Differentiation of the human monocyte cell line, U937, with dibutyryl cyclicAMP induces the expression of the inhibitory Fc receptor, FcγRIIb

Immunology Letters 83 (2002) 171 /179 www.elsevier.com/locate/

Differentiation of the human monocyte cell line, U937, with dibutyryl cyclicAMP induces the expression of the inhibitory Fc receptor, FcgRIIb Angus J.M. Cameron a,*, Kenneth J. McDonald a, Margaret M. Harnett b, Janet M. Allen a,1 a

Department of Medicine & Therapeutics and Division of Biochemistry & Molecular Biology, University of Glasgow, Glasgow G12 8QQ, UK b Department of Immunology, University of Glasgow, Western Infirmary, Glasgow G11 6NT, UK Received 11 February 2002; received in revised form 1 May 2002; accepted 5 May 2002

Abstract FC receptor for IgG receptor (Fcg) mediated activation of macrophages is essential for the clearance of immune complexes and control of inflammation. However, activated macrophages play an integral role in tissue destruction associated with autoimmune and inflammatory disease processes. Understanding the mechanisms which balance activating and inhibitory signals generated by immune complexes are therefore of critical importance to human disease. Here, we demonstrate that differentiation of the human monocytic U937 cell line to a macrophage phenotype with dibutyryl cyclicAMP induces both mRNA and protein expression of the inhibitory IgG receptor, FcgRIIb1. We further demonstrate that, following receptor aggregation, FcgRII transiently recruits the 5?inositol phosphatase, SHIP. These data define a role for FcgRIIb in the modulation of immune complex mediated macrophage activation in a human model system. # 2002 Elsevier Science B.V. All rights reserved. Keywords: Fc receptors; Immunoglobulins; Macrophages

1. Introduction Receptors for the constant region of IgG (Fcg receptors) play a critical role in the clearance of immune complexes, regulation of inflammation and co-ordination of the immune response [1,2]. Fcg receptors comprise a family of receptors for IgG which can be divided into three subclasses (FcgRI, FcgRII and FcgRIII), that are distinguished by affinity for ligand, monoclonal antibody recognition and tissue distribution [3]. Thus, FcgRI (CD64) is a high affinity receptor able Abbreviations: dbcAMP, dibutyryl cyclicAMP; FcgR, Fc receptor for IgG; ITAM, immunoreceptor tyrosine based activation motif; ITIM, immunoreceptor tyrosine based inhibitory motif; PLC, phospholipase C. * Corresponding author. Tel.: /44-141-330-6450; fax: /44-141339-4620 E-mail addresses: [email protected] (A.J.M. Cameron), [email protected] (J.M. Allen). 1 Present address: Inpharmatica, 60 Charlotte Street, London, W1T 2NU, UK. Tel.: /44-207-074-4600; fax: /44-207-074-4700

to bind monomeric IgG at physiological concentrations. In contrast FcgRII (CD32) and FcgRIII (CD16) isoforms bind IgG with lower affinity and thus only bind IgG in the form of immune complexes. The FcgRII receptors represent by far the most broadly expressed and functionally heterogeneous subfamily of Fc receptors [4]. At least six different isoforms of FcgRII have been described in man which arise from three genes (IIA, IIB and IIC). While the extracellular domains of these receptors display striking homology, the cytoplasmic domains bear distinct signalling motifs, thereby accounting for the functional heterogeneity of these receptors. Thus, aggregation of FcgRIIa, which is principally expressed in myeloid cells, results in an array of responses, including PLCg activation, calcium mobilisation, phagocytosis and activation of the respiratory burst [1,5,6]. These responses have been attributed to the presence of an immunoreceptor tyrosine based activation motif (ITAM) within its cytoplasmic tail responsible for recruitment and activation of non-receptor tyrosine kinases and subsequent initiation of signal

0165-2478/02/$ - see front matter # 2002 Elsevier Science B.V. All rights reserved. PII: S 0 1 6 5 - 2 4 7 8 ( 0 2 ) 0 0 1 1 8 - 9

172

A.J.M. Cameron et al. / Immunology Letters 83 (2002) 171 /179

transduction [7,8]. In contrast, FcgRIIb couples to an inhibitory signalling pathway. The inhibitory role of FcgRIIb has been extensively studied in B-cells and mast cells where coaggregation with the B-cell antigen receptor or FcoRI respectively results in downregulation of activatory responses [9,10]. This function has been mapped to a cytoplasmic immunoreceptor tyrosine based inhibitory motif (ITIM) [11,12]. In B-cells and mast cells, co-crosslinking of FcgRIIb with either the BCR or FcoRI results in phosphorylation of the ITIM tyrosine to create a docking site for the SH2 containing inositol phosphatase, SHIP [9,13]. The human monocytic cell line, U937, has been widely used as a functional model for monocytes and treatment of these cells with dibutyryl cyclicAMP (dbcAMP) allows controlled differentiation to a more macrophage phenotype [14,15]. It is well established that differentiation of U937 cells with dbcAMP is accompanied by upregulation of FcgRII expression [15]. However, the FcgRII receptor subtypes involved in this upregulation have not been defined. Indeed previous studies reported that U937 cells do not constitutively express detectable FcgRIIb mRNA [4] or protein [16]. Here we show that dbcAMP differentiation of these cells to a more macrophage-like phenotype induces expression of both FcgRIIa and FcgRIIb. Thus, both receptor isoforms contribute to the increase in CD32 expression on the cell surface of U937 cells. Induction of FcgRIIb expression results in the recruitment of SHIP to receptor complexes following co-aggregation of FcgRIIa and FcgRIIb. These findings delineate a role for FcgRIIb in the modulation of immune complex mediated activation of human macrophages. These data also define a novel system for studying the interplay between FcgRIIa and FcgRIIb isoforms endogenously expressed within the same cell.

2. Materials and methods 2.1. Cell culture U937 cells were cultured in RPMI 1640 (Gibco) supplemented with FCS (10%), glutamine (2 mM), penicillin (10 U/ml) and streptomycin (10 mg/ml) at 37 8C, 6.8% carbon dioxide. Cells were treated with either dbcAMP (1 mM) for 48 h or with IFN-g (200 ng/ ml) for 24 h.

membranes were hybridized with specific 32P labelled probes derived by PCR from the relevant plasmid.

2.3. RT-PCR For reverse transcriptase PCR (RT-PCR), cDNA was prepared from total RNA using an Invitrogen cDNA cycle kit with oligo dT primers. PCR amplifications of cDNA aliquots were carried out in 50 ml containing 20 pmol of each appropriate primer (FcgRIIa, Primers 1 and 2; FcgRIIb, Primers 1 and 3) and 0.25 U Taq polymerase (Promega). Standard PCR amplifications were performed for 30 cycles at 93 8C for 1 min, 50 8C for 1 min and 72 8C for 1 min. All PCR products were positively identified by cloning into the pGEM T PCR (Promega) cloning vector followed by sequence analysis. For semiquantitative RT-PCR, FcgRIIa and FcgRIIb were amplified together using 20 pmol each of primers 1, 2 and 3 (Table 1). Reactions were terminated at 20 cycles at which point formation of product was shown to be linear with levels of input cDNA (data not shown). PCR products were then Southern blotted and hybridised with a pan-FcgRII specific cDNA probe and products visualised by autoradiography. In addition, bands were quantified using quantitative phosphorimaging. Levels of input cDNA were normalised between samples using the same protocol as for FcgRII but using primers specific for cyclophilin (Table 1 */primers 4 and 5).

2.4. Flow cytometry 106 cells were incubated with 5 mg/ml of anti-FcgRII monoclonal antibodies (mAbs) IV3 (Medarex) or KB61 (Dako) for 30 min on ice in the presence of 3 mM human IgG to block the ligand binding pocket of FcgRI. A FITC conjugated goat anti-mouse IgG (Sigma) was used as a secondary antibody. Cells were analysed using a Becton Dickinson FACScan. Table 1 Details of the oligonucleotide primer sequences used for RT-PCR characterisation Primer Description

Sequence

1

5? GCACAGGAAACATAGGCTACACG 5? GGTATCTTCTTAGAAAGTCCC

2.2. Northern blot analysis

2

Cells were treated with IFN-g or dbcAMP and harvested at set times. Equal quantities of total RNA (20 mg/sample) were separated using formaldehyde agarose gels and transferred to Hybond-N  nylon membranes (Amersham). Following UV cross-linking,

3 4 5

FcgRII forward primer FcgRIIa reverse primer FcgRIIb reverse primer cyclophilin forward primer cyclophilin reverse primer

5? GGTGATTGTGTTCTCAGCCCC 5? GGTGACTTCACACGCCATAATG 5? GAGTTGTCCACAGTCGGAGATG

A.J.M. Cameron et al. / Immunology Letters 83 (2002) 171 /179

173

Fig. 1. U937 cells express multiple forms of FcgRII. (A) Northern blot analysis of FcgRII expression in U937 cells. Total RNA (20 mg) was subjected to Northern analysis and hybridised with 32P-labelled cDNA probe specific for all forms of FcgRII. (B) Schematic to demonstrate positions of primers used in RT-PCR amplification of FcgRIIa and FcgRIIb (See Table 1 for primer sequences). (C) RT-PCR amplification of FcgRIIa (719 bp) and the splice variant, FcgRIIa2 (596 bp) transcripts from U937 cell cDNA. cDNA from U937 cells or COS-7 cells was amplified with primers 1 and 2 for 30 cycles, electrophoresed through 1% agarose and visualised by staining with ethidium bromide. (D) RT-PCR amplification of FcgRIIb1 (289 bp) and FcgRIIb2 (232 bp) transcripts. cDNA was amplified with primers 1 and 3 for 30 cycles as described for (C).

174

A.J.M. Cameron et al. / Immunology Letters 83 (2002) 171 /179

2.5. Fc receptor aggregation To aggregate FcgRII, cells were washed and incubated with either mAb KB61 or Fab fragments of mAb IV3 for 45 min at 4 8C. Cell were washed to remove unbound mAbs and the receptors were cross-linked by the addition of F(ab)2 fragments of goat anti-mouse IgG (1:50 dilution; Jackson Laboratories). Cells were then warmed to 37 8C for the times specified. 2.6. Immune precipitations and Western blotting Cells were lysed by the addition of ice-cold lysis buffer (1% (v/v) Triton X-100, 50 mM Tris /HCl, pH 7.5, 0.25% (w/v) sodium-deoxycholate, 150 mM NaCl, 1 mM EDTA, 1 mM vanadate and 1 mM NaF) containing protease inhibitors (1 mM phenylmethylsulfonyl fluoride and 1 mg/ml each chymostatin, leupeptin, antipain and pepstatin). Insoluble debris was removed by centrifugation at 15 000 /g for 15 min. mAb bound FcgRII was precipitated by the addition of goat antimouse IgG conjugated to agarose beads for 2 h. Precipitates were washed four times with ice cold lysis buffer and dissociated from beads by boiling in sample buffer [17]. Immune precipitates or whole cell lysates were resolved by SDS-PAGE and transferred to nitrocellulose membranes. Membranes were incubated overnight with the specified antibody and developed with an appropriate HRP conjugated secondary antibody and enhanced chemiluminescence (Amersham). 2.7. In vitro inositol phosphatase assay Hydrolysis of [3H]Ins(1,3,4,5)P4 (NEN) by immune precipitates was measured in 25 ml containing 16 mM [3H]Ins(1,3,4,5)P4, 50 mM Tris /HCl (pH 7.5), 10 mM MgCl2. Reaction mixtures were incubated, with shaking, for 10 min at 37 8C, stopped with 500 ml ice cold water, and immediately applied to 0.5 ml dowex-formate columns. [3H]Ins(1,3,4)P3 product was eluted with 6 ml 0.7 M ammonium formate, 0.1 M formic acid and nonhydrolysed [3H]Ins(1,3,4,5)P4 was eluted with 6 ml 2.0 M ammonium formate, 0.1 M formic acid [18]. Both eluted fractions were counted in a Beckman Instruments scintillation counter.

3. Results 3.1. Characterisation of FcgRII receptor mRNAs expression in undifferentiated U937 cells The expression of the different FcgRII subtypes in U937 cells was investigated by Northern analysis and RT-PCR. Hybridisation of Northern blots with a cDNA

probe consisting of FcgRII revealed a broad band at about 2.6 kb and a 1.5 kb transcript (Fig. 1A). FcgRIIa has been reported to give rise to both a 2.6 and a 1.5 kb transcript which arise from differential polyadenylation [4]. In addition, a splice variant of FcgRIIa, known as FcgRIIa2, in which the exon encoding the transmembrane domain is not expressed has also been reported and this has been shown to generate a soluble Fc receptor [19,20]. To assess whether this splice variant was present in U937 cells, specific primers for RT-PCR were designed that flank this region (Table 1 and Fig. 1B). Products of the appropriate molecular weight for both FcgRIIa and its splice variant FcgRIIa2 were obtained (Fig. 1C). Products were cloned and their nature characterised by sequence analysis which confirmed that both FcgRIIa and the splice variant, FcgRIIa2, are expressed in U937 cells (Fig. 1C). The 1.5 kb transcript is the predicted length for both FcgRIIa and FcgRIIb [4]. Under the conditions used here, the probe used to visualise the mRNAs is unable to distinguish between these two low affinity receptors. Therefore, receptor subtype specific primers were designed that would amplify only FcgRIIa or FcgRIIb (Table 1 and Fig. 1B). For this a single shared forward primer was used. For FcgRIIa, a specific reverse primer was designed that would yield a product of 719 bp. Three splice variants exist for FcgRIIb; FcgRIIb1, FcgRIIb2, and FcgRIIIb3. FcgRIIb1 and FcgRIIb3 generate an identical mature protein as they differ only in the signal sequence [4]. FcgRIIb2, however, has a shorter C terminal domain than FcgRIIb1, being generated by deletion of a single exon encoding 19 amino acids of the cytoplasmic tail [11]. For RT-PCR of FcgRIIb, a specific reverse primer was designed that lay downstream of the FcgRIIb2 splice site. Thus, the RTPCR product for FcgRIIb1 is predicted to be 289 bp in length and for FcgRIIb2 to be 232 bp. Products of the predicted length for both FcgRIIb1 and FcgRIIb2 were observed in untreated U937 cells (Fig. 1D). These products were cloned and sequenced which confirmed the identity of these products as FcgRIIb1 and FcgRIIb2. In summary, U937 cells express both FcgRIIa and its soluble splice variant FcgRIIa2. In addition, U937 cells express transcripts for the inhibitory Fcg receptor, FcgRIIb. 3.2. Differentiation of U937 cells with dbcAMP increases expression of both FcgRIIa and FcgRIIb mRNAs Changes in the expression of the various FcgRII subtypes in U937 cells in response to differentiation with dbcAMP or priming with IFNg were determined using a combination of Northern blotting and RT-PCR. Total RNA was extracted from U937 cells at various time points following treatment with either IFNg or

A.J.M. Cameron et al. / Immunology Letters 83 (2002) 171 /179

Fig. 2. Differentiation of cells with dbcAMP upregulates expression of FcgRIIa, FcgRIIa2 and FcgRIIb. (A) U937 cells were treated with either IFN-g or dbcAMP and harvested at the times shown (hours). Total RNA (20 mg/sample) was subjected to Northern blot analysis. Blots were hybridised with 32P-labelled cDNA probe specific for FcgRII. Bands were visualised by autoradiography (top panel). The bottom panel shows equal loading of total RNA as assessed by ethidium bromide staining of the RNA gel prior to blotting. The bands indicated are the 18S and 28S ribosomal subunits as indicated. (B) U937 cells were treated with either IFN-g or dbcAMP and harvested at the times shown (hours). Following preparation of cDNA by reverse transcription, PCR was used to amplify either FcgRIIa and FcgRIIb or cyclophilin as described in Section 2. PCR products were visualised by Southern blot hybridisation with a crossreactive cDNA probe for FcgRII (top panel). Cyclophilin was used as an internal standard to ensure equal loading of cDNA, as indicated. Bands were visualised by autoradiography.

dbcAMP and samples were subjected to Northern blot analysis. Hybridisation with a non-subtype selective FcgRII cDNA probe revealed that transcripts at 2.6 kb and the 1.5 kb transcripts were detectable at all time points tested following both IFNg and dbcAMP treatment (Fig. 2A). However, the relative proportions of the 2.6 and the 1.5 kb transcript differed depending on the differentiation state of the cell. Priming with IFNg led to a small transient increase in the 2.6 kb doublet but only a very small increase in the 1.5 kb transcript. Differentiation with dbcAMP led to a large increase in the levels of both the 2.6 and 1.5 kb transcripts. These increases were observed within 6 h of starting treatment with dbcAMP. Levels of both transcripts continued to rise over time and remained substantially elevated 48 h

175

after treatment. Equal loading of total RNA was assessed by ethidium bromide staining of the 18S and 28S ribosomal subunits on the RNA gel prior to blotting (Fig. 2A */lower panel). As the nature of the FcgRII receptor subtype encoded in the 1.5 kb transcript cannot be distinguished by Northern, semiquantitative RT-PCR was performed to define the nature of FcgRII subtype induced in cells differentiated with dbcAMP. RT-PCR analysis of the RNA extracted from dbcAMP differentiated cells revealed that expression of FcgRIIa, FcgRIIa2 and FcgRIIb was increased (Fig. 2B). At the lower cycle numbers required for quantitative RT-PCR, no signal could be detected for FcgRIIb2, indicating that this splice variant is likely to be expressed at much lower levels than FcgRIIb1. Thus, 24 h after starting dbcAMP, the levels of the PCR products specific for FcgRIIa and FcgRIIa2 were increased about 10-fold above undifferentiated cells (Fig. 2B). At the same time point, levels of the PCR product specific for FcgRIIb1 were increased about 20-fold above undifferentiated cells. At 48 h, levels of FcgRIIa were increased 20-fold above undifferentiated cells and levels of FcgRIIb were increased 50-fold above basal (Fig. 2B). In cells primed with IFNg, expression of either FcgRIIa or FcgRIIb as assessed by RT-PCR was unchanged. Thus, dbcAMP differentiation increases expression of both the activating receptor, FcgRIIa, and the inhibitory receptor, FcgRIIb. 3.3. FcgRIIa and FcgRIIb are both expressed on the cell surface of differentiated U937 cells The extracellular domains of FcgRIIa and FcgRIIb are almost identical [4]. As a result, the majority of mAbs specific for CD32 are unable to distinguish between the two receptor subtypes. However, the mAb IV3 has been reported to recognise only FcgRIIa [21,22] and we first exploited this fact to determine whether the differentiation dependent changes observed in mRNA expression for FcgRIIa were reflected in cell surface expression. In agreement with the changes in mRNA, cell surface expression of FcgRIIa was increased in cells differentiated for 48 hours with dbcAMP (Fig. 3A). No change in cell surface expression of FcgRIIa was observed in cells treated with IFNg. To determine whether FcgRIIb is expressed in dbcAMP differentiated cells, Western blot analysis was performed. Blots were probed with the FcgRIIb specific mAb, II8D2, that recognises the intracellular tail of FcgRIIb and shows no cross-reactivity with FcgRIIa [23]. Lysates were prepared from untreated cells and from cells treated either with IFNg (24 h) or dbcAMP (48 h). In addition, lysates from the human B cell line, EDR, were prepared as a positive control for FcgRIIb expression. Probing blots with II8D2 revealed a band of

176

A.J.M. Cameron et al. / Immunology Letters 83 (2002) 171 /179

remove unbound antibody. Following cell lysis, KB61 bound FcgRII was immune precipitated with agarose immobilised goat anti-mouse IgG and immunoprecipitates subjected to SDS-PAGE. The resultant blots were probed for FcgRIIb using the specific mAb, II8D2. A band of the correct molecular weight for FcgRIIb was recognised by II8D2 but only in cells differentiated with dbcAMP (Fig. 3C). The precipitating antibody (KB61) is also recognised by the anti-mouse secondary giving rise to the bands at the molecular weight for heavy and light chain of mouse immunoglobulin (Fig. 3C). In cells primed with IFNg, no band for FcgRIIb was observed in these immunoprecipitates (Fig. 3C). Thus, expression of the inhibitory receptor, FcgRIIb, is upregulated by dbcAMP and this receptor is expressed on the cell surface of dbcAMP differentiated U937 cells. By contrast, although low levels of FcgRIIb can be detected in lysates derived from untreated cells or cells primed with IFNg, no receptor could be detected on the cell surface. Fig. 3. Analysis of FcgRIIa and FcgRIIb protein expression. (A) FACS analysis of cell surface FcgRIIa. Untreated U937 cells and cells treated with either IFN-g (24 h) or dbcAMP (48 h) were labelled with the FcgRIIa specific mAb IV3. Human IgG (3 mM) was also added to prevent non-specific binding of antibodies to Fc receptors. A goat antimouse IgG:FITC was used as a secondary antibody and cells were subjected to FACS analysis. Control cells with no primary antibody were also included (indicated by *). (B) Western blot analysis of FcgRIIb expression in cell lysates. Cell lysates (20 mg/sample) from untreated U937 cells (control) and cells treated with either IFN-g (24 h) or dbcAMP (48 h) were subjected SDS-PAGE and Western blot analysis with the FcgRIIb specific mAb II8D2. Cell lysate (20 mg) from the EDR human B-cell line was also included as a positive control. An anti-mouse:HRP was used as a secondary antibody and bands were visualised using the ECL system (Amersham). (C) Cell surface expression of FcgRIIb. FcgRII at the cell surface was immune precipitated using the pan-FcgRII mAb KB61 as described in Section 3. Immune precipitates were subjected to Western blot analysis with the FcgRIIb specific mAb II8D2 as described for (B). The heavy and light chains of the precipitating antibody KB61, which are detected by the secondary HRP conjugate, are indicated by IgG.

the correct molecular size for FcgRIIb in all U937 cell lysates (Fig. 3B). Differentiation of cells with dbcAMP, dramatically upregulated the expression of FcgRIIb. The band for FcgRIIb detected in U937 cells was identical in molecular size to the band for FcgRIIb in EDR B-cells (Fig. 3B). As B-cells are known to predominantly express the FcgRIIb1 splice variant, this data is consistent with the RT-PCR data presented above (Fig. 2B). In the absence of an FcgRIIb specific monoclonal antibody suitable for FACS, the presence of FcgRIIb on the cell surface was measured by immunoprecipitating all surface FcgRII from intact cells and probing these immunoprecipitates for the presence of FcgRIIb using the specific mAb, II8D2. Thus, intact cells were incubated with the mAb, KB61, which recognises all FcgRII subtypes, followed by extensive washing to

3.4. FcgRII transiently recruits SHIP following immune complex activation In B cells and mast cells, FcgRIIb plays a critical inhibitory signalling role by recruiting the 5? inositol phosphatase, SHIP [9]. Having identified FcgRIIb on the surface of dbcAMP differentiated cells, we next investigated the ability of immune complex activation of FcgRII to recruit active SHIP. FcgRII on dbcAMP differentiated cells was aggregated by loading cells with the mAb, KB61 and aggregating receptor with goat anti-mouse IgG (Fab specific). Following aggregation, cells were harvested at given times and lysed. Immobilised goat anti-mouse IgG (Fc specific) was then added to the lysates to immunoprecipitate FcgRII bound to KB61. Immune precipitates were subjected to Western blotting with anti-phosphotyrosine mAbs (clone 4G10) and anti-SHIP (Santa Cruz). No tyrosine phosphorylated bands were observed in the FcgRII immunoprecipitates derived from resting cells. However, after receptor aggregation, a number of tyrosine phosphorylated bands appeared in these FcgRII immunoprecipitates, including a band for a protein of 145 kDa potentially corresponding to SHIP (Fig. 4A). Probing a parallel blot with anti-SHIP antibodies confirmed the appearance of SHIP in these FcgRII immunoprecipitates and also demonstrated that the 145 kDa tyrosine phosphorylated band migrates in the same position as SHIP. Thus, immunoreactive SHIP appeared within 30 s following receptor aggregation and remained present in the FcgRII immunoprecipitates at 2 min. Immunoreactive SHIP was no longer detectable in these immunoprecipitates 15 min after receptor aggregation.

A.J.M. Cameron et al. / Immunology Letters 83 (2002) 171 /179

177

by Western blotting. However, in contrast to dbcAMP differentiated cells, immunoreactive SHIP could not be detected in FcgRII immunoprecipitates by Western blot and no inositol phosphatase activity could be measured in these immunoprecipitates at any time point after receptor aggregation (data not shown). As IFNg primed cells compared to dbcAMP differentiated cells express no detectable FcgRIIb on their cell surface, this data implies that SHIP is recruited by FcgRIIb to the immune complexes in dbcAMP differentiated cells.

4. Discussion

Fig. 4. FcgRII recruits SHIP in dbcAMP differentiated cells. Cells were treated with dbcAMP for 48 h prior to the experiment. FcgRII was aggregated for the times indicated. Cells where no crosslinking antibody was added were included as a control. FcgRII was precipitated via KB61 using goat anti-mouse (Fc specific) IgG conjugated agarose. Immune precipitates were subjected either to Western blot analysis (A) or in vitro inositol phosphatase assays (B). For Western blot analysis (A), membranes were probed with either anti-phosphotyrosine mAb 4G10 (top panel) or goat polyclonal antiSHIP antibodies (bottom panel). For inositol phosphatase assays (B) data are the mean9/S.D. (error bars) of triplicate measurements and are representative of three separate experiments. As a positive control, SHIP was directly immune precipitated from whole cell lysates with goat anti-SHIP antibodies conjugated to agarose while unconjugated agarose was used as a negative control.

The transient association of active SHIP with FcgRII was confirmed by measuring inositol phosphatase activity in FcgRII immunoprecipitates. Thus, in resting cells, only low levels of inositol phosphatase activity could be detected in FcgRII immunoprecipitates (Fig. 4B). However, 1 min after receptor aggregation, inositol phosphatase activity could be measured in the FcgRII immunoprecipitates. Activity remained detectable at 2 min and had returned to basal levels by 15 min. Specific aggregation of FcgRII on IFNg primed cells resulted in protein tyrosine phosphorylation as observed

Expression of different subclasses of Fc receptors by myeloid cells is likely to direct the nature of cellular response to challenge with immune complex. Here, we demonstrate that differentiation of the U937 cell with dbcAMP results in the increased expression of multiple isoforms of FcgRII, including the inhibitory receptor, FcgRIIb1. In dbcAMP differentiated cells, expression of cell surface FcgRIIb was associated with recruitment of SHIP to the receptor complex following aggregation by immune complexes. In IFN-g primed U937 cells, which do not express surface FcgRIIb, no SHIP immunoreactivity or enzyme activity could be detected in receptor complexes following activation. This data implies that in dbcAMP differentiated cells, SHIP is recruited to the ITIM of FcgRIIb. It should be noted that these data do not provide unequivocal proof that SHIP is recruited exclusively by FcgRIIb, since activation of FcgRIIb requires coaggregation with FcgRIIa and receptor precipitations will inevitably contain both FcgRII isoforms. Moreover, no antibodies capable of specifically immune precipitating FcgRIIb (but not FcgRIIa) are currently available. Thus, we cannot rule out the alternative possibility that SHIP recruitment to immune complexes is, at least in part, a result of FcgRIIa upregulation in these cells. Indeed immobilized peptides corresponding to the phosphorylated ITAM of FcgRIIa have been reported to adsorb low levels of SHIP from activated U937 cell extracts [16]. However, the reported association of SHIP with immobilised phosphoITAM peptides is neglible relative to the association of SHIP with an immobilized phosphorylated ITIM peptide of FcgRIIb. Significantly, in direct contrast to the well established recruitment of SHIP to the ITIM of FcgRIIb in B-cells and mast cells, no association of SHIP with FcgRIIa has been demonstrated in intact cells. In our study we were able to coimmune precipitate SHIP with FcgRII from intact cells but only from cells expressing surface FcgRIIb. Taken together, our results strongly support recruitment to the FcgRIIb ITIM rather than to the ITAM of FcgRIIa. The role of FcgRIIb has been extensively studied in both B-cells and mast cells. The inhibitory properties of

178

A.J.M. Cameron et al. / Immunology Letters 83 (2002) 171 /179

this receptor centre round the recruitment of the 5? inositol phosphatase, SHIP [9,13,24]. In these cells, coaggregation of FcgRIIb with the ITAM of the B-cell receptor (BCR) or FcoRI results in the phosphorylation of the single tyrosine residue of the ITIM in the cytoplasmic tail of FcgRIIb. This creates a docking site for the SH2 domain of SHIP. SHIP then serves to hydrolyses the 5? phosphate from PIP3 generated by PI3 kinase thereby uncoupling receptors from PLCg activation and calcium influx [25 /27]. In addition, inhibition of FcgRIIa function by FcgRIIb has been previously reported in transfected RBL-2H3 cells [22]. Here, aggregation of heterologously expressed FcgRIIa on RBL cells was found to induce degranulation as assessed by serotonin release. Co-expression of FcgRIIb with FcgRIIa in these cells was found to inhibit FcgRIIa mediated serotonin release. However, no data exist for the effects of FcgRIIb on FcgRIIa function under endogenous conditions. Consistent with these observations, co-aggregation of FcgRIIa with FcgRIIb by immune complex in dbcAMP differentiated cells resulted in the recruitment of SHIP to the receptor complex. This finding was unexpected as we have previously shown that, in these differentiated cells, immune complex stimulation results in activation of PLCg1 and the generation of sustained calcium oscillations [28 /30]. Taken together, this data implies that recruitment of SHIP to the receptor complex by FcgRIIb in these cells does not uncouple Fcg receptors from cell activation, in contrast to mast cells and B-cells. Perhaps consistent with our results, a non-inhibitory, adapter protein role for SHIP has been proposed [31]. Thus, SHIP has been implicated in directing the recruitment and phosphorylation of the adapter protein, Shc, which plays a role in coupling receptors to the activation of the Ras pathway. However, we and others have demonstrated that in Fcg receptor signalling SHIP /Shc interactions occur in the absence of FcgRIIb RIIb expression [16,18]. Thus, in IFN-g primed cells, where no FcgRIIb expression was detected, immune complexes rapidly induce the phosphorylation of SHIP and its association with Shc. In addition, differentiation of cells with dbcAMP was found to have no detectable effect on the formation of SHIP /Shc complexes in response to Fcg receptor aggregation (unpublished observations). Thus, a role for FcgRIIb in directing Shc phosphorylation seems unlikely. Alternatively, FcgRIIb may serve to set a threshold to control activation of cytotoxic effector functions. In resting U937 cells, Fcg receptors are not efficiently coupled to cytotoxic responses. Differentiation to more macrophage like cells with dbcAMP is accompanied by enhanced phagocytic activity and superoxide production [15]. FcgRIIb expression in these cells may, therefore, serve to set thresholds for immune complex induced cell activation. In support of this hypothesis, macrophages

isolated from FcgRIIb deficient mice show enhanced Fcg receptor functions and these mice show enhanced susceptibility to, and severity of, inflammatory diseases in model systems [32 /34]. In addition to FcgRIIb expression, we find that differentiation with dbcAMP results in a large increase in the expression of the FcgRIIa splice variant, FcgRIIa2. FcgRIIa2 lacks the sequence encoding the transmembrane segment and has been demonstrated to generate a soluble form of FcgRIIa [19,20]. Previous studies have suggested that production of soluble Fc receptors has an inhibitory effect on the binding of immune complexes to FcgR positivr cells though the rationale for such inhibition is not entirely clear. In summary, differentiation of U937 cells with dbcAMP induces the expression of FcgRIIb, which when co-aggregated with FcgRIIa, transiently recruits SHIP. This recruitment of SHIP is specific to dbcAMP cells and appears independent of the previously reported, ITIM independent, SHIP /Shc interactions induced by Fcg receptors [18]. Thus, FcgRIIb appears to act as a differentiation dependent regulator of immune complex mediated activation in a human monocyte/ macrophage context. This study also describes a novel system to help define the role of FcgRIIb in modulating immune complex mediated macrophage activation within a human system.

Acknowledgements AJMC is a Wellcome Trust Prize research fellow. KJM is supported by the National Kidney Research Fund. This work was supported by a grant from the Wellcome trust.

References [1] [2] [3] [4] [5] [6] [7] [8] [9] [10] [11]

[12]

M. Daeron, Annu. Rev. Immunol. 15 (1997) 203 /234. J.V. Ravetch, J.P. Kinet, Annu. Rev. Immunol. 9 (1991) 457 /492. M.D. Hulett, P.M. Hogarth, Adv. Immunol. 57 (1994) 1 /127. D.G. Brooks, W.Q. Qiu, A.D. Luster, J.V. Ravetch, J. Exp. Med. 170 (1989) 1369 /1385. B.M. Rankin, S.A. Yocum, R.S. Mittler, P.A. Kiener, J. Immunol. 150 (1993) 605 /616. W. Davis, S.O. Sage, J.M. Allen, Cell Calcium 16 (1994) 29 /36. L.E. Samelson, R.D. Klausner, J. Biol. Chem. 267 (1992) 24913 / 24916. J.C. Cambier, J. Immunol. 155 (1995) 3281 /3285. M. Ono, S. Bolland, P. Tempst, J.V. Ravetch, Nature 383 (1996) 263 /266. A.M. Scharenberg, J.P. Kinet, Cell 87 (1996) 961 /964. S. Amigorena, C. Bonnerot, J.R. Drake, D. Choquet, W. Hunziker, J.G. Guillet, P. Webster, C. Sautes, I. Mellman, W.H. Fridman, Science 256 (1992) 1808 /1812. T. Muta, T. Kurosaki, Z. Misulovin, M. Sanchez, M.C. Nussenzweig, J.V. Ravetch, Nature 368 (1994) 70 /73.

A.J.M. Cameron et al. / Immunology Letters 83 (2002) 171 /179 [13] D. Dambrosio, D.C. Fong, J.C. Cambier, Immunol. Lett. 54 (1996) 77 /82. [14] P. Harris, P.J. Ralph, Leuk. Biol. 37 (1985) 407 /422. [15] B. Sheth, I. Dransfield, L.J. Partridge, M.D. Barker, D.R. Burton, Immunology 63 (1988) 483 /490. [16] D.L. Maresco, J.M. Osborne, D. Cooney, K.M. Coggeshall, C.L. Anderson, J. Immunol. 162 (1999) 6458 /6465. [17] U.K. Laemmli, Nature (London) 227 (1970) 680 /685. [18] A.J. Cameron, J.M. Allen, Immunology 97 (1999) 641 /647. [19] P.A.M. Warmerdam, J.G.J. van de Winkel, E.J. Gosselin, P.J.A. Capel, J. Exp. Med. 172 (1990) 19. [20] A. Astier, H. de la Salle, C. de la Salle, T. Bieber, M. EspositoFarese, M. Freund, J.P. Cazenave, W.H. Fridman, J.L. Teillaud, D.J. Hanau, Immunology 152 (1994) 201 /212. [21] P.A.M. Warmerdam, I.E. van den Herik-Oudijk, E.W.H.I. Parren, N.A.C. Westerdaal, J.G.J. van de Winkel, P.J.A. Capel, Int. Immunol. 3 (1993) 239 /247. [22] M. Daeron, S. Latour, O. Malbec, E. Espinosa, P. Pina, S. Pasmans, W.H. Fridman, Immunity 3 (1995) 635 /646. [23] V. Weinrich, P. Sondermann, N. Bewarder, K. Wissel, J. Frey, Hybridoma 15 (1996) 109 /116. [24] J.E. Damen, L. Liu, P. Rosten, R.K. Humphries, A.B. Jefferson, P.W. Majerus, G. Krystal, Proc. Natl. Acad. Sci. 93 (1996) 1689 / 1693.

179

[25] A.C. Fluckiger, Z.M. Li, R.M. Kato, M.I. Wahl, H.D. Ochs, R. Longnecker, J.P. Kinet, O.N. Witte, A.M. Scharenberg, D.J. Rawlings, EMBO J. 17 (1998) 1973 /1985. [26] S. Bolland, R.N. Pearse, T. Kurosaki, J.V. Ravetch, Immunity 8 (1998) 509 /516. [27] A.M. Scharenberg, O. ElHillal, D.A. Fruman, L.O. Beitz, Z.M. Li, S.Q. Lin, I. Gout, L.C. Cantley, D.J. Rawlings, J.P. Kinet, EMBO J. 17 (1998) 1961 /1972. [28] A.J. Melendez, M.M. Harnett, J.M. Allen, Immunology 98 (1999) 1 /8. [29] R.A. Floto, M.P. Mahaut-Smith, J.M. Allen, J. Physiol. Lond. 480 (1994) 121. [30] A.J. Melendez, R.A. Floto, A.J. Cameron, D.J. Gillooly, M.M. Harnett, J.M. Allen, Curr. Biol. 8 (1998) 210 /221. [31] R.J. Ingham, H. Okada, M. DangLawson, J. Dinglasan, P. van der Geer, T. Kurosaki, M.R. Gold, J. Immunol. 163 (1999) 5891 / 5895. [32] R. Clynes, J.S. Maizes, R. Guinamard, M. Ono, T. Takai, J.V. Ravetch, J. Exp. Med. 189 (1999) 179 /185. [33] A. Nakamura, T. Yuasa, A. Ujike, M. Ono, T. Nukiwa, J.V. Ravetch, T. Takai, J. Exp. Med. 191 (2000) 899 /905. [34] T. Yuasa, S. Kubo, T. Yoshino, A. Ujike, K. Matsumura, M. Ono, J.V. Ravetch, T. Takai, J. Exp. Med. 189 (1999) 187 /194.