- Email: [email protected]
Direct quantification of mitochondrial DNA and its 4.9-kb common deletion without DNA purification
Analytical Biochemistry 409 (2011) 298–300
Contents lists available at ScienceDirect
Analytical Biochemistry journal homepage: www.elsevier.com/locate/yabio
Notes & Tips
Direct quantification of mitochondrial DNA and its 4.9-kb common deletion without DNA purification A. Peinnequin a, T. Poyot a, A. Dib b, A. Aubourg b, C. Mouret a, C. Demeilliers b,c,⇑ a
Genomic Core Facility, IRBA La Tronche, BP87, 38702 La Tronche, France University of Grenoble, Grenoble F-38000, France c Inserm, U884, Grenoble F-38000, France b
a r t i c l e
i n f o
Article history: Received 1 October 2010 Accepted 6 October 2010 Available online 14 October 2010
a b s t r a c t Quantitative analysis of mitochondrial DNA (mtDNA) and its common deletion (CD) are sensitive and early markers for mitochondrial mutations and suffering. However, the use of purified DNA can lead to quantification errors because of variable DNA extraction yields due to the significant differences in size and structure between genomic DNA (gDNA) and mtDNA. We report a real-time qPCR-based protocol directly on tissue lysate, without DNA extraction. This method, which allows both absolute and relative measure, increases the measuring accuracy of the mtDNA/gDNA ratio and leads to reliable and more reproducible results when measuring the deleted/total mtDNA ratio. Ó 2010 Elsevier Inc. All rights reserved.
The ‘‘common deletion” (CD)1 of mitochondrial DNA (mtDNA) is the most frequent and best characterized mutation in mtDNA. It is a large deletion of 4977 bp in humans (4834 bp in rats). Even though deleted mtDNA represents only a small fraction of the mtDNA damage, a quantitative analysis of CD is considered to be a sensitive and early marker for mitochondrial mutations and suffering. Thus, in comprehensive molecular studies of mitochondrial disorders, aging, or oxidative stress, there is growing interest in a quantitative analysis of the CD, in addition to the determination of the total mtDNA content. Therefore, it would be highly meaningful to develop a sensitive method for determining in the same time the total mtDNA content and the relative frequency of deleted to total mtDNA. For quantitative assessment of the mtDNA content and the large mtDNA deletions, the experimental protocols previously published use either total DNA extracted directly from tissue [1,2] or mtDNA extracted from isolated mitochondria [3,4], or a mitochondrial lysate [5,6]. Use of total DNA extracted directly from tissue can lead to quantification errors, since significant differences in size and structure between genomic DNA (gDNA) and mtDNA led to differences in DNA extraction yields and/or reproducibility [6]. Use of mtDNA extracted from isolated mitochondria is not ideal because of the difficulty in completely recovering mitochondria
⇑ Corresponding author at: Laboratoire de Bioénergétique Fondamentale et Appliquée, Inserm, U884, Université Joseph Fourier, BP53, 38041 Grenoble cedex 9, France. Fax: +33 476 514 218. E-mail address: [email protected] (C. Demeilliers). 1 Abbreviations used: CD, common deletion; gDNA, genomic DNA; mtDNA, mitochondrial DNA. 0003-2697/$ - see front matter Ó 2010 Elsevier Inc. All rights reserved. doi:10.1016/j.ab.2010.10.010
of various sizes and densities and to obtain an mtDNA preparation completely free of gDNA. We describe here, a real-time PCR (qPCR)-based protocol directly on a tissue lysate, without preliminary extraction of DNA to quantify mtDNA, deleted mtDNA, and gDNA. This method, which allows both absolute and relative measure, increases the measuring accuracy of the mtDNA/gDNA ratio. Moreover, this improvement leads to reliable and more reproducible results when measuring the deleted/total mtDNA ratio. Wistar rat brain and liver samples (30 mg) were disrupted using a Retsch MM 301 mixer mill (2 min, 30 Hz, 2-mm tungsten carbide bead) in 1 mL of 1 lysis buffer (0.05% (v/v) Tween 20, 0.05% (v/v) Nonidet P40, 10 mM Tris HCl, pH 8.0) adapted from [7] and 0.1 mg/ mL proteinase K. Samples were incubated for 30 min at 56 °C. Then proteinase K was inactivated (15 min, 98 °C). Lysates (20 lL) were diluted in 100 lL 0.5 lysis buffer and sonicated using an Ultrasonik 300 water-bath sonicator (Ney, Yucaipa, USA) at maximum power (175 W) for 10 min. Then 14 lL of sonicated lysate was diluted in 8 lL of freshly sonicated 1 lysis buffer 1 and 48 lL H2O (final concentration: 1 mg tissue/mL; 0.214 lysis buffer). This step allowed obtaining reproducible qPCR efficiency due to the homogenization of the detergent present in the lysis buffer. Lysates are stable and can be kept frozen at 20 °C for months. All chemicals were supplied by Sigma–Aldrich (France). qPCRs were carried out with the LC FastStart DNA Master SYBR Green kit (Roche) using 7 mM MgCl2 and 0.4 lM for each primer (final concentration) from 5 lL of final lysate (0.214 lysis buffer). Forward and backward primers were as follows: mtDNA GGGTTAAAAACCGACGCAATC and AATGGGTATGAAGCTGTGATTTGAG; deleted mtDNA TCAGCA ACCGACTACACTCATTTC and AGTTATGGATGTGGCGATTAAAGTG;
299
Notes & Tips / Anal. Biochem. 409 (2011) 298–300
35
Crossing Threshold
GAPDH CCTGTTCATCCCTCCACACATC and CCAGTGATTTTCCAGCC CTAATC. PCR was performed using Lightcycler (Roche) for 45 cycles at 95 °C for 20 s, 54 °C for 5 s, and 72 °C for 8 s. All assays were carried out in duplicate. For each sample, PCR efficiency was assessed using LinRegPCR software [8]. The relative quantification was then achieved using the comparative threshold cycle method with efficiency correction [9] using the average value of measured PCR efficiencies [10]. Data are expressed using arbitrary relative unit depending on the calibrator value. PCR inhibition was assessed using inhibition assay based on alien template amplification as described in Supplementary data. A liver sample was ground to a fine, dry powder in a mortar and pestle under liquid nitrogen. The homogenate was then divided into 50-mg fractions which were subjected either to direct lysis or to DNA extraction (10 replicates). Total DNA extraction was carried out using a DNeasy blood and tissue kit (Qiagen, France) according to the manufacturer instructions. Data are mean ± SEM. Variability is expressed as relative standard deviation. Inhibition assays and comparison to total DNA extraction were analyzed using Wilcoxon tests. The effects of aging were analyzed using t tests (n = 11). Significance was accepted at P < 0.05. All samples were collected from experimental studies in accordance with ethical French guidelines and approved by the Ethical Committee of the French Army Medical Research Center. Specificity of PCR products obtained on a tissue lysate prepared as previously described was documented with high-resolution gel electrophoresis (Agilent 2100 Bioanalyser, DNA 500 kit) and with a LightCycler melting curve analysis. It resulted, respectively, in a single product with the expected length and in a single productspecific melting temperature (cf. Supplementary data). To confirm precision and reproducibility of qPCR from a tissue lysate, the interassay variation was investigated using six different tissue lysates prepared as described previously from the same rat liver and run in duplicate. PCR efficiencies using LinRegPCR software [8] were very close (1.79 ± 0.08, 1.80 ± 0.05, and 1.76 ± 0.06 for GAPDH, total and deleted mtDNA). Ct variability was very low (RSV 0.63%, 1.75%, and 1.76% for GAPDH and total and deleted mtDNA). Interexperimental reproducibility for duplicates of all investigated lysates was, respectively, 5.9% and 14.5% for total mtDNA/GAPDH and deleted/total mtDNA. In the literature, only few data are available regarding the reproducibility of mtDNA quantification. Bhat and Epelboym observed a 30% interexperimental reproducibility for total mtDNA/gDNA measured on total cellular DNA isolated from human normal blood [11] whereas Andreu et al. described a mtDNA/ gDNA relative standard deviation from 5.7% to 57.9% according to the DNA extraction methods [6]. Poe et al. quantified simultaneously wild-type and deleted mtDNA and described, respectively, a 15% and 11% relative standard deviation for wild-type and deleted mtDNA quantitation using a mitochondrial lysate of the human cybrid cell line containing 43–95% of deleted mtDNA [5]. However, in normal aging, the level of common deletion that we measure is generally much lower (less than 1% of total mtDNA). So, our lysate-based method has a good efficiency, reproducibility, and sensitivity compared to the previously published qPCR methods. Moreover, lysate-induced PCR inhibition was assessed both in direct lysate and in lysis buffer by alien inhibition assay. EPCR calculated from the slope (102% and 110%) and linearity (r: 0.999 and 1.000) are very close for lysis buffer and direct lysate (Fig. 1). These results are confirmed using LinRegPCR software [8]. Calculated EPCR were 83 ± 3 and 81 ± 4% for lysis buffer and direct lysate (P = 0.243). Thus, direct lysate components in the proposed range do not alter PCR kinetic regarding lysis buffer components. One of the theoretical advantages of the lysate-based method is to avoid extraction yield differences between mtDNA and gDNA. To test this hypothesis, the direct method was compared to total
30
25
20
15 103
104
105
106
107
108
log(copy number) Fig.1. qPCR inhibition assay using alien recombinant template. () Direct lysate EPCR = 110%. r = 1.000, y = 3.10x + 37.08; and (d) lysis buffer. EPCR = 102%. r = 0.999, y = 3.28x + 37.02.
DNA-based protocol (DNeasy blood and tissue kit, Qiagen) as it has been recently recommended [6]. A liver sample from a 24-monthold rat was ground to a fine, dry powder in a mortar and pestle and then was divided into 20 equal mass fractions as described above. Ten samples were processed using the direct method and total DNA extractions were performed on the 10 remaining samples. Total mtDNA/GAPDH ratios obtained with both methods differ significantly (P = 0.015, Wilcoxon test, n = 10) (Fig. 2). As expected, the values observed in the lysate are lower (mean ± SEM: 1.00 ± 0.09 from lysate and 1.49 ± 0.13 from total DNA). However, the relative standard deviations are very close using either the direct method or total DNA extraction (27.7% versus 26.7%). Both methods are equivalent to quantify the different forms of mtDNA (mean ± SEM deleted/total mtDNA: 1.00 ± 0.06 from lysate and 0.87 ± 0.09 from total DNA, P = 0.015, Wilcoxon test, n = 10). The relative standard deviations are lower using the direct method than the total DNA extraction (19.3% versus 30.8%). These results confirm that: (i) the DNA extraction provides a variable yield of mtDNA and gDNA regarding direct determination and (ii) the lysis buffer components do not interact with PCR quantification, even for low copy deleted mtDNA. As a validation of the assay in the rat, we have used this protocol to determine both the mtDNA relative copy number and the CD frequency in a mitotic and a postmitotic tissue (liver and brain, respectively) of 6- and 24-month-old rats. Concerning the relative
Fig.2. Comparison of total mtDNA/gDNA and deleted/total mtDNA ratios in direct lysate and after a DNA extraction (rat liver). Results are expressed relative to the lysate values. Data are mean ± standard deviation. Ten replicates were performed (**P < 0.01; /P > 0.05).
300
Notes & Tips / Anal. Biochem. 409 (2011) 298–300
mtDNA copy number, our study shows a significant decrease of 50% in the liver of old rats compared to adult and no change in the brain. These results are in accordance with the literature [12–15]. Moreover, we have found a significant increase of 60% in the frequency of the CD in the liver but not in the brain. Other previous studies describe an increase of the CD frequency in the liver of old rats but in different proportions [1,3,4,16–18]. These differences could be explained by the various methodologies used. Indeed, these studies have been performed on purified total DNA or mtDNA. Our method using a tissue lysate allows elimination of the extraction DNA step and improvement of the results accuracy. Moreover, we have determined absolute copy number of both deleted and total mtDNA in liver and brain tissue of 6-month-old rats (n = 11) thanks to the standard curve described in Supplementary data. In 1 lg of brain, deleted and total mtDNA were, respectively, 7.83 102 ± 0.85 102 and 5.89 105 ± 0.54 105 copy number. In liver, the corresponding values were, respectively, 1.61 103 ± 0.28 103 and 2.29 1 05 ± 0.45 105. So, common deletion represents 0.13% and 0.7% of total mtDNA, respectively, in the brain and in the liver. These results are in accordance with other studies using semiquantitative methods [1,2,19]. This method is a real improvement and leads to more reliable and reproducible results when measuring the deleted/total mtDNA ratio. Due to its sensitivity, this method can be applied to clinical biopsies. Moreover, through shortening the number of steps and while avoiding carrying out an extraction of DNA, it represents a benefit in terms of cost and time effectiveness. Acknowledgments This work was supported in part by grants from ‘‘Danone Eaux France” and ‘‘Delegation Générale pour l’Armement”. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.ab.2010.10.010. References [1] J.A. Nicklas, E.M. Brooks, T.C. Hunter, R. Single, R.F. Branda, Development of a quantitative PCR (TaqMan) assay for relative mitochondrial DNA copy number and the common mitochondrial DNA deletion in the rat, Environ. Mol. Mutagen. 44 (2004) 313–320.
[2] N. Filser, C. Margue, C. Richter, Quantification of wild-type mitochondrial DNA and its 4.8-kb deletion in rat organs, Biochem. Biophys. Res. Commun. 233 (1997) 102–107. [3] C.M. Kang, B.S. Kristal, B.P. Yu, Age-related mitochondrial DNA deletions: effect of dietary restriction, Free Radic. Biol. Med. 24 (1998) 148–154. [4] W. Edris, B. Burgett, O.C. Stine, C.R. Filburn, Detection and quantitation by competitive PCR of an age-associated increase in a 4.8-kb deletion in rat mitochondrial DNA, Mutat. Res. 316 (1994) 69–78. [5] B.G. Poe, M. Navratil, E.A. Arriaga, Absolute quantitation of a heteroplasmic mitochondrial DNA deletion using a multiplex three-primer real-time PCR assay, Anal. Biochem. 362 (2007) 193–200. [6] M.R. Andreu AL, R. Marti, E. García-Arumí, Quantification of mitochondrial DNA copy number: pre-analytical factors, Mitochondrion 9 (2009) 242– 246. [7] J.F. Poulin, M. Sylvestre, P. Champagne, M.L. Dion, N. Kettaf, A. Dumont, M. Lainesse, P. Fontaine, D.C. Roy, C. Perreault, R.P. Sekaly, R. Cheynier, Evidence for adequate thymic function but impaired naive T-cell survival following allogeneic hematopoietic stem cell transplantation in the absence of chronic graft-versus-host disease, Blood 102 (2003) 4600–4607. [8] J.M. Ruijter, C. Ramakers, W.M. Hoogaars, Y. Karlen, O. Bakker, M.J. Van Den Hoff, A.F. Moorman, Amplification efficiency: linking baseline and bias in the analysis of quantitative PCR data, Nucleic Acids Res. 37 (6) (2009) e45 (Epub 2009 February 22). [9] M.W. Pfaffl, A new mathematical model for relative quantification in real-time RT-PCR, Nucleic Acids Res. 29 (2001) e45. [10] S. Cikos, A. Bukovska, J. Koppel, Relative quantification of mRNA: comparison of methods currently used for real-time PCR data analysis, BMC Mol. Biol. 8 (2007) 113. [11] H.K. Bhat, I. Epelboym, Quantitative analysis of total mitochondrial DNA: competitive polymerase chain reaction versus real-time polymerase chain reaction, J. Biochem. Mol. Toxicol. 18 (2004) 180–186. [12] P. Cassano, A.G. Sciancalepore, A.M. Lezza, C. Leeuwenburgh, P. Cantatore, M.N. Gadaleta, Tissue-specific effect of age and caloric restriction diet on mitochondrial DNA content, Rejuvenation Res. 9 (2006) 211–214. [13] R. Barazzoni, K.R. Short, K.S. Nair, Effects of aging on mitochondrial DNA copy number and cytochrome c oxidase gene expression in rat skeletal muscle, liver, and heart, J. Biol. Chem. 275 (2000) 3343–3347. [14] K. Asano, M. Nakamura, A. Asano, T. Sato, H. Tauchi, Quantitation of changes in mitochondrial DNA during aging and regeneration of rat liver using nonradioactive DNA probes, Mech. Ageing Dev. 64 (1992) 85–98. [15] D.M. Stocco, J.C. Hutson, Quantitation of mitochondrial DNA and protein in the liver of Fischer 344 rats during aging, J. Gerontol. 33 (1978) 802– 809. [16] M.N. Gadaleta, G. Rainaldi, A.M. Lezza, F. Milella, F. Fracasso, P. Cantatore, Mitochondrial DNA copy number and mitochondrial DNA deletion in adult and senescent rats, Mutat. Res. 275 (1992) 181–193. [17] J.L. Quiles, J.J. Ochoa, M.C. Ramirez-Tortosa, J.R. Huertas, J. Mataix, Age-related mitochondrial DNA deletion in rat liver depends on dietary fat unsaturation, J. Gerontol. A Biol. Sci. Med. Sci. 61 (2006) 107–114. [18] C.R. Filburn, W. Edris, M. Tamatani, B. Hogue, I. Kudryashova, R.G. Hansford, Mitochondrial electron transport chain activities and DNA deletions in regions of the rat brain, Mech. Ageing Dev. 87 (1996) 35–46. [19] D.L. Yowe, B.N. Ames, Quantitation of age-related mitochondrial DNA deletions in rat tissues shows that their pattern of accumulation differs from that of humans, Gene 209 (1998) 23–30.
Contents lists available at ScienceDirect
Analytical Biochemistry journal homepage: www.elsevier.com/locate/yabio
Notes & Tips
Direct quantification of mitochondrial DNA and its 4.9-kb common deletion without DNA purification A. Peinnequin a, T. Poyot a, A. Dib b, A. Aubourg b, C. Mouret a, C. Demeilliers b,c,⇑ a
Genomic Core Facility, IRBA La Tronche, BP87, 38702 La Tronche, France University of Grenoble, Grenoble F-38000, France c Inserm, U884, Grenoble F-38000, France b
a r t i c l e
i n f o
Article history: Received 1 October 2010 Accepted 6 October 2010 Available online 14 October 2010
a b s t r a c t Quantitative analysis of mitochondrial DNA (mtDNA) and its common deletion (CD) are sensitive and early markers for mitochondrial mutations and suffering. However, the use of purified DNA can lead to quantification errors because of variable DNA extraction yields due to the significant differences in size and structure between genomic DNA (gDNA) and mtDNA. We report a real-time qPCR-based protocol directly on tissue lysate, without DNA extraction. This method, which allows both absolute and relative measure, increases the measuring accuracy of the mtDNA/gDNA ratio and leads to reliable and more reproducible results when measuring the deleted/total mtDNA ratio. Ó 2010 Elsevier Inc. All rights reserved.
The ‘‘common deletion” (CD)1 of mitochondrial DNA (mtDNA) is the most frequent and best characterized mutation in mtDNA. It is a large deletion of 4977 bp in humans (4834 bp in rats). Even though deleted mtDNA represents only a small fraction of the mtDNA damage, a quantitative analysis of CD is considered to be a sensitive and early marker for mitochondrial mutations and suffering. Thus, in comprehensive molecular studies of mitochondrial disorders, aging, or oxidative stress, there is growing interest in a quantitative analysis of the CD, in addition to the determination of the total mtDNA content. Therefore, it would be highly meaningful to develop a sensitive method for determining in the same time the total mtDNA content and the relative frequency of deleted to total mtDNA. For quantitative assessment of the mtDNA content and the large mtDNA deletions, the experimental protocols previously published use either total DNA extracted directly from tissue [1,2] or mtDNA extracted from isolated mitochondria [3,4], or a mitochondrial lysate [5,6]. Use of total DNA extracted directly from tissue can lead to quantification errors, since significant differences in size and structure between genomic DNA (gDNA) and mtDNA led to differences in DNA extraction yields and/or reproducibility [6]. Use of mtDNA extracted from isolated mitochondria is not ideal because of the difficulty in completely recovering mitochondria
⇑ Corresponding author at: Laboratoire de Bioénergétique Fondamentale et Appliquée, Inserm, U884, Université Joseph Fourier, BP53, 38041 Grenoble cedex 9, France. Fax: +33 476 514 218. E-mail address: [email protected] (C. Demeilliers). 1 Abbreviations used: CD, common deletion; gDNA, genomic DNA; mtDNA, mitochondrial DNA. 0003-2697/$ - see front matter Ó 2010 Elsevier Inc. All rights reserved. doi:10.1016/j.ab.2010.10.010
of various sizes and densities and to obtain an mtDNA preparation completely free of gDNA. We describe here, a real-time PCR (qPCR)-based protocol directly on a tissue lysate, without preliminary extraction of DNA to quantify mtDNA, deleted mtDNA, and gDNA. This method, which allows both absolute and relative measure, increases the measuring accuracy of the mtDNA/gDNA ratio. Moreover, this improvement leads to reliable and more reproducible results when measuring the deleted/total mtDNA ratio. Wistar rat brain and liver samples (30 mg) were disrupted using a Retsch MM 301 mixer mill (2 min, 30 Hz, 2-mm tungsten carbide bead) in 1 mL of 1 lysis buffer (0.05% (v/v) Tween 20, 0.05% (v/v) Nonidet P40, 10 mM Tris HCl, pH 8.0) adapted from [7] and 0.1 mg/ mL proteinase K. Samples were incubated for 30 min at 56 °C. Then proteinase K was inactivated (15 min, 98 °C). Lysates (20 lL) were diluted in 100 lL 0.5 lysis buffer and sonicated using an Ultrasonik 300 water-bath sonicator (Ney, Yucaipa, USA) at maximum power (175 W) for 10 min. Then 14 lL of sonicated lysate was diluted in 8 lL of freshly sonicated 1 lysis buffer 1 and 48 lL H2O (final concentration: 1 mg tissue/mL; 0.214 lysis buffer). This step allowed obtaining reproducible qPCR efficiency due to the homogenization of the detergent present in the lysis buffer. Lysates are stable and can be kept frozen at 20 °C for months. All chemicals were supplied by Sigma–Aldrich (France). qPCRs were carried out with the LC FastStart DNA Master SYBR Green kit (Roche) using 7 mM MgCl2 and 0.4 lM for each primer (final concentration) from 5 lL of final lysate (0.214 lysis buffer). Forward and backward primers were as follows: mtDNA GGGTTAAAAACCGACGCAATC and AATGGGTATGAAGCTGTGATTTGAG; deleted mtDNA TCAGCA ACCGACTACACTCATTTC and AGTTATGGATGTGGCGATTAAAGTG;
299
Notes & Tips / Anal. Biochem. 409 (2011) 298–300
35
Crossing Threshold
GAPDH CCTGTTCATCCCTCCACACATC and CCAGTGATTTTCCAGCC CTAATC. PCR was performed using Lightcycler (Roche) for 45 cycles at 95 °C for 20 s, 54 °C for 5 s, and 72 °C for 8 s. All assays were carried out in duplicate. For each sample, PCR efficiency was assessed using LinRegPCR software [8]. The relative quantification was then achieved using the comparative threshold cycle method with efficiency correction [9] using the average value of measured PCR efficiencies [10]. Data are expressed using arbitrary relative unit depending on the calibrator value. PCR inhibition was assessed using inhibition assay based on alien template amplification as described in Supplementary data. A liver sample was ground to a fine, dry powder in a mortar and pestle under liquid nitrogen. The homogenate was then divided into 50-mg fractions which were subjected either to direct lysis or to DNA extraction (10 replicates). Total DNA extraction was carried out using a DNeasy blood and tissue kit (Qiagen, France) according to the manufacturer instructions. Data are mean ± SEM. Variability is expressed as relative standard deviation. Inhibition assays and comparison to total DNA extraction were analyzed using Wilcoxon tests. The effects of aging were analyzed using t tests (n = 11). Significance was accepted at P < 0.05. All samples were collected from experimental studies in accordance with ethical French guidelines and approved by the Ethical Committee of the French Army Medical Research Center. Specificity of PCR products obtained on a tissue lysate prepared as previously described was documented with high-resolution gel electrophoresis (Agilent 2100 Bioanalyser, DNA 500 kit) and with a LightCycler melting curve analysis. It resulted, respectively, in a single product with the expected length and in a single productspecific melting temperature (cf. Supplementary data). To confirm precision and reproducibility of qPCR from a tissue lysate, the interassay variation was investigated using six different tissue lysates prepared as described previously from the same rat liver and run in duplicate. PCR efficiencies using LinRegPCR software [8] were very close (1.79 ± 0.08, 1.80 ± 0.05, and 1.76 ± 0.06 for GAPDH, total and deleted mtDNA). Ct variability was very low (RSV 0.63%, 1.75%, and 1.76% for GAPDH and total and deleted mtDNA). Interexperimental reproducibility for duplicates of all investigated lysates was, respectively, 5.9% and 14.5% for total mtDNA/GAPDH and deleted/total mtDNA. In the literature, only few data are available regarding the reproducibility of mtDNA quantification. Bhat and Epelboym observed a 30% interexperimental reproducibility for total mtDNA/gDNA measured on total cellular DNA isolated from human normal blood [11] whereas Andreu et al. described a mtDNA/ gDNA relative standard deviation from 5.7% to 57.9% according to the DNA extraction methods [6]. Poe et al. quantified simultaneously wild-type and deleted mtDNA and described, respectively, a 15% and 11% relative standard deviation for wild-type and deleted mtDNA quantitation using a mitochondrial lysate of the human cybrid cell line containing 43–95% of deleted mtDNA [5]. However, in normal aging, the level of common deletion that we measure is generally much lower (less than 1% of total mtDNA). So, our lysate-based method has a good efficiency, reproducibility, and sensitivity compared to the previously published qPCR methods. Moreover, lysate-induced PCR inhibition was assessed both in direct lysate and in lysis buffer by alien inhibition assay. EPCR calculated from the slope (102% and 110%) and linearity (r: 0.999 and 1.000) are very close for lysis buffer and direct lysate (Fig. 1). These results are confirmed using LinRegPCR software [8]. Calculated EPCR were 83 ± 3 and 81 ± 4% for lysis buffer and direct lysate (P = 0.243). Thus, direct lysate components in the proposed range do not alter PCR kinetic regarding lysis buffer components. One of the theoretical advantages of the lysate-based method is to avoid extraction yield differences between mtDNA and gDNA. To test this hypothesis, the direct method was compared to total
30
25
20
15 103
104
105
106
107
108
log(copy number) Fig.1. qPCR inhibition assay using alien recombinant template. () Direct lysate EPCR = 110%. r = 1.000, y = 3.10x + 37.08; and (d) lysis buffer. EPCR = 102%. r = 0.999, y = 3.28x + 37.02.
DNA-based protocol (DNeasy blood and tissue kit, Qiagen) as it has been recently recommended [6]. A liver sample from a 24-monthold rat was ground to a fine, dry powder in a mortar and pestle and then was divided into 20 equal mass fractions as described above. Ten samples were processed using the direct method and total DNA extractions were performed on the 10 remaining samples. Total mtDNA/GAPDH ratios obtained with both methods differ significantly (P = 0.015, Wilcoxon test, n = 10) (Fig. 2). As expected, the values observed in the lysate are lower (mean ± SEM: 1.00 ± 0.09 from lysate and 1.49 ± 0.13 from total DNA). However, the relative standard deviations are very close using either the direct method or total DNA extraction (27.7% versus 26.7%). Both methods are equivalent to quantify the different forms of mtDNA (mean ± SEM deleted/total mtDNA: 1.00 ± 0.06 from lysate and 0.87 ± 0.09 from total DNA, P = 0.015, Wilcoxon test, n = 10). The relative standard deviations are lower using the direct method than the total DNA extraction (19.3% versus 30.8%). These results confirm that: (i) the DNA extraction provides a variable yield of mtDNA and gDNA regarding direct determination and (ii) the lysis buffer components do not interact with PCR quantification, even for low copy deleted mtDNA. As a validation of the assay in the rat, we have used this protocol to determine both the mtDNA relative copy number and the CD frequency in a mitotic and a postmitotic tissue (liver and brain, respectively) of 6- and 24-month-old rats. Concerning the relative
Fig.2. Comparison of total mtDNA/gDNA and deleted/total mtDNA ratios in direct lysate and after a DNA extraction (rat liver). Results are expressed relative to the lysate values. Data are mean ± standard deviation. Ten replicates were performed (**P < 0.01; /P > 0.05).
300
Notes & Tips / Anal. Biochem. 409 (2011) 298–300
mtDNA copy number, our study shows a significant decrease of 50% in the liver of old rats compared to adult and no change in the brain. These results are in accordance with the literature [12–15]. Moreover, we have found a significant increase of 60% in the frequency of the CD in the liver but not in the brain. Other previous studies describe an increase of the CD frequency in the liver of old rats but in different proportions [1,3,4,16–18]. These differences could be explained by the various methodologies used. Indeed, these studies have been performed on purified total DNA or mtDNA. Our method using a tissue lysate allows elimination of the extraction DNA step and improvement of the results accuracy. Moreover, we have determined absolute copy number of both deleted and total mtDNA in liver and brain tissue of 6-month-old rats (n = 11) thanks to the standard curve described in Supplementary data. In 1 lg of brain, deleted and total mtDNA were, respectively, 7.83 102 ± 0.85 102 and 5.89 105 ± 0.54 105 copy number. In liver, the corresponding values were, respectively, 1.61 103 ± 0.28 103 and 2.29 1 05 ± 0.45 105. So, common deletion represents 0.13% and 0.7% of total mtDNA, respectively, in the brain and in the liver. These results are in accordance with other studies using semiquantitative methods [1,2,19]. This method is a real improvement and leads to more reliable and reproducible results when measuring the deleted/total mtDNA ratio. Due to its sensitivity, this method can be applied to clinical biopsies. Moreover, through shortening the number of steps and while avoiding carrying out an extraction of DNA, it represents a benefit in terms of cost and time effectiveness. Acknowledgments This work was supported in part by grants from ‘‘Danone Eaux France” and ‘‘Delegation Générale pour l’Armement”. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.ab.2010.10.010. References [1] J.A. Nicklas, E.M. Brooks, T.C. Hunter, R. Single, R.F. Branda, Development of a quantitative PCR (TaqMan) assay for relative mitochondrial DNA copy number and the common mitochondrial DNA deletion in the rat, Environ. Mol. Mutagen. 44 (2004) 313–320.
[2] N. Filser, C. Margue, C. Richter, Quantification of wild-type mitochondrial DNA and its 4.8-kb deletion in rat organs, Biochem. Biophys. Res. Commun. 233 (1997) 102–107. [3] C.M. Kang, B.S. Kristal, B.P. Yu, Age-related mitochondrial DNA deletions: effect of dietary restriction, Free Radic. Biol. Med. 24 (1998) 148–154. [4] W. Edris, B. Burgett, O.C. Stine, C.R. Filburn, Detection and quantitation by competitive PCR of an age-associated increase in a 4.8-kb deletion in rat mitochondrial DNA, Mutat. Res. 316 (1994) 69–78. [5] B.G. Poe, M. Navratil, E.A. Arriaga, Absolute quantitation of a heteroplasmic mitochondrial DNA deletion using a multiplex three-primer real-time PCR assay, Anal. Biochem. 362 (2007) 193–200. [6] M.R. Andreu AL, R. Marti, E. García-Arumí, Quantification of mitochondrial DNA copy number: pre-analytical factors, Mitochondrion 9 (2009) 242– 246. [7] J.F. Poulin, M. Sylvestre, P. Champagne, M.L. Dion, N. Kettaf, A. Dumont, M. Lainesse, P. Fontaine, D.C. Roy, C. Perreault, R.P. Sekaly, R. Cheynier, Evidence for adequate thymic function but impaired naive T-cell survival following allogeneic hematopoietic stem cell transplantation in the absence of chronic graft-versus-host disease, Blood 102 (2003) 4600–4607. [8] J.M. Ruijter, C. Ramakers, W.M. Hoogaars, Y. Karlen, O. Bakker, M.J. Van Den Hoff, A.F. Moorman, Amplification efficiency: linking baseline and bias in the analysis of quantitative PCR data, Nucleic Acids Res. 37 (6) (2009) e45 (Epub 2009 February 22). [9] M.W. Pfaffl, A new mathematical model for relative quantification in real-time RT-PCR, Nucleic Acids Res. 29 (2001) e45. [10] S. Cikos, A. Bukovska, J. Koppel, Relative quantification of mRNA: comparison of methods currently used for real-time PCR data analysis, BMC Mol. Biol. 8 (2007) 113. [11] H.K. Bhat, I. Epelboym, Quantitative analysis of total mitochondrial DNA: competitive polymerase chain reaction versus real-time polymerase chain reaction, J. Biochem. Mol. Toxicol. 18 (2004) 180–186. [12] P. Cassano, A.G. Sciancalepore, A.M. Lezza, C. Leeuwenburgh, P. Cantatore, M.N. Gadaleta, Tissue-specific effect of age and caloric restriction diet on mitochondrial DNA content, Rejuvenation Res. 9 (2006) 211–214. [13] R. Barazzoni, K.R. Short, K.S. Nair, Effects of aging on mitochondrial DNA copy number and cytochrome c oxidase gene expression in rat skeletal muscle, liver, and heart, J. Biol. Chem. 275 (2000) 3343–3347. [14] K. Asano, M. Nakamura, A. Asano, T. Sato, H. Tauchi, Quantitation of changes in mitochondrial DNA during aging and regeneration of rat liver using nonradioactive DNA probes, Mech. Ageing Dev. 64 (1992) 85–98. [15] D.M. Stocco, J.C. Hutson, Quantitation of mitochondrial DNA and protein in the liver of Fischer 344 rats during aging, J. Gerontol. 33 (1978) 802– 809. [16] M.N. Gadaleta, G. Rainaldi, A.M. Lezza, F. Milella, F. Fracasso, P. Cantatore, Mitochondrial DNA copy number and mitochondrial DNA deletion in adult and senescent rats, Mutat. Res. 275 (1992) 181–193. [17] J.L. Quiles, J.J. Ochoa, M.C. Ramirez-Tortosa, J.R. Huertas, J. Mataix, Age-related mitochondrial DNA deletion in rat liver depends on dietary fat unsaturation, J. Gerontol. A Biol. Sci. Med. Sci. 61 (2006) 107–114. [18] C.R. Filburn, W. Edris, M. Tamatani, B. Hogue, I. Kudryashova, R.G. Hansford, Mitochondrial electron transport chain activities and DNA deletions in regions of the rat brain, Mech. Ageing Dev. 87 (1996) 35–46. [19] D.L. Yowe, B.N. Ames, Quantitation of age-related mitochondrial DNA deletions in rat tissues shows that their pattern of accumulation differs from that of humans, Gene 209 (1998) 23–30.