- Email: [email protected]
Dinucleotide repeat polymorphisms in the Neprilysin gene are not associated with sporadic Alzheimer's disease
Neuroscience Letters 320 (2002) 105–107 www.elsevier.com/locate/neulet
Dinucleotide repeat polymorphisms in the Neprilysin gene are not associated with sporadic Alzheimer’s disease Masaya Oda a, Hiroyuki Morino a, Hirofumi Maruyama a, Hideo Terasawa a, Yuishin Izumi b, Tsuyoshi Torii c, Ken Sasaki d, Shigenobu Nakamura a, Hideshi Kawakami a,* a
Third Department of Internal Medicine, Hiroshima University School of Medicine, 1-2-3 Kasumi, Minami-ku, Hiroshima 734-8551, Japan b Department of Clinical Neuroscience, Tokushima University Hospital, Tokushima 770-8503, Japan c Department of Neurology, Hara National Hospital, Hiroshima 738-8505, Japan d Kinoko Espoir Hospital, Okayama 714-0071, Japan Received 10 December 2001; received in revised form 30 December 2001; accepted 7 January 2002
Abstract In the pathological process of Alzheimer’s disease (AD), deposition of amyloid b-peptide (Ab) in the brain parenchyma plays an important role. Neprilysin (NEP), a neutral endopeptidase, degrades Ab, and it is postulated that decreased NEP activity may contribute to the development of AD by promoting the accumulation of Ab. The human NEP gene possesses four dinucleotide repeat polymorphisms, and it is possible that these polymorphisms regulate the NEP expression levels and influence the pathological cascade of AD. Therefore, we investigated the association of these polymorphisms with AD. We performed genotyping of each polymorphism in 201 Japanese sporadic AD patients and 208 Japanese controls. There were no significant differences between the AD and control groups in allele frequencies of each polymorphism. We conclude that these polymorphisms in the NEP gene do not contribute to genetic risk factors for sporadic AD. q 2002 Published by Elsevier Science Ireland Ltd. Keywords: Alzheimer’s disease; Sporadic; Neprilysin; Amyloid b-peptide degrading enzyme; Genetic; Polymorphism; Japanese
Alzheimer’s disease (AD) is a progressive neurodegenerative disease that manifests clinically with deficits in memory and cognitive functions. In the pathological process of AD, deposition of amyloid b-peptide (Ab) in the brain parenchyma plays an important role. In several studies of Ab catabolism, some proteases are inferred as candidates for an Ab-degrading enzyme, including Neprilysin (NEP), which is known as a neutral endopeptidase, enkephalinase, CD10, and common acute lymphoblastic leukemia antigen (CALLA). NEP degrades Ab, and decreased NEP activity increases endogenous Ab levels, inducing Ab deposition in the brain [3,4,11]. The levels of mRNA and protein of NEP in the AD brain are lower in the hippocampus and midtemporal gyrus than in controls [13], and NEP immunoreactivity is weak in the human cerebral cortex in AD [1]. In the NEP gene-disrupted mouse brain, levels of Ab in the hippocampus and cortex are higher than in other brain regions [3]. * Corresponding author. Tel.: 181-82-2575201; fax: 181-825050490. E-mail address: [email protected] (H. Kawakami).
Decreased NEP activities may contribute to the development of AD by promoting the accumulation of Ab. The human NEP gene possesses four types of dinucleotide repeats over ten repeats, including AC and TG repeats in the upstream region of exon 1, a CA repeat in the 3rd intron, and a TG repeat in the 22nd intron (Fig. 1). We speculate that these polymorphisms in the NEP gene possibly regulate the expressions of NEP protein and influence the pathological cascade of AD. Here, we investigated the association of the NEP gene dinucleotide polymorphisms with AD. The subjects were 201 sporadic AD patients (diagnosed using NINCDS-ADRDA criteria [5], 135 women and 66 men; age range 45–93 years; mean 70.9, SD 10.6) and 208 control subjects (113 women and 95 men; age range 50–94 years; mean 64.7, SD 10.5). All subjects were Japanese. Informed consent for the study was obtained from all subjects under the Ethical Principles on the Human Genome Research of the Ministry of Education, Culture, Sports, Science and Technology, the Ministry of Health, Labour and Welfare and the Ministry of Economy, Trade and Industry of Japan.
0304-3940/02/$ - see front matter q 2002 Published by Elsevier Science Ireland Ltd. PII: S03 04 - 394 0( 0 2) 00 05 7- 5
106
M. Oda et al. / Neuroscience Letters 320 (2002) 105–107
Fig. 1. Schematic representation of the distributions of four dinucleotide repeat polymorphisms in the NEP gene.
Genomic DNA was extracted from peripheral blood by standard methods. The regions of the NEP gene containing each of the dinucleotide repeats were amplified by polymerase chain reaction (PCR) using TaKaRa Ex Taqe (Takara, Japan). Primers for the PCR were (6-FAM)CCTGGCCAATATGGAGAAAC and CCCTGGAAAGCATCTCAACT for the AC repeat upstream of exon 1, (6-FAM)TCCGCAGTGGAGTGTGAATA and ACAGCGATTCCTCCTCAAAG for the TG repeat upstream of exon 1, (6-FAM)TGACACACACCCTCATGGAT and CCCAGCCTTCTCTTTTCACA for the CA repeat in the 3rd intron, and (6-FAM)CTGGTTCCAAAGATCCCTCA and GAAGTGGCCTGTTTCCAAAA for the TG repeat in the 22nd intron. The reaction volume was 20 ml containing 10–20 ng DNA, 10 pmol of each primer, 200 mmol/l of each dNTP, 1.5 mmol/l MgCl2, and 0.7 units of DNA polymerase. The PCR cycle conditions were 5 min at 95 8C followed by 40 cycles of 95 8C for 1 min, 58 8C for 1 min and 72 8C for 1 min, with a final extension of 5 min at 72 8C in the last cycle. The fragment analysis was performed by an ABI PRISM 3100 Genetic Analyzer and GeneScan Analysis ver. 3.7 software (Perkin-Elmer Applied Biosystems, Foster City, CA). Statistical analysis was done using the CLUMP program performing Monte Carlo methods [9]. We also analyzed genotypes of the apolipoprotein E (APOE) gene as described previously [8] and performed the x 2 test using StatView software (SAS Institute Inc., Cary, NC). The following dinucleotide polymorphisms were detected: nine different-sized alleles in the AC repeat upstream of exon 1, six alleles in the TG repeat upstream of exon 1, three alleles in the CA repeat in the 3rd intron and 17 alleles in the TG repeat in the 22nd intron. The allele frequencies for the AD and control groups and statistical values produced by the CLUMP program are shown in Table 1. The P value of AC upstream of exon 1 was 0.021 and the P value of TG upstream of exon 1 was 0.042, and P values were higher than 0.05 in other two polymorphisms. However, those values were not significant as adjusted using Bonferroni’s method. There was no significant difference between the early onset (#64 years old) AD group and the control group, or between late onset ($65 years old) AD group and the control group (data not shown). In APOE gene analysis, 1 4 genotype increased the risk for AD (1 4 positive subjects were 92 in AD and 35 in controls, x2 ¼ 39:999, P , 0:0001). The APOE 1 4 allele did not affect the distributions of the NEP gene polymorphisms (data not shown). The NEP gene is located on chromosome 3, one of the
candidate loci of AD [7]. The NEP gene is regulated by androgen in prostate cancer [6], and the NEP gene has been shown to contain two androgen response regions [10]. The incidence of AD is lower among males than females [2], and the hormonal regulation of the NEP gene might be associated with the gender distribution of AD. It is likely that some microsatellite marker polymorphisms or single nucleotide polymorphisms (SNPs) in the NEP gene and related regions could cause up- or down-regulation of NEP expression levels and influence the Ab level in the brain. In our study, two polymorphisms of AC and TG repeats upstream of exon 1 showed P values lower than 0.05 in the CLUMP method. However, we performed multiple statistical analysis of four polymorphisms, so those Table 1 The allele frequencies of each polymorphism for AD and control groups Allele: product size (bp) AD
Control
AC repeat upstream of exon 1 1: 234 3 7 2: 236 2 6 3: 238 2 9 4: 240 354 352 5: 242 21 21 6: 244 15 7 7: 246 4 10 8: 248 1 3 9: 250 0 1
CLUMP x 2 x2 ¼ 11:894, P ¼ 0:021
TG repeat upstream of exon 1 1: 259 1 1 2: 261 6 18 3: 263 281 279 4: 265 100 104 5: 267 10 5 6: 269 4 9
CLUMP x 2 x2 ¼ 7:585, P ¼ 0:042
CA repeat in the 3rd intron 1: 249 338 340 2: 251 63 78 3: 255 1 0
CLUMP x 2 x2 ¼ 1:286, P ¼ 0:266
TG repeat in the 22nd intron 1: 209 55 2: 211 1 3: 217 0 4: 219 12 5: 221 10 6: 223 26 7: 225 38 8: 227 7 9: 229 56 10: 231 51 11: 233 98 12: 235 29 13: 237 15 14: 239 1 15: 241 1 16: 245 1 17: 247 1
CLUMP x 2 x2 ¼ 10:549, P ¼ 0:211
50 1 1 5 6 43 35 13 50 63 89 32 19 7 0 2 0
M. Oda et al. / Neuroscience Letters 320 (2002) 105–107
values were not significant as adjusted using Bonferroni’s method. Among AC repeats upstream of exon 1, TG repeats upstream of exon 1, and CA repeats in the 3rd intron, the allele distribution was specific for a particular allele. On the other hand, TG repeats in the 22nd intron occurred in 17 allele types and the distribution was scattered. Further analysis with a greater number of subjects might reveal a significant association between the AD and control groups. Recently, another study reported that one of these four polymorphisms of the gene in Japanese subjects was not associated with AD [12], as we showed. It may then be necessary to investigate these polymorphisms in another ethnic group, or to search SNPs in the target region as genetic risk factors for AD. In other searches for genetic risk factors for AD, the APOE gene has been the only confirmed susceptibility gene found so far that contributes to sporadic late onset AD [8]. We tried to find another gene that was unequivocally associated with AD, but have to conclude that the dinucleotide repeat polymorphisms analyzed here in the NEP gene do not contribute to genetic risk factors for sporadic AD. This work was partially supported by the Japan Society for the Promotion of Science Research for the Future Program. [1] Akiyama, H., Kondo, H., Ikeda, K., Kato, M. and McGeer, P.L., Immunohistochemical localization of neprilysin in the human cerebral cortex: inverse association with vulnerability to amyloid b-protein (Ab) deposition, Brain Res., 902 (2001) 277–281. [2] Fratiglioni, L., Viitanen, M., von Strauss, E., Tontodonati, V., Herlitz, A. and Winblad, B., Very old woman at highest risk of dementia and Alzheimer’s disease: incidence data from the Kungsholmen Project, Stockholm, Neurology, 48 (1997) 132–138. [3] Iwata, N., Tsubuki, S., Takaki, Y., Shirotani, K., Lu, B., Gerard, N.P., Gerard, C., Hama, E., Lee, H.J. and Saido, T.C., Metabolic regulation of brain Ab by neprilysin, Science, 292 (2001) 1550–1552. [4] Iwata, N., Tsubuki, S., Takaki, Y., Watanabe, K., Sekiguchi, M., Hosoki, E., Kawashima-Morishima, M., Lee, H.J., Hama,
[5]
[6]
[7]
[8]
[9]
[10]
[11]
[12]
[13]
107
E., Sekine-Aizawa, Y. and Saido, T.C., Identification of the major Ab1-42-degrading catabolic pathway in brain parenchyma: suppression leads to biochemical and pathological deposition, Nat. Med., 6 (2000) 143–150. McKhann, G., Drachman, D., Folstein, M., Katzman, R., Price, D. and Stadlan, E.M., Clinical diagnosis of Alzheimer’s disease, Neurology, 34 (1984) 939–944. Papandreou, C.N., Usami, B., Geng, Y., Bogenrieder, T., Freeman, R., Wilk, S., Finstad, C.L., Reuter, V.E., Powell, C.T., Scheinberg, D., Magill, C., Scher, H.I., Albino, A.P. and Nanus, D.M., Neutral endopeptidase 24.11 loss in metastatic human prostate cancer contributes to androgen-independent progression, Nat. Med., 4 (1998) 50–57. Poduslo, S.E., Yin, X., Hargis, J., Brumback, R.A., Mastrianni, J.A. and Schwankhaus, J., A familial case of Alzheimer’s disease without tau pathology may be linked with chromosome 3 markers, Hum. Genet., 105 (1999) 32– 37. Saunders, A.M., Strittmatter, W.J., Schmechel, D., GeorgeHyslop, P.H., Pericak-Vance, M.A., Joo, S.H., Rosi, B.L., Gusella, J.F., Crapper-MacLachlan, D.R., Alberts, M.J., Hulette, C., Crain, B., Goldgaber, D. and Roses, A.D., Association of apolipoprotein E allele e4 with late-onset familial and sporadic Alzheimer’s disease, Neurology, 43 (1993) 1467–1472. Sham, P.C. and Curtis, D., Monte Carlo tests for associations between disease and alleles at highly polymorphic loci, Ann. Hum. Genet., 59 (1995) 97–105. Shen, R., Sumitomo, M., Dai, J., Hardy, D.O., Navarro, D., Usami, B., Papandreou, C.N., Hersh, L.B., Shipp, M.A., Freedman, L.P. and Nanus, D.M., Identification and characterization of two androgen response regions in the human neutral endopeptidase gene, Mol. Cell. Endocrinol., 170 (2000) 131–142. Shirotani, K., Tsubuki, S., Iwata, N., Takaki, Y., Harigaya, W., Maruyama, K., Kiryu-Seo, S., Kiyama, H., Iwata, H., Tomita, T., Iwatsubo, T. and Saido, T.C., Neprilysin degrades both amyloid b peptides 1-40 and 1-42 most rapidly and efficiently among thiorphan- and phosphoramidon-sensitive endopeptidases, J. Biol. Chem., 276 (2001) 21895–21901. Sodeyama, N., Mizusawa, H., Yamada, M., Itoh, Y., Otomo, E. and Matsushita, M., Lack of association of neprilysin polymorphism with Alzheimer’s disease and Alzheimer’s disease-type neuropathological changes, J. Neurol. Neurosurg. Psychiatry, 71 (2001) 817–818. Yasojima, K., Akiyama, H., McGeer, E.G. and McGeer, P.L., Reduced neprilysin in high plaque areas of Alzheimer brain: a possible relationship to deficient degradation of bamyloid peptide, Neurosci. Lett., 297 (2001) 97–100.
Dinucleotide repeat polymorphisms in the Neprilysin gene are not associated with sporadic Alzheimer’s disease Masaya Oda a, Hiroyuki Morino a, Hirofumi Maruyama a, Hideo Terasawa a, Yuishin Izumi b, Tsuyoshi Torii c, Ken Sasaki d, Shigenobu Nakamura a, Hideshi Kawakami a,* a
Third Department of Internal Medicine, Hiroshima University School of Medicine, 1-2-3 Kasumi, Minami-ku, Hiroshima 734-8551, Japan b Department of Clinical Neuroscience, Tokushima University Hospital, Tokushima 770-8503, Japan c Department of Neurology, Hara National Hospital, Hiroshima 738-8505, Japan d Kinoko Espoir Hospital, Okayama 714-0071, Japan Received 10 December 2001; received in revised form 30 December 2001; accepted 7 January 2002
Abstract In the pathological process of Alzheimer’s disease (AD), deposition of amyloid b-peptide (Ab) in the brain parenchyma plays an important role. Neprilysin (NEP), a neutral endopeptidase, degrades Ab, and it is postulated that decreased NEP activity may contribute to the development of AD by promoting the accumulation of Ab. The human NEP gene possesses four dinucleotide repeat polymorphisms, and it is possible that these polymorphisms regulate the NEP expression levels and influence the pathological cascade of AD. Therefore, we investigated the association of these polymorphisms with AD. We performed genotyping of each polymorphism in 201 Japanese sporadic AD patients and 208 Japanese controls. There were no significant differences between the AD and control groups in allele frequencies of each polymorphism. We conclude that these polymorphisms in the NEP gene do not contribute to genetic risk factors for sporadic AD. q 2002 Published by Elsevier Science Ireland Ltd. Keywords: Alzheimer’s disease; Sporadic; Neprilysin; Amyloid b-peptide degrading enzyme; Genetic; Polymorphism; Japanese
Alzheimer’s disease (AD) is a progressive neurodegenerative disease that manifests clinically with deficits in memory and cognitive functions. In the pathological process of AD, deposition of amyloid b-peptide (Ab) in the brain parenchyma plays an important role. In several studies of Ab catabolism, some proteases are inferred as candidates for an Ab-degrading enzyme, including Neprilysin (NEP), which is known as a neutral endopeptidase, enkephalinase, CD10, and common acute lymphoblastic leukemia antigen (CALLA). NEP degrades Ab, and decreased NEP activity increases endogenous Ab levels, inducing Ab deposition in the brain [3,4,11]. The levels of mRNA and protein of NEP in the AD brain are lower in the hippocampus and midtemporal gyrus than in controls [13], and NEP immunoreactivity is weak in the human cerebral cortex in AD [1]. In the NEP gene-disrupted mouse brain, levels of Ab in the hippocampus and cortex are higher than in other brain regions [3]. * Corresponding author. Tel.: 181-82-2575201; fax: 181-825050490. E-mail address: [email protected] (H. Kawakami).
Decreased NEP activities may contribute to the development of AD by promoting the accumulation of Ab. The human NEP gene possesses four types of dinucleotide repeats over ten repeats, including AC and TG repeats in the upstream region of exon 1, a CA repeat in the 3rd intron, and a TG repeat in the 22nd intron (Fig. 1). We speculate that these polymorphisms in the NEP gene possibly regulate the expressions of NEP protein and influence the pathological cascade of AD. Here, we investigated the association of the NEP gene dinucleotide polymorphisms with AD. The subjects were 201 sporadic AD patients (diagnosed using NINCDS-ADRDA criteria [5], 135 women and 66 men; age range 45–93 years; mean 70.9, SD 10.6) and 208 control subjects (113 women and 95 men; age range 50–94 years; mean 64.7, SD 10.5). All subjects were Japanese. Informed consent for the study was obtained from all subjects under the Ethical Principles on the Human Genome Research of the Ministry of Education, Culture, Sports, Science and Technology, the Ministry of Health, Labour and Welfare and the Ministry of Economy, Trade and Industry of Japan.
0304-3940/02/$ - see front matter q 2002 Published by Elsevier Science Ireland Ltd. PII: S03 04 - 394 0( 0 2) 00 05 7- 5
106
M. Oda et al. / Neuroscience Letters 320 (2002) 105–107
Fig. 1. Schematic representation of the distributions of four dinucleotide repeat polymorphisms in the NEP gene.
Genomic DNA was extracted from peripheral blood by standard methods. The regions of the NEP gene containing each of the dinucleotide repeats were amplified by polymerase chain reaction (PCR) using TaKaRa Ex Taqe (Takara, Japan). Primers for the PCR were (6-FAM)CCTGGCCAATATGGAGAAAC and CCCTGGAAAGCATCTCAACT for the AC repeat upstream of exon 1, (6-FAM)TCCGCAGTGGAGTGTGAATA and ACAGCGATTCCTCCTCAAAG for the TG repeat upstream of exon 1, (6-FAM)TGACACACACCCTCATGGAT and CCCAGCCTTCTCTTTTCACA for the CA repeat in the 3rd intron, and (6-FAM)CTGGTTCCAAAGATCCCTCA and GAAGTGGCCTGTTTCCAAAA for the TG repeat in the 22nd intron. The reaction volume was 20 ml containing 10–20 ng DNA, 10 pmol of each primer, 200 mmol/l of each dNTP, 1.5 mmol/l MgCl2, and 0.7 units of DNA polymerase. The PCR cycle conditions were 5 min at 95 8C followed by 40 cycles of 95 8C for 1 min, 58 8C for 1 min and 72 8C for 1 min, with a final extension of 5 min at 72 8C in the last cycle. The fragment analysis was performed by an ABI PRISM 3100 Genetic Analyzer and GeneScan Analysis ver. 3.7 software (Perkin-Elmer Applied Biosystems, Foster City, CA). Statistical analysis was done using the CLUMP program performing Monte Carlo methods [9]. We also analyzed genotypes of the apolipoprotein E (APOE) gene as described previously [8] and performed the x 2 test using StatView software (SAS Institute Inc., Cary, NC). The following dinucleotide polymorphisms were detected: nine different-sized alleles in the AC repeat upstream of exon 1, six alleles in the TG repeat upstream of exon 1, three alleles in the CA repeat in the 3rd intron and 17 alleles in the TG repeat in the 22nd intron. The allele frequencies for the AD and control groups and statistical values produced by the CLUMP program are shown in Table 1. The P value of AC upstream of exon 1 was 0.021 and the P value of TG upstream of exon 1 was 0.042, and P values were higher than 0.05 in other two polymorphisms. However, those values were not significant as adjusted using Bonferroni’s method. There was no significant difference between the early onset (#64 years old) AD group and the control group, or between late onset ($65 years old) AD group and the control group (data not shown). In APOE gene analysis, 1 4 genotype increased the risk for AD (1 4 positive subjects were 92 in AD and 35 in controls, x2 ¼ 39:999, P , 0:0001). The APOE 1 4 allele did not affect the distributions of the NEP gene polymorphisms (data not shown). The NEP gene is located on chromosome 3, one of the
candidate loci of AD [7]. The NEP gene is regulated by androgen in prostate cancer [6], and the NEP gene has been shown to contain two androgen response regions [10]. The incidence of AD is lower among males than females [2], and the hormonal regulation of the NEP gene might be associated with the gender distribution of AD. It is likely that some microsatellite marker polymorphisms or single nucleotide polymorphisms (SNPs) in the NEP gene and related regions could cause up- or down-regulation of NEP expression levels and influence the Ab level in the brain. In our study, two polymorphisms of AC and TG repeats upstream of exon 1 showed P values lower than 0.05 in the CLUMP method. However, we performed multiple statistical analysis of four polymorphisms, so those Table 1 The allele frequencies of each polymorphism for AD and control groups Allele: product size (bp) AD
Control
AC repeat upstream of exon 1 1: 234 3 7 2: 236 2 6 3: 238 2 9 4: 240 354 352 5: 242 21 21 6: 244 15 7 7: 246 4 10 8: 248 1 3 9: 250 0 1
CLUMP x 2 x2 ¼ 11:894, P ¼ 0:021
TG repeat upstream of exon 1 1: 259 1 1 2: 261 6 18 3: 263 281 279 4: 265 100 104 5: 267 10 5 6: 269 4 9
CLUMP x 2 x2 ¼ 7:585, P ¼ 0:042
CA repeat in the 3rd intron 1: 249 338 340 2: 251 63 78 3: 255 1 0
CLUMP x 2 x2 ¼ 1:286, P ¼ 0:266
TG repeat in the 22nd intron 1: 209 55 2: 211 1 3: 217 0 4: 219 12 5: 221 10 6: 223 26 7: 225 38 8: 227 7 9: 229 56 10: 231 51 11: 233 98 12: 235 29 13: 237 15 14: 239 1 15: 241 1 16: 245 1 17: 247 1
CLUMP x 2 x2 ¼ 10:549, P ¼ 0:211
50 1 1 5 6 43 35 13 50 63 89 32 19 7 0 2 0
M. Oda et al. / Neuroscience Letters 320 (2002) 105–107
values were not significant as adjusted using Bonferroni’s method. Among AC repeats upstream of exon 1, TG repeats upstream of exon 1, and CA repeats in the 3rd intron, the allele distribution was specific for a particular allele. On the other hand, TG repeats in the 22nd intron occurred in 17 allele types and the distribution was scattered. Further analysis with a greater number of subjects might reveal a significant association between the AD and control groups. Recently, another study reported that one of these four polymorphisms of the gene in Japanese subjects was not associated with AD [12], as we showed. It may then be necessary to investigate these polymorphisms in another ethnic group, or to search SNPs in the target region as genetic risk factors for AD. In other searches for genetic risk factors for AD, the APOE gene has been the only confirmed susceptibility gene found so far that contributes to sporadic late onset AD [8]. We tried to find another gene that was unequivocally associated with AD, but have to conclude that the dinucleotide repeat polymorphisms analyzed here in the NEP gene do not contribute to genetic risk factors for sporadic AD. This work was partially supported by the Japan Society for the Promotion of Science Research for the Future Program. [1] Akiyama, H., Kondo, H., Ikeda, K., Kato, M. and McGeer, P.L., Immunohistochemical localization of neprilysin in the human cerebral cortex: inverse association with vulnerability to amyloid b-protein (Ab) deposition, Brain Res., 902 (2001) 277–281. [2] Fratiglioni, L., Viitanen, M., von Strauss, E., Tontodonati, V., Herlitz, A. and Winblad, B., Very old woman at highest risk of dementia and Alzheimer’s disease: incidence data from the Kungsholmen Project, Stockholm, Neurology, 48 (1997) 132–138. [3] Iwata, N., Tsubuki, S., Takaki, Y., Shirotani, K., Lu, B., Gerard, N.P., Gerard, C., Hama, E., Lee, H.J. and Saido, T.C., Metabolic regulation of brain Ab by neprilysin, Science, 292 (2001) 1550–1552. [4] Iwata, N., Tsubuki, S., Takaki, Y., Watanabe, K., Sekiguchi, M., Hosoki, E., Kawashima-Morishima, M., Lee, H.J., Hama,
[5]
[6]
[7]
[8]
[9]
[10]
[11]
[12]
[13]
107
E., Sekine-Aizawa, Y. and Saido, T.C., Identification of the major Ab1-42-degrading catabolic pathway in brain parenchyma: suppression leads to biochemical and pathological deposition, Nat. Med., 6 (2000) 143–150. McKhann, G., Drachman, D., Folstein, M., Katzman, R., Price, D. and Stadlan, E.M., Clinical diagnosis of Alzheimer’s disease, Neurology, 34 (1984) 939–944. Papandreou, C.N., Usami, B., Geng, Y., Bogenrieder, T., Freeman, R., Wilk, S., Finstad, C.L., Reuter, V.E., Powell, C.T., Scheinberg, D., Magill, C., Scher, H.I., Albino, A.P. and Nanus, D.M., Neutral endopeptidase 24.11 loss in metastatic human prostate cancer contributes to androgen-independent progression, Nat. Med., 4 (1998) 50–57. Poduslo, S.E., Yin, X., Hargis, J., Brumback, R.A., Mastrianni, J.A. and Schwankhaus, J., A familial case of Alzheimer’s disease without tau pathology may be linked with chromosome 3 markers, Hum. Genet., 105 (1999) 32– 37. Saunders, A.M., Strittmatter, W.J., Schmechel, D., GeorgeHyslop, P.H., Pericak-Vance, M.A., Joo, S.H., Rosi, B.L., Gusella, J.F., Crapper-MacLachlan, D.R., Alberts, M.J., Hulette, C., Crain, B., Goldgaber, D. and Roses, A.D., Association of apolipoprotein E allele e4 with late-onset familial and sporadic Alzheimer’s disease, Neurology, 43 (1993) 1467–1472. Sham, P.C. and Curtis, D., Monte Carlo tests for associations between disease and alleles at highly polymorphic loci, Ann. Hum. Genet., 59 (1995) 97–105. Shen, R., Sumitomo, M., Dai, J., Hardy, D.O., Navarro, D., Usami, B., Papandreou, C.N., Hersh, L.B., Shipp, M.A., Freedman, L.P. and Nanus, D.M., Identification and characterization of two androgen response regions in the human neutral endopeptidase gene, Mol. Cell. Endocrinol., 170 (2000) 131–142. Shirotani, K., Tsubuki, S., Iwata, N., Takaki, Y., Harigaya, W., Maruyama, K., Kiryu-Seo, S., Kiyama, H., Iwata, H., Tomita, T., Iwatsubo, T. and Saido, T.C., Neprilysin degrades both amyloid b peptides 1-40 and 1-42 most rapidly and efficiently among thiorphan- and phosphoramidon-sensitive endopeptidases, J. Biol. Chem., 276 (2001) 21895–21901. Sodeyama, N., Mizusawa, H., Yamada, M., Itoh, Y., Otomo, E. and Matsushita, M., Lack of association of neprilysin polymorphism with Alzheimer’s disease and Alzheimer’s disease-type neuropathological changes, J. Neurol. Neurosurg. Psychiatry, 71 (2001) 817–818. Yasojima, K., Akiyama, H., McGeer, E.G. and McGeer, P.L., Reduced neprilysin in high plaque areas of Alzheimer brain: a possible relationship to deficient degradation of bamyloid peptide, Neurosci. Lett., 297 (2001) 97–100.