Dipeptidase 1: a candidate tumor-specific molecular marker in colorectal carcinoma

Cancer Letters 209 (2004) 67–74 www.elsevier.com/locate/canlet

Dipeptidase 1: a candidate tumor-specific molecular marker in colorectal carcinoma C.M. McIvera,c, J.M. Lloyda, P.J. Hewettb, J.E. Hardinghama,c,* a

Department of Haematology-Oncology, The Basil Hetzel Institute, The Queen Elizabeth Hospital, 28 Woodville Rd, Woodville, SA, 5011, Australia b Department of Surgery, The Basil Hetzel Institute, The Queen Elizabeth Hospital, 28 Woodville Rd, Woodville, SA, 5011, Australia c Department of Physiology, Adelaide University, Adelaide, SA 5006, Australia Received 18 July 2003; received in revised form 17 November 2003; accepted 25 November 2003

Abstract The aim of this study was to identify tumor-specific markers for the detection of rare disseminated colorectal tumor cells in peripheral venous blood and in intra-peritoneal saline lavage samples collected before and after resection of colorectal tumors. Using cDNA micro-array screening, we found dipeptidase 1 (DPEP1) to be highly expressed in colon tumors compared to matched normal mucosa. Relative reverse transcriptase (RT)-PCR showed that DPEP1 was over-expressed by $ 2 fold in colon tumor compared to normal colonic mucosal tissue in 56/68 (82%) patients. Using immunobead RT-PCR, a technique that first enriches for epithelial cells, we found DPEP1 positive cells in intra-peritoneal lavage and venous blood samples from 15/38 (39%) colorectal cancer cases. This is the first report of DPEP1 as a marker for disseminated colon tumor cells. q 2004 Elsevier Ireland Ltd. All rights reserved. Keywords: Dipeptidase1; Colorectal cancer; Molecular marker; Over-expression; cDNA micro-array

1. Introduction The development of techniques for the accurate staging of colorectal cancer (CRC) may enable clinicians to make more appropriate decisions about treatment options. To date, the majority of staging systems rely on histological examination of the tumor and surrounding lymph nodes. Staging systems based * Corresponding author. Address: Department of HaematologyOncology, The Basil Hetzel Institute, The Queen Elizabeth Hospital, 28 Woodville Rd, Woodville, SA 5011, Australia. Tel.: þ 61-882226142; fax: þ 61-88226144. E-mail address: [email protected] (J.E. Hardingham).

on these variables are not always reliable for the prediction of patient outcome, particularly as patients diagnosed within the same stage may have markedly different disease outcomes [1]. The detection of tumor cells in peripheral blood and intra-peritoneal lavage samples has the potential to identify early stage CRC patients at risk of recurrent or metastatic disease. Tumor cells have been detected in blood samples from various carcinomas including breast [2], prostate [3], and colorectal [4]. Previously our laboratory developed a sensitive technique, immunobead RT-PCR, to detect minimal numbers of tumor cells in blood. This technique uses immuno-magnetic beads for

0304-3835/$ - see front matter q 2004 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.canlet.2003.11.033

68

C.M. McIver et al. / Cancer Letters 209 (2004) 67–74

the enrichment of epithelial cells and RT-PCR for the epithelial-specific markers MUC1, MUC2, CK19 and CK20 [5 – 8]. Circulating tumor cells were detected in pre-operative peripheral blood samples from 19/94 CRC patients. Those patients in whom marker positive cells were detected had a significantly shorter overall survival ðP , 0:0001Þ than patients who were negative. However, positive expression of these markers was also found in 4/34 blood samples from patients with benign inflammatory bowel disease [8]. Castells et al. (1998) [14] also found positive expression for carcinoembryonic antigen (CEA) in 5/9 blood samples from patients with benign inflammatory bowel disease [9]. The current study aimed to identify a tumor-specific marker for use in immunobead RT-PCR. We used 8 K human cDNA micro-arrays to identify genes with the greatest differential expression between colon tumor and matched normal mucosa. Our findings were confirmed by using the digital gene expression displayer (DGED) tool from the Cancer Genome Anatomy Project (CGAP) website [10] and relative RT-PCR. From these analyses we identified dipeptidase 1 (DPEP1) as a potential tumor-specific marker. DPEP1 has been previously found to be a zinc metalloprotease [11], however, its role in colon cancer is yet to be determined. Here we describe the overexpression of DPEP1 in a large cohort of primary colorectal tumors compared to match normal colonic mucosa. This finding suggests that DPEP1 expression may be appropriate for use as a molecular marker to identify disseminated tumor cells in CRC patients at risk of developing metastatic disease.

2. Materials and methods 2.1. Collection of patient samples Human colon tissue samples were collected from 68 patients (median age 71 years, range 41– 92) undergoing colorectal surgery at The Queen Elizabeth Hospital. Samples were obtained from tumor and matched normal mucosa adjacent to the resected margin. Normal colonic mucosa was dissociated from the underlying muscle and connective tissue. Samples were cut immediately after colon resection and snap frozen in liquid nitrogen. The remaining resected

colon was sent for histopathological analysis. Tumors were staged according to the Australian Clinical Pathological Staging (ACPS) system [23]. Peripheral venous blood (20 ml) was collected pre- and postsurgery from another 38 patients also undergoing surgery for CRC and in 15 patients undergoing bowel resection for benign inflammatory conditions. Intraoperative saline lavage samples (50 ml) were collected from the tumor bed and the pelvic floor area of these patients prior to bowel mobilization and following resection. Peripheral venous blood was also obtained from 12 patients undergoing venesection for polycythaemia as ‘no surgery’ controls. The study was approved by The Queen Elizabeth Hospital Ethics of Human Research Committee and informed consent was obtained from all patients. 2.2. Cell culture The colon cancer cell lines SW48, SW480, SW620, HT29, LIM-2412, LIM-1215, LIM-2099, LIM-2405, LIM-1899 and LIM-1863 were tested in RT-PCR assays to investigate DPEP1 expression. The LIM cell lines were kindly provided by Dr R. Whitehead, Ludwig Institute for Cancer Research, Melbourne, Australia; the remainder were purchased from the American Type Culture Collection (Rockville, MD). Cell lines were maintained in RPMI-1640 medium with 10% fetal calf serum. 2.3. RNA extraction from patient tissue samples Frozen tumor and normal mucosa tissues were disrupted using a mortar and pestle under liquid nitrogen and homogenized through an 18 gauge needle RNA was extracted from samples using 1 ml TRIzol Reagent (Invitrogen, Carlsbad, USA), per 50 – 100 mg of tissue, according to the manufacturer’s instructions. RNA was redissolved in 100 ml of ultra pure water (UPW; Biotech International, Perth, Australia) and the concentration was determined using a SmartSpece 3000 spectrophotometer (Bio-Rad, Hercules, USA). 2.4. Purification of RNA for cDNA micro-array hybridization Following homogenisation, RNA from four patients’ tumor and matched normal mucosa were

C.M. McIver et al. / Cancer Letters 209 (2004) 67–74

69

Slides were analysed by the Adelaide Micro-array Facility bioinformatics group and the top 100 differentially expressed genes were identified for each of the four patients. The DGED tool from the CGAP website http://cgap.nci.nih.gov [10], was used to confirm the differential expression of selected genes in colon tumor compared to normal mucosa. The DGED tool compares gene expression between two pools of serial analysis of gene expression (SAGE) libraries, one from colon tumor tissue, one from normal colon tissue and reports statistically significant differences. A virtual northern blot tool showed the expression pattern across a range of human tissues. This enabled us to select the gene with the greatest differential expression in colon tumors. Over-expression was then further validated using relative RT-PCR in a large cohort of matched colon tumor and normal RNA samples.

(product size 502 bp), and MUC2 PCR (sense) 50 TGGCTGCGTGGTGGAGAAGGAA, and antisense, 50 -TTGGAGCAGGTGACGC CCGTAGT (product size 320 bp). Both sets of primers were used in a mulitiplex PCR performed on a 2 ml aliquot of cDNA from patient tissue samples or cell lines. Reaction conditions included 100 ng of each DPEP1 primer, 10 ng of each MUC2 primer, 0.75 U of Tth plus Taq polymerase (Biotech International), 5 ml of 10 £ PCR buffer (670 mM Tris – HCl pH 8.8, 166 mM [NH4]2SO4, 4.5% Triton X-100, 2 mg/ml Gelatin), 1.5 mM MgCl2 (Biotech International), 200 mM of each deoxynucleotide triphosphate (Promega) and UPW (Biotech International) to a final volume of 50 ml. The mid-point of the exponential phase of the amplification reaction was established for DPEP1 at 32 cycles. Cycling conditions involved an initial denaturation at 94 8C for 5 min, then 30 s at 94, 62 and 72 8C for 32 cycles with a final extension of 7 min at 72 8C. Following identification of positive expression in cell lines, these were subsequently used as positive controls. Negative controls consisted of reagent only (no target). PCR products were run on a 1.5% agarose gel and stained with ethidium bromide. Gel analysis was performed using Kodak 1D image analysis software (Eastman Kodak Company, New Haven, CT). The mass (ng) of DPEP1 PCR product was normalized relative to the mass of the MUC2 product and the expression of each patient tumor – normal pair was expressed as a ratio T:N.

2.6. Relative RT-PCR

2.7. Statistical analysis

Total RNA (2 mg each of tumor and normal mucosa samples) was denatured at 70 8C for 3 min then reverse transcribed at 37 8C for 1 h in 1 £ First Strand Buffer (50 mM Tris – HCl pH 8.3, 75 mM KCl, 3 mM MgCl2), 200 U of M-MLV (both from Invitrogen), 750 ng pD(N)6 random hexamers (Pharmacia, Uppsala, Sweden), 0.6 mM of each deoxynucleotide triphosphate (Promega, Madison, USA) and UPW (Biotech International) to a volume of 30 ml. PCR was performed using MUC2 as an internal control marker as its expression was similar across multiple normal colon mucosa and tumor tissue samples. The primers used for DPEP1 PCR were (sense) 50 -CCTGAGGCTGGTGAAACAGACA, (anti-sense) 50 -GGGACTCTGGTCTCCCAGGTTT

Comparison of the expression of DPEP1 between colon tumor and normal mucosa was performed using a paired students t-test ðP , 0:05Þ: Analysis of colon tumor expression between the three stages of the disease was performed using ANOVA. A difference between groups of P , 0:05 was considered significant.

isolated using the RNeasy Mini Kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. Hybridization of the 8 K human cDNA slides was carried out at the Adelaide Micro-array Facility (Adelaide University, Adelaide, Australia). Four matched tumor and normal mucosal samples were labeled with either Cy3 (green fluorophore) or Cy5 (red fluorophore) and hybridized to each of 4 microarray slides. 2.5. Gene identification, confirmation and validation

2.8. Immunobead RT-PCR to detect disseminated tumor cells The technique for isolating epithelial cells from blood samples using immuno-magnetic beads has been described previously [8]. The lavage samples were centrifuged and the cell pellet re-suspended in

70

C.M. McIver et al. / Cancer Letters 209 (2004) 67–74

10 ml phosphate buffered saline. Each 10 ml blood or lavage sample was incubated with 4 £ 106 immunomagnetic beads (Dynal, Oslo, Norway), labeled with the epithelial-specific monoclonal antibody Ber-EP4 (Dakopatts, Gestrop, Denmark) for 2 h or overnight with gentle mixing at 4 8C. Bead-rosetted cells, isolated using a magnetic array, were lysed in a volume of 15 ml containing 0.1% Nonidet P-40, 10 mM dithiothreitol and 10 units RNasin (Promega, WI, USA) to release RNA. RT was performed in a total volume of 30 ml as described above. An aliquot of 5 ml cDNA was used for PCR. PCR products were run on a 1.5% agarose gel, transferred to nylon membrane (Hybond N þ , Amersham, Uppsala, Sweden), and hybridized to a 32P end-labelled internal oligo-probe. Autoradiographs were exposed for 6 –72 h.

expression of DPEP1 in either tumor or normal mucosa, despite expression of MUC2. A representative gel is shown in Fig. 1. Over-expression of DPEP1 was found amongst all stages of disease with 12/13 (92%) stage A, 26/30 (86%) stage B and 18/25 (72%) late stage (C and D) patients showing a two fold increase or greater (Fig. 2). The median expression of DPEP1, normalized to MUC2, in colon tumor for stage A was 71 ng (range 0 –157 ng), stage B 74 ng (range 0 –272 ng) and stage C and D 84 ng (range 0– 143 ng). The difference in mean expression of DPEP1 between colon tumor and normal mucosa was highly significant ðP ¼ 3:3 £ 10215 Þ (Students t-test). There was, however, no statistical difference in mean expression of DPEP1 in colon tumor between the stages of disease ðP ¼ 0:65Þ: 3.3. Immunobead RT-PCR

3. Results 3.1. Micro-array analysis The cDNA micro-array analysis identified DPEP1 to be the third and tenth highest differentially expressed gene, respectively, in 2/4 patients (data not shown). Over-expression of DPEP1 in colon tumors was confirmed using the DGED tool from the CGAP website. A virtual northern tool, vNorthern, showed expression of DPEP1 in colon tumor tissue, pancreatic cancer tissue and in normal brain and kidney. 3.2. Verification of DPEP1 over-expression by relative RT-PCR Using relative RT-PCR, DPEP1 was found to be expressed in all 10 colon cancer cell lines tested (results not shown). The primers were designed so as not to amplify a genomic product from DNA samples in the PCR conditions used. DPEP1 was found to be over-expressed in colon tumor tissue samples compared to matched normal mucosa in 56/68 (82%) patients by two fold or greater (ratio range 1:1 . 100:1), with 50/68 (74%) showing a ratio of $ 100:1 (Table 1). Where there was no detectable expression in the normal tissue, a ratio of . 100:1 was assigned. In five cases there was no detectable

A total of 140 intra-operative lavage samples and 65 blood samples from 38 consecutive cases of CRC were tested by immunobead RT-PCR for DPEP1 expression. Fifteen of 38 (39%) patients (4 stage A, 1 stage B, 6 stage C, 4 stage D) were positive for DPEP1 expression in one or more samples. Two patients (1 stage A, 1 stage C) were positive in preoperative blood only and five patients (2 stage A, 1 stage C, 2 stage D) had positive expression in samples collected following surgical removal of the tumor but no expression in samples collected before surgical manipulation. Four of 90 samples from 15 benign controls were also positive for DPEP1 expression. The histology of these four cases were diverticulitis with marked inflammatory cell infiltrate (2 cases), resection for bleeding ulcer with inflammation (1 case) and large villous adenoma with severe dysplasia (1 case). All 12 ‘no surgery’ control blood samples were negative by immunobead RT-PCR. However, when RT-PCR was performed using whole blood RNA rather than immunobead isolated cells, 2/15 showed weak expression (, 5 ng, data not shown) of DPEP1.

4. Discussion Current molecular markers used to detect circulating colon tumor cells such as CK20,

C.M. McIver et al. / Cancer Letters 209 (2004) 67–74 Table 1 Patient characteristics and normalized DPEP1 expression in colon tumor and normal mucosa Patient ID Age Sex Stage Tumor Normal Tumor:Normal (yrs) (ng) (ng) 084 537 570 245 512 151 375 376 716 762 081 197 798 438 951 429 512 798 680 421 134 001 186 427 728 877 534 473 047 969 798 584 958 321 008 596 426 309 878 142 741 295 105 847 476 694 688 444 581 684

90 81 69 71 50 45 71 81 86 76 55 87 83 86 74 86 68 80 83 74 72 73 78 84 78 79 92 64 67 71 55 79 86 59 58 77 67 50 80 57 74 41 85 83 73 51 55 89 78 69

M M F M M M F F F M M F M M F F M M M M F M F M F M F M M M M F M M M F M M F M F M F F M F F M F M

A A A A A A A A A A A A A B B B B B B B B B B B B B B B B B B B B B B B B B B B B B B C C C C C C C

116.23 0 16.9 0 65.97 0 93.98 0 36.27 0 71.43 0 76.65 0 82.46 0 92.01 0 48.29 0 156.76 0 0 0 62.8 0 0 0 193.31 0 82.03 0 11.14 0 21.17 11.12 56.48 0 49.09 0 26.03 0 99.42 104.85 51.44 47.42 271.75 0 144.12 82.73 234.97 0 33.47 0 18.38 0 77.72 0 60.64 0 139 0 113.6 0 90.5 0 99.29 0 85.94 0 57 1.4 96.13 0 73.64 0 74.59 0 127.29 0 26.2 1.9 0 0 19.16 0 92.52 0 0 0 5.5 0 8.4 0 54.75 0 87.93 0 0 0

.100:1 .100:1 .100:1 .100:1 .100:1 .100:1 .100:1 .100:1 .100:1 .100:1 .100:1 NE .100:1 NE .100:1 .100:1 .100:1 2:1 .100:1 .100:1 .100:1 1:1 1:1 .100:1 2:1 .100:1 .100:1 .100:1 .100:1 .100:1 .100:1 .100:1 .100:1 .100:1 .100:1 41:1 .100:1 .100:1 .100:1 .100:1 14:1 NE .100:1 .100:1 NE .100:1 .100:1 .100:1 .100:1 NE

71

Table 1 (continued) Patient ID Age Sex Stage Tumor Normal Tumor:Normal (yrs) (ng) (ng) 484 367 605 744 456 033 423 590 634 411 908 214 862 741 711 479 268 961

68 61 55 74 64 69 67 47 71 66 70 61 74 54 74 77 59 78

M F M M M F M M F M M M F M M M M M

C C C C C C C C C D D D D D D D D D

68.24 0 0 95.08 142.52 84.47 99.26 89.46 83.88 0 48.98 93.65 107.3 90.32 95.01 113.76 90.76 83.08

0 0 0 0 10.67 0 32.39 0 0 0 33.1 59.74 0 0 0 0 0 0

.100:1 NE NE .100:1 13:1 .100:1 3:1 .100:1 .100:1 NE 1.5:1 1.5:1 .100:1 .100:1 .100:1 .100:1 .100:1 .100:1

Abbreviation NE: no expression of DPEP1 in either tumor or normal.

CK19, and CEA, are epithelial-specific rather than tumor-specific. Therefore, this study aimed to identify a potential tumor-specific molecular marker to detect disseminated tumor cells using immunobead RT-PCR. We found DPEP1 to be overexpressed in colon tumors compared to matched normal mucosa by micro-array analysis in 2/4 CRC patients, and this result was verified by semiquantitative RT-PCR in 56/68 (82%) CRC patients. DPEP1, also known as membrane dipeptidase, microsomal dipeptidase or renal dipeptidase, is a zinc-dependent metallopeptidase that hydrolyses a variety of dipeptides and is involved in glutathione metabolism [11]. The encoded protein has been found to have a highly hydrophobic sequence located at its carboxyl terminus and is anchored to the membrane by a covalently attached glycosylphosphatidylinositol moiety [12,13]. DPEP1 was originally identified at band q24 of chromosome 16 [14] and later localized to the region of 16q24.3 [15]. Interestingly, chromosome 16q is a region reported to be frequently involved in allele loss in several tumors including breast and prostate carcinomas [16]. Further, DPEP1 was identified as a potential tumor suppressor gene due to its decreased

72

C.M. McIver et al. / Cancer Letters 209 (2004) 67–74

Fig. 1. Relative RT-PCR of matched tumor/normal tissue samples from six patients. M, molecular weight marker; P, positive cell line control (LIM 2099); NC, negative control; T, tumor; N, normal.

expression in Wilms’ tumor when compared to normal kidney [17]. In contrast, we have shown this gene to be over-expressed in colorectal tumors compared to normal mucosa. Previous expression studies have shown membrane dipeptidase to be expressed by one of two human colon carcinoma cell lines tested [18], in kidney [19], in cultured human tracheal epithelial cells [20], pancreas, lungs [21], and on the brush border membranes of the kidney and intestines [22]. More recently, renal dipeptidase was identified from SAGE analysis to be expressed by colon adenomas and carcinomas but not normal colonic mucosa and this finding was verified by comparing expression in seven matched colorectal neoplasms and normal mucosa [23]. The role of DPEP1 in cancer progression is currently unknown. However, as it is a membrane bound dipeptidase it may be involved in the degradation of surrounding extracellular matrix components, a mechanism that would aid in the ability of tumor cells to migrate from the primary site through the extracellular matrix. In this study, we have shown that DPEP1 is overexpressed in the majority (82%) of colon tumors compared to normal mucosal samples with 74% of patients showing a differential expression ratio of . 100:1. However, there was no statistical difference in expression between the stages of disease (Fig. 2). These findings suggested that DPEP1 would be useful as a tumor-specific marker of disseminated cells. We tested intra-operative lavage and venous blood samples from 38 CRC cases by immunobead

RT-PCR and found 15 (39%) to be positive for DPEP1 expression, suggesting the presence of disseminated colon tumor cells in 5 early (A and B) stage patients as well as 10 late (C and D) stage patients. Five patients had positive expression in lavage samples collected following removal of the bowel segment but were negative for all samples collected before surgical manipulation. This may indicate that tumor cells have escaped into the peritoneal cavity and clinical follow-up of these patients will indicate whether this results in recurrent disease. Some patients with benign disease were also positive for DPEP1 expression: one of these had a large villous adenoma with severe dysplasia that may have contained a micro-focus of malignant cells. The three other patients all had marked inflammatory cell infiltrates in the bowel segment removed. Perhaps the increase in inflammatory cytokines had induced expression of DPEP1 in the epithelium in a similar way to the induced expression of CEA and CK19 in

Fig. 2. Comparison of mean DPEP1 expression between stages of disease.

C.M. McIver et al. / Cancer Letters 209 (2004) 67–74

blood and marrow cells of patients with chronic inflammatory bowel disease [24]. Further cases will be studied and long-term survival analysis will be carried out to determine the prognostic significance of this marker for the development of recurrent or metastatic disease. Detection of disseminated tumor cells in early stage patients may result in the restaging of the disease and thus alter the treatment strategy.

[8]

[9]

[10]

Acknowledgements This work was supported by the NHMRC, The Cancer Council of South Australia and the Cancer and Bowel Research Trust project grants. Cassandra McIver was supported by The Queen Elizabeth Hospital Research Foundation and The Faculty of Science, Adelaide University. We would like to thank the colorectal unit and nursing staff of The Queen Elizabeth Hospital.

References [1] S. Nakamori, M. Kameyama, H. Furukawa, O. Takeda, S. Sugai, S. Imaoka, Y. Nakamura, Genetic detection of colorectal cancer cells in circulation and lymph nodes, Dis. Colon Rectum 40 (1997) 29 –36. [2] X.C. Hu, L.W. Chow, Detection of circulating breast cancer cells by reverse transcriptase polymerase chain reaction (RT-PCR), Eur. J. Surg. Oncol. 26 (2000) 530–535. [3] R.A. Ghossein, S. Bhattacharya, Molecular detection and characterization of circulating tumor cells and micrometastases in prostatic, urothelial and renal cell carcinomas, Semin. Surg. Oncol. 20 (2001) 304–311. [4] G. Travellas, H. Patel, T.G. Allen-Mersh, Detection and clinical significance of occult tumor cells in colorectal cancer, Brit. J. Surg. 88 (2001) 1307– 1320. [5] J.E. Hardingham, D. Kotasek, B. Farmer, R.N. Butler, J-X. Mi, R.E. Sage, A. Dobrovic, Immunobead-PCR: A technique for the detection of circulating tumor cells using immunomagnetic beads and the polymerase chain reaction, Cancer Res. 53 (1993) 3455–3458. [6] J.E. Hardingham, D. Kotasek, R.E. Sage, M.C. Eaton, V.H. Pascoe, A. Dobrovic, Detection of circulating tumor cells in colorectal cancer by immunobead-PCR is a sensitive prognostic marker for relapse of disease, Mol. Med. 1 (1995) 789–794. [7] M.C. Eaton, J.E. Hardingham, D. Kotasek, R.E. Sage, A. Dobrovic, Immunobead RT-PCR. A sensitive method for

[11]

[12]

[13]

[14]

[15]

[16]

[17]

[18]

[19]

[20]

[21]

73

the detection of circulating tumor cells, Biotechniques 22 (1997) 100 –105. J.E. Hardingham, P.J. Hewett, R.E. Sage, J.L. Finch, J.D. Nuttall, D. Kotasek, A. Dobrovic, Molecular detection of blood-borne epithelial cells in colorectal cancer patients and in patients with benign bowel disease, Int. J. Cancer 89 (2000) 8– 13. A. Castells, L. Boix, L. Gargallo, J.M. Pique, Detection of colonic cells in peripheral blood of colorectal patients by means of reverse transcriptase and polymerase chain reaction, Br. J. Cancer 78 (1998) 1368– 1372. R.L. Strausberg, The cancer genome anatomy project: new resources for reading the molecular signatures of cancer, J. Pathol. 195 (2001) 31 –40. E.M. Kozak, S.S. Tate, Glutathione-degrading enzymes of microvillus membranes, J. Biol. Chem. 257 (1982) 6322–6327. N.M. Hooper, M.G. Low, A.J. Turner, Renal dipeptidase is one of the membrane proteins released by phosphatidylinositolspecific phospholipase C, Biochem. J. 244 (1987) 465–469. H. Adachi, Y. Tawaragi, C. Inuzuka, I. Kubota, M. Tsujimoto, T. Nishihara, H. Nakazato, Primary structure of human microsomal dipeptidase deduced from molecular cloning, J. Biol. Chem. 265 (1990) 3992–3995. H. Nakagawa, J. Inazawa, K. Inoue, S. Misawa, K. Kashima, H. Adachi, H. Nakazato, T. Abe, Assignment of the human renal dipeptidase gene (DPEP1) to band q24 of chromosome 16, Cytogenet. Cell Genet. 59 (1991) 258–260. E. Austruy, C. Jeanpierre, C. Antignac, S.A. Whitmore, N. Van Cong, A. Bernheim, D.F. Callen, C. Junien, Physical and genetic mapping of the dipeptidase gene DPEP1 to 16q24.3, Genomics 15 (1993) 684 –687. B. Seizinger, H. Klinger, C. Junien, M. Nakamura, M. Le Beau, W. Cavenee, B. Emanuel, B. Ponder, S. Nayor, F. Mitelman, D. Louis, A. Menon, I. Newsham, J. Decker, M. Kaelbling, I. Henry, A. Deimling, Report of the committee on chromosome and gene loss in human neoplasia, Cytogenet. Cell Genet. 58 (1991) 1080–1096. E. Austruy, M. Cohen-Salmon, C. Antignac, C. Beroud, I. Henry, N. Van Cong, L. Brugieres, C. Junien, C. Jeanpierre, Isolation of kidney complementary DNA’s down-expressed in Wilms’ tumor by a subtractive hybridization approach, Cancer Res. 53 (1993) 2888– 2894. S. Howell, A.J. Kenny, A.J. Turner, A survey of membrane peptidases in two human colonic cell lines Caco-2 and HT-29, Biochem. J. 284 (1992) 595 –601. S. Satoh, K. Ohtsuka, Y. Keida, C. Kusunoki, Y. Knota, M. Niwa, M. Kohsaka, Gene structural analysis and expression of human renal dipeptidase, Biotechnol. Prog. 10 (1994) 134 –140. M. Yamya, K. Sekizawa, M. Terajima, S. Okinaga, T. Ohrui, H. Sasaki, Dipeptidase inhibitor and epithelial removal potentiate leukotriene D4-induced human tracheal smooth muscle contraction, Respir. Physiol. 111 (1998) 101–109. N.M. Hooper, S. Cook, J. Laine, D. Lebel, Identification of membrane dipeptidase as a major glycosyl-phosphatidylinositol-anchored protein of the pancreatic zymogen granule

74

C.M. McIver et al. / Cancer Letters 209 (2004) 67–74

membrane, and evidence for its release by phospholipase A, BioChem. J. 324 (1997) 151 –157. [22] S. Keynan, A. Asipu, N. Hooper, A. Turner, G.E. Blair, Stable and temperature-sensitive transformation of baby rat kidney cells by SV40 suppresses expression of membrane dipeptidase, Oncogene 15 (1997) 1241–1245. [23] P. Buckhaults, C. Rago, B.St. Croix, K.E. Romans, S. Saha, L. Zhang, B. Vogelstein, K.W. Kinzler, Secreted and cell surface

genes expressed in benign and malignant colorectal tumors, Cancer Res. 61 (2001) 6996–7001. [24] R. Jung, W. Kruger, S. Hosch, M. Holweg, N. Kroger, K. Gutensohn, C. Wagener, M. Neumaier, A.R. Zander, Specificity of reverse transcriptase polymerase chain reaction assays designed for the detection of circulating cancer cells is influenced by cytokines in vivo and in vitro, Br. J. Cancer 78 (1998) 1194–1198.