cohen, P. L., and Eisenberg, R. A., The lpr and gld genes in systemic autoimmunity: Life and death in the Fas lane. Immunol. Today 13, 427, 1992. 10. Cohen, J. J., Duke, R. C., Fadok, V. A., and Sellins, K. S., Apoptosis and programmed cell death in immunity. Ann. Rev. Immunol. 10, 267, 1992. 11. Griffith, T. S., Brunner, T., Fletcher, S. M., Green, D. R., and Ferguson, T. A., Fas ligand-induced apoptosis as a mechanism of immune privilege. Science 270, 1189, 1995. 12. Zhang, H., Yang, Y., Horton, J. L., Samoilova, E. B., Judge, T., Turka, L. A., Wilson, J. M., and Chen, Y., Amelioration of collagen-induced arthitis by Fas (CD95)-ligand gene transfer. J. Clin. Invest. 100, 1951, 1997. 13. Hahne, M., Rimoldi, D., Schoter, M., Romero, P., Scheier, M., French, L. E., Schneider, P., Bornand, T., Fontana, A., Lienard, D., Cerottini, J., and Tschopp, J., Melanoma cell expression of Fas(Apo-1/CD95) ligand: Implications for tumor immune escape. Science 274, 1363, 1996. 14. Giordano, C., Stassi, G., De Maria, R., Todaro, M., Richiusa, P., Papoff, G., Ruberti, G., Bagnasco, M., Testi, R., and Galluzzo, A., Potential involvement of Fas and its ligand in the pathogenesis of Hashimoto’s thyroiditis. Science 275, 960, 1997.
15. Chervonsky, A. V., Wang, Y., Wong, F. S., Visintin, I., Flavell, R. A., Janeway, C. A., Jr., and Matis, L. A., The role of Fas in autoimmune diabetes. Cell 89, 17, 1997. 16. D’Souza, S. D., Bonetti, B., Balasingam, V., Cashman, N. R., Barker, P. A., Troutt, A. B., Raine, C. S., and Antel, J. P., Multiple sclerosis: Fas signaling in oligodendrocyte cell death. J. Exp. Med. 184, 2361, 1996. 17. Bonetti, B., and Raine, C. S., Multiple sclerosis: Oligodendrocytes display cell death-related molecules in situ but do not undergo apoptosis. Ann. Neurol. 42, 74, 1997. 18. Xerri, L., Devilard, E., Hassoun, J., Mawas, C., and Birg, F., Fas ligand is not only expressed in immune privileged human organs but is also coexpressed with Fas in various epithelial tissues. Mol. Pathol. 50, 87, 1997. 19. Waldner, H., Sobel, R. A., Howard, E., and Kuchroo, V. K., Fasand FasL-deficient mice are resistant to induction of autoimmune encephalomyelitis. J. Immunol. 159, 3100 , 1997. 20. Sabelko, K. A., Kelly, K. A., MNahm, M. H., Cross, A. H., and Russell, J. H., Fas and Fas ligand enhance the pathogenesis of experimental allergic encephalomyelitis, but are not essential for immune privilege in the central nervous system. J. Immunol. 159, 3096, 1997. 21. Sabelko-Downes, K. A., Cross, A. H., and Russell, J. H., Dual role for Fas ligand in the initiation of and recovery from experimental allergic encephalomyelitis. J. Exp. Med. 189, 1195, 1999. 22. Dittel, B. N., Merchant, R. M., and Janeway, C. A., Jr., Evidence for Fas-dependent and Fas-independent mechanisms in the pathogenesis of experimental autoimmune encephalomyelitis. J. Immunol. 162, 6392, 1999. 23. Lafaille, J. J., Keere, F. V., Hsu, A. L., Baron, J. L., Haas, W., Raine, C. S., and Tonegawa, S., Myelin basic protein-specific T helper 2 (Th2) cells cause experimental autoimmune encephalomyelitis in immunodeficient hosts rather than protect them from the disease. J. Exp. Med. 186, 307, 1997. 24. Lafaille, J. J., Nagashima, K., Katsuki, M., and Tonegawa, S., High incidence of spontanous autoimmune encephalomyelitis in immunodeficient anti-myelin basic protein T cell receptor transgenic mice. Cell 78, 399, 1994. 25. Chen, Y., Kuchroo, V. K., Inobe, J.-I., Hafler, D. A., and Weiner, H. L., Regulatory T cell clones induced by oral tolerance: Suppression of autoimmune encephalomyelitis. Science 265, 1237, 1994. 26. Moore, G. R., Traugott, U., Farooq, M., Norton, W. T., and Raine, C. S., Experimental autoimmune encephalomyelitis. Augmentation of demyelination by different myelin lipids. Lab. Invest. 51, 416, 1984. 27. Goverman, J., Woods, A., Larson, L., Weiner, L. P., Hood, L., and Zaller, D. M., Transgenic mice that express a myelin basic protein-specific T cell receptor develop spontaneous autoimmunity. Cell 72, 551, 1993. 28. Ben-Nun, A., Yossefi, S., and Lehmann, D., PPD and pertussis toxin as proteins active in protecting mice against experimental autoimmune encephalomyelitis. Eur. J. Immunol. 23, 689, 1993. 29. Khelef, N., Zychlinsky, A., and Guiso, N., Bordetella pertussis induces apoptosis in macrophages: Role of adenylate cyclasehemolysin. Infect. Immun. 61, 4064, 1993. 30. Kang, S. M., Schneider, D. B., Lin, Z., Hanahan, D., Dichek, D. A., Stock, P. G., and Baekkeskov, S., Fas ligand expression in islets of Langerhans does not confer immune privilege and instead targets them for rapid destruction. Nature Med. 3, 738, 1997.
FAS LIGAND IN AUTOIMMUNE ENCEPHALOMYELITIS 31. Scott, C. F., Jr., Tsurufuji, M., Lu, C. Y., Finberg, R., and Sy, M. S., Comparison of antigen-specific T cell responses in autoimmune MRL/Mp-lpr/lpr and MRL/Mp-⫹/⫹ mice. J. Immunol. 132, 633, 1984. 32. Yui, K., Bhandoola, A., Radic, M. Z., Komori, S., Katsumata, M., and Greene, M. I., Inhibition of abnormal T cell development and autoimmunity in gld mice by transgenic T cell receptor beta chain. Eur. J. Immunol. 22, 1693, 1992. 33. Chen, Y., Hancock, W. W., Marks, R., Gonnella, P., and Weiner, H. L., Mechanisms of recovery from experimental autoimmune encephalomyelitis: T cell deletion and immune deviation in myelin basic protein T cell receptor transgenic mice. J. Neuroimmunol. 82, 149, 1998. Received November 4, 1999; accepted with revision March 7, 2000
211
34. Mercep, M., Weissman, A. M., Frank, S. J., Klausner, R. D., and Ashwell, J. D., Activation-driven programmed cell death and T cell receptor zeta eta expression. Science 246, 1162, 1989. 35. Brunner, T., Mogil, R. J., LaFace, D., Yoo, N. J., Mahboubi, A., Echeverri, F., Martin, S. J., Force, W. R., Lynch, D. H., Ware, C. F., and Green, D. R., Cell-autonomous Fas (CD95)/Fas-ligand interaction mediates activation-induced apoptosis in T-cell hybridomas. Nature 373, 441, 1995. 36. Mogil, R. J., Radvanyi, L., Gonzalez-Quintial, R., Miller, R., Mills, G., Theofilopoulos, A. N., and Green, D. R., Fas (CD95) participates in peripheral T cell deletion and associated apoptosis in vivo. Int. Immunol. 7, 1451, 1995.