- Email: [email protected]
Differentiation of C-strain “Riems” or CP7_E2alf vaccinated animals from animals infected by classical swine fever virus field strains using real-time RT-PCR
Journal of Virological Methods 158 (2009) 114–122
Contents lists available at ScienceDirect
Journal of Virological Methods journal homepage: www.elsevier.com/locate/jviromet
Differentiation of C-strain “Riems” or CP7 E2alf vaccinated animals from animals infected by classical swine fever virus field strains using real-time RT-PCR Immanuel Leifer a , Klaus Depner a , Sandra Blome a , Marie-Frederique Le Potier b , Mireille Le Dimna b , Martin Beer a,∗ , Bernd Hoffmann a a
Institute of Diagnostic Virology, Friedrich-Loeffler-Institut, Südufer 10, 17493 Greifswald-Insel Riems, Germany Agence Franc¸aise de Sécurité Sanitaire des Aliments, Laboratorie d’Etudes et de Recherches Avicoles Porcines et Piscicoles - Unité de Virologie et Immunologie Porcines, Laboratorie National de Référence pour les Pestes Porcines, Zoopôle, 22440 Ploufragan, France b
a b s t r a c t Article history: Received 1 October 2008 Received in revised form 24 January 2009 Accepted 5 February 2009 Available online 12 February 2009 Keywords: Classical swine fever virus Multiplex real-time RT-PCR C-strain Genetic differentiation of vaccinated from infected animals Candidate marker vaccine CP7 E2alf
Classical swine fever (CSF) is one of the most important diseases of pigs. Although prophylactic vaccination is banned within the European Union, emergency vaccination, allowing differentiation of vaccinated from infected animals, is an option for disease control. Up to now, these strategies are based on antibody detection. In this context, conventional modified live vaccines are not suitable. A promising perspective could be genetic differentiation of vaccinated from infected animals where field virus strains are differentiated from vaccine viruses by sequence differences. This concept could also be used with marker vaccines. To this end, a set of real-time reverse transcription-polymerase chain reaction (RT-PCR) assays was developed and validated. Specific primers and probes were designed for detection of the C-strain “Riems” vaccine virus or the chimeric marker vaccine candidate CP7 E2alf. A heterologous internal positive control was also included. The assays were then multiplexed to detect simultaneously either CSF field virus, C-strain “Riems”, and the internal control or CSF field virus, CP7 E2alf, and the internal control. To validate both systems, samples from vaccination/challenge trials were tested. Only samples from vaccinated animals were found to be positive, while all samples from wild type virus-infected animals and a broad test panel of different pestiviruses were negative. Field application of the “C-strain Riems” specific assay was proven with wild boar samples from surveillance programs in Germany and France. In conclusion, ready-to-use RT-PCR sets are presented as reliable tools for genetic differentiation of vaccinated from infected animals for CSFV eradication strategies. © 2009 Elsevier B.V. All rights reserved.
1. Introduction Classical swine fever virus (CSFV), Bovine viral diarrhea virus (BVDV) and Border disease virus (BDV) belong to the genus Pestivirus of the family Flaviviridae (Fauquet and Fargette, 2005). Pestiviruses possess a single-stranded, positive-sense RNA genome of about 12.3 kb (Meyers and Thiel, 1996). Because of high infectivity, pathogenicity and restriction measures for infected herds and regions, classical swine fever (CSF) can cause significant economic losses in industrialized pig productions (Edwards et al., 2000; Vandeputte and Chappuis, 1999). The recent German CSF outbreak in 2006 was, e.g. caused by a highly virulent CSFV of subtype 2.3 (Depner et al., 2007a). Within the European Union (EU), CSF control is based on a stamping out strategy without prophylactic vaccination. In case
∗ Corresponding author. Tel.: +49 38351 7 200; fax: +49 38351 7 151. E-mail address: Martin.Beer@fli.bund.de (M. Beer). 0166-0934/$ – see front matter © 2009 Elsevier B.V. All rights reserved. doi:10.1016/j.jviromet.2009.02.002
of large outbreaks, this policy often results in a vast number of culled animals not only from infected herds but also from the established restriction zones (Edwards et al., 2000). Although prophylactic vaccination is banned, emergency vaccination following an EU approved emergency vaccination plan is possible (Anon., 2001) and may help to reduce the spread of virus as well as the number of culled animals. Nevertheless, vaccination areas are placed under extensive restrictions. Only if a marker vaccine is used which allows differentiation of infected from vaccinated animals, derogations can be made. So far, differentiation of vaccinated from infected animals strategies are based solely on serological tests detecting antibodies against field CSFV. The only CSFV marker vaccine available commercially is based on baculovirus-expressed envelope protein E2, and the accompanying marker assays detect antibodies specific for the envelope protein ERNS (Blome et al., 2006; Dong and Chen, 2007). In the context of emergency vaccination, the vaccine employed must provide rapid and solid horizontal and vertical protection. Modified live vaccines such as “C-strain Riems” meet these
I. Leifer et al. / Journal of Virological Methods 158 (2009) 114–122
demands (Anon., 2003) and are used currently for bait vaccination campaigns in European wild boar populations (Germany, France, Romania, and Slovakia) and as part of an emergency vaccination program for domestic pigs in Romania. Worldwide, several modified live vaccine strains are used. Most modified live vaccines are based on either the ‘Chinese’ (C) strain, or on the cell culture adapted Japanese guinea-pig exaltation-negative (GPE−) strain, or on the French cell culture adapted Thiverval strain (Blome et al., 2006; Greiser-Wilke and Moennig, 2004; Van Oirschot, 2003). There is no legal obligation to use any particular strain, however, extensive data exist mainly for the C-strain vaccines. Regarding bait vaccination, reliable data so far have been collected only for the “C-strain Riems” (Brauer et al., 2006; Faust et al., 2007; Kaden et al., 2000, 2001, 2002, 2003, 2004a,b, 2005, 2006, 2008; Kaden and Lange, 2001, 2004; von Rueden et al., 2008). Nevertheless, the ideal vaccine should also have marker properties. Unfortunately, none of the current C-strain vaccines allows serological differentiation of vaccinated from infected animals. In contrast, E2 subunit marker vaccines available currently are suitable for serological differentiation of vaccinated from infected animals but lack properties such as rapid and complete protection after administration of a single vaccine dose or suitability for oral administration (Anon., 2003). Therefore, a promising solution could be the use of a so-called genetic differentiation of vaccinated from infected animals, where differentiation is based on genome sequence varieties between vaccine strains and field viruses (Beer et al., 2007). Novel marker vaccine candidates that would allow both genetic and serological differentiation of vaccinated from infected animals are chimeric pestiviruses such as CP7 E2alf (Beer et al., 2007; Dong and Chen, 2007; Reimann et al., 2004; Wehrle et al., 2007; Koenig et al., 2007b). These candidate vaccines would combine the marker aspect with all the advantages of a modified live vaccine. However, genetic differentiation of infected from vaccinated animals would also be possible with conventional modified live vaccines differentiating vaccinated from infected animals by real-time reverse transcription-polymerase chain reaction (RT-PCR). Thus, for genetic differentiation of vaccinated from infected animals, vaccine virus-specific real-time RT-PCR protocols are necessary. In this context, a multiplex real-time RT-PCR system for detection and differentiation of the Chinese vaccine strain (Shimen/HVRI AY775178) from field strains has been recently reported (Zhao et al., 2008). However, due to sequence differences, this detection system cannot be used for CSF vaccine strains used in Europe. The development of a uniform system for all vaccine strains applied seems impossible. Within the EU, “C-strain Riems” is one of the major vaccine strains and thus, a number of primer sets were tested using different approaches to establish a reliable system for genetic differentiation of the C-strain “Riems”. For CP7 E2alf, genetic differentiation of infected from vaccinated animals was reported based on a combination of CSFV- and panpesti-specific real-time RTPCRs. To optimize genetic discrimination of CP7 E2alf-vaccinated from CSFV field strain-infected pigs, an additional CP7 E2alf specific real-time RT-PCR protocol was designed and validated. Finally, the real-time PCR sets were validated both with analytical samples as well as with diagnostic materials. 2. Materials and methods
115
standard protocols (cell culture collection of veterinary medicine, Friedrich-Loeffler-Institut, Insel Riems, Germany). For the C-strain specific protocol, tissue samples from different infection trials carried out at the Friedrich-Loeffler-Institut and the Agence Franc¸aise de Sécurité Sanitaire des Aliments were used for test validation. Samples were taken from animals vaccinated with the C-strain as well as from animals infected with CSFV (strains “Koslov” and “Bas-Rhin”, respectively) at different time points (Koenig et al., 2007a; Reimann et al., 2004). For all samples known PCR results where available, obtained by already established and field-tested CSFV specific PCR protocols (Hoffmann et al., 2005; Depner et al., 2006; Depner et al., 2007b; Le Dimna et al., 2008). The CP7 E2alf specific assay was tested with several tonsil samples from animals vaccinated experimentally (data not shown). All samples had known preliminary results regarding a panpestispecific RT-PCR (Hoffmann et al., 2006) and were taken at different time points after vaccination. Three samples taken at 6, 17, and 24 days post-vaccination, respectively, were positive (Koenig et al., 2007a). In addition, RNA was extracted from the C-strain and the CP7 E2alf vaccine virus containing cell culture supernatants (Reimann et al., 2004). The extracted RNAs were diluted 10-fold serially to analyse the analytical sensitivity of the real-time RT-PCR systems. Within work-package 4.1 (“Real-time PCR diagnostics”) of the EU-funded EPIZONE project, a so-called ‘EPIZONE REFERENCE RNA’ panel was developed for the comparison, standardization and validation of molecular pestivirus assays (Hoffmann et al., unpublished data). The panel incorporates a representative collection of CSFVRNA of the most relevant genotypes as well as members of related pestiviruses (BDV, BVDV, and atypical pestiviruses). The ‘EPIZONE REFERENCE RNA’ panel comprises currently 30 different pestiviral RNAs from cell culture supernatants with about 1000 genome copies per l. The viral RNAs were diluted and aliquoted in RNA safe buffer-RSB consisting of 50 ng/l carrier polyA-RNA (RNAHomopolymer, #27-4110-01, Amersham Biosciences), 0.05% Tween 20, and 0.05% sodium azide in RNase free water. Aliquots were then stored at −80 ◦ C for long-term use. In order to prove application in the field, routine diagnostic samples from German and French wild boar were tested with the C-strain “Riems” specific RT-PCR. German samples (blood, tonsil, and lymph node) originated from a C-strain vaccination area in Rhineland Palatinate, and were known to contain C-strain viral RNA (confirmed by CSFV specific real-time RT-PCR and subsequent sequencing at the German National Reference Laboratory for CSF). French spleen samples originated from the Northern Vosges region (Pol et al., 2008), where oral vaccination has been carried out for 3 years. Eight out of nine French samples were found positive by a commercial real-time RT-PCR (TaqVet-CSF kit; LSI, Lyon, France) at the French National Reference Laboratory for CSF. 2.2. RNA isolation Viral RNA from cell culture or serum samples was extracted with the QIAamp Viral RNA Kit (Qiagen GmbH, Hilden, Germany), and from tissues samples using the RNeasy Mini Kit (Qiagen GmbH, Hilden, Germany) according to the manufacturer’s instructions. The protocols were modified by the addition of an internal control RNA (IC2) as described previously (Hoffmann et al., 2006).
2.1. Samples 2.3. Primer and probe selection All viruses (BDV, BVDV, CSFV strains and chimeric Pestivirus CP7 E2alf) were obtained from the German National Reference Laboratory for CSF. CSFV strains were cultured using porcine kidney cells (PK15), BVDV and BDV were propagated on bovine kidney cells (MDBK) or sheep thymus cells (SFT), respectively, according to
According to the NCBI database, 28 different complete CSFV genome sequences were aligned by using the ClustalW2 (EMBL-EBI) (Larkin et al., 2007) and BioEdit software (IBIS Biosciences Carlsbad, USA). For primer and probe selection, the beacon designer
116
I. Leifer et al. / Journal of Virological Methods 158 (2009) 114–122
Table 1 Primers and probes used for the different real-time RT-PCR protocols. Name of primer
Sequence of primer
Information
C-strain 1625-F (forward primer) C-strain 1702-R (reverse primer) C-strain 1652-FAM (FAM labeled probe)
ATAGAGAGCCCATGTAATTTCAATA CTGGAGCAAACTGCCGCT TCCGTGGAGGATACCTTGTATGGGGATC
Under research
Panpesti BVD 190-F (forward primer) Panpesti ML 121 (reverse primer) Panpesti probe TET 1
GRAGTCGTCARTGGTTCGAC TCAACTCCATGTGCCATGTAC TGCYAYGTGGACGAGGGCATG
CP7E2alf-insF (forward) CP7E2alf-insR (reverse) CP7E2alf-v2-FAM (FAM labeled probe)
TCCTGTGGCTAATAGTGACCT CCACTTCAACACTGTCATGTG TCGCCGCTGGTTACGTAGTCCAGTAT
CSF 100F (forward) CSF192R (reverse) CSF 1-TEX (TEX labeled probe)
ATGCCCAYAGTAGGACTAGCA CTACTGACGACTGTCCTGTAC TGGCGAGCTCCCTGGGTGGTCTAAGT
5.0 was used (Premier Biosoft International, Palo Alto, USA). Oligonucleotides (Table 1) were synthesized by biomers.net (Ulm, Germany) and Eurogentec (Eurogentec GmbH, Cologne, Germany). For the C-strain “Riems” specific assay, primers “C-strain 1625F” and “CSF-strain 1702-R” were selected in the ERNS encoding genome region of C-strain “Riems” (NCBI entry number AY259122) as depicted in Fig. 1a. They amplified a 77 bp fragment (nucleotides 1625–1702 of AY259122) detected by the FAM-labeled probe “Cstrain 1652-FAM”. Sequences of the selected primers and probes are shown in Table 1. From an alignment of the CP7 E2alf sequence with different pestiviruses, a primer/probe combination was chosen to detect specifically CP7 E2alf (Fig. 1b and Table 1). These primers amplify a 125 bp fragment at the cloning site between the E2 protein of CSFV strain Alfort and the p7 protein of BVDV backbone strain CP7 (nucleotides 3526–3651 of CP7 E2alf, see Table 1) (Reimann et al., 2003). The reverse primer is specific for BVDV; therefore, amplification of CSFV RNA is excluded. For the 24 bp FAM labeled probe, a specific genomic region was chosen whose sequence does not exist in any wild type pestivirus. It enables specific amplicon detection (Table 1). 2.4. Real-time RT-PCR (rRT-PCR) A one-step rRT-PCR protocol was established by using the Superscript III One-Step RT-PCR Kit (Invitrogen GmbH, Karlsruhe, Germany). The assay was optimized for 25 l total reaction volume. The PCR master mix for duplex rRT-PCR contained 12.5 l 2× RT-PCR reaction mix, 1 l Superscript III enzyme mix, 2 l CSF mix 1.-TEX (20 pmol reverse and forward primer, 2.5 pmol TEX-labeled probe), 2.5 l Rnase free water, 5 l template RNA, and 2 l C-strain mix 1-FAM (20 pmol reverse and forward primer, 2.5 pmol FAM labeled probe) or, CP7 E2alf mix 1-FAM (20 pmol reverse and forward primer, 2.5 pmol FAM labeled probe), respectively. Real-time RT-PCR was carried out in an Mx3005pro cycler (Stratagene, La Jolla, USA). Reverse transcription was performed for 30 min at 50 ◦ C following 2 min at 94 ◦ C. DNA amplification was carried out over 42 cycles of 15 s 94 ◦ C (DNA denaturation), 30 s 59 ◦ C (annealing, fluorescence data collection), and 30 s 68 ◦ C (elongation). To allow multiplexing, the temperature profile was chosen in accordance with the CSFV- and panpesti-specific RT-PCR protocols previously published by Hoffmann et al. (2005, 2006). These assays contained a simultaneously amplified internal control that consists of a heterologous transcript (Hoffmann et al., 2006). To obtain the preliminary test results of samples from CP7 E2alf vaccinated animals, and for the ‘EPIZONE REFERENCE RNA’ panel, a panpesti-specific assay described previously was used (Hoffmann et al., 2006).
Published by Hoffmann et al. (2006) Modified TET labeled probe
Under research Published by Hoffmann et al. (2005) Modified TEX labeled probe
3. Results 3.1. C-strain specific rRT-PCR Analytical sensitivity was determined using a 10-fold dilution series containing C-strain positive RNA derived from the ‘EPIZONE REFERENCE RNA’, according to the protocol of Hoffmann et al. (2005, 2006). It was shown that the detection limit was six dilution steps of the used standard, and the detection limit of the control RNA goes linearly down to 101 copies/well with an efficiency of 102.6%. The Ct-values of the detected dilutions ranged between 23 and 39.5 (see Figs. 2a and 3a). In order to estimate specificity, a test panel of 30 pestiviral RNAs (‘EPIZONE REFERENCE RNA’) was used. The panel consisted of 13 CSFV strains including the C-strain, 4 BDV strains, 8 BVDV-1 strains, 5 BVDV-2 strains, and the chimeric pestivirus CP7 E2alf. Whereas the C-strain “Riems” RNA was detected, all other CSFV, BDV, and BVDV RNAs as well as the chimeric pestivirus RNA were negative (Table 2). In addition, samples were examined from vaccinated pigs of different animal experiments carried out at the Institute of Diagnostic Virology, Friedrich-Loeffler-Institut, Insel Riems, Germany, or at Agence Franc¸aise de Sécurité Sanitaire des Aliments, Ploufragan, France. C-strain specific viral RNA was detected in different tissues such as tonsils, blood and spleen of vaccinated pigs with Ct-values of about 22.0–38.0 (Table 3). To demonstrate application in the field, routine diagnostic specimens from wild boar were investigated. The samples were sent to the German and French National Reference Laboratory for CSF (blood and tissue samples). Most German samples originated from regions where wild boar vaccination has been implemented recently and which were positive previously by CSFV and/or panpesti-specific rRT-PCRs. C-strain viral RNA was detected in all samples with a positive CSF- or panpesti-specific rRT-PCR result with Ct-values between 32.7 and 35.2 (Table 3). Eight out of nine French spleen samples were found to be positive by a commercial real-time RT-PCR kit. Five of these positive samples were also positive using the C-strain specific protocol with Ct-values ranging from 34.8 to 40.7 (Table 3). These organs were obtained from wild boars shot just 1 week after C-strain vaccine bait distribution. 3.2. CP7 E2alf specific rRT-PCR The analytical sensitivity of the CP7 E2alf rRT-PCR was determined according to the same procedure as described for the C-strain specific rRT-PCR. To this end, a 10-fold dilution series of a positive RNA standard, obtained after extraction of CP7 E2alf viral RNA from cell culture supernatant was used. The CP7 E2alf specific rRT-PCR
Table 2 Real-time RT-PCR results of all tested protocols. A reference RNA panel (‘EPIZONE REFERENCE RNA’) was used for comparison of sensitivity and specificity of the single rRT-PCR assays with the duplex rRT-PCR systems.
I. Leifer et al. / Journal of Virological Methods 158 (2009) 114–122 117
118
I. Leifer et al. / Journal of Virological Methods 158 (2009) 114–122
Fig. 1. (a) Multi-alignment of 28 different CSFV genomes (NCBI database entries). For alignment, ClustalW2 and BioEdit Software were used. Primers and probe specific for C-strain Riems (NCBI database entry AY259122.1) were selected in the ERNS region (nucleotides 1625–1702). (b) Multi-alignment of 28 different CSFV genomes (NCBI database entries) and CP7 E2alf (red color). For the alignment ClustalW2 and BioEdit Software were used. Primers and probe specific for the CP7 E2alf chimeric pestivirus construct were selected at the cloning site between the region coding for the E2 protein of CSFV strain Alfort and the p7 protein of BVDV backbone strain CP7. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of the article.)
detected six dilution steps of the standard tested (Figs. 2b and 3b). Fig. 3b shows the standard curve of the dilution series. The efficiency of the rRT-PCR was 99.6%, and the detection limit for the positive control RNA scored with 101 copies/well. The Ct-values for the dilution series ranged from 19 to 36. All experimental samples which were positive by a preliminary test status could be detected. The above RNA panel was used again to estimate specificity. While the CP7 E2alf RNA was detected reliably, none of the other pestiviral RNAs gave a positive result (Table 2). 3.3. Multiplex rRT-PCRs (duplex or triplex systems) In order to allow simultaneous detection, the vaccine virusspecific rRT-PCRs were combined with each other and a rRT-PCR protocol for detecting field virus. The field virus detecting protocol
contained the internal control system and was used as such. It was shown that the C-strain specific rRT-PCR as well as the CP7 E2alf specific rRT-PCR could be carried out as duplex (Table 3) or triplex rRT-PCR (data not shown) together with the modified CSF specific rRT-PCR protocol according to Hoffmann et al. (2005, 2006), including the internal control (IC2) specific rRT-PCR as published previously. Comparison of single and duplex assays based on the ‘EPIZONE REFERENCE RNA’ panel showed no noticeable influence on specificity and sensitivity. The C-strain specific and the CP7 E2alf specific rRT-PCR detected only the corresponding vaccine virus and no other pestiviruses of the test panel. The CSFV specific rRT-PCR detected all CSFV strains and no other pestivirus strains of the test panel. The difference of the Ct-values of the single and the multiplex assays was in all cases less than 1 or 2 Ct values. Comparative results are shown in Table 2.
I. Leifer et al. / Journal of Virological Methods 158 (2009) 114–122
119
Fig. 2. (a and b) Standard curve of C-strain (a) and CP7 E2alf (b) real-time RT-PCR amplification plots. Tenfold dilution series of RNA derived from extraction of viral RNA from cell culture supernatant of CP7 E2alf transfected cells.
Table 3 C-strain specific real-time RT-PCR results of different samples from animal trials and wild boars from regions with oral C-strain vaccination programs. Both the sample material (blood or organs) and the corresponding Ct-values are listed. Sample Tonsil after oral vaccination (animal trial) Tonsil after intramuscular vaccination (animal trial) Tonsil after intramuscular vaccination (animal trial) Tonsil after intramuscular vaccination (animal trial) Blood (German wild boar field sample) Blood (German wild boar field sample) Tonsil (German wild boar field sample) Lymph node (German wild boar field sample) Tonsil animal trial France (C-strain) Tonsil animal trial France (C-strain) Tonsil animal trial France (C-strain) Tonsil animal trial France (C-strain) Spleen animal trial France (C-strain) Spleen animal trial France (C-strain) Spleen animal trial France (C-strain) Spleen animal trial France (C-strain) Spleen field sample France northern Vosges (C-strain) Spleen field sample France northern Vosges (field virus) Spleen field sample France northern Vosges (negative) Spleen field sample France northern Vosges (C-strain) Spleen field sample France northern Vosges (C-strain) Spleen field sample France northern Vosges (C-strain) Spleen field sample France northern Vosges (C-strain) Spleen field sample France northern Vosges (field virus) Spleen field sample France northern Vosges (field virus) a b c
Panpesti rRT-PCR (Hoffmann et al., 2006). CSFV-rRT-PCR (Hoffmann et al., 2005). CSFV-rRT-PCR (LSI, Lyon, France).
Ct-value CSFV rRT-PCR a
>42 38.77a 36.04a 36.35a 36.02b 27.72b 38.41b 35.06b 23.22c 33.12c 30.69c 31.11c 36.48c 34.79c 38.87c >42c 37.31c 37.3c >42c 37.11c 35.98c 39.34c 39.37c 39.54c 37.92c
Ct-value C-strain specific rRT-PCR 37.95 36.31 36.85 33.19 33.73 32.74 35.22 34.41 21.99 32.54 28.36 35.20 36.77 32.59 28.51 >42 36.50 >42 >42 34.79 35.85 40.67 37.20 >42 >42
120
I. Leifer et al. / Journal of Virological Methods 158 (2009) 114–122
Fig. 3. (a and b) Analytical sensitivity based on a 10-fold dilution series of viral RNA. Standard curve graph for the C-strain (a) and CP7 E2alf (b) real-time RT-PCR.
4. Discussion The possibility of differentiating infected from vaccinated animals is a key prerequisite for CSF emergency vaccination strategies within the EU. A promising solution could be the use of a so-called genetic differentiation of vaccinated from infected animals, where differentiation is based on genome sequence variations between vaccine strains and field viruses (Beer et al., 2007). Genetic differentiation of vaccinated from infected animals could also be applied to novel marker vaccine candidates such as the chimeric pestivirus CP7 E2alf. Chimeric pestiviruses would allow both genetic and serological differentiation of infected from vaccinated animals and thus combine the marker aspect with all advantages of a modified live vaccine. However, for genetic differentiation of vaccinated from infected animals, reliable vaccine virus-specific rRT-PCR protocols are necessary. Based on the Chinese CSFV vaccine strains, different RT-PCR assays have been published (Li et al., 2007; Peng et al., 2007; Zhao et al., 2008), and another assay was developed for the Korean variation (Cho et al., 2006). In addition, Zaberezhny et al. (1999) combined a RT-PCR assay with restriction fragment length polymorphism (RFLP) to discriminate field viruses from Russian vaccine strains. Because of sequence differences, none of these systems is applicable for the European C-strain “Riems” vaccine. The present study was undertaken to develop and validate real-time RT-PCR protocols for differentiation of CSF field virus infected from C-strain “Riems”or CP7 E2alf-vaccinated pigs. For detection of C-strain “Riems” vaccine virus a specific and sensitive real-time RT-PCR system was developed. With a reference panel of 30 different pestiviral RNAs we could demonstrate the
specificity of the new rRT-PCR. Except for the vaccine virus, none of the pestiviruses tested was detected by the C-strain specific PCR system. Analytical sensitivity was estimated using dilution series. It was shown that six 10-fold dilution steps were detected by the new system. In order to confirm the practicability of the new PCR assay in the field, well characterized samples from different animal experiments carried out at the Friedrich-Loeffler-Institut or the Agence Franc¸aise de Sécurité Sanitaire des Aliments were tested. The Cstrain vaccine virus was detected in organs after oral as well as after intramuscular immunisation in accordance with the respective preliminary report. Furthermore, routinely collected wild boar samples were tested (blood, spleen, lymph nodes, and tonsil) from different regions in western parts of Germany and North-eastern France where oral vaccination of wild boar were carried out recently. All samples had been sent to the National Reference Laboratories for CSF for confirmatory testing and exclusion of CSF field virus infection. Most of these samples were positive by CSFV specific real-time RT-PCRs and were subjected subsequently to the new C-strain specific rRT-PCR assay developed in this study. All samples which were found to contain the C-strain genome by sequencing were also detected by our C-strain specific rRT-PCR protocol proving reliability of the new test system. Reliable results were also obtained with French samples. Surprisingly, vaccine virus could also be detected in some field blood samples from Germany with quite low Ct-values (Table 3). This contradicts the common expert opinion and experience that the C-strain “Riems” is found rarely in blood samples and, if it is detected, with very high Ct-values. It has been considered if genetic differentiation of vaccinated from infected animals is possible and necessary at all, as the C-strain “Riems” vaccine virus as well as the new chimeric marker vaccine candidates rarely, if ever,
I. Leifer et al. / Journal of Virological Methods 158 (2009) 114–122
induce detectable viraemia as was shown by Koenig et al. (2007a). In experimental settings, the vaccine virus was only found in tonsils for a longer period. Nevertheless, the results of the present study with routine field samples show that it is necessary to have an easy to handle and rapid C-strain specific “backup system”, especially in areas with wild boar vaccination. Although the C-strain “Riems” vaccine induces virtually sterile immunity after a short time period (Anon., 2003), it must be stated that in the very unlikely event of a CSF field virus infection shortly after C-strain vaccination, the new rRT-PCR might fail to discriminate clearly between C-strain vaccinated pigs and pigs infected with a field virus after vaccination. This would, however, only be the case if the copy numbers of both wild CSFV and C-strain are nearly identical. So far, all attempts to develop an rRT-PCR system which detects only CSFV field strains and excludes the vaccine C-strain “Riems” failed. Nevertheless, combination of the new C-strain “Riems” specific rRT-PCR with sequencing will ensure that these animals are identified. Implementation of chimeric marker vaccines such as the chimeric Pestivirus CP7 E2alf for vaccination would circumvent even these very unlikely problems. In this study a highly sensitive real-time RT-PCR was developed which can discriminate clearly between CP7 E2alf and CSFV field strain RNAs. By testing 10-fold dilution series, field samples and RNAs of more than 30 different pestiviruses, the sensitivity and specificity of the new PCR system was demonstrated. CP7 E2alf is just as difficult to find in organ samples as the C-strain “Riems” (Koenig et al., 2007a). Therefore, only a very limited number of positive materials was obtained from animal trials. These samples were detected reliably (data not shown). However, field experience with the C-strain “Riems” vaccine shows that the novel marker vaccine might behave slightly differently under suboptimal field conditions and a specific confirmatory method would be valuable. In summary, discrimination of CSF vaccine strains from field viruses is possible by specific real-time RT-PCRs. A distinct system for genetic differentiation of vaccinated from infected animals could be established for C-strain vaccine “Riems” and the promising marker vaccine candidate CP7 E2alf. Together with serological methods such as the ERNS specific ELISAs, discrimination between vaccinated pigs and infected pigs would no longer be a problem with the new generation of CSFV marker vaccines. Based on this concept, political and economical vaccine restrictions during CSFV outbreaks in the EU could be reconsidered. Acknowledgements We thank Ulrike Polenz for excellent technical assistance, the state veterinary service of Rhineland Palatinate and the French National Reference Laboratory for supplying field samples, and the EU Network of Excellence, EPIZONE (Contract No. FOOD-CT-2006016236) as well as the EU project “CSF Vaccine and Wild Boar” (SSPE-CT-2003-501559) for financial support. References Anon., 2001. Council directive 2001/89/EC of 23 October 2001 on community measures for the control of classical swine fever. Off. J. Eur. Commun. L316, 5–35. Anon., 2003. Diagnostic techniques and vaccines for foot-and-mouth disease, classical swine fever, avian influenza and some other important OIE list a diseases. Report of the Scientific Committee on Animal Health and Animal Welfare Adopted 24–25th April 2003, pp. 1–150. Beer, M., Reimann, I., Hoffmann, B., Depner, K., 2007. Novel marker vaccines against classical swine fever. Vaccine 25 (30), 5665–5670. Blome, S., Meindl-Bohmer, A., Loeffen, W., Thuer, B., Moennig, V., 2006. Assessment of classical swine fever diagnostics and vaccine performance. Rev. Sci. Technol. 25 (3), 1025–1038. Brauer, A., Lange, E., Kaden, V., 2006. Oral immunisation of wild boar against classical swine fever: uptake studies of new baits and investigations on the stability of lyophilised C-strain vaccine. Eur. J. Wildl. Res. 52 (4), 271–276.
121
Cho, H.S., Park, S.J., Park, N.Y., 2006. Development of a reverse-transcription polymerase chain reaction assay with fluorogenic probes to discriminate Korean wild-type and vaccine isolates of Classical swine fever virus. Can. J. Vet. Res. 70 (3), 226–229. Depner, K., Bunzenthal, C., Heun-Münch, B., Strebelow, G., Hoffmann, B., Beer, M., 2006. Diagnostic evaluation of a real-time RT-PCR assay for routine diagnosis of classical swine fever in wild boar. Journal of Veterinary Medicine Series BInfectious Diseases and Veterinary Public Health 53, 317–320. Depner, K., Allmann, R., Utke, K., von Felbert, I., Lange, E., Hoffmann, B., Beer, M., 2007a. Der Verlauf der klassischen Schweinepest: Ein Infektionsversuch mit dem aktuellen Schweinepest-Virusisolat aus Nordrhein-Westfalen (Kreis Borken). Tierärztl. Umschau 62, 192–195. Depner, K., Hoffmann, B., Beer, M., 2007b. Evaluation of real-time RT-PCR assay for the routine intra vitam diagnosis of classical swine fever. Veterinary Microbiology 121, 338–343. Dong, X.N., Chen, Y.H., 2007. Marker vaccine strategies and candidate CSFV marker vaccines. Vaccine 25 (2), 205–230. Edwards, S., Fukusho, A., Lefevre, P., Lipowski, A., Pejsak, Z., Roehe, P., Westergaard, J., 2000. Classical swine fever: the global situation. Vet. Microbiol. 73 (2/3), 103–119. Fauquet, C.M., Fargette, D., 2005. International committee on taxonomy of viruses and the 3,142 unassigned species. Virol. J. 2, 64. Faust, A., Lange, E., Kaden, V., 2007. Efficacy of lyophilised C-strain vaccine after oral immunisation of domestic pigs and wild boar against classical swine fever: first results. Dtsch. Tierarztl. Wochenschr. 114 (11), 412–417. Greiser-Wilke, I., Moennig, V., 2004. Vaccination against classical swine fever virus: limitations and new strategies. Anim. Health Res. Rev. 5 (2), 223–226. Hoffmann, B., Beer, M., Schelp, C., Schirrmeier, H., Depner, K., 2005. Validation of a real-time RT-PCR assay for sensitive and specific detection of classical swine fever. J. Virol. Methods 130 (1/2), 36–44. Hoffmann, B., Depner, K., Schirrmeier, H., Beer, M., 2006. A universal heterologous internal control system for duplex real-time RT-PCR assays used in a detection system for pestiviruses. J. Virol. Methods 136 (1/2), 200–209. Kaden, V., Hänel, A., Renner, C., Gossger, K., 2005. Oral immunisation of wild boar against classical swine fever in Baden-Württemberg: development of the seroprevalence based on the hunting bag. Eur. J. Wildl. Res. 51, 101–107. Kaden, V., Heyne, H., Kiupel, H., Letz, W., Kern, B., Lemmer, U., Gossger, K., Rothe, A., Bohme, H., Tyrpe, P., 2002. Oral immunisation of wild boar against classical swine fever: concluding analysis of the recent field trials in Germany. Berl Munch. Tierarztl. Wochenschr. 115 (5/6), 179–185. Kaden, V., Lange, B., 2001. Oral immunisation against classical swine fever (CSF): onset and duration of immunity. Vet. Microbiol. 82 (4), 301–310. Kaden, V., Lange, E., 2004. Development of maternal antibodies after oral vaccination of young female wild boar against classical swine fever. Vet. Microbiol. 103 (1/2), 115–119. Kaden, V., Lange, E., Fischer, U., Strebelow, G., 2000. Oral immunisation of wild boar against classical swine fever: evaluation of the first field study in Germany. Vet. Microbiol. 73 (2/3), 239–252. Kaden, V., Lange, E., Muller, T., Teuert, J., Teifke, J.P., Riebe, R., 2006. Protection of gruntlings against classical swine fever virus-infection after oral vaccination of sows with C-strain vaccine. J. Vet. Med. B: Infect. Dis. Vet. Public Health 53 (10), 455–460. Kaden, V., Lange, E., Riebe, R., Lange, B., 2004a. Classical swine fever virus Strain ‘C’. How long is it detectable after oral vaccination? J. Vet. Med. B: Infect. Dis. Vet. Public Health 51 (6), 260–262. Kaden, V., Lange, E., Steyer, H., 2004b. Does multiple oral vaccination of wild boar against classical swine fever (CSF) have a positive influence on the immunity? Dtsch. Tierarztl. Wochenschr. 111 (2), 63–67. Kaden, V., Lange, E., Steyer, H., Lange, B., Klopfleisch, R., Teifke, J.P., Bruer, W., 2008. Classical swine fever virus strain “C” protects the offspring by oral immunisation of pregnant sows. Vet. Microbiol. 130 (1-2), 20–27. Kaden, V., Renner, C., Rothe, A., Lange, E., Hanel, A., Gossger, K., 2003. Evaluation of the oral immunisation of wild boar against classical swine fever in BadenWurttemberg. Berl Munch. Tierarztl. Wochenschr. 116 (9/10), 362–367. Kaden, V., Schurig, U., Steyer, H., 2001. Oral immunization of pigs against classical swine fever. Course of the disease and virus transmission after simultaneous vaccination and infection. Acta Virol. 45 (1), 23–29. Koenig, P., Hoffmann, B., Depner, K.R., Reimann, I., Teifke, J.P., Beer, M., 2007a. Detection of classical swine fever vaccine virus in blood and tissue samples of pigs vaccinated either with a conventional C-strain vaccine or a modified live marker vaccine. Vet. Microbiol. 120 (3/4), 343–351. Koenig, P., Lange, E., Reimann, I., Beer, M., 2007b. CP7 E2alf: A safe and efficient marker vaccine strain for oral immunisation of wild boar against Classical swine fever virus (CSFV). Vaccine 25, 3391–3399. Larkin, M.A., Blackshields, G., Brown, N.P., Chenna, R., McGettigan, P.A., McWilliam, H., Valentin, F., Wallace, I.M., Wilm, A., Lopez, R., Thompson, J.D., Gibson, T.J., Higgins, D.G., 2007. Clustal W and clustal X version 2.0. Bioinformatics 23 (21), 2947–2948. Le Dimna, M., Vrancken, R., Koenen, F., Bougeard, S., Mesplede, A., Hutet, E., KuntzSimon, G., Le Potier, M.F., 2008. Validation of two commercial real-time RT-PCR kits for rapid and specific diagnosis of classical swine fever virus. J. Virol. Methods 147 (1), 136–142. Li, Y., Zhao, J.J., Li, N., Shi, Z., Cheng, D., Zhu, Q.H., Tu, C., Tong, G.Z., Qiu, H.J., 2007. A multiplex nested RT-PCR for the detection and differentiation of wild-type viruses from C-strain vaccine of classical swine fever virus. J. Virol. Methods 143 (1), 16–22.
122
I. Leifer et al. / Journal of Virological Methods 158 (2009) 114–122
Meyers, G., Thiel, H.J., 1996. Molecular characterization of pestiviruses. Adv. Virus Res. 47, 53–118. Peng, W.P., Xia, Z.H., Hou, Q., Li, N., Sun, Y., Tong, G.Z., Qiu, H.J., 2007. Differences in glycosylation of the E2 protein between virulent Shimen strain and a virulent C-strain of classical swine fever virus. Bing. Du Xue. Bao. 23 (5), 389–393. Pol, F., Rossi, S., Mesplede, A., Kuntz-Simon, G., Le Potier, M.F., 2008. Two outbreaks of classical swine fever in wild boar in France. Vet. Rec. 162 (25), 811–816. Reimann, I., Depner, K., Trapp, S., Beer, M., 2004. An avirulent chimeric Pestivirus with altered cell tropism protects pigs against lethal infection with classical swine fever virus. Virology 322 (1), 143–157. Reimann, I., Meyers, G., Beer, M., 2003. Trans-complementation of autonomously replicating Bovine viral diarrhea virus replicons with deletions in the E2 coding region. Virology 307 (2), 213–227. Van Oirschot, J.T., 2003. Vaccinology of classical swine fever: from lab to field. Vet. Microbiol. 96 (4), 367–384. Vandeputte, J., Chappuis, G., 1999. Classical swine fever: the European experience and a guide for infected areas. Rev. Sci. Technol. 18 (3), 638–647.
von Rueden, S., Staubach, C., Kaden, V., Hess, R.G., Blicke, J., Kuhne, S., Sonnenburg, J., Frohlich, A., Teuffert, J., Moennig, V., 2008. Retrospective analysis of the oral immunisation of wild boar populations against classical swine fever virus (CSFV) in region Eifel of Rhineland-Palatinate. Vet. Microbiol.. Wehrle, F., Renzullo, S., Faust, A., Beer, M., Kaden, V., Hofmann, M.A., 2007. Chimeric pestiviruses: candidates for live-attenuated classical swine fever marker vaccines. J. Gen. Virol. 88 (Pt 8), 2247–2258. Zaberezhny, A.D., Grebennikova, T.V., Kurinnov, V.V., Tsybanov, S.G., Vishnyakov, I.F., Biketov, S.F., Aliper, T.I., Nepoklonov, E.A., 1999. Differentiation between vaccine strain and field isolates of classical swine fever virus using polymerase chain reaction and restriction test. DTW Dtsch. Tierarztl. Wochenschr. 106 (9), 394–397. Zhao, J.J., Cheng, D., Li, N., Sun, Y., Shi, Z., Zhu, Q.H., Tu, C., Tong, G.Z., Qiu, H.J., 2008. Evaluation of a multiplex real-time RT-PCR for quantitative and differential detection of wild-type viruses and C-strain vaccine of Classical swine fever virus. Vet. Microbiol. 126 (1–3), 1–10.
Contents lists available at ScienceDirect
Journal of Virological Methods journal homepage: www.elsevier.com/locate/jviromet
Differentiation of C-strain “Riems” or CP7 E2alf vaccinated animals from animals infected by classical swine fever virus field strains using real-time RT-PCR Immanuel Leifer a , Klaus Depner a , Sandra Blome a , Marie-Frederique Le Potier b , Mireille Le Dimna b , Martin Beer a,∗ , Bernd Hoffmann a a
Institute of Diagnostic Virology, Friedrich-Loeffler-Institut, Südufer 10, 17493 Greifswald-Insel Riems, Germany Agence Franc¸aise de Sécurité Sanitaire des Aliments, Laboratorie d’Etudes et de Recherches Avicoles Porcines et Piscicoles - Unité de Virologie et Immunologie Porcines, Laboratorie National de Référence pour les Pestes Porcines, Zoopôle, 22440 Ploufragan, France b
a b s t r a c t Article history: Received 1 October 2008 Received in revised form 24 January 2009 Accepted 5 February 2009 Available online 12 February 2009 Keywords: Classical swine fever virus Multiplex real-time RT-PCR C-strain Genetic differentiation of vaccinated from infected animals Candidate marker vaccine CP7 E2alf
Classical swine fever (CSF) is one of the most important diseases of pigs. Although prophylactic vaccination is banned within the European Union, emergency vaccination, allowing differentiation of vaccinated from infected animals, is an option for disease control. Up to now, these strategies are based on antibody detection. In this context, conventional modified live vaccines are not suitable. A promising perspective could be genetic differentiation of vaccinated from infected animals where field virus strains are differentiated from vaccine viruses by sequence differences. This concept could also be used with marker vaccines. To this end, a set of real-time reverse transcription-polymerase chain reaction (RT-PCR) assays was developed and validated. Specific primers and probes were designed for detection of the C-strain “Riems” vaccine virus or the chimeric marker vaccine candidate CP7 E2alf. A heterologous internal positive control was also included. The assays were then multiplexed to detect simultaneously either CSF field virus, C-strain “Riems”, and the internal control or CSF field virus, CP7 E2alf, and the internal control. To validate both systems, samples from vaccination/challenge trials were tested. Only samples from vaccinated animals were found to be positive, while all samples from wild type virus-infected animals and a broad test panel of different pestiviruses were negative. Field application of the “C-strain Riems” specific assay was proven with wild boar samples from surveillance programs in Germany and France. In conclusion, ready-to-use RT-PCR sets are presented as reliable tools for genetic differentiation of vaccinated from infected animals for CSFV eradication strategies. © 2009 Elsevier B.V. All rights reserved.
1. Introduction Classical swine fever virus (CSFV), Bovine viral diarrhea virus (BVDV) and Border disease virus (BDV) belong to the genus Pestivirus of the family Flaviviridae (Fauquet and Fargette, 2005). Pestiviruses possess a single-stranded, positive-sense RNA genome of about 12.3 kb (Meyers and Thiel, 1996). Because of high infectivity, pathogenicity and restriction measures for infected herds and regions, classical swine fever (CSF) can cause significant economic losses in industrialized pig productions (Edwards et al., 2000; Vandeputte and Chappuis, 1999). The recent German CSF outbreak in 2006 was, e.g. caused by a highly virulent CSFV of subtype 2.3 (Depner et al., 2007a). Within the European Union (EU), CSF control is based on a stamping out strategy without prophylactic vaccination. In case
∗ Corresponding author. Tel.: +49 38351 7 200; fax: +49 38351 7 151. E-mail address: Martin.Beer@fli.bund.de (M. Beer). 0166-0934/$ – see front matter © 2009 Elsevier B.V. All rights reserved. doi:10.1016/j.jviromet.2009.02.002
of large outbreaks, this policy often results in a vast number of culled animals not only from infected herds but also from the established restriction zones (Edwards et al., 2000). Although prophylactic vaccination is banned, emergency vaccination following an EU approved emergency vaccination plan is possible (Anon., 2001) and may help to reduce the spread of virus as well as the number of culled animals. Nevertheless, vaccination areas are placed under extensive restrictions. Only if a marker vaccine is used which allows differentiation of infected from vaccinated animals, derogations can be made. So far, differentiation of vaccinated from infected animals strategies are based solely on serological tests detecting antibodies against field CSFV. The only CSFV marker vaccine available commercially is based on baculovirus-expressed envelope protein E2, and the accompanying marker assays detect antibodies specific for the envelope protein ERNS (Blome et al., 2006; Dong and Chen, 2007). In the context of emergency vaccination, the vaccine employed must provide rapid and solid horizontal and vertical protection. Modified live vaccines such as “C-strain Riems” meet these
I. Leifer et al. / Journal of Virological Methods 158 (2009) 114–122
demands (Anon., 2003) and are used currently for bait vaccination campaigns in European wild boar populations (Germany, France, Romania, and Slovakia) and as part of an emergency vaccination program for domestic pigs in Romania. Worldwide, several modified live vaccine strains are used. Most modified live vaccines are based on either the ‘Chinese’ (C) strain, or on the cell culture adapted Japanese guinea-pig exaltation-negative (GPE−) strain, or on the French cell culture adapted Thiverval strain (Blome et al., 2006; Greiser-Wilke and Moennig, 2004; Van Oirschot, 2003). There is no legal obligation to use any particular strain, however, extensive data exist mainly for the C-strain vaccines. Regarding bait vaccination, reliable data so far have been collected only for the “C-strain Riems” (Brauer et al., 2006; Faust et al., 2007; Kaden et al., 2000, 2001, 2002, 2003, 2004a,b, 2005, 2006, 2008; Kaden and Lange, 2001, 2004; von Rueden et al., 2008). Nevertheless, the ideal vaccine should also have marker properties. Unfortunately, none of the current C-strain vaccines allows serological differentiation of vaccinated from infected animals. In contrast, E2 subunit marker vaccines available currently are suitable for serological differentiation of vaccinated from infected animals but lack properties such as rapid and complete protection after administration of a single vaccine dose or suitability for oral administration (Anon., 2003). Therefore, a promising solution could be the use of a so-called genetic differentiation of vaccinated from infected animals, where differentiation is based on genome sequence varieties between vaccine strains and field viruses (Beer et al., 2007). Novel marker vaccine candidates that would allow both genetic and serological differentiation of vaccinated from infected animals are chimeric pestiviruses such as CP7 E2alf (Beer et al., 2007; Dong and Chen, 2007; Reimann et al., 2004; Wehrle et al., 2007; Koenig et al., 2007b). These candidate vaccines would combine the marker aspect with all the advantages of a modified live vaccine. However, genetic differentiation of infected from vaccinated animals would also be possible with conventional modified live vaccines differentiating vaccinated from infected animals by real-time reverse transcription-polymerase chain reaction (RT-PCR). Thus, for genetic differentiation of vaccinated from infected animals, vaccine virus-specific real-time RT-PCR protocols are necessary. In this context, a multiplex real-time RT-PCR system for detection and differentiation of the Chinese vaccine strain (Shimen/HVRI AY775178) from field strains has been recently reported (Zhao et al., 2008). However, due to sequence differences, this detection system cannot be used for CSF vaccine strains used in Europe. The development of a uniform system for all vaccine strains applied seems impossible. Within the EU, “C-strain Riems” is one of the major vaccine strains and thus, a number of primer sets were tested using different approaches to establish a reliable system for genetic differentiation of the C-strain “Riems”. For CP7 E2alf, genetic differentiation of infected from vaccinated animals was reported based on a combination of CSFV- and panpesti-specific real-time RTPCRs. To optimize genetic discrimination of CP7 E2alf-vaccinated from CSFV field strain-infected pigs, an additional CP7 E2alf specific real-time RT-PCR protocol was designed and validated. Finally, the real-time PCR sets were validated both with analytical samples as well as with diagnostic materials. 2. Materials and methods
115
standard protocols (cell culture collection of veterinary medicine, Friedrich-Loeffler-Institut, Insel Riems, Germany). For the C-strain specific protocol, tissue samples from different infection trials carried out at the Friedrich-Loeffler-Institut and the Agence Franc¸aise de Sécurité Sanitaire des Aliments were used for test validation. Samples were taken from animals vaccinated with the C-strain as well as from animals infected with CSFV (strains “Koslov” and “Bas-Rhin”, respectively) at different time points (Koenig et al., 2007a; Reimann et al., 2004). For all samples known PCR results where available, obtained by already established and field-tested CSFV specific PCR protocols (Hoffmann et al., 2005; Depner et al., 2006; Depner et al., 2007b; Le Dimna et al., 2008). The CP7 E2alf specific assay was tested with several tonsil samples from animals vaccinated experimentally (data not shown). All samples had known preliminary results regarding a panpestispecific RT-PCR (Hoffmann et al., 2006) and were taken at different time points after vaccination. Three samples taken at 6, 17, and 24 days post-vaccination, respectively, were positive (Koenig et al., 2007a). In addition, RNA was extracted from the C-strain and the CP7 E2alf vaccine virus containing cell culture supernatants (Reimann et al., 2004). The extracted RNAs were diluted 10-fold serially to analyse the analytical sensitivity of the real-time RT-PCR systems. Within work-package 4.1 (“Real-time PCR diagnostics”) of the EU-funded EPIZONE project, a so-called ‘EPIZONE REFERENCE RNA’ panel was developed for the comparison, standardization and validation of molecular pestivirus assays (Hoffmann et al., unpublished data). The panel incorporates a representative collection of CSFVRNA of the most relevant genotypes as well as members of related pestiviruses (BDV, BVDV, and atypical pestiviruses). The ‘EPIZONE REFERENCE RNA’ panel comprises currently 30 different pestiviral RNAs from cell culture supernatants with about 1000 genome copies per l. The viral RNAs were diluted and aliquoted in RNA safe buffer-RSB consisting of 50 ng/l carrier polyA-RNA (RNAHomopolymer, #27-4110-01, Amersham Biosciences), 0.05% Tween 20, and 0.05% sodium azide in RNase free water. Aliquots were then stored at −80 ◦ C for long-term use. In order to prove application in the field, routine diagnostic samples from German and French wild boar were tested with the C-strain “Riems” specific RT-PCR. German samples (blood, tonsil, and lymph node) originated from a C-strain vaccination area in Rhineland Palatinate, and were known to contain C-strain viral RNA (confirmed by CSFV specific real-time RT-PCR and subsequent sequencing at the German National Reference Laboratory for CSF). French spleen samples originated from the Northern Vosges region (Pol et al., 2008), where oral vaccination has been carried out for 3 years. Eight out of nine French samples were found positive by a commercial real-time RT-PCR (TaqVet-CSF kit; LSI, Lyon, France) at the French National Reference Laboratory for CSF. 2.2. RNA isolation Viral RNA from cell culture or serum samples was extracted with the QIAamp Viral RNA Kit (Qiagen GmbH, Hilden, Germany), and from tissues samples using the RNeasy Mini Kit (Qiagen GmbH, Hilden, Germany) according to the manufacturer’s instructions. The protocols were modified by the addition of an internal control RNA (IC2) as described previously (Hoffmann et al., 2006).
2.1. Samples 2.3. Primer and probe selection All viruses (BDV, BVDV, CSFV strains and chimeric Pestivirus CP7 E2alf) were obtained from the German National Reference Laboratory for CSF. CSFV strains were cultured using porcine kidney cells (PK15), BVDV and BDV were propagated on bovine kidney cells (MDBK) or sheep thymus cells (SFT), respectively, according to
According to the NCBI database, 28 different complete CSFV genome sequences were aligned by using the ClustalW2 (EMBL-EBI) (Larkin et al., 2007) and BioEdit software (IBIS Biosciences Carlsbad, USA). For primer and probe selection, the beacon designer
116
I. Leifer et al. / Journal of Virological Methods 158 (2009) 114–122
Table 1 Primers and probes used for the different real-time RT-PCR protocols. Name of primer
Sequence of primer
Information
C-strain 1625-F (forward primer) C-strain 1702-R (reverse primer) C-strain 1652-FAM (FAM labeled probe)
ATAGAGAGCCCATGTAATTTCAATA CTGGAGCAAACTGCCGCT TCCGTGGAGGATACCTTGTATGGGGATC
Under research
Panpesti BVD 190-F (forward primer) Panpesti ML 121 (reverse primer) Panpesti probe TET 1
GRAGTCGTCARTGGTTCGAC TCAACTCCATGTGCCATGTAC TGCYAYGTGGACGAGGGCATG
CP7E2alf-insF (forward) CP7E2alf-insR (reverse) CP7E2alf-v2-FAM (FAM labeled probe)
TCCTGTGGCTAATAGTGACCT CCACTTCAACACTGTCATGTG TCGCCGCTGGTTACGTAGTCCAGTAT
CSF 100F (forward) CSF192R (reverse) CSF 1-TEX (TEX labeled probe)
ATGCCCAYAGTAGGACTAGCA CTACTGACGACTGTCCTGTAC TGGCGAGCTCCCTGGGTGGTCTAAGT
5.0 was used (Premier Biosoft International, Palo Alto, USA). Oligonucleotides (Table 1) were synthesized by biomers.net (Ulm, Germany) and Eurogentec (Eurogentec GmbH, Cologne, Germany). For the C-strain “Riems” specific assay, primers “C-strain 1625F” and “CSF-strain 1702-R” were selected in the ERNS encoding genome region of C-strain “Riems” (NCBI entry number AY259122) as depicted in Fig. 1a. They amplified a 77 bp fragment (nucleotides 1625–1702 of AY259122) detected by the FAM-labeled probe “Cstrain 1652-FAM”. Sequences of the selected primers and probes are shown in Table 1. From an alignment of the CP7 E2alf sequence with different pestiviruses, a primer/probe combination was chosen to detect specifically CP7 E2alf (Fig. 1b and Table 1). These primers amplify a 125 bp fragment at the cloning site between the E2 protein of CSFV strain Alfort and the p7 protein of BVDV backbone strain CP7 (nucleotides 3526–3651 of CP7 E2alf, see Table 1) (Reimann et al., 2003). The reverse primer is specific for BVDV; therefore, amplification of CSFV RNA is excluded. For the 24 bp FAM labeled probe, a specific genomic region was chosen whose sequence does not exist in any wild type pestivirus. It enables specific amplicon detection (Table 1). 2.4. Real-time RT-PCR (rRT-PCR) A one-step rRT-PCR protocol was established by using the Superscript III One-Step RT-PCR Kit (Invitrogen GmbH, Karlsruhe, Germany). The assay was optimized for 25 l total reaction volume. The PCR master mix for duplex rRT-PCR contained 12.5 l 2× RT-PCR reaction mix, 1 l Superscript III enzyme mix, 2 l CSF mix 1.-TEX (20 pmol reverse and forward primer, 2.5 pmol TEX-labeled probe), 2.5 l Rnase free water, 5 l template RNA, and 2 l C-strain mix 1-FAM (20 pmol reverse and forward primer, 2.5 pmol FAM labeled probe) or, CP7 E2alf mix 1-FAM (20 pmol reverse and forward primer, 2.5 pmol FAM labeled probe), respectively. Real-time RT-PCR was carried out in an Mx3005pro cycler (Stratagene, La Jolla, USA). Reverse transcription was performed for 30 min at 50 ◦ C following 2 min at 94 ◦ C. DNA amplification was carried out over 42 cycles of 15 s 94 ◦ C (DNA denaturation), 30 s 59 ◦ C (annealing, fluorescence data collection), and 30 s 68 ◦ C (elongation). To allow multiplexing, the temperature profile was chosen in accordance with the CSFV- and panpesti-specific RT-PCR protocols previously published by Hoffmann et al. (2005, 2006). These assays contained a simultaneously amplified internal control that consists of a heterologous transcript (Hoffmann et al., 2006). To obtain the preliminary test results of samples from CP7 E2alf vaccinated animals, and for the ‘EPIZONE REFERENCE RNA’ panel, a panpesti-specific assay described previously was used (Hoffmann et al., 2006).
Published by Hoffmann et al. (2006) Modified TET labeled probe
Under research Published by Hoffmann et al. (2005) Modified TEX labeled probe
3. Results 3.1. C-strain specific rRT-PCR Analytical sensitivity was determined using a 10-fold dilution series containing C-strain positive RNA derived from the ‘EPIZONE REFERENCE RNA’, according to the protocol of Hoffmann et al. (2005, 2006). It was shown that the detection limit was six dilution steps of the used standard, and the detection limit of the control RNA goes linearly down to 101 copies/well with an efficiency of 102.6%. The Ct-values of the detected dilutions ranged between 23 and 39.5 (see Figs. 2a and 3a). In order to estimate specificity, a test panel of 30 pestiviral RNAs (‘EPIZONE REFERENCE RNA’) was used. The panel consisted of 13 CSFV strains including the C-strain, 4 BDV strains, 8 BVDV-1 strains, 5 BVDV-2 strains, and the chimeric pestivirus CP7 E2alf. Whereas the C-strain “Riems” RNA was detected, all other CSFV, BDV, and BVDV RNAs as well as the chimeric pestivirus RNA were negative (Table 2). In addition, samples were examined from vaccinated pigs of different animal experiments carried out at the Institute of Diagnostic Virology, Friedrich-Loeffler-Institut, Insel Riems, Germany, or at Agence Franc¸aise de Sécurité Sanitaire des Aliments, Ploufragan, France. C-strain specific viral RNA was detected in different tissues such as tonsils, blood and spleen of vaccinated pigs with Ct-values of about 22.0–38.0 (Table 3). To demonstrate application in the field, routine diagnostic specimens from wild boar were investigated. The samples were sent to the German and French National Reference Laboratory for CSF (blood and tissue samples). Most German samples originated from regions where wild boar vaccination has been implemented recently and which were positive previously by CSFV and/or panpesti-specific rRT-PCRs. C-strain viral RNA was detected in all samples with a positive CSF- or panpesti-specific rRT-PCR result with Ct-values between 32.7 and 35.2 (Table 3). Eight out of nine French spleen samples were found to be positive by a commercial real-time RT-PCR kit. Five of these positive samples were also positive using the C-strain specific protocol with Ct-values ranging from 34.8 to 40.7 (Table 3). These organs were obtained from wild boars shot just 1 week after C-strain vaccine bait distribution. 3.2. CP7 E2alf specific rRT-PCR The analytical sensitivity of the CP7 E2alf rRT-PCR was determined according to the same procedure as described for the C-strain specific rRT-PCR. To this end, a 10-fold dilution series of a positive RNA standard, obtained after extraction of CP7 E2alf viral RNA from cell culture supernatant was used. The CP7 E2alf specific rRT-PCR
Table 2 Real-time RT-PCR results of all tested protocols. A reference RNA panel (‘EPIZONE REFERENCE RNA’) was used for comparison of sensitivity and specificity of the single rRT-PCR assays with the duplex rRT-PCR systems.
I. Leifer et al. / Journal of Virological Methods 158 (2009) 114–122 117
118
I. Leifer et al. / Journal of Virological Methods 158 (2009) 114–122
Fig. 1. (a) Multi-alignment of 28 different CSFV genomes (NCBI database entries). For alignment, ClustalW2 and BioEdit Software were used. Primers and probe specific for C-strain Riems (NCBI database entry AY259122.1) were selected in the ERNS region (nucleotides 1625–1702). (b) Multi-alignment of 28 different CSFV genomes (NCBI database entries) and CP7 E2alf (red color). For the alignment ClustalW2 and BioEdit Software were used. Primers and probe specific for the CP7 E2alf chimeric pestivirus construct were selected at the cloning site between the region coding for the E2 protein of CSFV strain Alfort and the p7 protein of BVDV backbone strain CP7. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of the article.)
detected six dilution steps of the standard tested (Figs. 2b and 3b). Fig. 3b shows the standard curve of the dilution series. The efficiency of the rRT-PCR was 99.6%, and the detection limit for the positive control RNA scored with 101 copies/well. The Ct-values for the dilution series ranged from 19 to 36. All experimental samples which were positive by a preliminary test status could be detected. The above RNA panel was used again to estimate specificity. While the CP7 E2alf RNA was detected reliably, none of the other pestiviral RNAs gave a positive result (Table 2). 3.3. Multiplex rRT-PCRs (duplex or triplex systems) In order to allow simultaneous detection, the vaccine virusspecific rRT-PCRs were combined with each other and a rRT-PCR protocol for detecting field virus. The field virus detecting protocol
contained the internal control system and was used as such. It was shown that the C-strain specific rRT-PCR as well as the CP7 E2alf specific rRT-PCR could be carried out as duplex (Table 3) or triplex rRT-PCR (data not shown) together with the modified CSF specific rRT-PCR protocol according to Hoffmann et al. (2005, 2006), including the internal control (IC2) specific rRT-PCR as published previously. Comparison of single and duplex assays based on the ‘EPIZONE REFERENCE RNA’ panel showed no noticeable influence on specificity and sensitivity. The C-strain specific and the CP7 E2alf specific rRT-PCR detected only the corresponding vaccine virus and no other pestiviruses of the test panel. The CSFV specific rRT-PCR detected all CSFV strains and no other pestivirus strains of the test panel. The difference of the Ct-values of the single and the multiplex assays was in all cases less than 1 or 2 Ct values. Comparative results are shown in Table 2.
I. Leifer et al. / Journal of Virological Methods 158 (2009) 114–122
119
Fig. 2. (a and b) Standard curve of C-strain (a) and CP7 E2alf (b) real-time RT-PCR amplification plots. Tenfold dilution series of RNA derived from extraction of viral RNA from cell culture supernatant of CP7 E2alf transfected cells.
Table 3 C-strain specific real-time RT-PCR results of different samples from animal trials and wild boars from regions with oral C-strain vaccination programs. Both the sample material (blood or organs) and the corresponding Ct-values are listed. Sample Tonsil after oral vaccination (animal trial) Tonsil after intramuscular vaccination (animal trial) Tonsil after intramuscular vaccination (animal trial) Tonsil after intramuscular vaccination (animal trial) Blood (German wild boar field sample) Blood (German wild boar field sample) Tonsil (German wild boar field sample) Lymph node (German wild boar field sample) Tonsil animal trial France (C-strain) Tonsil animal trial France (C-strain) Tonsil animal trial France (C-strain) Tonsil animal trial France (C-strain) Spleen animal trial France (C-strain) Spleen animal trial France (C-strain) Spleen animal trial France (C-strain) Spleen animal trial France (C-strain) Spleen field sample France northern Vosges (C-strain) Spleen field sample France northern Vosges (field virus) Spleen field sample France northern Vosges (negative) Spleen field sample France northern Vosges (C-strain) Spleen field sample France northern Vosges (C-strain) Spleen field sample France northern Vosges (C-strain) Spleen field sample France northern Vosges (C-strain) Spleen field sample France northern Vosges (field virus) Spleen field sample France northern Vosges (field virus) a b c
Panpesti rRT-PCR (Hoffmann et al., 2006). CSFV-rRT-PCR (Hoffmann et al., 2005). CSFV-rRT-PCR (LSI, Lyon, France).
Ct-value CSFV rRT-PCR a
>42 38.77a 36.04a 36.35a 36.02b 27.72b 38.41b 35.06b 23.22c 33.12c 30.69c 31.11c 36.48c 34.79c 38.87c >42c 37.31c 37.3c >42c 37.11c 35.98c 39.34c 39.37c 39.54c 37.92c
Ct-value C-strain specific rRT-PCR 37.95 36.31 36.85 33.19 33.73 32.74 35.22 34.41 21.99 32.54 28.36 35.20 36.77 32.59 28.51 >42 36.50 >42 >42 34.79 35.85 40.67 37.20 >42 >42
120
I. Leifer et al. / Journal of Virological Methods 158 (2009) 114–122
Fig. 3. (a and b) Analytical sensitivity based on a 10-fold dilution series of viral RNA. Standard curve graph for the C-strain (a) and CP7 E2alf (b) real-time RT-PCR.
4. Discussion The possibility of differentiating infected from vaccinated animals is a key prerequisite for CSF emergency vaccination strategies within the EU. A promising solution could be the use of a so-called genetic differentiation of vaccinated from infected animals, where differentiation is based on genome sequence variations between vaccine strains and field viruses (Beer et al., 2007). Genetic differentiation of vaccinated from infected animals could also be applied to novel marker vaccine candidates such as the chimeric pestivirus CP7 E2alf. Chimeric pestiviruses would allow both genetic and serological differentiation of infected from vaccinated animals and thus combine the marker aspect with all advantages of a modified live vaccine. However, for genetic differentiation of vaccinated from infected animals, reliable vaccine virus-specific rRT-PCR protocols are necessary. Based on the Chinese CSFV vaccine strains, different RT-PCR assays have been published (Li et al., 2007; Peng et al., 2007; Zhao et al., 2008), and another assay was developed for the Korean variation (Cho et al., 2006). In addition, Zaberezhny et al. (1999) combined a RT-PCR assay with restriction fragment length polymorphism (RFLP) to discriminate field viruses from Russian vaccine strains. Because of sequence differences, none of these systems is applicable for the European C-strain “Riems” vaccine. The present study was undertaken to develop and validate real-time RT-PCR protocols for differentiation of CSF field virus infected from C-strain “Riems”or CP7 E2alf-vaccinated pigs. For detection of C-strain “Riems” vaccine virus a specific and sensitive real-time RT-PCR system was developed. With a reference panel of 30 different pestiviral RNAs we could demonstrate the
specificity of the new rRT-PCR. Except for the vaccine virus, none of the pestiviruses tested was detected by the C-strain specific PCR system. Analytical sensitivity was estimated using dilution series. It was shown that six 10-fold dilution steps were detected by the new system. In order to confirm the practicability of the new PCR assay in the field, well characterized samples from different animal experiments carried out at the Friedrich-Loeffler-Institut or the Agence Franc¸aise de Sécurité Sanitaire des Aliments were tested. The Cstrain vaccine virus was detected in organs after oral as well as after intramuscular immunisation in accordance with the respective preliminary report. Furthermore, routinely collected wild boar samples were tested (blood, spleen, lymph nodes, and tonsil) from different regions in western parts of Germany and North-eastern France where oral vaccination of wild boar were carried out recently. All samples had been sent to the National Reference Laboratories for CSF for confirmatory testing and exclusion of CSF field virus infection. Most of these samples were positive by CSFV specific real-time RT-PCRs and were subjected subsequently to the new C-strain specific rRT-PCR assay developed in this study. All samples which were found to contain the C-strain genome by sequencing were also detected by our C-strain specific rRT-PCR protocol proving reliability of the new test system. Reliable results were also obtained with French samples. Surprisingly, vaccine virus could also be detected in some field blood samples from Germany with quite low Ct-values (Table 3). This contradicts the common expert opinion and experience that the C-strain “Riems” is found rarely in blood samples and, if it is detected, with very high Ct-values. It has been considered if genetic differentiation of vaccinated from infected animals is possible and necessary at all, as the C-strain “Riems” vaccine virus as well as the new chimeric marker vaccine candidates rarely, if ever,
I. Leifer et al. / Journal of Virological Methods 158 (2009) 114–122
induce detectable viraemia as was shown by Koenig et al. (2007a). In experimental settings, the vaccine virus was only found in tonsils for a longer period. Nevertheless, the results of the present study with routine field samples show that it is necessary to have an easy to handle and rapid C-strain specific “backup system”, especially in areas with wild boar vaccination. Although the C-strain “Riems” vaccine induces virtually sterile immunity after a short time period (Anon., 2003), it must be stated that in the very unlikely event of a CSF field virus infection shortly after C-strain vaccination, the new rRT-PCR might fail to discriminate clearly between C-strain vaccinated pigs and pigs infected with a field virus after vaccination. This would, however, only be the case if the copy numbers of both wild CSFV and C-strain are nearly identical. So far, all attempts to develop an rRT-PCR system which detects only CSFV field strains and excludes the vaccine C-strain “Riems” failed. Nevertheless, combination of the new C-strain “Riems” specific rRT-PCR with sequencing will ensure that these animals are identified. Implementation of chimeric marker vaccines such as the chimeric Pestivirus CP7 E2alf for vaccination would circumvent even these very unlikely problems. In this study a highly sensitive real-time RT-PCR was developed which can discriminate clearly between CP7 E2alf and CSFV field strain RNAs. By testing 10-fold dilution series, field samples and RNAs of more than 30 different pestiviruses, the sensitivity and specificity of the new PCR system was demonstrated. CP7 E2alf is just as difficult to find in organ samples as the C-strain “Riems” (Koenig et al., 2007a). Therefore, only a very limited number of positive materials was obtained from animal trials. These samples were detected reliably (data not shown). However, field experience with the C-strain “Riems” vaccine shows that the novel marker vaccine might behave slightly differently under suboptimal field conditions and a specific confirmatory method would be valuable. In summary, discrimination of CSF vaccine strains from field viruses is possible by specific real-time RT-PCRs. A distinct system for genetic differentiation of vaccinated from infected animals could be established for C-strain vaccine “Riems” and the promising marker vaccine candidate CP7 E2alf. Together with serological methods such as the ERNS specific ELISAs, discrimination between vaccinated pigs and infected pigs would no longer be a problem with the new generation of CSFV marker vaccines. Based on this concept, political and economical vaccine restrictions during CSFV outbreaks in the EU could be reconsidered. Acknowledgements We thank Ulrike Polenz for excellent technical assistance, the state veterinary service of Rhineland Palatinate and the French National Reference Laboratory for supplying field samples, and the EU Network of Excellence, EPIZONE (Contract No. FOOD-CT-2006016236) as well as the EU project “CSF Vaccine and Wild Boar” (SSPE-CT-2003-501559) for financial support. References Anon., 2001. Council directive 2001/89/EC of 23 October 2001 on community measures for the control of classical swine fever. Off. J. Eur. Commun. L316, 5–35. Anon., 2003. Diagnostic techniques and vaccines for foot-and-mouth disease, classical swine fever, avian influenza and some other important OIE list a diseases. Report of the Scientific Committee on Animal Health and Animal Welfare Adopted 24–25th April 2003, pp. 1–150. Beer, M., Reimann, I., Hoffmann, B., Depner, K., 2007. Novel marker vaccines against classical swine fever. Vaccine 25 (30), 5665–5670. Blome, S., Meindl-Bohmer, A., Loeffen, W., Thuer, B., Moennig, V., 2006. Assessment of classical swine fever diagnostics and vaccine performance. Rev. Sci. Technol. 25 (3), 1025–1038. Brauer, A., Lange, E., Kaden, V., 2006. Oral immunisation of wild boar against classical swine fever: uptake studies of new baits and investigations on the stability of lyophilised C-strain vaccine. Eur. J. Wildl. Res. 52 (4), 271–276.
121
Cho, H.S., Park, S.J., Park, N.Y., 2006. Development of a reverse-transcription polymerase chain reaction assay with fluorogenic probes to discriminate Korean wild-type and vaccine isolates of Classical swine fever virus. Can. J. Vet. Res. 70 (3), 226–229. Depner, K., Bunzenthal, C., Heun-Münch, B., Strebelow, G., Hoffmann, B., Beer, M., 2006. Diagnostic evaluation of a real-time RT-PCR assay for routine diagnosis of classical swine fever in wild boar. Journal of Veterinary Medicine Series BInfectious Diseases and Veterinary Public Health 53, 317–320. Depner, K., Allmann, R., Utke, K., von Felbert, I., Lange, E., Hoffmann, B., Beer, M., 2007a. Der Verlauf der klassischen Schweinepest: Ein Infektionsversuch mit dem aktuellen Schweinepest-Virusisolat aus Nordrhein-Westfalen (Kreis Borken). Tierärztl. Umschau 62, 192–195. Depner, K., Hoffmann, B., Beer, M., 2007b. Evaluation of real-time RT-PCR assay for the routine intra vitam diagnosis of classical swine fever. Veterinary Microbiology 121, 338–343. Dong, X.N., Chen, Y.H., 2007. Marker vaccine strategies and candidate CSFV marker vaccines. Vaccine 25 (2), 205–230. Edwards, S., Fukusho, A., Lefevre, P., Lipowski, A., Pejsak, Z., Roehe, P., Westergaard, J., 2000. Classical swine fever: the global situation. Vet. Microbiol. 73 (2/3), 103–119. Fauquet, C.M., Fargette, D., 2005. International committee on taxonomy of viruses and the 3,142 unassigned species. Virol. J. 2, 64. Faust, A., Lange, E., Kaden, V., 2007. Efficacy of lyophilised C-strain vaccine after oral immunisation of domestic pigs and wild boar against classical swine fever: first results. Dtsch. Tierarztl. Wochenschr. 114 (11), 412–417. Greiser-Wilke, I., Moennig, V., 2004. Vaccination against classical swine fever virus: limitations and new strategies. Anim. Health Res. Rev. 5 (2), 223–226. Hoffmann, B., Beer, M., Schelp, C., Schirrmeier, H., Depner, K., 2005. Validation of a real-time RT-PCR assay for sensitive and specific detection of classical swine fever. J. Virol. Methods 130 (1/2), 36–44. Hoffmann, B., Depner, K., Schirrmeier, H., Beer, M., 2006. A universal heterologous internal control system for duplex real-time RT-PCR assays used in a detection system for pestiviruses. J. Virol. Methods 136 (1/2), 200–209. Kaden, V., Hänel, A., Renner, C., Gossger, K., 2005. Oral immunisation of wild boar against classical swine fever in Baden-Württemberg: development of the seroprevalence based on the hunting bag. Eur. J. Wildl. Res. 51, 101–107. Kaden, V., Heyne, H., Kiupel, H., Letz, W., Kern, B., Lemmer, U., Gossger, K., Rothe, A., Bohme, H., Tyrpe, P., 2002. Oral immunisation of wild boar against classical swine fever: concluding analysis of the recent field trials in Germany. Berl Munch. Tierarztl. Wochenschr. 115 (5/6), 179–185. Kaden, V., Lange, B., 2001. Oral immunisation against classical swine fever (CSF): onset and duration of immunity. Vet. Microbiol. 82 (4), 301–310. Kaden, V., Lange, E., 2004. Development of maternal antibodies after oral vaccination of young female wild boar against classical swine fever. Vet. Microbiol. 103 (1/2), 115–119. Kaden, V., Lange, E., Fischer, U., Strebelow, G., 2000. Oral immunisation of wild boar against classical swine fever: evaluation of the first field study in Germany. Vet. Microbiol. 73 (2/3), 239–252. Kaden, V., Lange, E., Muller, T., Teuert, J., Teifke, J.P., Riebe, R., 2006. Protection of gruntlings against classical swine fever virus-infection after oral vaccination of sows with C-strain vaccine. J. Vet. Med. B: Infect. Dis. Vet. Public Health 53 (10), 455–460. Kaden, V., Lange, E., Riebe, R., Lange, B., 2004a. Classical swine fever virus Strain ‘C’. How long is it detectable after oral vaccination? J. Vet. Med. B: Infect. Dis. Vet. Public Health 51 (6), 260–262. Kaden, V., Lange, E., Steyer, H., 2004b. Does multiple oral vaccination of wild boar against classical swine fever (CSF) have a positive influence on the immunity? Dtsch. Tierarztl. Wochenschr. 111 (2), 63–67. Kaden, V., Lange, E., Steyer, H., Lange, B., Klopfleisch, R., Teifke, J.P., Bruer, W., 2008. Classical swine fever virus strain “C” protects the offspring by oral immunisation of pregnant sows. Vet. Microbiol. 130 (1-2), 20–27. Kaden, V., Renner, C., Rothe, A., Lange, E., Hanel, A., Gossger, K., 2003. Evaluation of the oral immunisation of wild boar against classical swine fever in BadenWurttemberg. Berl Munch. Tierarztl. Wochenschr. 116 (9/10), 362–367. Kaden, V., Schurig, U., Steyer, H., 2001. Oral immunization of pigs against classical swine fever. Course of the disease and virus transmission after simultaneous vaccination and infection. Acta Virol. 45 (1), 23–29. Koenig, P., Hoffmann, B., Depner, K.R., Reimann, I., Teifke, J.P., Beer, M., 2007a. Detection of classical swine fever vaccine virus in blood and tissue samples of pigs vaccinated either with a conventional C-strain vaccine or a modified live marker vaccine. Vet. Microbiol. 120 (3/4), 343–351. Koenig, P., Lange, E., Reimann, I., Beer, M., 2007b. CP7 E2alf: A safe and efficient marker vaccine strain for oral immunisation of wild boar against Classical swine fever virus (CSFV). Vaccine 25, 3391–3399. Larkin, M.A., Blackshields, G., Brown, N.P., Chenna, R., McGettigan, P.A., McWilliam, H., Valentin, F., Wallace, I.M., Wilm, A., Lopez, R., Thompson, J.D., Gibson, T.J., Higgins, D.G., 2007. Clustal W and clustal X version 2.0. Bioinformatics 23 (21), 2947–2948. Le Dimna, M., Vrancken, R., Koenen, F., Bougeard, S., Mesplede, A., Hutet, E., KuntzSimon, G., Le Potier, M.F., 2008. Validation of two commercial real-time RT-PCR kits for rapid and specific diagnosis of classical swine fever virus. J. Virol. Methods 147 (1), 136–142. Li, Y., Zhao, J.J., Li, N., Shi, Z., Cheng, D., Zhu, Q.H., Tu, C., Tong, G.Z., Qiu, H.J., 2007. A multiplex nested RT-PCR for the detection and differentiation of wild-type viruses from C-strain vaccine of classical swine fever virus. J. Virol. Methods 143 (1), 16–22.
122
I. Leifer et al. / Journal of Virological Methods 158 (2009) 114–122
Meyers, G., Thiel, H.J., 1996. Molecular characterization of pestiviruses. Adv. Virus Res. 47, 53–118. Peng, W.P., Xia, Z.H., Hou, Q., Li, N., Sun, Y., Tong, G.Z., Qiu, H.J., 2007. Differences in glycosylation of the E2 protein between virulent Shimen strain and a virulent C-strain of classical swine fever virus. Bing. Du Xue. Bao. 23 (5), 389–393. Pol, F., Rossi, S., Mesplede, A., Kuntz-Simon, G., Le Potier, M.F., 2008. Two outbreaks of classical swine fever in wild boar in France. Vet. Rec. 162 (25), 811–816. Reimann, I., Depner, K., Trapp, S., Beer, M., 2004. An avirulent chimeric Pestivirus with altered cell tropism protects pigs against lethal infection with classical swine fever virus. Virology 322 (1), 143–157. Reimann, I., Meyers, G., Beer, M., 2003. Trans-complementation of autonomously replicating Bovine viral diarrhea virus replicons with deletions in the E2 coding region. Virology 307 (2), 213–227. Van Oirschot, J.T., 2003. Vaccinology of classical swine fever: from lab to field. Vet. Microbiol. 96 (4), 367–384. Vandeputte, J., Chappuis, G., 1999. Classical swine fever: the European experience and a guide for infected areas. Rev. Sci. Technol. 18 (3), 638–647.
von Rueden, S., Staubach, C., Kaden, V., Hess, R.G., Blicke, J., Kuhne, S., Sonnenburg, J., Frohlich, A., Teuffert, J., Moennig, V., 2008. Retrospective analysis of the oral immunisation of wild boar populations against classical swine fever virus (CSFV) in region Eifel of Rhineland-Palatinate. Vet. Microbiol.. Wehrle, F., Renzullo, S., Faust, A., Beer, M., Kaden, V., Hofmann, M.A., 2007. Chimeric pestiviruses: candidates for live-attenuated classical swine fever marker vaccines. J. Gen. Virol. 88 (Pt 8), 2247–2258. Zaberezhny, A.D., Grebennikova, T.V., Kurinnov, V.V., Tsybanov, S.G., Vishnyakov, I.F., Biketov, S.F., Aliper, T.I., Nepoklonov, E.A., 1999. Differentiation between vaccine strain and field isolates of classical swine fever virus using polymerase chain reaction and restriction test. DTW Dtsch. Tierarztl. Wochenschr. 106 (9), 394–397. Zhao, J.J., Cheng, D., Li, N., Sun, Y., Shi, Z., Zhu, Q.H., Tu, C., Tong, G.Z., Qiu, H.J., 2008. Evaluation of a multiplex real-time RT-PCR for quantitative and differential detection of wild-type viruses and C-strain vaccine of Classical swine fever virus. Vet. Microbiol. 126 (1–3), 1–10.