- Email: [email protected]
MyD88 signal pathway
International Immunopharmacology 36 (2016) 132–141
Contents lists available at ScienceDirect
International Immunopharmacology journal homepage: www.elsevier.com/locate/intimp
Dioscin reduces lipopolysaccharide-induced inflammatory liver injury via regulating TLR4/MyD88 signal pathway Hong Yao a,1, Changsheng Hu b,1, Lianhong Yin a, Xufeng Tao a, Lina Xu a, Yan Qi a, Xu Han a, Youwei Xu a, Yanyan Zhao a, Changyuan Wang a, Jinyong Peng a,⁎ a b
College of Pharmacy, Dalian Medical University, Western 9 Lvshunnan Road, Dalian 116044, China Huanggang Polytechnic College, No. 109 Taoyuan St., Nanhu Educational District, Huanggang City 438002, Hubei Province, China
a r t i c l e
i n f o
Article history: Received 17 January 2016 Received in revised form 30 March 2016 Accepted 18 April 2016 Available online xxxx Keywords: Acute liver injury Dioscin Lipopolysaccharide Inflammation TLR4/MyD88 signal pathway
a b s t r a c t We previously reported the effects of dioscin against carbon tetrachloride-, acetaminophen- and alcohol-induced acute liver damage. However, its effect on lipopolysaccharide (LPS)-induced inflammatory liver injury remains unknown. In the present work, liver injury in mice and rats was induced by LPS, and dioscin was intragastrically administered for 7 days. In vitro, the AML-12 cells and HepG-2 cells were treated with LPS after dioscin treatment. The results showed that dioscin not only markedly reduced serum ALT, AST levels and relative liver weights, but also restored cell injury caused by LPS. In mechanism study, dioscin significantly attenuated inflammation through down-regulating the levels of toll-like receptor (TLR) 4, myeloid differentiation factor 88 (MyD88), interleukin-1 receptor-associated kinase 1 (IRAK1), tumor necrosis factor receptor-associated factor 6 (TRAF6), phosphorylated inhibitor of nuclear factor κB kinase (p-IKK), phosphorylated inhibitor of nuclear factor κB alpha (p-IκBα), phosphorylated nuclear factor κB p65 (p-NF-κB p65), high-mobility group protein 1 (HMGB-1), interleukin (IL)-1, IL-6 and tumor necrosis factor-α (TNF-α). TLR4 overexpression was also decreased by dioscin, leading to the markedly decreased levels of MyD88, IRAK1, TRAF6, p-IKK, p-IκBα, p-NF-κB p65 and HMGB-1. Suppression of MyD88 by ST2825 eliminated the inhibitory effects of dioscin on the levels of IRAK1, TRAF6, p-IKK, p-IκBα, p-NF-κB p65, HMGB-1, IL-1β, IL-6 and TNF-α. Our results suggested that dioscin exhibited protective effect against LPS-induced liver injury via altering TLR4/MyD88 pathway, which should be developed as one potent candidate for the treatment of acute inflammatory liver injury in the future. © 2016 Elsevier B.V. All rights reserved.
1. Introduction Many factors can cause the activation of macrophages with an excessive production of pro-inflammatory cytokines including interleukin (IL)-1β, IL-6 and tumor necrosis factor-α (TNF-α), and consequently lead to liver injury [1]. Acute liver injury (ALI) associated with devastating consequences [2] can be caused by many chemicals. Lipopolysaccharide (LPS), which exists in the cell wall of gramnegative bacteria, is not only the cause of the serious global problem of sepsis, but also the most potent bioactivator of the immunological system [3,4]. The innate immune response is the first line of defense against microbial pathogens and their derivatives, and uncontrolled response of immune system to LPS can lead to septic shock and systemic inflammatory [5].
⁎ Corresponding author. E-mail address: [email protected] (J. Peng). 1 These authors contributed the same work to this paper and they are the co-first authors.
http://dx.doi.org/10.1016/j.intimp.2016.04.023 1567-5769/© 2016 Elsevier B.V. All rights reserved.
Although inflammation is present in virtually all patients with hepatic injury and correlates with injury progression, the molecular link between hepatic inflammation and injury remains elusive. Tolllike receptors (TLRs) constitute a highly conserved family of receptors which can recognize pathogen-associated molecular patterns and allow the host to detect microbial infection [6]. TLRs are not only important in regulating innate and adaptive immune response, but also associated with inflammatory liver diseases [7]. TLR4, one receptor for LPS, can trigger two different signaling pathways. One is a myeloid differentiation factor 88 (MyD88)-dependent pathway, which can lead to the activation of nuclear factor κB (NF-κB) and stimulate the production of proinflammatory cytokines, chemokines, and type I interferon [8]. Although many efforts have been made to determine the underlying mechanisms of ALI caused by LPS, ideal treatment methods remain controversial and uncertain. Therefore, it is urgent to develop new and potent drugs for the treatment of this condition. Herbal medicines have been used to treat hepatic injury for a long time, and many natural products, including rubia cordifolia, acteoside and rhein, have potent effects against LPS-induced hepatic injury [9–11]. Thus, it is reasonable
H. Yao et al. / International Immunopharmacology 36 (2016) 132–141
to explore new and effective natural products from medicinal herbs to treat LPS-induced ALI. Dioscin (Dio, shown in Fig. 1A), a plant steroid saponin, is widely prevalent in many herbs [12]. Pharmacological investigations have demonstrated that dioscin has anti-inflammatory, anti-tumor and anti-hyperlipidemic activities [13,14]. Our previous studies have shown that dioscin has remarkable effects against chemically-induced liver injury, non-alcoholic fatty liver disease (NAFLD), hepatic ischemia–reperfusion injury and liver fibrosis [15–18]. Furthermore, we have also found that dioscin has significantly protective effects against ethanol-induced liver injury [19]. However, it still remains unclear on the effect and molecular mechanism of dioscin against LPS-induced inflammatory liver injury.
133
Therefore, in the present work, the effects and possible mechanisms of dioscin against LPS-induced inflammatory liver injury were investigated. 2. Materials and methods 2.1. Chemicals Dioscin was prepared from Dioscorea nipponica Makino in our laboratory with the activity of over 98% analyzed by high-performance liquid chromatography [20,21]. Dioscin was dissolved with 0.1% dimethylsulfoxide (DMSO) for in vitro experiments, or with 0.5% carboxymethylcellulose sodium (CMC-Na) solution for in vivo tests.
Fig. 1. Dioscin inhibits cell proliferation treated with LPS. (A) The chemical structure of dioscin. (B) Effects of dioscin (75, 150, 300, 600, 1200, 2400 and 4800 ng/ml) on the cell viability of AML-12 cells for 24 h. (C) Effects of dioscin (150, 300 and 600 ng/ml) on the proliferation of AML-12 cells treated with LPS (100 ng/ml) for 6, 12 and 24 h. (D) Effects of dioscin (50, 100, 200, 400, 800, 1600 and 3200 ng/ml) on the cell viability of HepG-2 cells for 24 h. (E) Effects of dioscin (200, 400 and 800 ng/ml) on the proliferation of HepG-2 cells treated with LPS (100 ng/ml) for 6, 12 and 24 h. Data are presented as the mean ± SD (n = 5). *p b 0.05 and **p b 0.01 compared with model groups.
134
H. Yao et al. / International Immunopharmacology 36 (2016) 132–141
ST2825 was purchased from Sigma-Aldrich (St.Louis, MO, USA). Alanine aminotran-sferase (ALT) and aspartate aminotransferase (AST) kits were obtained from the Nanjing Jiancheng Institute of Biotechnology (Nanjing, China). A tissue protein extraction kit was obtained from Keygen Biotech. Co., Ltd. (Nanjing, China). A bicinchoninicacid (BCA) protein assay kit was purchased from the Beyotime Institute of Biotechnology (Jiangsu, China). Tris, SDS, CMC-Na and 4′,6′diamidino-2- phenylindole (DAPI) were purchased from Sigma (St.Louis, MO, USA). RNAiso Plus, a PrimeScript® RT Reagent Kit with gDNA Eraser (Perfect Real Time) and SYBR® Premix Ex Taq™ II (Tli RNase H Plus) were purchased from TaKaRa Biotechnology Co., Ltd. (Dalian, China).
2.2. Cell culture The alpha mouse liver 12 (AML-12) cells were obtained from American type culture collection (ATCC) (Manassas, VA, USA) and cultured in Dulbecco's modified Eagle's medium and Ham's F12 medium (Gibco, Carlsbad, CA, USA) with 0.005 mg/ml insulin, 0.005 mg/ml transferrin, 5 ng/ml selenium, 40 ng/ml dexamethasone and 10% fetal bovine serum (FBS) (Gibco, Carlsbad, CA, USA). The human hepatocellular carcinoma (HepG-2) cells were purchased from the Chinese Academy of Medical Sciences tumor cell libraries (Beijing, China) and cultured in Dulbecco's Modified Eagle's Medium containing 10% fetal bovine serum (FBS) (Gibco, Carlsbad, CA, USA). The cells were cultured in humidified environment containing 5% CO2 at 37 °C. AML-12 and HepG-2 cells were pretreated with different concentrations of dioscin (600, 300 and 150 ng/ml for AML-12; 800, 400 and 200 ng/ml for HepG-2) and treated with LPS (100 ng/ml) for 24 h.
2.3. Cell toxicity assay The AML-12 cells and HepG-2 cells were plated into 96-well plates at a density of 5 × 104 cells/ml for 24 h before treatment, and then incubated for another 24 h in the presence of different concentrations of dioscin (75, 150, 300, 600, 1200, 2400 and 4800 ng/ml for AML-12; 50, 100, 200, 400, 800, 1600 and 3200 ng/ml for HepG-2). The cell proliferation was measured using the MTT method.
2.4. Cell proliferation assay The AML-12 cells and HepG-2 cells were plated into 96-well plates at a density of 5 × 104 cells/ml for 24 h before treatment. The cells were incubated for 6, 12 and 24 h in the presence of different concentrations of dioscin (150, 300 and 600 ng/ml for AML-12; 200, 400 and 800 ng/ml for HepG-2) caused by LPS, and then measured using the MTT method.
2.5. LPS-induced inflammatory liver injury in vivo Male C57BL/6J mice (20 ± 2 g) and male Wistar rats (200 ± 20 g) were purchased from the Experimental Animal Centre of Dalian Medical University, Dalian, China (quality certificate number: SCXK (Liao) 2013–0003). After 1 week of acclimatization, the mice were randomly divided into five groups (n = 8 per group) as follows: control, model (LPS) and dioscin-treated (80, 40 and 20 mg/kg) groups. The rats were also randomly divided into five groups (n = 8 per group) as follows: control, model (LPS), and dioscin-treated (60, 30 and 15 mg/kg) groups. The animals were administered with dioscin for 7 consecutive days. Liver injury in mice and rats was induced by intraperitoneal (i.p.) LPS at the doses of 8 mg/kg and 5 mg/kg 2 h before the last administration. After 7 days, the animals were sacrificed. Then, the blood and liver tissue were collected and stored for further assay. In the test, all animals were housed in a controlled environment at 23 ± 2 °C under a 12-h dark/light cycle with free access to food and water. All experimental procedures were approved by the Animal Care and Use Committee of Dalian Medical University and performed in strict accordance with the People's Republic of China Legislation Regarding the Use and Care of Laboratory Animals. 2.6. Determination of serum AST and ALT levels The serum levels of AST and ALT were detected using a commercial clinical test kit based on the manufacturer's instructions. 2.7. Histological assay Liver tissues were fixed in 10% formalin and embedded in paraffin. Five-micron-thick sections were stained with hematoxylin-eosin (H&E). Images were acquired by light microscopy (Nikon Eclipse TE2000-U, Nikon, Japan), and the degree of liver injury was quantified using Image-Pro Plus 6.0 software. 2.8. Immunofluorescence assay Immunofluorescence staining of tissue slices or formal in-fixed cells for TLR4 and MyD88 was performed using primary antibodies (Santa Cruz, California, USA) in a humidified chamber at 4 °C overnight. After washing twice in PBS, the cells and liver tissue sections were incubated with a fluorescein-labelled secondary antibody for 1 h. Eventually, cell nuclei were stained with DAPI (5 μg/ml). All samples were imaged using a fluorescence microscope (Olympus, Tokyo, Japan). 2.9. Quantitative real-time PCR assay Total RNA samples from the cells and livers were extracted using RNAiso Plus reagent following the manufacturer's protocol. Reverse transcription for cDNA synthesis and quantitative real-time PCR were
Table 1 The primer sequences used for real-time PCR assay in the present work. Gene
GenBank accession
Forward primer (5′-3′)
Reverse primer (5′-3′)
Mouse GAPDH Mouse TNF-α Mouse IL1-β Mouse IL-6 Rat GAPDH Rat IL1-β Rat IL-6 Rat TNF-α Human GAPDH Human IL1-β Human IL-6 Human TNF-α
NM_008084.2 NM_013693.2 NM_008361.3 NM_031168.1 NM_017008.3 NM_031512.2 NM_012589.1 NM_012675.3 NM_002046.3 NM_000576.2 NM_000600.3 NM_000594.3
TGTGTCCGTCGTGGATCTGA TATGGCCCAGACCCTCACA TCCAGGATGAGGACATGAGCAC CCACTTCACAAGTCGGAGGCTTA GGCACAGTCAAGGCTGAGAATG CCCTGAACTCAACTGTGAAATAGCA ATTGTATGAACAGCGATGATGCAC TCAGTTCCATGGCCCAGAC GCACCGTCAAGGCTGAGAAC CTGAGCACCTTCTTTCCCTTCA TGGCTGAAAAAGATGGATGCT TGTAGCCCATGTTGTAGCAAACC
TTGCTGTTGAAGTCGCAGGAG GGAGTAGACAAGGTACAACCCATC GAACGTCACACACCAGCAGGTTA CCAGTTTGGTAGCATCCATCATTTC ATGGTGGTGAAGACGCCAGTA CCCAAGTCAAGGGCTTGGAA CCAGGTAGAAACGGAACTCCAGA GTTGTCTTTGAGATCCATGCCATT TGGTGAAGACGCCAGTGGA TGGACCAGACATCACCAAGCT TCTGCACAGCTCTGGCTTGT GAGGACCTGGGAGTAGATGAGGTA
H. Yao et al. / International Immunopharmacology 36 (2016) 132–141 Table 2 The information of the antibodies used in the present work. Antibody
Source
Dilutions
Company
GAPDH TLR4 MyD88 IRAK1 TRAF6 p-IKK p-IκBα p-NF-κB p65 HMGB-1
Rabbit Rabbit Rabbit Rabbit Rabbit Rabbit Rabbit Rabbit Rabbit
1:2000 1:1000 1:1000 1:1000 1:1000 1:1000 1:1000 1:1000 1:1000
Proteintech Group, Chicago, USA Proteintech Group, Chicago, USA Proteintech Group, Chicago, USA Proteintech Group, Chicago, USA Proteintech Group, Chicago, USA Santa Cruz, CA, USA Santa Cruz, CA, USA Proteintech Group, Chicago, USA Proteintech Group, Chicago, USA
performed as previously described. The forward (F) and reverse (R) primers for the tested genes are listed in Table 1. For each sample, the Ct values for the target gene and GAPDH (as a calibrator) were determined based on standard curves. The calculated relative Ct value of each gene was divided by the relative value of GAPDH. Then, the expression level of each gene in the control group was set to one-fold and used to determine the relative levels in the other samples (n-fold).
135
2.10. Western blotting assay The protein samples from the cells and liver tissues were extracted following standard protocols (Beyotime Biotechnology, Haimen, China), and the protein content was determined using a BCA Protein Assay Kit. Proteins were subjected to SDS-PAGE and then transferred to a nitrocellulose membrane. After blocking, the membranes were incubated for 1 h at room temperature or overnight at 4 °C. The primary antibodies are listed in Table 2. The blots were then incubated with horseradish peroxidise-conjugated antibodies for 2 h at room temperature at a 1:2000 dilution (Beyotime Institute of Biotechnology, China). Protein expression was detected by the enhanced chemiluminescence (ECL) method and imaged with a Bio-Spectrum Gel Imaging System (UVP, USA). To eliminate variations due to protein quantity and quality, the data were adjusted to GAPDH expression (IOD of objective protein versus IOD of GAPDH protein). 2.11. TLR4 gene transfection in cells The AML-12 cells and HepG-2 cells were transfected with pPICZATLR4 plasmid DNA using Lipofectamine Plus Reagent (Invitrogen Life Technologies, CA, USA) according to the manufacturer's instructions.
Fig. 2. Dioscin rehabilitates LPS-induced acute liver injury in mice and rats. (A–B) Effects of dioscin on LPS-induced liver injury based on H&E staining (200× original magnification). (C) Effects of dioscin (20, 40, 80 mg/kg) on the serum levels of AST, ALT, and the relative liver weight in mice. (D) Effects of dioscin (15, 30, 60 mg/kg) on the serum levels of AST, ALT, and the relative liver weight in rats. Values are expressed as the mean ± SD (n = 8). *p b 0.05 and **p b 0.01 compared with model groups.
136
H. Yao et al. / International Immunopharmacology 36 (2016) 132–141
Twenty-four hours after transfection, the cells were subjected to serum deprivation for 24 h before exposure to LPS (100 ng/ml) in the presence or absence of dioscin (600 ng/ml for AML-12 and 800 ng/ml for HepG-2) for an additional 24 h. Then, the mRNA levels of IL-1β, IL-6 and TNF-α, and the protein levels of TLR4, MyD88, IRAK1, TRAF6, p-IKK, p-IκBα, p-NF-κB p65 and HMGB-1 were determined. 2.12. Inhibition of MyD88 The AML-12 cells and HepG-2 cells were plated into 6-well plates (5 × 104 cells/ml), and then exposed to MyD88 inhibitor ST2825 (20 μM) for 2 h [22]. After incubation, the cells were pretreated with different concentrations of dioscin (600 ng/ml for AML-12 and 800 ng/ml for HepG-2) and treated with LPS (100 ng/ml) for 24 h for further analysis. Then, the mRNA levels of IL-1β, IL-6 and TNF-α, and the protein levels of TLR4, MyD88, IRAK1, TRAF6, p-IKK, p-IκBα, p-NF-κB p65 and HMGB-1 were determined.
2.13. Statistical analyses Data were evaluated as the mean ± standard deviation (mean ± SD). Statistical analysis of the quantitative data for multiple group comparisons was performed using one-way analysis of variance (ANOVA) followed by Duncan's test, whereas paired comparisons were performed using the t-test with SPSS software (ver. 20.0; SPSS, Chicago, IL, USA). The results were considered to be significant at p b 0.05 or p b 0.01. 3. Results 3.1. Dioscin inhibits proliferation of the cells treated with LPS As shown in Fig. 1, dioscin at the concentrations of 75, 150, 300, 600, 1200 ng/ml for AML-12 cells, and 50, 100, 200, 400, 800 ng/ml for HepG-2 cells under 24 h treatment showed no statistically significant difference in cell viability. Compared with LPS group, dioscin
Fig. 3. Dioscin attenuates inflammation in vitro. (A) Effects of dioscin (150, 300 and 600 ng/ml) on the protein levels of TLR4, MyD88, IRAK1, TRAF6, IKK, IκB, NF-κB and HMGB-1 in AML-12 cells. (B) Effects of dioscin (200, 400 and 800 ng/ml) on the protein levels of TLR4, MyD88, IRAK1, TRAF6, p-IKK, p-IκBα, p-NF-κB p65 and HMGB-1 in HepG-2 cells. (C) Effects of dioscin (150, 300 and 600 ng/ml) on the mRNA levels of TNF-α, IL-1β and IL-6 in AML-12 cells. (D) Effects of dioscin (200, 400 and 800 ng/ml) on the mRNA levels of TNF-α, IL-1β and IL-6 in HepG-2 cells. Values are expressed as the mean ± SD (n = 3). *p b 0.05 and **p b 0.01 compared with model groups.
H. Yao et al. / International Immunopharmacology 36 (2016) 132–141
137
at the concentrations of 150, 300, 600 ng/ml for AML-12 cells, and 200, 400, 800 ng/ml for HepG-2 cells under 6, 12 and 24 h treatment significantly changed cell viability. Therefore, dioscin at the concentrations of 150, 300, 600 ng/ml for AML-12 cells, and 200, 400, 800 ng/ml for HepG-2 cells under 24 h treatment was selected to protect LPSinduced ALI. Under these conditions, dioscin effectively inhibited cell proliferation treated by LPS with time- and dose-dependent manners.
including large areas of extensive cell necrosis with loss of hepatic architecture and massive inflammatory cells infiltration around the blood vessels, which were all restored by dioscin. Further -more, the increased AST, ALT levels, and relative liver weight were also significantly attenuated by dioscin compared with model groups (Fig. 2C–D).
3.2. Dioscin rehabilitates LPS-induced acute liver injury in mice and rats
As shown in Fig. 3A–B, the expression levels of TLR4, MyD88, IRAK1, TRAF6, p-IKK, p-IκBα, p-NF-κB p65 and HMGB-1 in AML-12 and HepG-2 cells were significantly down-regulated by dioscin in a dose-dependent manner compared with model groups. In addition, the mRNA levels of
As shown in Fig. 2A–B, the liver in control group showed normal architecture, and apparent injuries were found in LPS-treated groups,
3.3. Dioscin attenuates inflammation in vitro
Fig. 4. Dioscin attenuates inflammation in vivo. (A–B) Effects of dioscin on the levels of TLR4 and MyD88 based on immunofluorescence assays (200× original magnification). (C) Effects of dioscin (20, 40, 80 mg/kg) on the expression levels of TLR4, MyD88, IRAK1, TRAF6, p-IKK, p-IκBα, p-NF-κB p65 and HMGB-1 in mice. (D) Effects of dioscin (15, 30, 60 mg/kg) on the expression levels of TLR4, MyD88, IRAK1, TRAF6, p-IKK, p-IκBα, p-NF-κB p65 and HMGB-1 in rats. (E) Effects of dioscin (20, 40, 80 mg/kg) on the mRNA levels of TNF-α, IL-1β and IL-6 in mice. (F) Effects of dioscin (15, 30, 60 mg/kg) on the mRNA levels of TNF-α, IL-1β and IL-6 in rats. Values are expressed as the mean ± SD (n = 3). *p b 0.05 and **p b 0.01 compared with model groups.
138
H. Yao et al. / International Immunopharmacology 36 (2016) 132–141
IL-1β, IL-6 and TNF-α were all significantly decreased by dioscin (Fig. 3C–D).
of MyD88, IRAK1, TRAF6, p-IKK, p-IκBα, p-NF-κB p65 and HMGB-1 were markedly decreased in dioscin-treated groups after transfection (Fig. 5C–D).
3.4. Dioscin attenuates inflammation in vivo 3.6. Dioscin inhibits MyD88 mediated-inflammation As shown in Fig. 4A–B, doscin clearly suppressed the expression levels of TLR4 and MyD88 based on immunofluorescence assays. The expression levels of TLR4, MyD88, IRAK1, TRAF6, p-IKK, p-IκBα, p-NFκB p65 and HMGB-1 in model groups were markedly increased compared with normal groups, which were all significantly down-regulated by dioscin (Fig. 4C–D). As shown in Fig. 4E–F, the increased mRNA levels of IL-1β, IL-6 and TNF-α were significantly decreased by dioscin (80 mg/kg in mice; 60 mg/kg in rats). Together, these data indicated that dioscin attenuated LPS-induced liver injury via down-regulating inflammation.
As shown in Fig. 6, treatment of the AML-12 and HepG-2 cells with ST2825 at 20 μM for 2 h significantly inhibited MyD88 expression, and the increased levels of MyD88, IRAK1, TRAF6, p-IKK, p-IκBα, p-NF-κB p65, HMGB-1, TNF-α, IL-1β and IL-6 caused by LPS were partially abolished by ST2825. No obvious changes in TLR4 expression were noted in the cells treated with ST2825. These results showed that the MyD88-dependent inhibition of inflammation by dioscin might be associated with TLR4/MyD88 pathway. 4. Discussion
3.5. Dioscin inhibits TLR4/MyD88 signal pathway As shown in Fig. 5A–B, doscin markedly suppressed the expression levels of TLR4 and MyD88 based on immunofluorescence assays. Compared with LPS groups, the expression level of TLR4 was downregulated in dioscin-treated groups after transfection. The protein levels
Liver injury can be caused by different agents including alcohols, chemicals and viruses [23]. LPS can induce inflammatory cytokine production and cause liver injury [24–26], which is a well-known experimental model to evaluate the effects and underlying mechanisms of drugs [27,28]. In the present paper, dioscin showed significant effects
Fig. 5. Dioscin adjusts TLR4-MyD88 signal pathway.(A–B) Effects of dioscin on TLR4 and MyD88 levels based on an immunofluorescence assay in AML-12 and HepG-2 cells (×400 original magnification). (C–D) Effects of dioscin on the expression levels of TLR4, MyD88, IRAK1, TRAF6, p-IKK, p-IκBα, p-NF-κB p65 and HMGB-1 in AML-12 and HepG-2 cells. *p b 0.05 and **p b 0.01 compared with model groups. ##p b 0.01 compared with LPS + TLR4 gene groups.
H. Yao et al. / International Immunopharmacology 36 (2016) 132–141
139
Fig. 6. Dioscin inhibits MyD88 mediated inflammation. (A–B) Effects of dioscin on the expression levels of TLR4, MyD88, IRAK1, TRAF6, p-IKK, p-IκBα, p-NF-κB p65 and HMGB-1 in AML-12 and HepG-2 cells. (C–D) Effects of dioscin on the mRNA levels of TNF-α, IL-1β and IL-6 in AML-12 and HepG-2 cells. Values are expressed as the mean ± SD (n = 3). *p b 0.05 and **p b 0.01 compared with model groups.
against LPS-induced ALI as evidenced by the improvement of the decreased AST, ALT levels, and the alleviation of histopathological changes. The mechanisms responsible for LPS-induced ALI are multi-factorial and complex, and recent studies have proven that TLR4 is highly expressed in LPS-induced ALI [29]. The TLR4 signal containing MyD88dependent and MyD88-independent pathways [30–32] associated with the occurrence and development of LPS-induced ALI may be a potential mediator of inflammation and innate activation [33,34]. The activation of TLR4 signal pathway is related to recognizing particular TLR ligands including LPS [35,36], and LPS/TLR4 signal is critically involved in LPS-induced ALI [37]. TLR4 combined with MyD88 leads to the activation of TNF receptor-associated factor 6 (TRAF6), interleukin-1 receptor-associated kinase 1 (IRAK1), phosphorylated inhibitor of nuclear factor κB kinase (p-IKK), phosphorylated inhibitor of nuclear factor κB alpha (p-IκBα), phosphorylated nuclear factor κB p65 (p-NFκB p65) and high-mobility group protein 1 (HMGB-1) [17,38,39]. Proinflammatory cytokines, including interleukins (IL-1β and IL-6)
and TNF-α, are produced by inflammatory cells, and their levels are strictly regulated by maintaining the balance between the proinflammatory and anti-inflammatory responses [40–42]. In these processes, NF-κB plays an important role in the regulation of inflammatory responses, and its activation leads to the expression of various proinflammatory cytokines including IL-1β, IL-6 and TNF-α [43,44]. In the present work, the anti-inflammatory capability of dioscin mainly resulted from the decreased levels of MyD88, IRAK1, TRAF6, p-IKK, p-IκBα, p-NF-κB p65, HMGB-1, TNF-α, IL-1β and IL-6 via reducingTLR4 expression. TLR4 has a critical role in LPS-induced liver injury independent of MyD88 [45]. The results of this study showed that dioscin significantly decreased the MyD88 levels, and pre-treatment with ST2825 apparently abolished the participation of dioscin in the down-regulation of MyD88. These data demonstrated that the decreased TLR4 expression by dioscin may underlie the decreased MyD88 level [22]. To clearly establish whether TLR4 gene overexpression can affect TNF-α, IL-1β and IL-6 production, we measured the TNF-α, IL-1β and IL-6 levels in AML-12 and HepG-2 cells following TLR4 overexpression. These results
140
H. Yao et al. / International Immunopharmacology 36 (2016) 132–141
Fig. 7. The schematic diagram of the mechanism of dioscin against LPS-induced acute liver injury. Dioscin decreased intracellular MyD88 level by down-regulating the expression of TLR4, leading to the attenuation of inflammation.
suggested that the alterations in TNF-α, IL-1β and IL-6 levels by dioscin may be mediated by TLR4. 5. Conclusion In conclusion, our results demonstrated that dioscin exhibited potent effect against LPS-induced inflammatory liver injury via TLR4/ MyD88 signal pathway (Fig. 7). Dioscin decreased MyD88 level via down-regulating TLR4 expression. These findings provide novel insights into the mechanisms of dioscin as a potent agent to treat acute inflammatory liver injury in the future. However, the deeply mechanisms and clinical applications of dioscin against inflammatory liver injury are needed further investigation. Conflict of interest The authors declare that there are no conflicts of interest. Acknowledgments This work was supported by the Program for Liaoning Innovative Research Team in University (LT2013019). References [1] N. Coant, M. Simon-Rudler, T. Gustot, M. Fasseu, S. Gandoura, K. Ragot, et al., Glycogen synthase kinase 3 involvement in the excessive proinflammatory response to LPS in patients with decompensated cirrhosis, J. Hepatol. 55 (2011) 784–793. [2] S.S. Zou, W. Yang, H.X. Yan, L.X. Yu, Y.Q. Li, F.Q. Wu, et al., Role of beta-catenin in regulating the balance between TNF-alpha- and Fas-induced acute liver injury, Cancer Lett. 335 (2013) 160–167. [3] T.R. Stoyanoff, J.S. Todaro, M.V. Aguirre, M.C. Zimmermann, N.C. Brandan, Amelioration of lipopolysaccharide-induced acute kidney injury by erythropoietin: involvement of mitochondria-regulated apoptosis, Toxicology 318 (2014) 13–21. [4] C.H. Yeh, J.J. Yang, M.L. Yang, Y.C. Li, Y.H. Kuan, Rutin decreases lipopolysaccharideinduced acute lung injury via inhibition of oxidative stress and the MAPK-NFkappaB pathway, Free Radic. Biol. Med. 69 (2014) 249–257. [5] B. Jawan, Y.H. Kao, S. Goto, M.C. Pan, Y.C. Lin, L.W. Hsu, et al., Propofol pretreatment attenuates LPS-induced granulocyte-macrophage colony-stimulating factor production in cultured hepatocytes by suppressing MAPK/ERK activity and NF-kappaB translocation, Toxicol. Appl. Pharm. 229 (2008) 362–373.
[6] H. Shi, L. Dong, J. Jiang, J. Zhao, G. Zhao, X. Dang, et al., Chlorogenic acid reduces liver inflammation and fibrosis through inhibition of toll-like receptor 4 signaling pathway, Toxicology 303 (2013) 107–114. [7] L. Lai, Y. Chen, X. Tian, X. Li, X. Zhang, J. Lei, et al., Artesunate alleviates hepatic fibrosis induced by multiple pathogenic factors and inflammation through the inhibition of LPS/TLR4/NF-kappaB signaling pathway in rats, Eur. J. Pharmacol. 765 (2015) 234–241. [8] N. Ding, Y. Zhang, P.A. Loughran, Q. Wang, A. Tsung, T.R. Billiar, TIFA upregulation after hypoxia-reoxygenation is TLR4- and MyD88-dependent and associated with HMGB1 upregulation and release, Free Radic. Biol. Med. 63 (2013) 361–367. [9] A.K. Singh, Y.B. Tripathi, N. Pandey, D.P. Singh, D. Tripathi, O.N. Srivastava, Enhanced antilipopolysaccharide (LPS) induced changes in macrophage functions by Rubia cordifolia (RC) embedded with Au nanoparticles, Free Radic. Biol. Med. 65 (2013) 217–223. [10] W. Jing, M. Chunhua, W. Shumin, Effects of acteoside on lipopolysaccharide -induced inflammation in acute lung injury via regulation of NF-kappaB pathway in vivo and in vitro, Toxicol. Appl. Pharmacol. 285 (2015) 128–135. [11] Y. Gao, X. Chen, L. Fang, F. Liu, R. Cai, C. Peng, Y. Qi, Rhein exerts pro- and antiinflammatory actions by targeting IKKbeta inhibition in LPS-activated macrophages, Free Radic. Biol. Med. 72 (2014) 104–112. [12] H. Dong, F.E. Lu, L. Zhao, Chinese herbal medicine in the treatment of nonalcoholic fatty liver disease, Chin. J. Integr. Med. 18 (2012) 152–160. [13] M.J. Kaskiw, M.L. Tassotto, M. Mok, S.L. Tokar, R. Pycko, J. Th'ng, et al., Structural analogues of diosgenyl saponins: synthesis and anticancer activity, Bioorg. Med. Chem. 17 (2009) 7670–7679. [14] B.N. Lu, L.H. Yin, L.N. Xu, J.Y. Peng, Application of proteomic and bioinformatic techniques for studying the hepatoprotective effect of dioscin against CCl4induced liver damage in mice, Planta Med. 77 (2011) 407–415. [15] X.M. Zhao, X.N. Cong, L.L. Zheng, L.N. Xu, L.H. Yin, J.Y. Peng, Dioscin, a natural steroid saponin, shows remarkable protective effect against acetaminophen-induced liver damage in vitro and in vivo, Toxicol. Lett. 214 (2012) 69–80. [16] L.N. Xu, Y.L. Wei, D.S. Dong, L.H. Yin, Y. Qi, X. Han, et al., iTRAQ-based proteomics for studying the effects of dioscin against nonalcoholic fatty liver disease in rats, RSC Adv. 4 (2014) 30704. [17] X.F. Tao, X.Y. Wan, Y.W. Xu, L.N. Xu, Y. Qi, L.H. Yin, et al., Dioscin attenuates hepatic ischemia–reperfusion injury in rats through inhibition of oxidative–nitrative stress, inflammation and apoptosis, Transplantation 98 (2014) 604–611. [18] X.L. Zhang, X. Han, L.H. Yin, L.N. Xu, Y. Qi, Y.W. Xu, et al., Potent effects of dioscin against liver fibrosis, Sci. Rep. 5 (2015) 9713. [19] T.T. Xu, L.L. Zheng, L.N. Xu, L.H. Yin, Y. Qi, Y.W. Xu, et al., Protective effects of dioscin against alcohol-induced liver injury, Arch. Toxicol. 88 (2014) 739–753. [20] M.M. Hu, L.N. Xu, L.H. Yin, Y. Qi, H. Li, Y.W. Xu, et al., Cytotoxicity of dioscin in human gastric carcinoma cells through death receptor and mitochondrial pathways, J. Appl. Toxicol. 33 (2013) 712–722. [21] L.H. Yin, L.N. Xu, X.N. Wang, B.N. Lu, Y.T. Liu, J.Y. Peng, An economical method for isolation of dioscin from Dioscorea nipponica Makino by HSCCC coupled with ELSD, and a computer-aided UNIFAC mathematical model, Chromatographia 71 (2010) 15–23. [22] F. Capolunghi, M.M. Rosado, S. Cascioli, E. Girolami, S. Bordasco, M. Vivarelli, et al., Pharmacological inhibition of TLR9 activation blocks autoantibody production in human B cells from SLE patients, Rheumatology 49 (2010) 2281–2289. [23] J. Mimura, K. Itoh, Role of Nrf2 in the pathogenesis of atherosclerosis, Free Radic. Biol. Med. 88 (2015) 221–232. [24] Y. Ijiri, R. Kato, M. Sadamatsu, M. Takano, Y. Okada, K. Tanaka, et al., Chronological changes in circulating levels of soluble tumor necrosis factor receptors 1 and 2 in rats with carbon tetrachloride-induced liver injury, Toxicology 316 (2014) 55–60. [25] M.M. Hossain, P.K. Sonsalla, J.R. Richardson, Coordinated role of voltage-gated sodium channels and the Na+/H+ exchanger in sustaining microglial activation during inflammation, Toxicol. Appl. Pharmcol. 273 (2013) 355–364. [26] M. Rana, S.S. Reddy, P. Maurya, V. Singh, S. Chaturvedi, K. Kaur, et al., Turmerone enriched standardized Curcuma longa extract alleviates LPS induced inflammation and cytokine production by regulating TLR4–IRAK1–ROS–MAPK–NFκB axis, J. Funct. Foods 16 (2015) 152–163. [27] M.L. Olleros, D. Vesin, A.L. Fotio, M.L. Santiago-Raber, S. Tauzin, D.E. Szymkowski, et al., Soluble TNF, but not membrane TNF, is critical in LPS-induced hepatitis, J. Hepatol. 53 (2010) 1059–1068. [28] A. Gandhi, T. Guo, P. Shah, B. Moorthy, R. Ghose, Chlorpromazine-induced hepatotoxicity during inflammation is mediated by TIRAP-dependent signaling pathway in mice, Toxicol. Appl. Pharmacol. 266 (2013) 430–438. [29] Y. Zhao, Q. Liu, L. Yang, D. He, L. Wang, J. Tian, et al., TLR4 inactivation protects from graft-versus-host disease after allogeneic hematopoietic stem cell transplantation, Cell. Mol. Immunol. 10 (2013) 165–175. [30] Y. Wang, Q. Tu, W. Yan, D. Xiao, Z. Zeng, Y. Ouyang, et al., CXC195 suppresses proliferation and inflammatory response in LPS-induced human hepatocellular carcinoma cells via regulating TLR4-MyD88-TAK1-mediated NF-kappaB and MAPK pathway, Biochem. Biophys. Res. Commun. 456 (2015) 373–379. [31] V.L. Massey, K.S. Stocke, R.H. Schmidt, M. Tan, N. Ajami, R.E. Neal, et al., Oligofructose protects against arsenic-induced liver injury in a model of environment/obesity interaction, Toxicol. Appl. Pharmacol. 284 (2015) 304–314. [32] W.H. Shin, M.T. Jeon, E. Leem, S.Y. Won, K.H. Jeong, S.J. Park, et al., Induction of microglial toll-like receptor 4 by prothrombin kringle-2: a potential pathogenic mechanism in Parkinson's disease, Sci. Rep. 5 (2015) 14764. [33] M. Imamura, H. Tsutsui, K. Yasuda, R. Uchiyama, S. Yumikura-Futatsugi, K. Mitani, et al., Contribution of TIR domain-containing adapter inducing IFN-beta -mediated IL-18 release to LPS-induced liver injury in mice, J. Hepatol. 51 (2009) 333–341.
H. Yao et al. / International Immunopharmacology 36 (2016) 132–141 [34] S. Gandoura, E. Weiss, P.E. Rautou, M. Fasseu, T. Gustot, F. Lemoine, et al., Gene- and exon-expression profiling reveals an extensive LPS-induced response in immune cells in patients with cirrhosis, J. Hepatol. 58 (2013) 936–948. [35] C. Liu, C. Zhang, R.E. Mitchel, J. Cui, J. Lin, Y. Yang, et al., A critical role of toll-like receptor 4 (TLR4) and its' in vivo ligands in basal radio-resistance, Cell Death Dis. 4 (2013), e649. [36] H. Guo, J. Sun, H. He, G.C. Yu, J. Du, Antihepatotoxic effect of corn peptides against Bacillus Calmette-Guerin/lipopolysaccharide-induced liver injury in mice, Food Chem. Toxicol. 47 (2009) 2431–2435. [37] Q. Gu, H. Guan, Q. Shi, Y. Zhang, H. Yang, Curcumin attenuated acute Propionibacterium acnes-induced liver injury through inhibition of HMGB1 expression in mice, Int. Immunopharmacol. 24 (2015) 159–165. [38] W. Zhao, G. Ma, X. Chen, Lipopolysaccharide induced LOX-1 expression via TLR4/ MyD88/ROS activated p38MAPK–NF-kappaB pathway, Vasc. Pharmacol. 63 (2014) 162–172. [39] A. Tao, J. Song, T. Lan, X. Xu, P. Kvietys, R. Kao, et al., Cardiomyocyte–fibroblast interaction contributes to diabetic cardiomyopathy in mice: role of HMGB1/TLR4/IL-33 axis, Biochim. Biophys. Acta (BBA) - Mol. Basis Dis. 1852 (2015) 2075–2085.
141
[40] S. Ramm, A. Mally, Role of drug-independent stress factors in liver injury associated with diclofenac intake, Toxicology 312 (2013) 83–96. [41] X. Shen, L. Yang, S. Yan, H. Zheng, L. Liang, X. Cai, et al., Fetuin A promotes lipotoxicity in beta cells through the TLR4 signaling pathway and the role of pioglitazone in anti-lipotoxicity, Mol. Cell. Endocrinol. 412 (2015) 1–11. [42] C. Wang, S. Song, Y. Zhang, Y. Ge, X. Fang, T. Huang, et al., Inhibition of the Rho/Rho kinase pathway prevents lipopolysaccharide-induced hyperalgesia and the release of TNF-alpha and IL-1beta in the mouse spinal cord, Sci. Rep. 5 (2015) 14553. [43] M. Li, F. Lin, Y. Lin, W. Peng, Extracellular polysaccharide from Bordetella species reduces high glucose-induced macrophage apoptosis via regulating interaction between caveolin-1 and TLR4, Biochem. Biophys. Res. Commun. 466 (2015) 748–754. [44] G. Moon, J. Kim, Y. Min, S.M. Wi, J.H. Shim, E. Chun, et al., Phosphoinositide-dependent kinase-1 inhibits TRAF6 ubiquitination by interrupting the formation of TAK1-TAB2 complex in TLR4 signaling, Cell. Signal. 27 (2015) 2524–2533. [45] P. Liu, F. Li, M. Qiu, L. He, Expression and cellular distribution of TLR4, MyD88, and NF-kappaB in diabetic renal tubulointerstitial fibrosis, in vitro and in vivo, Diabetes Res. Clin. Pract. 105 (2014) 206–216.
Contents lists available at ScienceDirect
International Immunopharmacology journal homepage: www.elsevier.com/locate/intimp
Dioscin reduces lipopolysaccharide-induced inflammatory liver injury via regulating TLR4/MyD88 signal pathway Hong Yao a,1, Changsheng Hu b,1, Lianhong Yin a, Xufeng Tao a, Lina Xu a, Yan Qi a, Xu Han a, Youwei Xu a, Yanyan Zhao a, Changyuan Wang a, Jinyong Peng a,⁎ a b
College of Pharmacy, Dalian Medical University, Western 9 Lvshunnan Road, Dalian 116044, China Huanggang Polytechnic College, No. 109 Taoyuan St., Nanhu Educational District, Huanggang City 438002, Hubei Province, China
a r t i c l e
i n f o
Article history: Received 17 January 2016 Received in revised form 30 March 2016 Accepted 18 April 2016 Available online xxxx Keywords: Acute liver injury Dioscin Lipopolysaccharide Inflammation TLR4/MyD88 signal pathway
a b s t r a c t We previously reported the effects of dioscin against carbon tetrachloride-, acetaminophen- and alcohol-induced acute liver damage. However, its effect on lipopolysaccharide (LPS)-induced inflammatory liver injury remains unknown. In the present work, liver injury in mice and rats was induced by LPS, and dioscin was intragastrically administered for 7 days. In vitro, the AML-12 cells and HepG-2 cells were treated with LPS after dioscin treatment. The results showed that dioscin not only markedly reduced serum ALT, AST levels and relative liver weights, but also restored cell injury caused by LPS. In mechanism study, dioscin significantly attenuated inflammation through down-regulating the levels of toll-like receptor (TLR) 4, myeloid differentiation factor 88 (MyD88), interleukin-1 receptor-associated kinase 1 (IRAK1), tumor necrosis factor receptor-associated factor 6 (TRAF6), phosphorylated inhibitor of nuclear factor κB kinase (p-IKK), phosphorylated inhibitor of nuclear factor κB alpha (p-IκBα), phosphorylated nuclear factor κB p65 (p-NF-κB p65), high-mobility group protein 1 (HMGB-1), interleukin (IL)-1, IL-6 and tumor necrosis factor-α (TNF-α). TLR4 overexpression was also decreased by dioscin, leading to the markedly decreased levels of MyD88, IRAK1, TRAF6, p-IKK, p-IκBα, p-NF-κB p65 and HMGB-1. Suppression of MyD88 by ST2825 eliminated the inhibitory effects of dioscin on the levels of IRAK1, TRAF6, p-IKK, p-IκBα, p-NF-κB p65, HMGB-1, IL-1β, IL-6 and TNF-α. Our results suggested that dioscin exhibited protective effect against LPS-induced liver injury via altering TLR4/MyD88 pathway, which should be developed as one potent candidate for the treatment of acute inflammatory liver injury in the future. © 2016 Elsevier B.V. All rights reserved.
1. Introduction Many factors can cause the activation of macrophages with an excessive production of pro-inflammatory cytokines including interleukin (IL)-1β, IL-6 and tumor necrosis factor-α (TNF-α), and consequently lead to liver injury [1]. Acute liver injury (ALI) associated with devastating consequences [2] can be caused by many chemicals. Lipopolysaccharide (LPS), which exists in the cell wall of gramnegative bacteria, is not only the cause of the serious global problem of sepsis, but also the most potent bioactivator of the immunological system [3,4]. The innate immune response is the first line of defense against microbial pathogens and their derivatives, and uncontrolled response of immune system to LPS can lead to septic shock and systemic inflammatory [5].
⁎ Corresponding author. E-mail address: [email protected] (J. Peng). 1 These authors contributed the same work to this paper and they are the co-first authors.
http://dx.doi.org/10.1016/j.intimp.2016.04.023 1567-5769/© 2016 Elsevier B.V. All rights reserved.
Although inflammation is present in virtually all patients with hepatic injury and correlates with injury progression, the molecular link between hepatic inflammation and injury remains elusive. Tolllike receptors (TLRs) constitute a highly conserved family of receptors which can recognize pathogen-associated molecular patterns and allow the host to detect microbial infection [6]. TLRs are not only important in regulating innate and adaptive immune response, but also associated with inflammatory liver diseases [7]. TLR4, one receptor for LPS, can trigger two different signaling pathways. One is a myeloid differentiation factor 88 (MyD88)-dependent pathway, which can lead to the activation of nuclear factor κB (NF-κB) and stimulate the production of proinflammatory cytokines, chemokines, and type I interferon [8]. Although many efforts have been made to determine the underlying mechanisms of ALI caused by LPS, ideal treatment methods remain controversial and uncertain. Therefore, it is urgent to develop new and potent drugs for the treatment of this condition. Herbal medicines have been used to treat hepatic injury for a long time, and many natural products, including rubia cordifolia, acteoside and rhein, have potent effects against LPS-induced hepatic injury [9–11]. Thus, it is reasonable
H. Yao et al. / International Immunopharmacology 36 (2016) 132–141
to explore new and effective natural products from medicinal herbs to treat LPS-induced ALI. Dioscin (Dio, shown in Fig. 1A), a plant steroid saponin, is widely prevalent in many herbs [12]. Pharmacological investigations have demonstrated that dioscin has anti-inflammatory, anti-tumor and anti-hyperlipidemic activities [13,14]. Our previous studies have shown that dioscin has remarkable effects against chemically-induced liver injury, non-alcoholic fatty liver disease (NAFLD), hepatic ischemia–reperfusion injury and liver fibrosis [15–18]. Furthermore, we have also found that dioscin has significantly protective effects against ethanol-induced liver injury [19]. However, it still remains unclear on the effect and molecular mechanism of dioscin against LPS-induced inflammatory liver injury.
133
Therefore, in the present work, the effects and possible mechanisms of dioscin against LPS-induced inflammatory liver injury were investigated. 2. Materials and methods 2.1. Chemicals Dioscin was prepared from Dioscorea nipponica Makino in our laboratory with the activity of over 98% analyzed by high-performance liquid chromatography [20,21]. Dioscin was dissolved with 0.1% dimethylsulfoxide (DMSO) for in vitro experiments, or with 0.5% carboxymethylcellulose sodium (CMC-Na) solution for in vivo tests.
Fig. 1. Dioscin inhibits cell proliferation treated with LPS. (A) The chemical structure of dioscin. (B) Effects of dioscin (75, 150, 300, 600, 1200, 2400 and 4800 ng/ml) on the cell viability of AML-12 cells for 24 h. (C) Effects of dioscin (150, 300 and 600 ng/ml) on the proliferation of AML-12 cells treated with LPS (100 ng/ml) for 6, 12 and 24 h. (D) Effects of dioscin (50, 100, 200, 400, 800, 1600 and 3200 ng/ml) on the cell viability of HepG-2 cells for 24 h. (E) Effects of dioscin (200, 400 and 800 ng/ml) on the proliferation of HepG-2 cells treated with LPS (100 ng/ml) for 6, 12 and 24 h. Data are presented as the mean ± SD (n = 5). *p b 0.05 and **p b 0.01 compared with model groups.
134
H. Yao et al. / International Immunopharmacology 36 (2016) 132–141
ST2825 was purchased from Sigma-Aldrich (St.Louis, MO, USA). Alanine aminotran-sferase (ALT) and aspartate aminotransferase (AST) kits were obtained from the Nanjing Jiancheng Institute of Biotechnology (Nanjing, China). A tissue protein extraction kit was obtained from Keygen Biotech. Co., Ltd. (Nanjing, China). A bicinchoninicacid (BCA) protein assay kit was purchased from the Beyotime Institute of Biotechnology (Jiangsu, China). Tris, SDS, CMC-Na and 4′,6′diamidino-2- phenylindole (DAPI) were purchased from Sigma (St.Louis, MO, USA). RNAiso Plus, a PrimeScript® RT Reagent Kit with gDNA Eraser (Perfect Real Time) and SYBR® Premix Ex Taq™ II (Tli RNase H Plus) were purchased from TaKaRa Biotechnology Co., Ltd. (Dalian, China).
2.2. Cell culture The alpha mouse liver 12 (AML-12) cells were obtained from American type culture collection (ATCC) (Manassas, VA, USA) and cultured in Dulbecco's modified Eagle's medium and Ham's F12 medium (Gibco, Carlsbad, CA, USA) with 0.005 mg/ml insulin, 0.005 mg/ml transferrin, 5 ng/ml selenium, 40 ng/ml dexamethasone and 10% fetal bovine serum (FBS) (Gibco, Carlsbad, CA, USA). The human hepatocellular carcinoma (HepG-2) cells were purchased from the Chinese Academy of Medical Sciences tumor cell libraries (Beijing, China) and cultured in Dulbecco's Modified Eagle's Medium containing 10% fetal bovine serum (FBS) (Gibco, Carlsbad, CA, USA). The cells were cultured in humidified environment containing 5% CO2 at 37 °C. AML-12 and HepG-2 cells were pretreated with different concentrations of dioscin (600, 300 and 150 ng/ml for AML-12; 800, 400 and 200 ng/ml for HepG-2) and treated with LPS (100 ng/ml) for 24 h.
2.3. Cell toxicity assay The AML-12 cells and HepG-2 cells were plated into 96-well plates at a density of 5 × 104 cells/ml for 24 h before treatment, and then incubated for another 24 h in the presence of different concentrations of dioscin (75, 150, 300, 600, 1200, 2400 and 4800 ng/ml for AML-12; 50, 100, 200, 400, 800, 1600 and 3200 ng/ml for HepG-2). The cell proliferation was measured using the MTT method.
2.4. Cell proliferation assay The AML-12 cells and HepG-2 cells were plated into 96-well plates at a density of 5 × 104 cells/ml for 24 h before treatment. The cells were incubated for 6, 12 and 24 h in the presence of different concentrations of dioscin (150, 300 and 600 ng/ml for AML-12; 200, 400 and 800 ng/ml for HepG-2) caused by LPS, and then measured using the MTT method.
2.5. LPS-induced inflammatory liver injury in vivo Male C57BL/6J mice (20 ± 2 g) and male Wistar rats (200 ± 20 g) were purchased from the Experimental Animal Centre of Dalian Medical University, Dalian, China (quality certificate number: SCXK (Liao) 2013–0003). After 1 week of acclimatization, the mice were randomly divided into five groups (n = 8 per group) as follows: control, model (LPS) and dioscin-treated (80, 40 and 20 mg/kg) groups. The rats were also randomly divided into five groups (n = 8 per group) as follows: control, model (LPS), and dioscin-treated (60, 30 and 15 mg/kg) groups. The animals were administered with dioscin for 7 consecutive days. Liver injury in mice and rats was induced by intraperitoneal (i.p.) LPS at the doses of 8 mg/kg and 5 mg/kg 2 h before the last administration. After 7 days, the animals were sacrificed. Then, the blood and liver tissue were collected and stored for further assay. In the test, all animals were housed in a controlled environment at 23 ± 2 °C under a 12-h dark/light cycle with free access to food and water. All experimental procedures were approved by the Animal Care and Use Committee of Dalian Medical University and performed in strict accordance with the People's Republic of China Legislation Regarding the Use and Care of Laboratory Animals. 2.6. Determination of serum AST and ALT levels The serum levels of AST and ALT were detected using a commercial clinical test kit based on the manufacturer's instructions. 2.7. Histological assay Liver tissues were fixed in 10% formalin and embedded in paraffin. Five-micron-thick sections were stained with hematoxylin-eosin (H&E). Images were acquired by light microscopy (Nikon Eclipse TE2000-U, Nikon, Japan), and the degree of liver injury was quantified using Image-Pro Plus 6.0 software. 2.8. Immunofluorescence assay Immunofluorescence staining of tissue slices or formal in-fixed cells for TLR4 and MyD88 was performed using primary antibodies (Santa Cruz, California, USA) in a humidified chamber at 4 °C overnight. After washing twice in PBS, the cells and liver tissue sections were incubated with a fluorescein-labelled secondary antibody for 1 h. Eventually, cell nuclei were stained with DAPI (5 μg/ml). All samples were imaged using a fluorescence microscope (Olympus, Tokyo, Japan). 2.9. Quantitative real-time PCR assay Total RNA samples from the cells and livers were extracted using RNAiso Plus reagent following the manufacturer's protocol. Reverse transcription for cDNA synthesis and quantitative real-time PCR were
Table 1 The primer sequences used for real-time PCR assay in the present work. Gene
GenBank accession
Forward primer (5′-3′)
Reverse primer (5′-3′)
Mouse GAPDH Mouse TNF-α Mouse IL1-β Mouse IL-6 Rat GAPDH Rat IL1-β Rat IL-6 Rat TNF-α Human GAPDH Human IL1-β Human IL-6 Human TNF-α
NM_008084.2 NM_013693.2 NM_008361.3 NM_031168.1 NM_017008.3 NM_031512.2 NM_012589.1 NM_012675.3 NM_002046.3 NM_000576.2 NM_000600.3 NM_000594.3
TGTGTCCGTCGTGGATCTGA TATGGCCCAGACCCTCACA TCCAGGATGAGGACATGAGCAC CCACTTCACAAGTCGGAGGCTTA GGCACAGTCAAGGCTGAGAATG CCCTGAACTCAACTGTGAAATAGCA ATTGTATGAACAGCGATGATGCAC TCAGTTCCATGGCCCAGAC GCACCGTCAAGGCTGAGAAC CTGAGCACCTTCTTTCCCTTCA TGGCTGAAAAAGATGGATGCT TGTAGCCCATGTTGTAGCAAACC
TTGCTGTTGAAGTCGCAGGAG GGAGTAGACAAGGTACAACCCATC GAACGTCACACACCAGCAGGTTA CCAGTTTGGTAGCATCCATCATTTC ATGGTGGTGAAGACGCCAGTA CCCAAGTCAAGGGCTTGGAA CCAGGTAGAAACGGAACTCCAGA GTTGTCTTTGAGATCCATGCCATT TGGTGAAGACGCCAGTGGA TGGACCAGACATCACCAAGCT TCTGCACAGCTCTGGCTTGT GAGGACCTGGGAGTAGATGAGGTA
H. Yao et al. / International Immunopharmacology 36 (2016) 132–141 Table 2 The information of the antibodies used in the present work. Antibody
Source
Dilutions
Company
GAPDH TLR4 MyD88 IRAK1 TRAF6 p-IKK p-IκBα p-NF-κB p65 HMGB-1
Rabbit Rabbit Rabbit Rabbit Rabbit Rabbit Rabbit Rabbit Rabbit
1:2000 1:1000 1:1000 1:1000 1:1000 1:1000 1:1000 1:1000 1:1000
Proteintech Group, Chicago, USA Proteintech Group, Chicago, USA Proteintech Group, Chicago, USA Proteintech Group, Chicago, USA Proteintech Group, Chicago, USA Santa Cruz, CA, USA Santa Cruz, CA, USA Proteintech Group, Chicago, USA Proteintech Group, Chicago, USA
performed as previously described. The forward (F) and reverse (R) primers for the tested genes are listed in Table 1. For each sample, the Ct values for the target gene and GAPDH (as a calibrator) were determined based on standard curves. The calculated relative Ct value of each gene was divided by the relative value of GAPDH. Then, the expression level of each gene in the control group was set to one-fold and used to determine the relative levels in the other samples (n-fold).
135
2.10. Western blotting assay The protein samples from the cells and liver tissues were extracted following standard protocols (Beyotime Biotechnology, Haimen, China), and the protein content was determined using a BCA Protein Assay Kit. Proteins were subjected to SDS-PAGE and then transferred to a nitrocellulose membrane. After blocking, the membranes were incubated for 1 h at room temperature or overnight at 4 °C. The primary antibodies are listed in Table 2. The blots were then incubated with horseradish peroxidise-conjugated antibodies for 2 h at room temperature at a 1:2000 dilution (Beyotime Institute of Biotechnology, China). Protein expression was detected by the enhanced chemiluminescence (ECL) method and imaged with a Bio-Spectrum Gel Imaging System (UVP, USA). To eliminate variations due to protein quantity and quality, the data were adjusted to GAPDH expression (IOD of objective protein versus IOD of GAPDH protein). 2.11. TLR4 gene transfection in cells The AML-12 cells and HepG-2 cells were transfected with pPICZATLR4 plasmid DNA using Lipofectamine Plus Reagent (Invitrogen Life Technologies, CA, USA) according to the manufacturer's instructions.
Fig. 2. Dioscin rehabilitates LPS-induced acute liver injury in mice and rats. (A–B) Effects of dioscin on LPS-induced liver injury based on H&E staining (200× original magnification). (C) Effects of dioscin (20, 40, 80 mg/kg) on the serum levels of AST, ALT, and the relative liver weight in mice. (D) Effects of dioscin (15, 30, 60 mg/kg) on the serum levels of AST, ALT, and the relative liver weight in rats. Values are expressed as the mean ± SD (n = 8). *p b 0.05 and **p b 0.01 compared with model groups.
136
H. Yao et al. / International Immunopharmacology 36 (2016) 132–141
Twenty-four hours after transfection, the cells were subjected to serum deprivation for 24 h before exposure to LPS (100 ng/ml) in the presence or absence of dioscin (600 ng/ml for AML-12 and 800 ng/ml for HepG-2) for an additional 24 h. Then, the mRNA levels of IL-1β, IL-6 and TNF-α, and the protein levels of TLR4, MyD88, IRAK1, TRAF6, p-IKK, p-IκBα, p-NF-κB p65 and HMGB-1 were determined. 2.12. Inhibition of MyD88 The AML-12 cells and HepG-2 cells were plated into 6-well plates (5 × 104 cells/ml), and then exposed to MyD88 inhibitor ST2825 (20 μM) for 2 h [22]. After incubation, the cells were pretreated with different concentrations of dioscin (600 ng/ml for AML-12 and 800 ng/ml for HepG-2) and treated with LPS (100 ng/ml) for 24 h for further analysis. Then, the mRNA levels of IL-1β, IL-6 and TNF-α, and the protein levels of TLR4, MyD88, IRAK1, TRAF6, p-IKK, p-IκBα, p-NF-κB p65 and HMGB-1 were determined.
2.13. Statistical analyses Data were evaluated as the mean ± standard deviation (mean ± SD). Statistical analysis of the quantitative data for multiple group comparisons was performed using one-way analysis of variance (ANOVA) followed by Duncan's test, whereas paired comparisons were performed using the t-test with SPSS software (ver. 20.0; SPSS, Chicago, IL, USA). The results were considered to be significant at p b 0.05 or p b 0.01. 3. Results 3.1. Dioscin inhibits proliferation of the cells treated with LPS As shown in Fig. 1, dioscin at the concentrations of 75, 150, 300, 600, 1200 ng/ml for AML-12 cells, and 50, 100, 200, 400, 800 ng/ml for HepG-2 cells under 24 h treatment showed no statistically significant difference in cell viability. Compared with LPS group, dioscin
Fig. 3. Dioscin attenuates inflammation in vitro. (A) Effects of dioscin (150, 300 and 600 ng/ml) on the protein levels of TLR4, MyD88, IRAK1, TRAF6, IKK, IκB, NF-κB and HMGB-1 in AML-12 cells. (B) Effects of dioscin (200, 400 and 800 ng/ml) on the protein levels of TLR4, MyD88, IRAK1, TRAF6, p-IKK, p-IκBα, p-NF-κB p65 and HMGB-1 in HepG-2 cells. (C) Effects of dioscin (150, 300 and 600 ng/ml) on the mRNA levels of TNF-α, IL-1β and IL-6 in AML-12 cells. (D) Effects of dioscin (200, 400 and 800 ng/ml) on the mRNA levels of TNF-α, IL-1β and IL-6 in HepG-2 cells. Values are expressed as the mean ± SD (n = 3). *p b 0.05 and **p b 0.01 compared with model groups.
H. Yao et al. / International Immunopharmacology 36 (2016) 132–141
137
at the concentrations of 150, 300, 600 ng/ml for AML-12 cells, and 200, 400, 800 ng/ml for HepG-2 cells under 6, 12 and 24 h treatment significantly changed cell viability. Therefore, dioscin at the concentrations of 150, 300, 600 ng/ml for AML-12 cells, and 200, 400, 800 ng/ml for HepG-2 cells under 24 h treatment was selected to protect LPSinduced ALI. Under these conditions, dioscin effectively inhibited cell proliferation treated by LPS with time- and dose-dependent manners.
including large areas of extensive cell necrosis with loss of hepatic architecture and massive inflammatory cells infiltration around the blood vessels, which were all restored by dioscin. Further -more, the increased AST, ALT levels, and relative liver weight were also significantly attenuated by dioscin compared with model groups (Fig. 2C–D).
3.2. Dioscin rehabilitates LPS-induced acute liver injury in mice and rats
As shown in Fig. 3A–B, the expression levels of TLR4, MyD88, IRAK1, TRAF6, p-IKK, p-IκBα, p-NF-κB p65 and HMGB-1 in AML-12 and HepG-2 cells were significantly down-regulated by dioscin in a dose-dependent manner compared with model groups. In addition, the mRNA levels of
As shown in Fig. 2A–B, the liver in control group showed normal architecture, and apparent injuries were found in LPS-treated groups,
3.3. Dioscin attenuates inflammation in vitro
Fig. 4. Dioscin attenuates inflammation in vivo. (A–B) Effects of dioscin on the levels of TLR4 and MyD88 based on immunofluorescence assays (200× original magnification). (C) Effects of dioscin (20, 40, 80 mg/kg) on the expression levels of TLR4, MyD88, IRAK1, TRAF6, p-IKK, p-IκBα, p-NF-κB p65 and HMGB-1 in mice. (D) Effects of dioscin (15, 30, 60 mg/kg) on the expression levels of TLR4, MyD88, IRAK1, TRAF6, p-IKK, p-IκBα, p-NF-κB p65 and HMGB-1 in rats. (E) Effects of dioscin (20, 40, 80 mg/kg) on the mRNA levels of TNF-α, IL-1β and IL-6 in mice. (F) Effects of dioscin (15, 30, 60 mg/kg) on the mRNA levels of TNF-α, IL-1β and IL-6 in rats. Values are expressed as the mean ± SD (n = 3). *p b 0.05 and **p b 0.01 compared with model groups.
138
H. Yao et al. / International Immunopharmacology 36 (2016) 132–141
IL-1β, IL-6 and TNF-α were all significantly decreased by dioscin (Fig. 3C–D).
of MyD88, IRAK1, TRAF6, p-IKK, p-IκBα, p-NF-κB p65 and HMGB-1 were markedly decreased in dioscin-treated groups after transfection (Fig. 5C–D).
3.4. Dioscin attenuates inflammation in vivo 3.6. Dioscin inhibits MyD88 mediated-inflammation As shown in Fig. 4A–B, doscin clearly suppressed the expression levels of TLR4 and MyD88 based on immunofluorescence assays. The expression levels of TLR4, MyD88, IRAK1, TRAF6, p-IKK, p-IκBα, p-NFκB p65 and HMGB-1 in model groups were markedly increased compared with normal groups, which were all significantly down-regulated by dioscin (Fig. 4C–D). As shown in Fig. 4E–F, the increased mRNA levels of IL-1β, IL-6 and TNF-α were significantly decreased by dioscin (80 mg/kg in mice; 60 mg/kg in rats). Together, these data indicated that dioscin attenuated LPS-induced liver injury via down-regulating inflammation.
As shown in Fig. 6, treatment of the AML-12 and HepG-2 cells with ST2825 at 20 μM for 2 h significantly inhibited MyD88 expression, and the increased levels of MyD88, IRAK1, TRAF6, p-IKK, p-IκBα, p-NF-κB p65, HMGB-1, TNF-α, IL-1β and IL-6 caused by LPS were partially abolished by ST2825. No obvious changes in TLR4 expression were noted in the cells treated with ST2825. These results showed that the MyD88-dependent inhibition of inflammation by dioscin might be associated with TLR4/MyD88 pathway. 4. Discussion
3.5. Dioscin inhibits TLR4/MyD88 signal pathway As shown in Fig. 5A–B, doscin markedly suppressed the expression levels of TLR4 and MyD88 based on immunofluorescence assays. Compared with LPS groups, the expression level of TLR4 was downregulated in dioscin-treated groups after transfection. The protein levels
Liver injury can be caused by different agents including alcohols, chemicals and viruses [23]. LPS can induce inflammatory cytokine production and cause liver injury [24–26], which is a well-known experimental model to evaluate the effects and underlying mechanisms of drugs [27,28]. In the present paper, dioscin showed significant effects
Fig. 5. Dioscin adjusts TLR4-MyD88 signal pathway.(A–B) Effects of dioscin on TLR4 and MyD88 levels based on an immunofluorescence assay in AML-12 and HepG-2 cells (×400 original magnification). (C–D) Effects of dioscin on the expression levels of TLR4, MyD88, IRAK1, TRAF6, p-IKK, p-IκBα, p-NF-κB p65 and HMGB-1 in AML-12 and HepG-2 cells. *p b 0.05 and **p b 0.01 compared with model groups. ##p b 0.01 compared with LPS + TLR4 gene groups.
H. Yao et al. / International Immunopharmacology 36 (2016) 132–141
139
Fig. 6. Dioscin inhibits MyD88 mediated inflammation. (A–B) Effects of dioscin on the expression levels of TLR4, MyD88, IRAK1, TRAF6, p-IKK, p-IκBα, p-NF-κB p65 and HMGB-1 in AML-12 and HepG-2 cells. (C–D) Effects of dioscin on the mRNA levels of TNF-α, IL-1β and IL-6 in AML-12 and HepG-2 cells. Values are expressed as the mean ± SD (n = 3). *p b 0.05 and **p b 0.01 compared with model groups.
against LPS-induced ALI as evidenced by the improvement of the decreased AST, ALT levels, and the alleviation of histopathological changes. The mechanisms responsible for LPS-induced ALI are multi-factorial and complex, and recent studies have proven that TLR4 is highly expressed in LPS-induced ALI [29]. The TLR4 signal containing MyD88dependent and MyD88-independent pathways [30–32] associated with the occurrence and development of LPS-induced ALI may be a potential mediator of inflammation and innate activation [33,34]. The activation of TLR4 signal pathway is related to recognizing particular TLR ligands including LPS [35,36], and LPS/TLR4 signal is critically involved in LPS-induced ALI [37]. TLR4 combined with MyD88 leads to the activation of TNF receptor-associated factor 6 (TRAF6), interleukin-1 receptor-associated kinase 1 (IRAK1), phosphorylated inhibitor of nuclear factor κB kinase (p-IKK), phosphorylated inhibitor of nuclear factor κB alpha (p-IκBα), phosphorylated nuclear factor κB p65 (p-NFκB p65) and high-mobility group protein 1 (HMGB-1) [17,38,39]. Proinflammatory cytokines, including interleukins (IL-1β and IL-6)
and TNF-α, are produced by inflammatory cells, and their levels are strictly regulated by maintaining the balance between the proinflammatory and anti-inflammatory responses [40–42]. In these processes, NF-κB plays an important role in the regulation of inflammatory responses, and its activation leads to the expression of various proinflammatory cytokines including IL-1β, IL-6 and TNF-α [43,44]. In the present work, the anti-inflammatory capability of dioscin mainly resulted from the decreased levels of MyD88, IRAK1, TRAF6, p-IKK, p-IκBα, p-NF-κB p65, HMGB-1, TNF-α, IL-1β and IL-6 via reducingTLR4 expression. TLR4 has a critical role in LPS-induced liver injury independent of MyD88 [45]. The results of this study showed that dioscin significantly decreased the MyD88 levels, and pre-treatment with ST2825 apparently abolished the participation of dioscin in the down-regulation of MyD88. These data demonstrated that the decreased TLR4 expression by dioscin may underlie the decreased MyD88 level [22]. To clearly establish whether TLR4 gene overexpression can affect TNF-α, IL-1β and IL-6 production, we measured the TNF-α, IL-1β and IL-6 levels in AML-12 and HepG-2 cells following TLR4 overexpression. These results
140
H. Yao et al. / International Immunopharmacology 36 (2016) 132–141
Fig. 7. The schematic diagram of the mechanism of dioscin against LPS-induced acute liver injury. Dioscin decreased intracellular MyD88 level by down-regulating the expression of TLR4, leading to the attenuation of inflammation.
suggested that the alterations in TNF-α, IL-1β and IL-6 levels by dioscin may be mediated by TLR4. 5. Conclusion In conclusion, our results demonstrated that dioscin exhibited potent effect against LPS-induced inflammatory liver injury via TLR4/ MyD88 signal pathway (Fig. 7). Dioscin decreased MyD88 level via down-regulating TLR4 expression. These findings provide novel insights into the mechanisms of dioscin as a potent agent to treat acute inflammatory liver injury in the future. However, the deeply mechanisms and clinical applications of dioscin against inflammatory liver injury are needed further investigation. Conflict of interest The authors declare that there are no conflicts of interest. Acknowledgments This work was supported by the Program for Liaoning Innovative Research Team in University (LT2013019). References [1] N. Coant, M. Simon-Rudler, T. Gustot, M. Fasseu, S. Gandoura, K. Ragot, et al., Glycogen synthase kinase 3 involvement in the excessive proinflammatory response to LPS in patients with decompensated cirrhosis, J. Hepatol. 55 (2011) 784–793. [2] S.S. Zou, W. Yang, H.X. Yan, L.X. Yu, Y.Q. Li, F.Q. Wu, et al., Role of beta-catenin in regulating the balance between TNF-alpha- and Fas-induced acute liver injury, Cancer Lett. 335 (2013) 160–167. [3] T.R. Stoyanoff, J.S. Todaro, M.V. Aguirre, M.C. Zimmermann, N.C. Brandan, Amelioration of lipopolysaccharide-induced acute kidney injury by erythropoietin: involvement of mitochondria-regulated apoptosis, Toxicology 318 (2014) 13–21. [4] C.H. Yeh, J.J. Yang, M.L. Yang, Y.C. Li, Y.H. Kuan, Rutin decreases lipopolysaccharideinduced acute lung injury via inhibition of oxidative stress and the MAPK-NFkappaB pathway, Free Radic. Biol. Med. 69 (2014) 249–257. [5] B. Jawan, Y.H. Kao, S. Goto, M.C. Pan, Y.C. Lin, L.W. Hsu, et al., Propofol pretreatment attenuates LPS-induced granulocyte-macrophage colony-stimulating factor production in cultured hepatocytes by suppressing MAPK/ERK activity and NF-kappaB translocation, Toxicol. Appl. Pharm. 229 (2008) 362–373.
[6] H. Shi, L. Dong, J. Jiang, J. Zhao, G. Zhao, X. Dang, et al., Chlorogenic acid reduces liver inflammation and fibrosis through inhibition of toll-like receptor 4 signaling pathway, Toxicology 303 (2013) 107–114. [7] L. Lai, Y. Chen, X. Tian, X. Li, X. Zhang, J. Lei, et al., Artesunate alleviates hepatic fibrosis induced by multiple pathogenic factors and inflammation through the inhibition of LPS/TLR4/NF-kappaB signaling pathway in rats, Eur. J. Pharmacol. 765 (2015) 234–241. [8] N. Ding, Y. Zhang, P.A. Loughran, Q. Wang, A. Tsung, T.R. Billiar, TIFA upregulation after hypoxia-reoxygenation is TLR4- and MyD88-dependent and associated with HMGB1 upregulation and release, Free Radic. Biol. Med. 63 (2013) 361–367. [9] A.K. Singh, Y.B. Tripathi, N. Pandey, D.P. Singh, D. Tripathi, O.N. Srivastava, Enhanced antilipopolysaccharide (LPS) induced changes in macrophage functions by Rubia cordifolia (RC) embedded with Au nanoparticles, Free Radic. Biol. Med. 65 (2013) 217–223. [10] W. Jing, M. Chunhua, W. Shumin, Effects of acteoside on lipopolysaccharide -induced inflammation in acute lung injury via regulation of NF-kappaB pathway in vivo and in vitro, Toxicol. Appl. Pharmacol. 285 (2015) 128–135. [11] Y. Gao, X. Chen, L. Fang, F. Liu, R. Cai, C. Peng, Y. Qi, Rhein exerts pro- and antiinflammatory actions by targeting IKKbeta inhibition in LPS-activated macrophages, Free Radic. Biol. Med. 72 (2014) 104–112. [12] H. Dong, F.E. Lu, L. Zhao, Chinese herbal medicine in the treatment of nonalcoholic fatty liver disease, Chin. J. Integr. Med. 18 (2012) 152–160. [13] M.J. Kaskiw, M.L. Tassotto, M. Mok, S.L. Tokar, R. Pycko, J. Th'ng, et al., Structural analogues of diosgenyl saponins: synthesis and anticancer activity, Bioorg. Med. Chem. 17 (2009) 7670–7679. [14] B.N. Lu, L.H. Yin, L.N. Xu, J.Y. Peng, Application of proteomic and bioinformatic techniques for studying the hepatoprotective effect of dioscin against CCl4induced liver damage in mice, Planta Med. 77 (2011) 407–415. [15] X.M. Zhao, X.N. Cong, L.L. Zheng, L.N. Xu, L.H. Yin, J.Y. Peng, Dioscin, a natural steroid saponin, shows remarkable protective effect against acetaminophen-induced liver damage in vitro and in vivo, Toxicol. Lett. 214 (2012) 69–80. [16] L.N. Xu, Y.L. Wei, D.S. Dong, L.H. Yin, Y. Qi, X. Han, et al., iTRAQ-based proteomics for studying the effects of dioscin against nonalcoholic fatty liver disease in rats, RSC Adv. 4 (2014) 30704. [17] X.F. Tao, X.Y. Wan, Y.W. Xu, L.N. Xu, Y. Qi, L.H. Yin, et al., Dioscin attenuates hepatic ischemia–reperfusion injury in rats through inhibition of oxidative–nitrative stress, inflammation and apoptosis, Transplantation 98 (2014) 604–611. [18] X.L. Zhang, X. Han, L.H. Yin, L.N. Xu, Y. Qi, Y.W. Xu, et al., Potent effects of dioscin against liver fibrosis, Sci. Rep. 5 (2015) 9713. [19] T.T. Xu, L.L. Zheng, L.N. Xu, L.H. Yin, Y. Qi, Y.W. Xu, et al., Protective effects of dioscin against alcohol-induced liver injury, Arch. Toxicol. 88 (2014) 739–753. [20] M.M. Hu, L.N. Xu, L.H. Yin, Y. Qi, H. Li, Y.W. Xu, et al., Cytotoxicity of dioscin in human gastric carcinoma cells through death receptor and mitochondrial pathways, J. Appl. Toxicol. 33 (2013) 712–722. [21] L.H. Yin, L.N. Xu, X.N. Wang, B.N. Lu, Y.T. Liu, J.Y. Peng, An economical method for isolation of dioscin from Dioscorea nipponica Makino by HSCCC coupled with ELSD, and a computer-aided UNIFAC mathematical model, Chromatographia 71 (2010) 15–23. [22] F. Capolunghi, M.M. Rosado, S. Cascioli, E. Girolami, S. Bordasco, M. Vivarelli, et al., Pharmacological inhibition of TLR9 activation blocks autoantibody production in human B cells from SLE patients, Rheumatology 49 (2010) 2281–2289. [23] J. Mimura, K. Itoh, Role of Nrf2 in the pathogenesis of atherosclerosis, Free Radic. Biol. Med. 88 (2015) 221–232. [24] Y. Ijiri, R. Kato, M. Sadamatsu, M. Takano, Y. Okada, K. Tanaka, et al., Chronological changes in circulating levels of soluble tumor necrosis factor receptors 1 and 2 in rats with carbon tetrachloride-induced liver injury, Toxicology 316 (2014) 55–60. [25] M.M. Hossain, P.K. Sonsalla, J.R. Richardson, Coordinated role of voltage-gated sodium channels and the Na+/H+ exchanger in sustaining microglial activation during inflammation, Toxicol. Appl. Pharmcol. 273 (2013) 355–364. [26] M. Rana, S.S. Reddy, P. Maurya, V. Singh, S. Chaturvedi, K. Kaur, et al., Turmerone enriched standardized Curcuma longa extract alleviates LPS induced inflammation and cytokine production by regulating TLR4–IRAK1–ROS–MAPK–NFκB axis, J. Funct. Foods 16 (2015) 152–163. [27] M.L. Olleros, D. Vesin, A.L. Fotio, M.L. Santiago-Raber, S. Tauzin, D.E. Szymkowski, et al., Soluble TNF, but not membrane TNF, is critical in LPS-induced hepatitis, J. Hepatol. 53 (2010) 1059–1068. [28] A. Gandhi, T. Guo, P. Shah, B. Moorthy, R. Ghose, Chlorpromazine-induced hepatotoxicity during inflammation is mediated by TIRAP-dependent signaling pathway in mice, Toxicol. Appl. Pharmacol. 266 (2013) 430–438. [29] Y. Zhao, Q. Liu, L. Yang, D. He, L. Wang, J. Tian, et al., TLR4 inactivation protects from graft-versus-host disease after allogeneic hematopoietic stem cell transplantation, Cell. Mol. Immunol. 10 (2013) 165–175. [30] Y. Wang, Q. Tu, W. Yan, D. Xiao, Z. Zeng, Y. Ouyang, et al., CXC195 suppresses proliferation and inflammatory response in LPS-induced human hepatocellular carcinoma cells via regulating TLR4-MyD88-TAK1-mediated NF-kappaB and MAPK pathway, Biochem. Biophys. Res. Commun. 456 (2015) 373–379. [31] V.L. Massey, K.S. Stocke, R.H. Schmidt, M. Tan, N. Ajami, R.E. Neal, et al., Oligofructose protects against arsenic-induced liver injury in a model of environment/obesity interaction, Toxicol. Appl. Pharmacol. 284 (2015) 304–314. [32] W.H. Shin, M.T. Jeon, E. Leem, S.Y. Won, K.H. Jeong, S.J. Park, et al., Induction of microglial toll-like receptor 4 by prothrombin kringle-2: a potential pathogenic mechanism in Parkinson's disease, Sci. Rep. 5 (2015) 14764. [33] M. Imamura, H. Tsutsui, K. Yasuda, R. Uchiyama, S. Yumikura-Futatsugi, K. Mitani, et al., Contribution of TIR domain-containing adapter inducing IFN-beta -mediated IL-18 release to LPS-induced liver injury in mice, J. Hepatol. 51 (2009) 333–341.
H. Yao et al. / International Immunopharmacology 36 (2016) 132–141 [34] S. Gandoura, E. Weiss, P.E. Rautou, M. Fasseu, T. Gustot, F. Lemoine, et al., Gene- and exon-expression profiling reveals an extensive LPS-induced response in immune cells in patients with cirrhosis, J. Hepatol. 58 (2013) 936–948. [35] C. Liu, C. Zhang, R.E. Mitchel, J. Cui, J. Lin, Y. Yang, et al., A critical role of toll-like receptor 4 (TLR4) and its' in vivo ligands in basal radio-resistance, Cell Death Dis. 4 (2013), e649. [36] H. Guo, J. Sun, H. He, G.C. Yu, J. Du, Antihepatotoxic effect of corn peptides against Bacillus Calmette-Guerin/lipopolysaccharide-induced liver injury in mice, Food Chem. Toxicol. 47 (2009) 2431–2435. [37] Q. Gu, H. Guan, Q. Shi, Y. Zhang, H. Yang, Curcumin attenuated acute Propionibacterium acnes-induced liver injury through inhibition of HMGB1 expression in mice, Int. Immunopharmacol. 24 (2015) 159–165. [38] W. Zhao, G. Ma, X. Chen, Lipopolysaccharide induced LOX-1 expression via TLR4/ MyD88/ROS activated p38MAPK–NF-kappaB pathway, Vasc. Pharmacol. 63 (2014) 162–172. [39] A. Tao, J. Song, T. Lan, X. Xu, P. Kvietys, R. Kao, et al., Cardiomyocyte–fibroblast interaction contributes to diabetic cardiomyopathy in mice: role of HMGB1/TLR4/IL-33 axis, Biochim. Biophys. Acta (BBA) - Mol. Basis Dis. 1852 (2015) 2075–2085.
141
[40] S. Ramm, A. Mally, Role of drug-independent stress factors in liver injury associated with diclofenac intake, Toxicology 312 (2013) 83–96. [41] X. Shen, L. Yang, S. Yan, H. Zheng, L. Liang, X. Cai, et al., Fetuin A promotes lipotoxicity in beta cells through the TLR4 signaling pathway and the role of pioglitazone in anti-lipotoxicity, Mol. Cell. Endocrinol. 412 (2015) 1–11. [42] C. Wang, S. Song, Y. Zhang, Y. Ge, X. Fang, T. Huang, et al., Inhibition of the Rho/Rho kinase pathway prevents lipopolysaccharide-induced hyperalgesia and the release of TNF-alpha and IL-1beta in the mouse spinal cord, Sci. Rep. 5 (2015) 14553. [43] M. Li, F. Lin, Y. Lin, W. Peng, Extracellular polysaccharide from Bordetella species reduces high glucose-induced macrophage apoptosis via regulating interaction between caveolin-1 and TLR4, Biochem. Biophys. Res. Commun. 466 (2015) 748–754. [44] G. Moon, J. Kim, Y. Min, S.M. Wi, J.H. Shim, E. Chun, et al., Phosphoinositide-dependent kinase-1 inhibits TRAF6 ubiquitination by interrupting the formation of TAK1-TAB2 complex in TLR4 signaling, Cell. Signal. 27 (2015) 2524–2533. [45] P. Liu, F. Li, M. Qiu, L. He, Expression and cellular distribution of TLR4, MyD88, and NF-kappaB in diabetic renal tubulointerstitial fibrosis, in vitro and in vivo, Diabetes Res. Clin. Pract. 105 (2014) 206–216.