Differentially expressed genes in response to cyadox in swine liver analyzed by DDRT-PCR

Research in Veterinary Science 118 (2018) 72–78

Contents lists available at ScienceDirect

Research in Veterinary Science journal homepage: www.elsevier.com/locate/rvsc

Differentially expressed genes in response to cyadox in swine liver analyzed by DDRT-PCR

T

Rui Yu, Yinfeng Zhang, Qirong Lu, Luqing Cui, Yulian Wang, Xu Wang, Guyue Cheng, Zhenli Liu, ⁎ ⁎ Menghong Dai , Zonghui Yuan MOA Key Laboratory of Food Safety Evaluation/National Reference Laboratory of Veterinary Drug Residues (HZAU), Huazhong Agricultural University, Wuhan, Hubei 430070, China

A R T I C L E I N F O

A B S T R A C T

Keywords: Cyadox Piglets Differentially expressed genes Liver DDRT-PCR

Cyadox is a good antimicrobial growth-promoter of quinoxalines. However, the molecular mechanism of action remains unclear. A growth performance study and mRNA differential display reverse transcription polymerase chain reaction (DDRT-PCR) in combination with Northern dot-blot and reverse Northern dot-blot analysis were conducted to determine the differentially expressed genes in liver tissues of piglets after treatment with cyadox. Transcription levels of the differentially expressed genes were quantificated by realtime RT-PCR in porcine primary hepotocytes. Cyadox could significantly promote body weight of piglets via feed with average daily gain (ADG) improved by 24.7% and 64.8% in 100 and 500 mg/kg group, compared with control. A total of eight differentially expressed genes were found, of which the expression levels of five genes had positive correlation with cyadox dose. One gene expression had a negative correlation with cyadox dose and it was a new gene. The other two genes were up-regulated by cyadox, but the expression quantity was invariably when the cyadox doses were increased. Among the up-regulated genes, one was transcriptional regulating factor, two were growthrelated factors, one was involved in immune defense and immune-regulation and three might be involved in the maintenance of normal development. In primary cultured pig hepatocytes, cyadox treatment evoked a significant time-dependent effect of eight genes expression. The results suggest, at the transcriptional level in vitro and in vivo, that growth factor and metabolism may be associated with cyadox growth-promoting activity, whereas immune defense and immune-regulation could play major roles in prophylaxis of cyadox in piglets.

1. Introduction Evidence for growth promotion through antibacterial action has also accumulated over the past seventy years. Most of the attention given to pig growth promoted by antibiotics in feed has focused on the intestinal microbiota (Visek, 1978; Walton, 1983; Gaskins et al., 2002). However, in some other papers, the researchers proposed that the effect of antimicrobials on animal growth was related to the animal growth hormone axis and the production of growth factors (Landagora et al., 1957; Hathaway et al., 1996; Zhu et al., 2006). In fact, animal growth is a very complex process of cell proliferation and differentiation and regulated by factors of the growth hormone axis. Understanding what regulates animal growth caused by growth-promotion antibiotics has important implications in conditions such as the development of animal husbandry and drug discovery. Cyadox is a product of quinoxaline-1, 4-dioxides and has a broad antimicrobial spectrum, growth-promoting activity to broilers and pigs,

⁎

and lower toxicity (Tokosová and Pleva, 1988; van der Molen et al., 1989; Nabuurs et al., 1990; Wang et al., 2005). Moreover, cyadox improves pig performance by altering concentrations of peripheral metabolic hormones and growth factor such as epidermal growth factor (EGF), insulin, thyroid hormones (tri-iodothyronine (T3) and thyroxine (T4)), and cortisol (Zhu et al., 2006). However, the molecular mechanism of growth promotion is still not fully elucidated. The liver plays a central role in the regulation of carbohydrate, amino acid and lipid metabolism. Many genes of key enzymes of these metabolic cycles expressed in the liver are candidates for traits related to growth, performance, body composition and fitness (Siriluck et al., 2001). The present investigation is the first to use DDRT-PCR to evaluate the influence of cyadox on liver gene expression in piglets, together with Northern dot-blot and reverse Northern dot-blot to confirm differentially expressed genes.

Corresponding authors. E-mail addresses: [email protected] (M. Dai), [email protected] (Z. Yuan).

https://doi.org/10.1016/j.rvsc.2018.01.014 Received 21 April 2017; Received in revised form 18 January 2018; Accepted 18 January 2018 0034-5288/ © 2018 Published by Elsevier Ltd.

Research in Veterinary Science 118 (2018) 72–78

R. Yu et al.

2. Materials and methods

Table 2 Sequences of primers used in DDRT-PCR.

2.1. Drug β-actin

Cyadox (99.5%) was synthesized by the Institute of Veterinary Pharmaceuticals in Huazhong Agricultural University (China).

3′anchored primer

2.2. Animal experiments 5′arbitrary primer

All experimental procedures performed in this study were approved by Hubei Province Committee on Laboratory Animal Care, China. Eighteen weaned crossbred male piglets (Landrace × Large White) with an average initial weight of 10.04 kg were randomly allotted to three groups: a basal diet group without cyadox as control and a basal diet group supplemented with cyadox at either 100 or 500 mg/kg feed. Each diet was offered to three replicates of two pigs per pen. The pigs were housed in pens 4.6 m × 1.2 m, with a nipple drinker and feeder to allow pig ad libitum access to food and water. We chose these doses for several reasons. The 100 mg/kg dose was used to allow some direct comparison with our earlier findings and because it was known to increase average daily gain (ADG), gain/food ratio and serum insulin and EGF concentrations of piglets (Zhu et al., 2006). The 500 mg/kg dose was 5 times the clinical recommended dose (100 mg/kg) and no toxic symptoms appeared on pigs under this dose in our earlier clinical trials (data not published). The basal diet was recommended by National Research Council (1998) (Table 1). Preceding the formal experiment, piglets were allowed a 7-day adjustment period, during which they were offered a basal diet for ad libitum consumption. Animals were fed the diet for three weeks. They were not given any other oral or injectable antimicrobial agents before or during the experiment. Pigs were weighed at the beginning and the end of the experiment. ADG and feed conversion efficiency (FCE, feed intake/weight gained) were measured. Immediately after conventional electrical stunning and exsanguination of the pigs the livers were quickly removed and frozen in liquid nitrogen and stored at − 80 °C for RNA isolation.

Percent

Corn Soybean Fish meal (imported) Powder CaHPO4 Salt Stone powder Vitamin mixturea Trace element mixtureb Lysine

65.67 24.0 2.0 5.0 2.0 0.3 0.5 0.03 0.3 0.2

Digest energy (MJ/kg) Dry matters Coarse protein Ca P

13.44 88.15 18.34 1.07 0.62

5′-CGGGACCTGACCGACTACCT-3′ 5′-GGGCCGTGATCTCCTTCTG-3′ 5′-AAGCTTTTTTTTTTTA-3′ 5′-AAGCTTTTTTTTTTTG-3′ 5′-AAGCTTTTTTTTTTTC-3′ 5′-AAGCTTGATTGCC-3′ 5′-AAGCTTCGACTGT-3′ 5′-AAGCTTTGGTCAG-3′ 5′-AAGCTTCTCAACG-3′ 5′-AAGCTTAGTAGGC-3′ 5′-AAGCTTGCACCAT-3′ 5′-AAGCTTAACGAGG-3′ 5′-AAGCTTTTACCGC-3′

Total RNA was isolated from individual liver tissues of 6 pigs of each group or hepatocytes using Trizol Reagent (Invitrogen) according to the manufacturer's protocol except for a slight modification; tissues were ground in liquid nitrogen before homogenation. RNA was treated with DNaseI (TAKARA) to remove the trace amounts of genomic DNA. RNA quantification was determined spectrophotometrically, and the integrity was verified by agarose electrophoresis and ethidium bromide staining. The RNA concentrations were adjusted to 1 μg/μL. 2.5. Reverse transcription For the first-strand cDNA synthesis, 2 μg of pooled RNA samples extracted from liver tissues of either control or cyadox-treated piglets was reverse transcribed using 200 U of M-MLV reverse transcriptase (Promega) and 2 mM of 3′ anchored primers (Table 2) in a solution containing 5 μL of M-MLV 5 × Buffer, 1.25 μL of 10 mM dNTPs, 40 U of RNase Inhibitor (Promega) in a total volume of 50 μL. The cDNA reactions were carried out at 37 °C for 60 min, then at 70 °C for 5 min using a Gradient cycler PTC-200 (BioeRad). Anchored primers and arbitrary primers were referenced as described previously (Peng et al., 1994). 2.6. Differential display PCR(DDPCR) PCR amplification was performed in a total volume of 20 μL. The reaction mixture contained 2.0 μL of 10 × PCR Buffer(Fermentas), 1.2 μL of MgCl2 (25 mM), 0.1 μL of dNTPs (10 mM), 2 μL of arbitrary primer (Table 2) (10 μM), 2 μL of anchored primer(10 μM), 2.5 U of Taq Polymerase (Fermentas), 1.5 μL of cDNA and 10.7 μL of distilled water. Cycling parameters were denaturation at 94 °C for 2 min; 30 cycles of amplification at 94 °C for 30 s, 40 °C for 2 min, and 72 °C for 30 s; and elongation at 72 °C for 5 min. Twenty-four primer pair combinations were used for amplifying porcine liver cDNAs. The PCR products were separated by electrophoresis in 6% non-denaturing polyacrylamide gels and then visualized by silver staining using the method improved by Peng et al. (1995). Only cDNAs exhibiting a consistent altered expression subsequent to cyadox treatment were excised from the gel, suspended in 100 μL of distilled water, and incubated at 25 °C for 2 min. After centrifugation, the polyacrylamide gel was suspended in 30 μL of distilled water and ground with tip. Then the cDNAs were eluted by boiling the gel slices for 10 min in microfuge tubes, followed by icebath for overnight. 3 μL of eluted DDPCR products were used directly as a template in 20 μL PCR re-amplification reactions. Re-amplification

Table 1 Ingredients and nutrient level of a basal diet (unit: %). Nutrition level

Sense Antisense HT11A HT11G HT11C AP1 AP2 AP3 AP4 AP5 AP6 AP7 AP8

2.4. RNA isolation

Hepatocytes were isolated from the liver of six untreated Landrace × Large White castrated male pigs in control groups by a twostep collagenase digestion procedure (Chen et al., 2002). Cells from each piglet were separately cultured. The hepatocytes were adjusted to 5 × 105 cell/mL, seeded into 24-well plates with 0.9 mL per well (the wells were pre-wetted with fetal calf serum/FCS and dried in the cleansing workbench). The hepatocytes were pre-cultured in Dulbecco's modified Eagle's medium (DMEM) containing 10% FCS at 37 °C in 5% CO2 until they reached 80% confluence (about 4 h). Then hepatocytes

Percent

Sequences

were added serum-free DMEM and incubated by cyadox with concentrations of 2 μM for 0.5, 1 2, 4, 8 h. The medium was then removed and the adherent cells were used for total RNA extraction.

2.3. In vitro culture of porcine hepatocytes

Ingredients

Primer

a The trace element mixture supplied (per kg feed): Cu, 10 mg; Fe, 100 mg; Mn, 60 mg; Zn, 100 mg; Se, 0.3 mg; I, 0.2–0.3 mg. b The vitamin mixture supplied (per kg feed): VA, 6660 IU; VD3, 660 IU; VE, 88 IU; VK, 4.4 mg; VB2, 8.8 mg; D2 pantothenic acid, 24.2 mg; Niacin, 33 mg; Choline Chloride, 330 mg.

73

Research in Veterinary Science 118 (2018) 72–78

R. Yu et al.

was carried out by using PCR conditions as for DDRT-PCR above with the MgCl2 and dNTPs concentrations increased and the cycling parameters changed. The reaction mixture contained 2.0 μL of 10 × PCR Buffer, 1.5 μL of MgCl2 (25 mM), 0.5 μL of dNTPs (10 mM), 2 μL of arbitrary primer (10 μM), 2 μL of anchored primer (10 μM), 2.5 U of Taq Polymerase 3.0 μL of retrieved cDNAs and 8.5 μL of deionized water. Cycling parameters were denaturation at 94 °C for 2 min; 20 cycles of amplification at 94 °C for 30 s, 40 °C for 2 min, 72 °C for 30 s; 20 cycles of amplification at 94 °C for 30 s, 50 °C for 2 min, 72 °C for 30 s; and elongation at 72 °C for 5 min. DNAs were purified and cloned into pMD18-T simple vector (TAKARA) before sequencing. The clones with the correct size of insert were sequenced by Shanghai Sangon Biotechnology Company (China). To prevent isolation of a “false positive”, all amplification experiments were conducted in duplicate.

Table 3 Primers used for real-time RT-PCR.

2.7. Northern dot-blot and reverse northern dot-blot analysis To further confirm the differential expressed genes, Northern hybridization and reverse Northern hybridization were performed. For Northern dot-blot hybridization and reverse Northern dot-blot analysis, the re-amplified and purified DNA (1 μg)(as described above) and the first-strand cDNAs reverse-transcribed from pools of total RNA (1 μg) were labelled and hybridized with pools of total RNAs and twelve reamplified purified DDPCR products, respectively. Pools of total RNA were created using the piglets of each group that contributed RNA for the DDPCR study. Probe-labeling and hybridization procedures were described in the instruction of DIG High Prime DNA Labeling and Detection Starter Kit I (Roche). For Northern dot-blot hybridization, probes for hybridization were produced using the DIG High Prime in kit. In brief, approximately 1 μg of the re-amplified and purified DNA besides β-actin cDNA was denatured with 15 μL distilled water at 100 °C for 10 min. 4 μL of the DIG-High Prime in kit was added to the denatured DNA buffer, and incubated for 20 h at 37 °C The reaction was terminated using 0.2 M EDTA (pH 8.0) at 65 °C for 10 min. Pools of total RNA of each group (1 μg) (as described above) was transferred in duplicate to the nylon membranes (Immobilon Ny+, Millipore), and the membranes were left by baking at 120 °C for 30 min. RNA attached to the membrane was hybridized with the DIG-labelled DNA probe at 37 °C for 20 h in DIG Easy Hyb buffer. For Northern reverse dot-blot hybridization, the firststrand cDNA reverse-transcribed from pools of total RNA (1 μg) was labelled with DIG-High Prime, following the same procedure as above. 1 μg of the re-amplified and purified DNA was blotted in duplicate on nylon membranes (Immobilon Ny+, Millipore) and baked for 30 min at 120 °C As a loading control, 1 μg of β-actin cDNA was also applied to each membrane. The conditions of labeling, hybridization, and detection of the probe were followed with the same procedure as above. The hybridization signal was detected and analyzed by using the Image-pro plus 6.0 software (Media Cybernetics, USA).

Gene

Accession NO.

Sequence (5′–3′)

(bps)

EGF

NM_214020

216

IGF-1

NM_214256

C3

NM_214009

DAD1

NM_213944

PARP

XM_0019273254

TK

NM_001112681

New gene

–

SZNF

XM_001928046.1

β-actin

XM_003124280.1

Fwd: GCTTTCCTGGGTATGAC Rev: ATTTCAGGGCTGTATGG Fwd: ATCGTGGATGAGTGCTGC Rev: TCTTGTTTCCTGAACTCCCT Fwd: CGTCCTACCCTACAACA Rev: TCCCACCTTCAACAGC Fwd: CGGTGTTGTCGGTAAT Rev: ATGCCTTGGAAATCTG Fwd: GATACTGGACTGCTGCTC Rev: ACTCCCATTCAAGGTGAT Fwd: CGTTCGCAGCCTTCTTC Rev: CACCATCGCTTGGGTAAA Fwd: GTTTATGGGATTTACCGCAAGCC Rev: GTAGCCGAGACCAGGAAGCAAG Fwd: GCGTCTACGAGGAGAAGCG Rev: GCTTGAGCCAGGTCACGAT Fwd:GCCCAAGATGCCCTTCAGT Rev: CCTTCCGTGTTCCTACCCC

262 151 194 156 192 220 144 198

PR China). The cDNA was amplified by RT-qPCR (BioeRad, Hercules, CA) using SYBR Premix Ex Taq RT-PCR kit (Takara, China). Each 25 μL reaction mixture consisted of 12.5 μL SYBR Premix Ex Taq, 0.5 μL of each primer (10 mM), 2 μL of cDNA, and 9.5 μL RNase-free dH2O. Cycling conditions were as follows: step 1, 30 s at 95 °C; step 2, 40 cycles at 95 °C for 5 s, 60 °C for 30 s; step 3, dissociation stage. Data from the reaction were collected and analyzed by the complementary computer software. Relative quantization of gene expression was calculated using 2− ΔΔCt data analysis method as previously described (Wang et al., 2012) and normalized to β-actin in each sample. Primers used in this study were provided in Table 3. 2.10. Statistical analysis Results were expressed as mean ± S.E.M. of triplicate experiments from independent hepatocyte cultures and animals as indicated. Statistical analysis was performed using SPSS 12.0 one-way ANOVA and the means were separated by using the Student's planned multiple comparison test (basal condition versus each experimental group). 3. Results 3.1. Effects of cyadox treatment on performance of pigs The performance of pigs fed diets with different levels of cyadox supplementation is shown in Table 4. Results showed that cyadox could promote body weight of piglets via feed significantly (P < 0.01). ADGs in cyadox 100 mg/kg group and 500 mg/kg group were elevated 24.7% and 64.8% compared with control group, respectively. Compared to the control, FCE of the pigs fed cyadox was increased by 15.3% in 100 mg/ kg group, and 22.0% in 500 mg/kg group. During the 21-day feeding period, there were no obvious abnormal appearance or behavior observed in any of the pigs.

2.8. Functional prediction of expressed genes Those sequenced differential displayed fragments were analyzed by BLAST in GenBank database of the US National Center for Biotechnology Information server (http://www.ncbi.nlm.nih.gov/ BLAST/). The databases included non-redundant database, the expressed sequence tag (EST) database, the genomic sequence databases and the protein sequence databases. The known genes were analyzed by BLASTX and classified according to their putative function.

Table 4 Effects of cyadox treatment on performance of pigs (n = 6). Control group

Cyadox groups 100 mg/kg

2.9. Quantification of 8 differentially expressed genes ADG (g/d) FCE (g/g)

The expression levels of differentially expressed genes were determined by quantitative real-time PCR (RT-qPCR). One microgram of RNA was reverse transcribed to complementary DNA (cDNA) with the use of Prime Script® Reverse Transcriptase (RNase H−) (Takara, Dalian,

357.9 ± 12 0.510 ± 0.017

500 mg/kg a

446.3 ± 15 0.588 ± 0.020a

590.0 ± 15a 0.622 ± 0.016a

ADG: average daily gain; FCE: feed conversion efficiency (feed intake/weight gained). a Indicates the value of cyadox group is significantly different from control (P < 0.01).

74

Research in Veterinary Science 118 (2018) 72–78

R. Yu et al.

Fig. 1. Representative silver-stained SDS-PAGE of DDRTPCR products. A, B and C were products amplified using primers HT11C and AP5, primers HT11C and AP7, primers HT11A and AP6, respectively. M is marker. The sizes are 1500, 1000, 900, 800, 700, 600, 500, 400, 300, 200, 100 bp from top to down. 1 is control group, 2 is cyadox 100 mg/kg group, 3 is cyadox 500 mg/kg group, K is negative control. The arrows indicate differentially expressed fragments.

cyadox and by sequence similarity they corresponded to EGF mRNA, zinc finger mRNA, defender against cell death 1 (DAD1) mRNA, class 1 insulin-like growth factor I (IGF-I) mRNA, complement component 3 (C3) mRNA, respectively. The C-7-1 cDNA did not show significant homology to any translated sequence contained in the GenBank database, suggesting that it may either encode unidentified proteins, or correspond to untranslated non-conserved regions of mRNA molecules already known from other species. It was a new gene and down-regulated by both doses of cyadox. The expression levels of two genes C-3-2 and C-5-1 were up-regulated by cyadox, but the cyadox dose-reponse seen with the other transcripts was not evident. They had high homology with Sus scrofa transketolase mRNA and bostaurus similar to Poly [ADP-ribose] polymerase 4 (PARP-4) mRNA, respectively.

3.2. Identification of cyadox-responsive genes by DDRT-PCR In the present study we used DDRT-PCR technique to identify genes differentially expressed in the porcine liver after treatment with cyadox. Using 3 anchored primers and 8 arbitrary primers, 12 differentially expressed cDNAs were identified. Representative results of this analysis were shown in Fig. 1A–C. There were no bands present in the negative controls, which confirmed the absence of contaminating DNA in the RNA samples used to synthesize the cDNAs.

3.3. Hybridization verification and sequence analysis The results of Northern dot-blot hybridization and reverse Northern dot-blot hybridization were consistent (Figs. 2 and 3). As expected, the level of expression of β-actin mRNA was constant. No obvious difference was found in the expression levels of four genes A-1-1, A-3-3, A-43 and A-4-5 from livers of three groups, and therefore they were considered to be false positive. Out of the 12 genes, the other eight genes were obviously regulated by cyadox in a manner consistent with the results from DDRT-PCR. Sequencing analysis of these fragments revealed 8 different transcripts. Sequence homology searches and comparisons were performed using BLAST (http://www.ncbi.nlm.nih.gov/ BLAST). Out of these 8 transcripts, 7 (87.5%) showed similarity to known pig-specific genes and 1 (12.5%) showed no similarity to known genes. The seven known genes are related to growth factors, immune factors, metabolism enzymes and transcription factors, as summarized in Table 5. Among the eight genes, expression level of five cDNAs, A-34, A-4-4, A-6-2, G-1-1 and G-6-1 were up-regulated by both doses of

3.4. The time-effect relationship of gene expressions induced by cyadox in primary cultured pig hepatocytes The results presented in Fig. 4 show that the mRNA expression level of IGF-1, EGF, C3, DAD1, TK, PARP, SZNF and New gene was detected by RT-qPCR in primary cultured pig hepatocytes. Hepatocytes were exposed to cyadox at the final concentration of 2 μM for 0.5 h, 1 h, 2 h, 4 h, 8 h. As shown in Fig. 4, there were significant time-dependent effects of 8 genes evoked by cyadox treatment. Compared with the blank, the mRNA expression levels of EGF and DAD1 were increased remarkably in 0.5 h; the mRNA expressions levels of IGF-1, TK, PARP, New gene and SZNF increased in 1 h, and that of C3 was increased almost 2 folds in 2 h.

Fig. 2. Representative Northern dot-blot of differentially expressed genes. There are hybridization results of gene βactin, A-1-1, A-3-3, A-3-4, A-4-3, A-4-4, A-4-5, A-6-2, G-1-1, G-6-1, C-3-2, C-5-1 and C-7-1 with RNA of every group, respectively. There are control group RNA, cyadox 100 mg/ kg group RNA, cyadox 500 mg/kg group RNA, negative control in order from the left to right in every panel.

75

Research in Veterinary Science 118 (2018) 72–78

R. Yu et al.

Fig. 3. Representative reverse Northern dot-blot of differentially expressed genes. There are hybridization results of RNA of every group (A, control group; B, cyadox 100 mg/ kg group; C, cyadox 500 mg/kg group) with differentially expressed genes. 1a, 2a, 3a, 4a, 1b, 2b, 3b, 4b, 1c, 2c, 3c, 4c, and 1d were the reverse Northern dot-blot of β-actin, A1-1, A-3-3, A-3-4, A-4-3, A-4-4, A-4-5, A-6-2, G-1-1, G-6-1, C-3-2, C-5-1 and C-7-1, respectively. Only cDNA bands showing a two-fold or more increase were considered indicative of a change in the levels of expression of the corresponding mRNAs. The location of up-regulated cDNA fragments with cyadox doses increased is: 4a = A-3-4, 2b = A-4-4, 4b = A-6-2, 1c = G-1-1, 2c = G-6-1; The location of up-regulated cDNA fragments with cyadox doses, but no change with cyadox dose increased: 3c = C-3-2, 4c = C-5-1; The location of down-regulated cDNA fragments is: 1d = C-7-1; The location of β-actin cDNA fragment is: 1a.

Table 5 Differential gene fragments by DDRT-PCR and hybridization confirmation. Gene fragments

Size (bp)

Cyadox-regulated trend (↑/↓/#)

GenBank accession no.

Sequence identity (%)

Description

A-3-4 G-1-1 A-4-4 A-6-2 G-6-1 C-3-2 C-5-1 C-7-1

493 697 513 342 511 212 340 335

↑ ↑ ↑ ↑ ↑ # # ↓

NM_214020.1 DQ784687.1 XM_001928046 NM_213944.1 NM_214009.1 NM_001112681.1 XM_867149.2 -

99 99 100 99 99 100 85 -

Sus scrofa epidermal growth factor (EGF) Sus scrofa class 1 insulin-like growth factor I(IGF-I) Sus scrofa zinc finger CCHC domain containing3(SZNF) Sus scrofa defender against cell death 1(DAD1) Sus scrofa complement component 3(C3) Sus scrofa transketolase(TK) Bos taurus similar to Poly [ADP-ribose] polymerase 4 (PARP-4) New gene

‘↑’ and ‘↓’ stand for the up- or down-regulated genes with cyadox doses increased, respectively; ‘#’ represents up-regulated genes to cyadox dose, but no change with cyadox dose increased. ‘-’ represents no related information.

4. Discussion

by cyadox might play a role in N-linked glycosylation catalyzed by OST and maintenance of the normal development. Transketolase is an important enzyme of pentose phosphate pathway (PPP) which provides several essential materials for biosynthesis of fatty acid, cholesterol, nucleic acid and aromatic amino acid (Grossmann et al., 2004). In the non-oxidative branch of the PPP, several reactions are catalyzed by transketolase (Williams and Blackmore, 1983). The PPP produces NADPH to supply reducing power needed for cell growth and proliferation (Puskas et al., 2000), and also to keep the levels of reduced glutathione to protect cells from the damage of reactive oxygen intermediates (Banki et al., 1996). So we infer that cyadox could stimulate the PPP to produce energy and materials for biosynthesis so as to improve the fast growth of pigs. However, the transcriptional level was not changed when cyadox dose increased from 100 mg/kg to 500 mg/kg, it demonstrated that glycolysis might not be modulated by cyadox. Cyadox, in clinical recommended dose, facilitated the sufficient D-ribose for nucleic acid synthesis rather than shifting its conversion to glyceraldehyde-3-phosphate for glycolysis. Complement component 3 is the core of complement system which plays an important role on immune-defense and immunoregulation (Kopf et al., 2002; Pratt et al., 2002). It has been shown in studies that cyadox can suppress E. coli-induced immune activation, especially intestinal mucosal immune activation on piglets (Ding et al., 2006a, 2006b). Moreover, one study by our team suggested that cyadox has very good effect on preventing the infection caused by Escherichia coli in chickens (data not shown). Collectively, cyadox might be an immune irritant to stimulate transcription of complement component 3 to prevent diseases. Poly [ADP-ribose] polymerase 4, namely Poly [ADP-ribose] polymerase(VPARP), is a small component of a large cytoplasmic ribonucleoprotein particle, the vault complex, the intracellular localization of which is present in the nucleus and in elongated structures in the cytoplasm (VPARP-rods). It may play a role in tube formation, however it appears to be a small element in the complex event of the vault-tube formation (van Zon et al., 2003). It is also an unique member of the PARP family as it has a putative VPARP catalytic domain shares 28%

From the results of DDRT-PCR, eight cyadox-responsive genes from porcine livers were observed, including EGF, IGF-I, Sus scrofa zinc finger CCHC domain containing 3, DAD1, C3, Sus scrofa transketolase, PARP-4 and a new gene. The expression levels of EGF and IGF-I were up-regulated by cyadox in dose-dependent manner. It was consistent with the results of another in vivo and in vitro study previously performed by our panel (data not published). EGF has been characterized as an important growth factor in mammalian development and function, it may play a role in embryogenesis and fetal growth (Fisher, 1988). EGF can also influence the activity of digestive enzyme on intestinal and enteric absorption (Charlotte et al., 1993). IGF-I is a regulatory factor on growth promotion (Saleri et al., 2001). IGF-I advances muscle cell differentiation (Buekinsham et al., 2003), regulates skeletal muscle growth and increases the length of intestinal villus (Park et al., 1999). IGF-I is also one target of growth hormone (GH)-mediated signaling which impacts cellular metabolism, proliferation and differentiation, and GH could regulate longitudinal growth in vertebrates (Rise et al., 2006). The upregulation of the two genes suggests that hepatocyte mitotic pathways and GH-mediated signaling pathway might be involved in promoting growth of the pig by cyadox. DAD1 is one of the important regulating factors in programmed cell death and has significant effect on cell differentiation and development (Nakashima et al., 1993; Tanaka et al., 1997). Furthermore, DAD1 is a subunit of the mammalian oligosaccharyltrans- ferase (OST) (Silberstein et al., 1995) thatis required for the function and the structural integrity of the oligosaccharyltransferase complex (Sanjay et al., 1998). This complex catalyzes the transfer of high mannose oligosaccharides onto asparagine residues in nascent polypeptides in the lumen of the rough endoplasmic reticulum (Kelleher and Gilmore, 1997). Asparagine-linked glycosylation is one of the most common protein modification reactions in eukaryotic cells, as many proteins that are translocated across or integrated into the rough endoplasmic reticulum carry N-linked oligosaccharides (Kelleher and Gilmore, 2006). Therefore, we conclude that upregulation of DAD1 gene in porcine liver 76

Research in Veterinary Science 118 (2018) 72–78

R. Yu et al.

Fig. 4. The time-effect relationships of 8 differentially expressed genes induced by cyadox in primary cultured pig hepatocytes. Hepatocytes were preincubated without FCS for 24 h before the addition of cyadox. After the addition of cyadox(2 μM), the cells were incubated for a further 0.5 h, 1 h, 2 h, 4 h, 8 h. Blank cells were treated similarly to the experimental cells except no cyadox was added. The mRNA levels in control cells were taken as one arbitrary unit. Analysis of gene expressions induced by cyadox was performed in three duplicates. The results were presented as mean ± SD (n = 6). Significant differences were indicated by *p < 0.05, **p < 0.01, versus control.

antimicrobial growth promoter by DDRT-PCR. We have shown that growth factor and metabolism may be associated with cyadox growthpromoting activity, whereas immune-defense and immunoregulation could play major roles in prophylactic use of cyadox in piglets. The novel molecular features of the porcine liver response to cyadox will provide new clues and reference to identify biomarkers of antimicrobial growth promoter action. Some techniques could be used to gain more insight into the role played by cyadox in growth promotion and disease prevention and to verify the function of the differentially expressed genes responsive for cyadox. Further study of these genes in this context is ongoing in our laboratory.

identity with the catalytic domain of Poly [ADP-ribose] polymerase 1(PARP 1), which is able to catalyze a poly(ADP-ribosyl)ation reaction (Kickhoefer et al., 1999). Liu et al. (2004) generated mice deficient in mVparp to investigate telomerase function and vault structure in their absence, and suggested that murine mVparp is dispensable for normal development, telomerase catalysis, telomere length maintenance, and vault structure in vivo. Although there are some studies regarding this at present, the function of it is not clearly clarified. Therefore, PARP4 upregulated by cyadox needs further investigation on the mechanism associated with development and other physiological actions in pigs. Zinc fingers, also called zinc binding domains, are mainly contained by many proteins in eukaryote. Zinc binding domains function as sequence-specific DNA (or RNA) binding motifs in gene regulation and also as mediators of protein-protein interactions involved in chromatin remodeling (Kowalski et al., 2002; He et al., 2007). Zinc finger found in this study has three domains, and perhaps is responsible for the transcription regulation in pig development. However, it was not determined how they regulate gene transcription process or mediate protein-protein interactions. Further studies are necessary by other molecular methods such as chromatin immunoprecipitation (ChIP) assay, yeast one-hybrid system, yeast two-hybrid system, electrophoresis mobility shift assay (EMSA). In the present study, we have identified porcine liver genes that are differentially expressed in response to exposure to two different concentrations of cyadox. It is the first contribution to the determination of the transcriptional profile of pig liver following treatment with an

Conflict of interest statement None of the authors of this paper has a personal or financial relationship with other people or organizations that could inappropriately influence or bias the content of the paper. Acknowledgement This work was financially supported by the National Key R&D Program of China (grant no. 2017YFC1600102), Applied Basic Research Programs of Wuhan (grant no. 2017020201010228), the Fundamental Research Funds for the Central Universities (grant no. 2662017JC034), and National Risk Assessment of Quality and Safety of Livestock and Poultry Products (GJFP2015008). The authors thank Roy 77

Research in Veterinary Science 118 (2018) 72–78

R. Yu et al.

Pleasants at Duke University Medical Center for critically revising the manuscript.

Nabuurs, M.J., van der Molen, E.J., de Graaf, G.J., Jager, L.P., 1990. Clinical signs and performance of porcines treated with different doses of carbadox, cyadox and olaquindox. Zentralbl. Veterinarmed. A 37, 68–76. Nakashima, T., Sekiguchi, T., Kuraoka, A., 1993. Molecular cloning of a human cDNA encoding a novel protein, DAD1, whose defect causes apoptotic cell death in hamster BHK21 cells. Mol. Cell. Biol. 13, 6367–6374. National Research Council, 1998. Nutrient Requirements of Swine, 10th edition. National Academy Press, Washington, DC. Park, Y.K., Monaco, M.H., Dorovan, S.M., 1999. Enteral insuline growth factor 1 augments intestinal disaccaridase activity in piglets receiving total parenteral nutrition. J. Pediatr. Gastroenterol. Nutr. 29, 198–206. Peng, L., Weimin, Z., Xiaoying, Z., Zhen, G., Robert, P., Lidia, A., Feilan, W., Arthur, B., 1994. Differential display using one-base anchored oligo-dT primers. Nucleic Acids Res. 22, 5763–5764. Peng, H., Du, M., Ji, J., Isaacson, P.G., Pan, L., 1995. High-resolution SSCP analysis using polyacrylamide agarose composite gel and a background-free silver staining method. BioTechniques 19, 410–414. Pratt, J.R., Basheer, S.A., Sacks, S.H., 2002. Local synthesis of complement component C3 regulates acute renal transplant rejection. NatMed 8, 82–87. Puskas, F., Gergely, P., Banki, K., Perl, A., 2000. Stimulation of the pentose phosphate pathway and glutathione levels by dehydroascorbate, the oxidized form of vitamin C. FASEB J. 14, 1352–1360. Rise, M.L., Douglas, S.E., Sakhrani, D., Williams, J., Ewart, K.V., Rise, M., Davidson, W.S., Koop, B.F., Devlin, R.H., 2006. Multiple microarray platforms utilized for hepatic gene expression profiling of GH transgenic coho salmon with and without ration restriction. J. Mol. Endocrinol. 37, 259–282. Saleri, R., Baratta, M., Mainardi, G.L., 2001. IGF-I, IGFBP-2 and 3 but not GH concentrations are different in normal and poor growing piglets. Reprod. Nutr. Dev. 41, 163–172. Sanjay, A., Fu, J., Kreibich, G., 1998. DAD1 is required for the function and the structural integrity of the oligosaccharyltransferase complex. J. Biol. Chem. 273, 26094–26099. Silberstein, S., Collins, P.G., Kelleher, D.J., Gilmore, R., 1995. The essential OST2 gene encodes the 16-kD subunit of the yeast oligosaccharyltransferase, a highly conserved protein expressed in diverse eukaryotic organisms. J. Cell Biol. 131, 371–383. Siriluck, P., Klaus, W., Karl, S., 2001. Application of differential display RT-PCR to identify porcine liver ESTs. Gene 280, 75–85. Tanaka, Y., Makishima, T., Sasabe, M., 1997. Dad-1 a putative programmed cell death suppressor gene in rice. Plant Cell Physiol. 38, 379–383. Tokosová, M., Pleva, J., 1988. The effect of growth stimulators on the health status and growth of broilers. Vet. Med. (Praha) 33, 303–311. Visek, W.J., 1978. The mode of growth promotion by antibiotics. J. Anim. Sci. 46, 1447–1469. Walton, J.R., 1983. Modes of action of growth promoting agents. Vet. Res. Commun. 7, 1–7. Wang, Y., Yuan, Z., Zhu, H., Ding, M., Fan, S., 2005. Effect of cyadox on growth and nutrient digestibility in weanling pigs. S. Afr. J. Anim. Sci. 35, 117–125. Wang, X., Liu, Q., Ihsan, A., Huang, L., Dai, M., Hao, H., Cheng, G., Liu, Z., Wang, Y., Yuan, Z., 2012. JAK/STAT pathway plays a critical role in the proinflammatory gene expression and apoptosis of RAW264.7 cells induced by trichothecenes as DON and T-2 toxin. Toxicol. Sci. 127, 412–424. Williams, J.F., Blackmore, P.F., 1983. Non-oxidative synthesis of pentose 5-phosphate from hexose 6-phosphate and triose phosphate by the L-type pentose pathway. Int. J. BioChemiPhysics 15, 797–816. Zhu, H.L., Yuan, Z.H., Wang, Y.L., Qiu, Y.S., Fan, S.X., 2006. The effect of cyadox supplementation on metabolic hormones and epidermal growth factor in pigs. Anim. Sci. 82, 345–350. van Zon, A., Mossink, M.H., Schoester, M., Houtsmuller, A.B., Scheffer, G.L., Scheper, R.J., Sonneveld, P., Wiemer, E.A., 2003. The formation of vault-tubes: a dynamic interaction between vaults and vault PARP. J. Cell Sci. 116, 4391–4400.

References Banki, K., Hutter, E., Colombo, E., Gonchoroff, N.J., Perl, A., 1996. Glutathione levels and sensitivity to apoptosis are regulated by changes in transaldolase expression. J. Biol. Chem. 271, 32994–33001. Buekinsham, M., Bajard, L., Chang, T., 2003. The formation of skeletal muscle: from somite to limb. J. Anat. 202, 59–68. Charlotte, F.J., Garand, J.C., Edouand, N.E., 1993. Epidermal growth factor and the maturation of intestinal sucrase in sucking rats. Am. J. Phys. 265, G459–G466. Chen, Z., Ding, Y., Zhang, H., 2002. Morphology, viability and functions of suckling porcine hepatocytes cultured in serum-free medium at high density. Dig. Surg. 19, 184–191. Ding, M.X., Yuan, Z.H., Wang, Y.L., Zhu, H.L., Fan, S.X., 2006a. Olaquindox and cyadox stimulate growth and decrease intestinal mucosal immunity of piglets orally inoculated with Escherichia coli. J. Anim. Physiol. Anim. Nutr. (Berl.) 90, 238–243. Ding, M.X., Wang, Y.L., Zhu, H.L., Yuan, Z.H., 2006b. Effects of cyadox and olaquindox on intestinal mucosal immunity and on fecal shedding of Escherichia coli in piglets. J. Anim. Sci. 84, 2367–2373. Fisher, D.A., 1988. Epidermal growth factor in the developing mammal. Mead Johnson Symp. Perinat. Dev. Med. 32, 33–40. Gaskins, H.R., Collier, C.T., Anderson, D.B., 2002. Antibiotics as growth promotants: mode of action. Anim. Biotechnol. 13, 29–42. Grossmann, C.E., Qian, Y., Banki, K., Perl, A., 2004. ZNF143 mediates basal and tissuespecific expression of human transaldolase. J. Biol. Chem. 279, 12190–12205. Hathaway, M.R., Dayton, W.R., White, M.E., Henderson, T.L., Henningson, T.B., 1996. Serum insulin-like growth factor I (IGF-I) concentrations are increased in porcines fed antimicrobials. J. Anim. Sci. 74, 541–547. He, F., Umehara, T., Tsuda, K., Inoue, M., Kigawa, T., Matsuda, T., Yabuki, T., Aoki, M., Seki, E., Terada, T., Shirouzu, M., Tanaka, A., Sugano, S., Muto, Y., Yokoyama, S., 2007. Solution structure of the zinc finger HIT domain in protein FON. Protein Sci. 16, 1577–1587. Kelleher, D.J., Gilmore, R., 1997. DAD1, the defender against apoptotic cell death, is a subunit of the mammalian oligosaccharyltransferase. Proc. Natl. Acad. Sci. U. S. A. 94, 4994–4999. Kelleher, D.J., Gilmore, R., 2006. An evolving view of the eukaryotic oligosaccharyltransferase. Glycobiology 16, 47R–62R. Kickhoefer, V.A., Siva, A.C., Kedersha, N.L., Inman, E.M., Ruland, C., Streuli, M., Rome, L.H., 1999. The 193-kD vault protein, VPARP, is a novel poly(ADP-ribose) polymerase. J. Cell Biol. 146, 917–928. Kopf, M., Abel, B., Gallimore, A., 2002. Complement component C3 promotes T-cell priming and lung migration to control acute influenza virus infection. NatMed 8, 373–378. Kowalski, K., Liew, C.K., Matthews, J.M., Gell, D.A., Crossley, M., Mackay, J.P., 2002. Characterization of the conserved interaction between GATA and FOG family proteins. J. Biol. Chem. 277, 35720–35729. Landagora, F.T., Rusoff, L.L., Harris Jr., B., 1957. Effect of chlortetracycline of carcass yields including physical and chemical composition of dairy calves. J. Anim. Sci. 16, 654–661. Liu, Y., Snow, B.E., Kickhoefer, V.A., Erdmann, N., Zhou, W., Wakeham, A., Gomez, M., Rome, L.H., Harrington, L., 2004. Vault poly(ADP-ribose) polymerase is associated with mammalian telomerase and is dispensable for telomerase function and vault structure in vivo. Mol. Cell. Biol. 24, 5314–5323. van der Molen, E.J., Baars, A.J., de Graaf, G.J., Jager, L.P., 1989. Comparative study of the effect of the effect of carbadox, olaquindox and cyadox on aldosterone, sodium and potassium plasma levels in weaned pigs. Res. Vet. Sci. 47, 11–16.

78