- Email: [email protected]
Direct detection of unamplified DNA from pathogenic mycobacteria using DNA-derivatized gold nanoparticles
Journal of Microbiological Methods 78 (2009) 260–264
Contents lists available at ScienceDirect
Journal of Microbiological Methods j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / j m i c m e t h
Direct detection of unamplified DNA from pathogenic mycobacteria using DNA-derivatized gold nanoparticles Emmanouil Liandris a, Maria Gazouli b, Margarita Andreadou a, Mirjana Čomor c, Nadica Abazovic c, Leonardo A. Sechi d, John Ikonomopoulos a,⁎ a
Faculty of Animal Science, Laboratory of Anatomy–Physiology, Agricultural University of Athens, Iera Odos 75, 11855 Votanikos, Athens, Greece Department of Biology, School of Medicine, University of Athens, Athens, Greece Laboratory for Radiation Chemistry and Physics, Vinča Institute of Nuclear Sciences, Belgrade, Serbia d Dipartimento di Scienze Biomediche, Sezione di Microbiologia Sperimentale e Clinica, Universita` degli Studi di Sassari, Sassari, Italy b c
a r t i c l e
i n f o
Article history: Received 24 February 2009 Received in revised form 1 June 2009 Accepted 4 June 2009 Available online 17 June 2009 Keywords: Mycobacteria Nanoparticles
a b s t r a c t Mycobacterial infections have a high economic, human and animal health impact. Herein, we present the development of a colorimetric method that relies on the use of gold nanoparticles for fast and specific detection of Mycobacterium spp. dispensing with the need for DNA amplification. The result can be recorded by visual and/or spectrophotometric comparison of solutions before and after acid induced AuNP-probe aggregation. The presence of a complementary target prevents aggregation and the solution remains pink, whereas in the opposite event it turns to purple. The application of the proposed method on isolated bacteria produced positive results with the mycobacterial isolates and negative with the controls. The minimum detection limit of the assay was defined at 18.75 ng of mycobacterial DNA diluted in a sample-volume of 10 μl. In order to obtain an indication of the method's performance on clinical samples we applied the optimized assay to the detection of Mycobacterium avium subsp. paratuberculosis DNA in faeces, in comparison with real-time PCR. The concordance of the two methods with connection to real-time PCR positive and negative sample was defined respectively as 87.5% and 100%. The proposed method could be used as a highly specific and sensitive screening tool for the detection of mycobacteria directly from clinical samples in a very simple manner, without the need of high-cost dedicated equipment. The technology described here, may develop into a platform that could accommodate detection of many bacterial species and could be easily adapted for high throughput and expedite screening of samples. © 2009 Elsevier B.V. All rights reserved.
1. Introduction Pathogens of the genus Mycobacterium are a major cause of morbidity and mortality worldwide. Concerning humans, in addition to tuberculosis, exposure to mycobacteria has been linked to the pathogenesis of sarcoidosis and Crohn's disease which affect millions of people in Europe alone (Gazouli et al., 2005; Sechi et al., 2001). Nonhuman primates can also be infected by Mycobacterium tuberculosis (Lin et al., 2008), while cattle and other ruminants are natural hosts of the closely-related species M. bovis, which causes substantial financial loss in many regions worldwide (Serrano-Moreno et al., 2008). The M. avium complex affects birds and mammals, including both livestock and dogs (Primm et al., 2004). Finally, paratuberculosis is another chronic
⁎ Corresponding author. School of Animal Science, Department of Anatomy– Physiology, Agricultural University of Athens, Iera Odos 75, 11855 Votanikos, Athens, Greece. Tel.: +30 2105294383. E-mail address: [email protected] (J. Ikonomopoulos). 0167-7012/$ – see front matter © 2009 Elsevier B.V. All rights reserved. doi:10.1016/j.mimet.2009.06.009
infectious disease caused by a member of Mycobacterium spp., namely M. avium subsp paratuberculosis (MAP) that affects mainly ruminants. Diagnostic investigation of mycobacterial infections is hampered by the difficulty to detect in a specific manner low populations of mycobacteria, or the immunology markers associated with the infections they cause. The laboratory diagnostic investigation of mycobacterial diseases relies on light microscopy of hematoxylin–eosin (H&E) or Ziehl–Neelsen (ZN) stained sections, mycobacterial culture, ELISA test and DNA amplification techniques. Each of these methods has certain advantages and limitations but in general, those with high specificity and low minimum detection limit are usually complex and expensive (Bancroft and Stevens, 1990; Brisson et al., 1991; Cousins et al., 1992; Pandey and Talib, 1993; Ravva and Stanker, 2005). In most cases the reliable application of these diagnostic methods requires highly trained personnel and very often, dedicated equipment that can be of considerable cost. Therefore, the development of a new diagnostic assay that would be easily applicable even by non-specialized personnel, and would allow specific and sensitive detection and identification of mycobacteria directly from clinical samples without the need for high-
E. Liandris et al. / Journal of Microbiological Methods 78 (2009) 260–264
cost dedicated equipment, and definitely improve diagnostic investigation of mycobacterial infections. Nucleotide probes conjugated with gold nanoparticles (AuNPprobes) were first used for this purpose a few years ago for the detection of M. tuberculosis DNA (Baptista et al., 2006). More recently AuNP-probes have been integrated in research and routine diagnostic applications and have shown great potential (Chen et al., 2008; Kaittanis et al., 2007). Therefore in the present study which is concerned with the first stage of the development of an array of gold nanoparticle-conjugated mycobacterial probes, we have utilized an AuNP-universal-probe for the development of a diagnostic assay that allows rapid and direct detection collectively of the main mycobacterial pathogens [M. tuberculosis complex (MTC), M. avium complex (MAV) and M. avium subsp. paratuberculosis (MAP)] in clinical samples, in a way that is highly specific, very easy to perform, and requires little infrastructure and expertise. 2. Material and methods 2.1. Probe design Probe design was based on the 16s–23s ITS DNA region that has high homology among the mycobacterial species. Deposited sequences of some of the most common mycobacterial pathogens (GeneBank accession numbers DQ445257, NC008769, NC008595, NC002944, CP000325) were aligned with ClustalW software (EMBL-EBI). Design of the 20 base long probe, MycoD1: 5′ CCAGTCCGTGTGGTGTCCCT 3′ was based on genus conserved genomic regions. Specificity of the probe was evaluated through dot-blot hybridization experiments using DNA isolated from the bacterial species listed in Table 1. Then a thiol group and an (A)10 tail were added at the 5′ end of the probe in order to be used for its conjugation with AuNPs. 2.2. Preparation of the gold nanoparticle probes Gold nanoparticles were prepared by the citrate reduction method described by Grabar et al. (1995). Briefly, 250 ml of HAuCl4 1 mM was brought to a vigorous boil while stirring in a round-bottom flask. Twenty-five milliliters of sodium citrate 38.8 mM were rapidly added and the mixture was refluxed for 15 min with a continuous stirring. The flask was allowed to cool to room temperature and stored in the dark until use. The synthesized colloidal AuNPs used had an average diameter of about 15–20 nm as determined by transmission electron microscopy (TEM), (data not shown). The AuNP-probe was synthesized by adding 1 ml of an aqueous solution of gold nanoparticle to 4 nmol thiolated oligonucleotide
261
Table 2 Comparison of the positive (+) and negative (−) results obtained by real-time PCR and the AuNP-probe method for the detection of M. avium subsp. paratuberculosis on DNA isolated from faecal samples. Sample
Real time PCR
DNA ng/μl
AuNP-probe
1 2 3 4 5 6 7 8 9 10 11 12
+ + + + + + + + − − − −
1905.8 136.14 1680.7 220.12 0.22 0.16 0.24 0.58 – – – –
+ + + + + − + + − − − −
[5′-thiol-(A)10-CCAGTCCGTGTGGTGTCCCT-3′] using a previously described protocol (Hill and Mirkin, 2006). Briefly, the thiol modified oligonucleotide was initially incubated with gold nanoparticles overnight on an orbital shaker at room temperature. The solution was then brought to phosphate buffer (pH 7) 9 mM and SDS solution 0.1% (w/v) was added in order to prevent aggregation. The total salting buffer (2 M NaCl in 10 mM PBS) needed to reach a final concentration of 0.3 M NaCl was divided in six doses that were added to the above dilution over the course of the next 2 days. After centrifugation, the precipitate was washed with 500 μl of 10 mM PBS (pH 7.4),150 mM NaCl, 0.1% SDS, and it was re-centrifuged and re-dispersed in 500 ml of the same buffer. The gold nanoprobes were stored in the dark at room temperature. 2.3. Hybridization and color detection The hybridization parameters of the MycoD1 AuNP-probe were calibrated using a synthetic complementary oligonucleotide: 0.5 nmol of the complementary oligonucleotide was diluted in 70 μl of 10 mM PBS (pH 5.0). After denaturation at 95 °C for 3 min, the solution was cooled to 65 °C and 6 μl of the AuNP-probe was added followed by 2 μl of 0.01 N HCl, after 5 min of incubation at room temperature. Blank preparations were made in exactly the same way using an equivalent volume of 10 mM PBS instead of DNA. The solutions were kept for 5–15 min at room temperature until color was developed and then they were photographed. The color could be detected visually and it was confirmed with an absorption spectrum (Infinite M200, Tecan, Switzerland). DNA extracted from mycobacterial cultures (positive controls) and related bacteria (negative controls) were also tested under the same conditions (Table 1). 2.4. Minimum detection limit
Table 1 Bacteria used for the evaluation of specificity. Species
Number of isolates
Source⁎
AuNP-probe
M. tuberculosis M. bovis BCG M. bovis M. microti M. caprae M. gordonae M. avium subsp. paratuberculosis M. intracellulare M. avium M. smegmatis Escherichia coli Enterococcus fecalis Brucella spp. Salmonella spp. Nocardia spp.
9 1 4 2 1 2 20
AUA, AUA AUA, AUA, AUA AUA, AUA,
US, Quattromed
+ + + + + + +
4 6 3 9 4 7 12 4
AUA, AUA, AUA, AUA, AUA, AUA, AUA, AUA
US, Quattromed, US, Quattromed, VRI US, Quattromed US US US US
US, Quattromed US, Quattromed US, Quattromed US, Quattromed, VRI
+ + + − − − − −
⁎AUA: Agricultural University of Athens, Greece, US: University of Sassary, Sardinia, Italy, Quattromed: S.r.L, Estonia, VRI: Veterinary Research institute, Brno, Czech Republic.
The minimum amount of DNA necessary for a positive result was determined as previously described (Ikonomopoulos et al., 2000). Specifically, 1.2 μg/μl M. tuberculosis DNA was serially diluted in HPLC water, from 1:2 to 1:64, and 10 μl of each dilution was transferred to 70 μl of PBS buffer (pH 5.0). Then, 6 μl of AuNP-probe was added as described above. Blanks containing PBS buffer instead of DNA were used in comparison with the test-samples for reading the results by visual observation and spectrophotometry. 2.5. Direct application on clinical samples In order to obtain an indication of the method's performance on clinical samples, we applied the optimized assay for the detection of MAP DNA in faeces. For this purpose we collected 12 faecal samples from an equal number of goats (capra hircus) from a herd with a wellestablished record of paratuberculosis. In brief, isolation of DNA from this material (12 samples) was performed as follows: 2 g of faeces was homogenized with 20 ml of sterile water for 5 min. After 20 min of
262
E. Liandris et al. / Journal of Microbiological Methods 78 (2009) 260–264
Fig. 1. Representative results recoded by the AuNP-probe assay: “Blank”, “Negative”, “Positive”, denote respectively test tubes that contain only the AuNP-probe, DNA isolated from cultivated Nocardia spp., and DNA isolated from cultivated M. avium subsp. paratuberculosis. UV/visible spectra were 15 min after addition of HCl. The pink colour indicates the presence of the target DNA and the purple its absence.
sedimentation at room temperature, 600 μl of the supernatant was transferred to a 1.5 ml tube containing 300 mg glass beads (Adiagene, Montpellier, France) and was disrupted in a Mixer Mill (Retsch, Haan, Germany) at 30 Hz for 10 min. The liquid phase was collected and incubated overnight with 30 μl of proteinase K (20 mg/ml) and then processed with the Nucleospin Tissue kit (Macherey Nagel, Düren, Germany) according to the manufacturer's instructions. For the detection of MAP, 10 μl of the DNA product was added to 70 μl of PBS buffer (pH 5.0) and 6 μl of the AuNP-probe, as described above. The results were compared to those obtained by a real-time PCR assay previously described (Kim et al., 2004), (Table 2). The quantification was performed using MAP DNA of known concentration, and the standard curve as obtained by real-time PCR has R2 = 0.9998, slope= −3.115 and efficiency= 109.424%. In order to assess the repeatability of the method for the specific type of samples, testing with the proposed assay was repeated 5 times for each DNA extract.
3. Results The AuNP-probe solution exhibits a pink color because of surface plasmon resonance at an absorbance peak of ~ 525 nm. The acidic environment after the addition of HCl enhanced precipitation of AuNPprobe in the absence of a target DNA sequence leading to a change of colour from pink to purple (indicating an absorbance peak shift toward the longer wavelength). In the event of specific probe hybridization to a target sequence (i.e., mycobacterial DNA), no AuNP-probe aggregation occurs, and the solution remains pink. Thus, the reading of the method described herein can be obtained by visual and spectrophotometric comparison of the solutions before and after acid induced Au nanoprobe aggregation. Fig. 1 illustrates the characteristic results of the method as determined visually and by UV–visible spectroscopy. After the addition of HCl, the solutions that do not contain the target sequence, turn from pink to purple, denoting AuNP-probe aggregation.
Fig. 2. Serial dilutions of M. tuberculosis DNA (1.2 μg/μl). UV/visible spectra were 15 min after addition of HCl.
E. Liandris et al. / Journal of Microbiological Methods 78 (2009) 260–264
In the case of positive samples, no precipitation is observed even when the test tubes remain overnight at room temperature. The application of the proposed method on isolated bacteria produced positive results with all the mycobacterial isolates that were incorporated here in the assessment of the AuNP-probe specificity and with none of the negative controls (Table 1). At or below 18.75 ng of mycobacterial DNA diluted in a sample-volume of 10 μl, the solution turned purple after addition of HCl, defining the minimum detection limit of the assay (Fig. 2). The real-time PCR assay applied on the faecal samples for the detection of MAP, produced positive results for 8 of the 12 samples that were tested. Seven (7) of these produced the same result by the AuNP-probe method (87.5% concordance) that reacted negatively with all the real-time PCR-negative samples (n = 4), (100% concordance), (Table 2). The application of the proposed method on the DNA isolated from the 12 faecal samples produced exactly the same results every time (n = 5) the evaluation of this material was repeated (100% repeatability). 4. Discussion The use of thiol-linked single-stranded DNA-modified gold nanoparticles (herein referred to as AuNP-probes) for the colorimetric detection of DNA targets represents an inexpensive and easy to perform alternative to PCR, fluorescence or radioactivity based assays (Storhoff et al., 2004; Baptista et al., 2008). The use of single-stranded oligonucleotide targets that could be detected using two different Au-nanoprobes such that each was functionalized with a DNAoligonucleotide complementary to one half of the given target, was described for first time a decade ago (Mirkin et al., 1996). The hybridization of the two Au-nanoprobes with the target resulted in the formation of a polymeric network (crosslinking mechanism), which brought the gold nanoparticles close enough to result in a pink to purple color change. Therefore, the crosslinking of multiple Au-nanoprobes allows for extensive nanoparticle aggregation, and yields the observed colorimetric change. In this system, the Au-nanoprobes were oriented in a tail-to-tail arrangement—one probe functionalized via a 5′-thiol bond and the other through a 3′-thiol group (Storhoff et al., 2004; Li et al., 2006; Beermann et al., 2007). Following a parallel approach, we developed a simple assay based on a non-crosslinking hybridization method, where aggregation of the AuNP-probe is induced by an increasing acid concentration. Our method consists of visual and/or spectrophotometric comparison of solutions before and after acid induced AuNP-probe aggregation—the presence of a complementary target prevents aggregation and the solution remains pink whereas non-complementary targets do not prevent AuNP-probe aggregation, resulting in a visible change of color from pink to purple. The detection is based on the fact that double and single-stranded oligonucleotides have different electrostatic properties. After hybridization, single-stranded DNA forms double-stranded DNA, which has double-helix geometry. As a result, the double-stranded DNA cannot uncoil sufficiently like the single-stranded DNA to expose its bases toward the AuNP-probe. Therefore, AuNP-probe undergoes aggregation in an acidic environment. The proposed method can be used as an easily applicable, low-cost screening tool, which is the reason why our approach was aimed primarily at the development of a universal probe for mycobacterial pathogens. Notably, the AuNP-probe assay is concluded within just over 15 min and it is performed in a single tube, which reduces carryover contamination and facilitates simultaneous testing of many samples. The evaluation of the specificity and the repeatability of the AuNP-probe method indicates that it can detect in a reliable and highly specific manner a broad spectrum of mycobacteria without cross reactions with related bacteria. The latter was demonstrated effectively by the results recorded after the application of the proposed method on DNA isolated from faecal samples since these harbor mixed bacterial populations that
263
may exceed greatly that of the targeted pathogen. This type of evaluation should be considered more representative of the method's performance than that obtained with the use of samples artificially inoculated with mycobacteria, since the low proportion of the targeted sequence compared to miscellaneous, renders the detection conditions by far more demanding. Furthermore, in the case of artificially constructed positive controls, the targeted sequence is not found intra-cellularly, which facilitates its detection considerably. Even under these conditions, the performance of the proposed method proved comparable to that of real-time PCR regarding both the sensitivity (87.5% concordance of positive results) and specificity (100% concordance of negative results) at only a fraction of time and cost. The minimum detection limit that we recorded is comprehensively consistent with the use of the AuNP-probe assay as a sensitive and highly specific screening tool. This is supported by the fact that even the lowest concentration of the targeted sequence was easily detected by simple visual observation of the test and the control tubes, which renders spectrophotometric reading of the result advisable mainly with connection to automated applications. The cost of the proposed assay is defined by more than 90% by the cost of the AuNPs. These can be constructed in-house or be purchased commercially. Depending on the source of the gold nanoparticles the cost of the AuNPdetection of mycobacteria per test-sample corresponds to approximately 70–120% of that of RT-PCR. Notably this estimation does not include cost of labor of expert personnel and dedicated equipment that represent a very considerable part of the investment required for the application of RT-PCR but not of the assay described here. Finally, it should be noted that the proposed method represents a platform that could accommodate detection of many bacterial species using an array of probes and could be easily adapted for high throughput and expedite screening of samples from animals, humans, and food samples. Acknowledgements This work was performed within the context of the NANOMYC project that is supported by the E.U. (LSHB-CT-2007-036812). References Bancroft, J.D., Stevens, A., 1990. Theory and Practice of Histological Techniques, 3rd ed. Churchill Livingstone Publications, Edinburgh. Baptista, P.V., Koziol-Montewka, M., Paluch-Oles, J., Doria, G., Franco, R., 2006. Goldnanoparticle-probe-based assay for rapid and direct detection of Mycobacterium tuberculosis DNA in clinical samples. Clin. Chem. 52, 1433–1434. Baptista, P., Pereira, E., Eaton, P., Doria, G., Miranda, A., Gomes, I., Quaresma, P., Franco, R., 2008. Gold nanoparticles for the development of clinical diagnosis methods. Anal. Bioanal. Chem. 391, 943–950. Beermann, B., Carrillo-Nava, E., Scheffer, A., Buscher, W., Jawalekar, A.M., Seela, F., Hinz, H.J., 2007. Association temperature governs structure and apparent thermodynamics of DNA-gold nanoparticles. Biophys. Chemist. 126, 124–131. Brisson, N.A., Aznar, C., Chureau, C., Nguyen, S., Bortoli, M., Bonete, R., Pialoux, G., Gicquel, B., Garrigne, G., 1991. Diagnosis of tuberculosis by DNA amplification in clinical samples. Lancet 338, 364. Chen, S.H., Wu, V.C., Chuang, Y.C., Lin, C.S., 2008. Using oligonucleotide-functionalized Au nanoparticles to rapidly detect foodborne pathogens on a piezoelectric biosensor. J. Microbiol. Methods 73, 7–17. Cousins, D.V., Wilton, S.D., Francis, B.R., Gow, B.L., 1992. Use of polymerase chain reaction for rapid diagnosis of tuberculosis. J. Clin. Microbiol. 30, 255–258. Gazouli, M., Ikonomopoulos, J., Koundourakis, A., Bartos, M., Pavlik, I., Overduin, P., Kremer, K., Gorgoulis, V., Kittas, C., 2005. Characterization of Mycobacterium tuberculosis complex isolates from Greek patients with sarcoidosis by spoligotyping. J. Clin. Microbiol. 43, 4858–4861. Grabar, K.C., Griffith-Freeman, R., Hommer, M.B., Natan, M.J., 1995. Preparation and characterization of Au colloid monolayers. Anal. Chem. 67, 735–743. Hill, D.H., Mirkin, C.A., 2006. The bio-barcode assay for the detection of protein and nucleic acid targets using DTT-induced ligand exchange. Natl. Protoc. 1, 324–336. Ikonomopoulos, J.A., Gorgoulis, V.G., Kastrinakis, N.G., Zacharatos, P.V., Kokotas, S.N., Evagelou, K., Kotsinas, A.G., Tsakris, A.G., Manolis, E.N., Kittas, C.N., 2000. Sensitive differential detection of genetically related mycobacterial pathogens in archival material. Am. J. Clin. Pathol. 114, 940–950. Kaittanis, C., Nasser, S.A., Perez, J.M., 2007. One-step, nanoparticle-mediated bacterial detection with magnetic relaxation. Nano Lett. 7, 380–383. Kim, S.G., Kim, E.H., Lafferty, C.J., Miller, L.J., Koo, H.J., Stehman, S.M., Shin, S.J., 2004. Use of conventional and real-time polymerase chain reaction for confirmation of Mycobacterium avium subsp. paratuberculosis in a broth-based culture system ESP II. J. Vet. Diagn. Invest. 16, 448–453.
264
E. Liandris et al. / Journal of Microbiological Methods 78 (2009) 260–264
Li, Y., Wark, A.W., Lee, H.J., Corn, R.M., 2006. Single-nucleotide polymorphism genotyping by nanoparticle-enhanced surface plasmon resonance imaging measurements of surface ligation reactions. Anal. Chem. 78, 3158–3164. Lin, P.L., Yee, J., Klein, E., Lerche, N.W., 2008. Immunological concepts in tuberculosis diagnostics for non-human primates: a review. Med. Primatol. 37, 44–51. Mirkin, C.A., Letsinger, R.L., Mucic, R.C., Storhoff, J.J., 1996. A DNA-based method for rationally assembling nanoparticles into macroscopic materials. Nature 382, 607–609. Pandey, J., Talib, V.H., 1993. Laboratory diagnosis of tuberculosis: use of ELISA and PCR. Indian J. Pathol. Microbiol. 36, 512–518. Primm, T.P., Lucero, C.A., Falkinham, J.O., 2004. Health impacts of environmental mycobacteria. Clin. Microbiol. Rev. 17, 98–106. Ravva, S.V., Stanker, L.H., 2005. Real-time quantitative PCR detection of Mycobacterium avium subsp. paratuberculosis and differentiation from other mycobacteria using SYBR Green and TaqMan assays. J. Microbiol. Methods 63, 305–317.
Sechi, L.A., Mura, M., Tanda, F., Lissia, A., Solinas, A., Fadda, G., Zanetti, S., 2001. Identification of Mycobacterium avium subsp. paratuberculosis in biopsy specimens from patients with Crohn's disease identified by in situ hybridization. J. Clin. Microbiol. 39, 4514–4517. Serrano-Moreno, B.A., Romero, T.A., Arriaga, C., Torres, R.A., Pereira-Suárez, A.L., GarcíaSalazar, J.A., Estrada-Chávez, C., 2008. High frequency of Mycobacterium bovis DNA in colostra from tuberculous cattle detected by nested PCR. Zoonoses Public Health 55, 258–266. Storhoff, J.J., Lucas, A.D., Garimella, V., Bao, Y.P., Muller, U.R., 2004. Homogeneous detection of unamplified genomic DNA sequences based on colorimetric scatter of gold nanoparticle probes. Nat. Biotechnol. 22, 883–887.
Contents lists available at ScienceDirect
Journal of Microbiological Methods j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / j m i c m e t h
Direct detection of unamplified DNA from pathogenic mycobacteria using DNA-derivatized gold nanoparticles Emmanouil Liandris a, Maria Gazouli b, Margarita Andreadou a, Mirjana Čomor c, Nadica Abazovic c, Leonardo A. Sechi d, John Ikonomopoulos a,⁎ a
Faculty of Animal Science, Laboratory of Anatomy–Physiology, Agricultural University of Athens, Iera Odos 75, 11855 Votanikos, Athens, Greece Department of Biology, School of Medicine, University of Athens, Athens, Greece Laboratory for Radiation Chemistry and Physics, Vinča Institute of Nuclear Sciences, Belgrade, Serbia d Dipartimento di Scienze Biomediche, Sezione di Microbiologia Sperimentale e Clinica, Universita` degli Studi di Sassari, Sassari, Italy b c
a r t i c l e
i n f o
Article history: Received 24 February 2009 Received in revised form 1 June 2009 Accepted 4 June 2009 Available online 17 June 2009 Keywords: Mycobacteria Nanoparticles
a b s t r a c t Mycobacterial infections have a high economic, human and animal health impact. Herein, we present the development of a colorimetric method that relies on the use of gold nanoparticles for fast and specific detection of Mycobacterium spp. dispensing with the need for DNA amplification. The result can be recorded by visual and/or spectrophotometric comparison of solutions before and after acid induced AuNP-probe aggregation. The presence of a complementary target prevents aggregation and the solution remains pink, whereas in the opposite event it turns to purple. The application of the proposed method on isolated bacteria produced positive results with the mycobacterial isolates and negative with the controls. The minimum detection limit of the assay was defined at 18.75 ng of mycobacterial DNA diluted in a sample-volume of 10 μl. In order to obtain an indication of the method's performance on clinical samples we applied the optimized assay to the detection of Mycobacterium avium subsp. paratuberculosis DNA in faeces, in comparison with real-time PCR. The concordance of the two methods with connection to real-time PCR positive and negative sample was defined respectively as 87.5% and 100%. The proposed method could be used as a highly specific and sensitive screening tool for the detection of mycobacteria directly from clinical samples in a very simple manner, without the need of high-cost dedicated equipment. The technology described here, may develop into a platform that could accommodate detection of many bacterial species and could be easily adapted for high throughput and expedite screening of samples. © 2009 Elsevier B.V. All rights reserved.
1. Introduction Pathogens of the genus Mycobacterium are a major cause of morbidity and mortality worldwide. Concerning humans, in addition to tuberculosis, exposure to mycobacteria has been linked to the pathogenesis of sarcoidosis and Crohn's disease which affect millions of people in Europe alone (Gazouli et al., 2005; Sechi et al., 2001). Nonhuman primates can also be infected by Mycobacterium tuberculosis (Lin et al., 2008), while cattle and other ruminants are natural hosts of the closely-related species M. bovis, which causes substantial financial loss in many regions worldwide (Serrano-Moreno et al., 2008). The M. avium complex affects birds and mammals, including both livestock and dogs (Primm et al., 2004). Finally, paratuberculosis is another chronic
⁎ Corresponding author. School of Animal Science, Department of Anatomy– Physiology, Agricultural University of Athens, Iera Odos 75, 11855 Votanikos, Athens, Greece. Tel.: +30 2105294383. E-mail address: [email protected] (J. Ikonomopoulos). 0167-7012/$ – see front matter © 2009 Elsevier B.V. All rights reserved. doi:10.1016/j.mimet.2009.06.009
infectious disease caused by a member of Mycobacterium spp., namely M. avium subsp paratuberculosis (MAP) that affects mainly ruminants. Diagnostic investigation of mycobacterial infections is hampered by the difficulty to detect in a specific manner low populations of mycobacteria, or the immunology markers associated with the infections they cause. The laboratory diagnostic investigation of mycobacterial diseases relies on light microscopy of hematoxylin–eosin (H&E) or Ziehl–Neelsen (ZN) stained sections, mycobacterial culture, ELISA test and DNA amplification techniques. Each of these methods has certain advantages and limitations but in general, those with high specificity and low minimum detection limit are usually complex and expensive (Bancroft and Stevens, 1990; Brisson et al., 1991; Cousins et al., 1992; Pandey and Talib, 1993; Ravva and Stanker, 2005). In most cases the reliable application of these diagnostic methods requires highly trained personnel and very often, dedicated equipment that can be of considerable cost. Therefore, the development of a new diagnostic assay that would be easily applicable even by non-specialized personnel, and would allow specific and sensitive detection and identification of mycobacteria directly from clinical samples without the need for high-
E. Liandris et al. / Journal of Microbiological Methods 78 (2009) 260–264
cost dedicated equipment, and definitely improve diagnostic investigation of mycobacterial infections. Nucleotide probes conjugated with gold nanoparticles (AuNPprobes) were first used for this purpose a few years ago for the detection of M. tuberculosis DNA (Baptista et al., 2006). More recently AuNP-probes have been integrated in research and routine diagnostic applications and have shown great potential (Chen et al., 2008; Kaittanis et al., 2007). Therefore in the present study which is concerned with the first stage of the development of an array of gold nanoparticle-conjugated mycobacterial probes, we have utilized an AuNP-universal-probe for the development of a diagnostic assay that allows rapid and direct detection collectively of the main mycobacterial pathogens [M. tuberculosis complex (MTC), M. avium complex (MAV) and M. avium subsp. paratuberculosis (MAP)] in clinical samples, in a way that is highly specific, very easy to perform, and requires little infrastructure and expertise. 2. Material and methods 2.1. Probe design Probe design was based on the 16s–23s ITS DNA region that has high homology among the mycobacterial species. Deposited sequences of some of the most common mycobacterial pathogens (GeneBank accession numbers DQ445257, NC008769, NC008595, NC002944, CP000325) were aligned with ClustalW software (EMBL-EBI). Design of the 20 base long probe, MycoD1: 5′ CCAGTCCGTGTGGTGTCCCT 3′ was based on genus conserved genomic regions. Specificity of the probe was evaluated through dot-blot hybridization experiments using DNA isolated from the bacterial species listed in Table 1. Then a thiol group and an (A)10 tail were added at the 5′ end of the probe in order to be used for its conjugation with AuNPs. 2.2. Preparation of the gold nanoparticle probes Gold nanoparticles were prepared by the citrate reduction method described by Grabar et al. (1995). Briefly, 250 ml of HAuCl4 1 mM was brought to a vigorous boil while stirring in a round-bottom flask. Twenty-five milliliters of sodium citrate 38.8 mM were rapidly added and the mixture was refluxed for 15 min with a continuous stirring. The flask was allowed to cool to room temperature and stored in the dark until use. The synthesized colloidal AuNPs used had an average diameter of about 15–20 nm as determined by transmission electron microscopy (TEM), (data not shown). The AuNP-probe was synthesized by adding 1 ml of an aqueous solution of gold nanoparticle to 4 nmol thiolated oligonucleotide
261
Table 2 Comparison of the positive (+) and negative (−) results obtained by real-time PCR and the AuNP-probe method for the detection of M. avium subsp. paratuberculosis on DNA isolated from faecal samples. Sample
Real time PCR
DNA ng/μl
AuNP-probe
1 2 3 4 5 6 7 8 9 10 11 12
+ + + + + + + + − − − −
1905.8 136.14 1680.7 220.12 0.22 0.16 0.24 0.58 – – – –
+ + + + + − + + − − − −
[5′-thiol-(A)10-CCAGTCCGTGTGGTGTCCCT-3′] using a previously described protocol (Hill and Mirkin, 2006). Briefly, the thiol modified oligonucleotide was initially incubated with gold nanoparticles overnight on an orbital shaker at room temperature. The solution was then brought to phosphate buffer (pH 7) 9 mM and SDS solution 0.1% (w/v) was added in order to prevent aggregation. The total salting buffer (2 M NaCl in 10 mM PBS) needed to reach a final concentration of 0.3 M NaCl was divided in six doses that were added to the above dilution over the course of the next 2 days. After centrifugation, the precipitate was washed with 500 μl of 10 mM PBS (pH 7.4),150 mM NaCl, 0.1% SDS, and it was re-centrifuged and re-dispersed in 500 ml of the same buffer. The gold nanoprobes were stored in the dark at room temperature. 2.3. Hybridization and color detection The hybridization parameters of the MycoD1 AuNP-probe were calibrated using a synthetic complementary oligonucleotide: 0.5 nmol of the complementary oligonucleotide was diluted in 70 μl of 10 mM PBS (pH 5.0). After denaturation at 95 °C for 3 min, the solution was cooled to 65 °C and 6 μl of the AuNP-probe was added followed by 2 μl of 0.01 N HCl, after 5 min of incubation at room temperature. Blank preparations were made in exactly the same way using an equivalent volume of 10 mM PBS instead of DNA. The solutions were kept for 5–15 min at room temperature until color was developed and then they were photographed. The color could be detected visually and it was confirmed with an absorption spectrum (Infinite M200, Tecan, Switzerland). DNA extracted from mycobacterial cultures (positive controls) and related bacteria (negative controls) were also tested under the same conditions (Table 1). 2.4. Minimum detection limit
Table 1 Bacteria used for the evaluation of specificity. Species
Number of isolates
Source⁎
AuNP-probe
M. tuberculosis M. bovis BCG M. bovis M. microti M. caprae M. gordonae M. avium subsp. paratuberculosis M. intracellulare M. avium M. smegmatis Escherichia coli Enterococcus fecalis Brucella spp. Salmonella spp. Nocardia spp.
9 1 4 2 1 2 20
AUA, AUA AUA, AUA, AUA AUA, AUA,
US, Quattromed
+ + + + + + +
4 6 3 9 4 7 12 4
AUA, AUA, AUA, AUA, AUA, AUA, AUA, AUA
US, Quattromed, US, Quattromed, VRI US, Quattromed US US US US
US, Quattromed US, Quattromed US, Quattromed US, Quattromed, VRI
+ + + − − − − −
⁎AUA: Agricultural University of Athens, Greece, US: University of Sassary, Sardinia, Italy, Quattromed: S.r.L, Estonia, VRI: Veterinary Research institute, Brno, Czech Republic.
The minimum amount of DNA necessary for a positive result was determined as previously described (Ikonomopoulos et al., 2000). Specifically, 1.2 μg/μl M. tuberculosis DNA was serially diluted in HPLC water, from 1:2 to 1:64, and 10 μl of each dilution was transferred to 70 μl of PBS buffer (pH 5.0). Then, 6 μl of AuNP-probe was added as described above. Blanks containing PBS buffer instead of DNA were used in comparison with the test-samples for reading the results by visual observation and spectrophotometry. 2.5. Direct application on clinical samples In order to obtain an indication of the method's performance on clinical samples, we applied the optimized assay for the detection of MAP DNA in faeces. For this purpose we collected 12 faecal samples from an equal number of goats (capra hircus) from a herd with a wellestablished record of paratuberculosis. In brief, isolation of DNA from this material (12 samples) was performed as follows: 2 g of faeces was homogenized with 20 ml of sterile water for 5 min. After 20 min of
262
E. Liandris et al. / Journal of Microbiological Methods 78 (2009) 260–264
Fig. 1. Representative results recoded by the AuNP-probe assay: “Blank”, “Negative”, “Positive”, denote respectively test tubes that contain only the AuNP-probe, DNA isolated from cultivated Nocardia spp., and DNA isolated from cultivated M. avium subsp. paratuberculosis. UV/visible spectra were 15 min after addition of HCl. The pink colour indicates the presence of the target DNA and the purple its absence.
sedimentation at room temperature, 600 μl of the supernatant was transferred to a 1.5 ml tube containing 300 mg glass beads (Adiagene, Montpellier, France) and was disrupted in a Mixer Mill (Retsch, Haan, Germany) at 30 Hz for 10 min. The liquid phase was collected and incubated overnight with 30 μl of proteinase K (20 mg/ml) and then processed with the Nucleospin Tissue kit (Macherey Nagel, Düren, Germany) according to the manufacturer's instructions. For the detection of MAP, 10 μl of the DNA product was added to 70 μl of PBS buffer (pH 5.0) and 6 μl of the AuNP-probe, as described above. The results were compared to those obtained by a real-time PCR assay previously described (Kim et al., 2004), (Table 2). The quantification was performed using MAP DNA of known concentration, and the standard curve as obtained by real-time PCR has R2 = 0.9998, slope= −3.115 and efficiency= 109.424%. In order to assess the repeatability of the method for the specific type of samples, testing with the proposed assay was repeated 5 times for each DNA extract.
3. Results The AuNP-probe solution exhibits a pink color because of surface plasmon resonance at an absorbance peak of ~ 525 nm. The acidic environment after the addition of HCl enhanced precipitation of AuNPprobe in the absence of a target DNA sequence leading to a change of colour from pink to purple (indicating an absorbance peak shift toward the longer wavelength). In the event of specific probe hybridization to a target sequence (i.e., mycobacterial DNA), no AuNP-probe aggregation occurs, and the solution remains pink. Thus, the reading of the method described herein can be obtained by visual and spectrophotometric comparison of the solutions before and after acid induced Au nanoprobe aggregation. Fig. 1 illustrates the characteristic results of the method as determined visually and by UV–visible spectroscopy. After the addition of HCl, the solutions that do not contain the target sequence, turn from pink to purple, denoting AuNP-probe aggregation.
Fig. 2. Serial dilutions of M. tuberculosis DNA (1.2 μg/μl). UV/visible spectra were 15 min after addition of HCl.
E. Liandris et al. / Journal of Microbiological Methods 78 (2009) 260–264
In the case of positive samples, no precipitation is observed even when the test tubes remain overnight at room temperature. The application of the proposed method on isolated bacteria produced positive results with all the mycobacterial isolates that were incorporated here in the assessment of the AuNP-probe specificity and with none of the negative controls (Table 1). At or below 18.75 ng of mycobacterial DNA diluted in a sample-volume of 10 μl, the solution turned purple after addition of HCl, defining the minimum detection limit of the assay (Fig. 2). The real-time PCR assay applied on the faecal samples for the detection of MAP, produced positive results for 8 of the 12 samples that were tested. Seven (7) of these produced the same result by the AuNP-probe method (87.5% concordance) that reacted negatively with all the real-time PCR-negative samples (n = 4), (100% concordance), (Table 2). The application of the proposed method on the DNA isolated from the 12 faecal samples produced exactly the same results every time (n = 5) the evaluation of this material was repeated (100% repeatability). 4. Discussion The use of thiol-linked single-stranded DNA-modified gold nanoparticles (herein referred to as AuNP-probes) for the colorimetric detection of DNA targets represents an inexpensive and easy to perform alternative to PCR, fluorescence or radioactivity based assays (Storhoff et al., 2004; Baptista et al., 2008). The use of single-stranded oligonucleotide targets that could be detected using two different Au-nanoprobes such that each was functionalized with a DNAoligonucleotide complementary to one half of the given target, was described for first time a decade ago (Mirkin et al., 1996). The hybridization of the two Au-nanoprobes with the target resulted in the formation of a polymeric network (crosslinking mechanism), which brought the gold nanoparticles close enough to result in a pink to purple color change. Therefore, the crosslinking of multiple Au-nanoprobes allows for extensive nanoparticle aggregation, and yields the observed colorimetric change. In this system, the Au-nanoprobes were oriented in a tail-to-tail arrangement—one probe functionalized via a 5′-thiol bond and the other through a 3′-thiol group (Storhoff et al., 2004; Li et al., 2006; Beermann et al., 2007). Following a parallel approach, we developed a simple assay based on a non-crosslinking hybridization method, where aggregation of the AuNP-probe is induced by an increasing acid concentration. Our method consists of visual and/or spectrophotometric comparison of solutions before and after acid induced AuNP-probe aggregation—the presence of a complementary target prevents aggregation and the solution remains pink whereas non-complementary targets do not prevent AuNP-probe aggregation, resulting in a visible change of color from pink to purple. The detection is based on the fact that double and single-stranded oligonucleotides have different electrostatic properties. After hybridization, single-stranded DNA forms double-stranded DNA, which has double-helix geometry. As a result, the double-stranded DNA cannot uncoil sufficiently like the single-stranded DNA to expose its bases toward the AuNP-probe. Therefore, AuNP-probe undergoes aggregation in an acidic environment. The proposed method can be used as an easily applicable, low-cost screening tool, which is the reason why our approach was aimed primarily at the development of a universal probe for mycobacterial pathogens. Notably, the AuNP-probe assay is concluded within just over 15 min and it is performed in a single tube, which reduces carryover contamination and facilitates simultaneous testing of many samples. The evaluation of the specificity and the repeatability of the AuNP-probe method indicates that it can detect in a reliable and highly specific manner a broad spectrum of mycobacteria without cross reactions with related bacteria. The latter was demonstrated effectively by the results recorded after the application of the proposed method on DNA isolated from faecal samples since these harbor mixed bacterial populations that
263
may exceed greatly that of the targeted pathogen. This type of evaluation should be considered more representative of the method's performance than that obtained with the use of samples artificially inoculated with mycobacteria, since the low proportion of the targeted sequence compared to miscellaneous, renders the detection conditions by far more demanding. Furthermore, in the case of artificially constructed positive controls, the targeted sequence is not found intra-cellularly, which facilitates its detection considerably. Even under these conditions, the performance of the proposed method proved comparable to that of real-time PCR regarding both the sensitivity (87.5% concordance of positive results) and specificity (100% concordance of negative results) at only a fraction of time and cost. The minimum detection limit that we recorded is comprehensively consistent with the use of the AuNP-probe assay as a sensitive and highly specific screening tool. This is supported by the fact that even the lowest concentration of the targeted sequence was easily detected by simple visual observation of the test and the control tubes, which renders spectrophotometric reading of the result advisable mainly with connection to automated applications. The cost of the proposed assay is defined by more than 90% by the cost of the AuNPs. These can be constructed in-house or be purchased commercially. Depending on the source of the gold nanoparticles the cost of the AuNPdetection of mycobacteria per test-sample corresponds to approximately 70–120% of that of RT-PCR. Notably this estimation does not include cost of labor of expert personnel and dedicated equipment that represent a very considerable part of the investment required for the application of RT-PCR but not of the assay described here. Finally, it should be noted that the proposed method represents a platform that could accommodate detection of many bacterial species using an array of probes and could be easily adapted for high throughput and expedite screening of samples from animals, humans, and food samples. Acknowledgements This work was performed within the context of the NANOMYC project that is supported by the E.U. (LSHB-CT-2007-036812). References Bancroft, J.D., Stevens, A., 1990. Theory and Practice of Histological Techniques, 3rd ed. Churchill Livingstone Publications, Edinburgh. Baptista, P.V., Koziol-Montewka, M., Paluch-Oles, J., Doria, G., Franco, R., 2006. Goldnanoparticle-probe-based assay for rapid and direct detection of Mycobacterium tuberculosis DNA in clinical samples. Clin. Chem. 52, 1433–1434. Baptista, P., Pereira, E., Eaton, P., Doria, G., Miranda, A., Gomes, I., Quaresma, P., Franco, R., 2008. Gold nanoparticles for the development of clinical diagnosis methods. Anal. Bioanal. Chem. 391, 943–950. Beermann, B., Carrillo-Nava, E., Scheffer, A., Buscher, W., Jawalekar, A.M., Seela, F., Hinz, H.J., 2007. Association temperature governs structure and apparent thermodynamics of DNA-gold nanoparticles. Biophys. Chemist. 126, 124–131. Brisson, N.A., Aznar, C., Chureau, C., Nguyen, S., Bortoli, M., Bonete, R., Pialoux, G., Gicquel, B., Garrigne, G., 1991. Diagnosis of tuberculosis by DNA amplification in clinical samples. Lancet 338, 364. Chen, S.H., Wu, V.C., Chuang, Y.C., Lin, C.S., 2008. Using oligonucleotide-functionalized Au nanoparticles to rapidly detect foodborne pathogens on a piezoelectric biosensor. J. Microbiol. Methods 73, 7–17. Cousins, D.V., Wilton, S.D., Francis, B.R., Gow, B.L., 1992. Use of polymerase chain reaction for rapid diagnosis of tuberculosis. J. Clin. Microbiol. 30, 255–258. Gazouli, M., Ikonomopoulos, J., Koundourakis, A., Bartos, M., Pavlik, I., Overduin, P., Kremer, K., Gorgoulis, V., Kittas, C., 2005. Characterization of Mycobacterium tuberculosis complex isolates from Greek patients with sarcoidosis by spoligotyping. J. Clin. Microbiol. 43, 4858–4861. Grabar, K.C., Griffith-Freeman, R., Hommer, M.B., Natan, M.J., 1995. Preparation and characterization of Au colloid monolayers. Anal. Chem. 67, 735–743. Hill, D.H., Mirkin, C.A., 2006. The bio-barcode assay for the detection of protein and nucleic acid targets using DTT-induced ligand exchange. Natl. Protoc. 1, 324–336. Ikonomopoulos, J.A., Gorgoulis, V.G., Kastrinakis, N.G., Zacharatos, P.V., Kokotas, S.N., Evagelou, K., Kotsinas, A.G., Tsakris, A.G., Manolis, E.N., Kittas, C.N., 2000. Sensitive differential detection of genetically related mycobacterial pathogens in archival material. Am. J. Clin. Pathol. 114, 940–950. Kaittanis, C., Nasser, S.A., Perez, J.M., 2007. One-step, nanoparticle-mediated bacterial detection with magnetic relaxation. Nano Lett. 7, 380–383. Kim, S.G., Kim, E.H., Lafferty, C.J., Miller, L.J., Koo, H.J., Stehman, S.M., Shin, S.J., 2004. Use of conventional and real-time polymerase chain reaction for confirmation of Mycobacterium avium subsp. paratuberculosis in a broth-based culture system ESP II. J. Vet. Diagn. Invest. 16, 448–453.
264
E. Liandris et al. / Journal of Microbiological Methods 78 (2009) 260–264
Li, Y., Wark, A.W., Lee, H.J., Corn, R.M., 2006. Single-nucleotide polymorphism genotyping by nanoparticle-enhanced surface plasmon resonance imaging measurements of surface ligation reactions. Anal. Chem. 78, 3158–3164. Lin, P.L., Yee, J., Klein, E., Lerche, N.W., 2008. Immunological concepts in tuberculosis diagnostics for non-human primates: a review. Med. Primatol. 37, 44–51. Mirkin, C.A., Letsinger, R.L., Mucic, R.C., Storhoff, J.J., 1996. A DNA-based method for rationally assembling nanoparticles into macroscopic materials. Nature 382, 607–609. Pandey, J., Talib, V.H., 1993. Laboratory diagnosis of tuberculosis: use of ELISA and PCR. Indian J. Pathol. Microbiol. 36, 512–518. Primm, T.P., Lucero, C.A., Falkinham, J.O., 2004. Health impacts of environmental mycobacteria. Clin. Microbiol. Rev. 17, 98–106. Ravva, S.V., Stanker, L.H., 2005. Real-time quantitative PCR detection of Mycobacterium avium subsp. paratuberculosis and differentiation from other mycobacteria using SYBR Green and TaqMan assays. J. Microbiol. Methods 63, 305–317.
Sechi, L.A., Mura, M., Tanda, F., Lissia, A., Solinas, A., Fadda, G., Zanetti, S., 2001. Identification of Mycobacterium avium subsp. paratuberculosis in biopsy specimens from patients with Crohn's disease identified by in situ hybridization. J. Clin. Microbiol. 39, 4514–4517. Serrano-Moreno, B.A., Romero, T.A., Arriaga, C., Torres, R.A., Pereira-Suárez, A.L., GarcíaSalazar, J.A., Estrada-Chávez, C., 2008. High frequency of Mycobacterium bovis DNA in colostra from tuberculous cattle detected by nested PCR. Zoonoses Public Health 55, 258–266. Storhoff, J.J., Lucas, A.D., Garimella, V., Bao, Y.P., Muller, U.R., 2004. Homogeneous detection of unamplified genomic DNA sequences based on colorimetric scatter of gold nanoparticle probes. Nat. Biotechnol. 22, 883–887.