- Email: [email protected]
Discovery of Rickettsia species in Dermacentor niveus Neumann ticks by investigating the diversity of bacterial communities
Ticks and Tick-borne Diseases 5 (2014) 564–568
Contents lists available at ScienceDirect
Ticks and Tick-borne Diseases journal homepage: www.elsevier.com/locate/ttbdis
Original article
Discovery of Rickettsia species in Dermacentor niveus Neumann ticks by investigating the diversity of bacterial communities Lu Zhuang a , Cheng-Yan Wang b , Yi-Gang Tong a , Fang Tang c , Hong Yang a , Wei Liu a,∗ , Wu-Chun Cao a,∗ a State Key Laboratory of Pathogen and Biosecurity, Beijing Institute of Microbiology and Epidemiology, 20 Dong-Da St., Fengtai District, Beijing 100071, PR China b SinoGenoMax Co., 3 Yong-Chang-Bei Rd., Beijing Economic-Technological Development Area, Beijing 100176, PR China c Center for Diseases Control and Prevention of Chinese Peoples’ Armed Police Forces, Beijing 102613, PR China
a r t i c l e
i n f o
Article history: Received 22 March 2013 Received in revised form 7 March 2014 Accepted 1 April 2014 Available online 18 June 2014 Keywords: Tick Rickettsia China 16s rRNA Microbial diversity
a b s t r a c t Ticks (Dermacentor niveus Neumann) were collected from Tacheng, Xinjiang Uygur Autonomous Region, and their bacterial diversity was investigated using the 16S RNA gene library method from one pooled sample. A total of 452 clones was successfully sequenced and assigned to 4 phyla. The dominant phylum was the Proteobacteria, accounting for 62.8% of all the clones of the 16S rRNA gene at the confidence level 80%. The other sequences were assigned to the phyla Bacteroidetes, Firmicutes, Actinobacteria and accounted for 13.5%, 12.4%, and 11.3%, respectively. These results provide an insight into the bacterial diversity associated with D. niveus ticks in the natural environment of Tacheng. They indicate the occurrence of Rickettsia raoultii and Rickettsia slovaca in D. niveus ticks in this area, and as a consequence, cases of TIBOLA/DEBONEL may occur (tick-borne lymphadenopathy/Dermacentor-borne necrosis erythema and lymphadenopathy). © 2014 Published by Elsevier GmbH.
Introduction Ticks are efficient vectors of multiple pathogens due to their interactions with a wide spectrum of vertebrate hosts during their life cycle. As a result, they have the opportunity to acquire a large array of different types of organisms that are present in the blood of these hosts. The microbial community in ticks includes viruses, bacteria, protozoa, and fungi, which serve as symbionts, commensals, and as pathogens (Anderson and Magnarelli, 2008). Multiple human pathogens can be carried by a single tick (Belongia, 2002), and exposure to a single tick may cause the risk of multiple infections. Therefore, the exploration of microbial populations from ticks might help to identify the pathogens causing human disease. Culture-dependent (Murrell et al., 2003; Rudolf et al., 2009) techniques were applied by Sanogo et al. (2003) studying the microbial populations in ticks. In the Czech Republic, culturedependent methods were used to identify the microorganisms from host-seeking Ixodes ricinus (I. ricinus), Dermacentor reticulatus, and Haemaphysalis concinna ticks, from which strains
∗ Corresponding authors. Tel.: +86 10 63896082; fax: +86 10 63896082. E-mail addresses: [email protected] (W. Liu), [email protected], [email protected] (W.-C. Cao). http://dx.doi.org/10.1016/j.ttbdis.2014.04.004 1877-959X/© 2014 Published by Elsevier GmbH.
of medical importance were found, including Advenella incenata, Corynebacterium aurimucosum, Microbacterium oxydans, M. schleiferi, Staphylococcus spp., and Stenotrophomonas maltophilia (Rudolf et al., 2009). In recent years, the method of metagenomics has been increasingly applied for exploration of microbial communities present in complex ecosystems. The small-subunit ribosomal RNA library method based on amplifying the 16S rRNA gene directly offers an effective way to identify bacterial and archaeal diversity from environmental samples and to estimate dynamics in a complex microbial community (Pace, 1997). The 16s rRNA gene has several conserved regions shared by a large number of bacterial species and variable regions which could be used to clarify the taxonomic affinities of a wide range of taxa (Baker et al., 2003). Universal primers are designed according to the conserved regions to amplify as many bacterial species as possible, and then the clonal library of the PCR product is screened for microbial taxa. Once microbial taxa of interest are identified, further investigation might be performed to test the existence of the specific microbes efficiently. For example, an investigation on I. ricinus ticks collected from the Netherlands disclosed the presence of Candidatus Neoehrlichia mikurensis, Rickettsia australis, and Borrelia species by this method (van Overbeek et al., 2008). Dermacentor niveus Neumann has been recorded as one of the dominant tick species at the sampling site. It is a parasite of humans
L. Zhuang et al. / Ticks and Tick-borne Diseases 5 (2014) 564–568
and a wide range of livestock (Deng and Jiang, 1991; Yin et al., 2010). The city of Tacheng was selected as the sampling site, as it is the key region in bridging China, Central Asia, and Europe, with a high density of D. niveus, a tick species that might transmit pathogens causing widespread infectious diseases. Here, we evaluated the bacterial diversity in D. niveus ticks collected from Tacheng using the 16S rRNA gene library approach. This characterization of the bacterial community in D. niveus is a fundamental step toward understanding its role as a vector in carrying and transmitting known and yet to be discovered pathogens in these as well as in adjacent regions.
565
Identification of Rickettsia and phylogenetic analysis
The field investigation was carried out in August 2008. Ticks were collected by dragging over the vegetation layer at Yumin town (82◦ 54 E, 46◦ 12 N) in Tacheng city, Xinjiang Uygur Autonomous Region. Morphologic features were used to identify species and developmental stage of the collected ticks by an entomologist (Y. Sun). Live ticks were then stored in 70% ethanol at −80 ◦ C until nucleic acid extraction.
After having evidence of the occurrence of Rickettsia, we performed a PCR with Rickettsia-specific PCR primers (Table 1) for the ompB and gltA genes for further identification of Rickettsia (Fernandez de Mera et al., 2009; Roux et al., 1997) using the previously obtained DNA as target. The PCR products were analyzed on a 1.5% agarose gel. Fragments of the right size were then purified, cloned to pMD-18T vector (Takara, Dalian, China), and introduced in the E. coli DH5␣. A single colony was cultured and sequenced. The clones were sequenced by standard techniques, and clean data were obtained as previously described. Blast search were then performed against nucleotide collection (nr/nt) database on the website of NCBI (http://www.ncbi.nlm.nih.gov/). Phylogenetic analysis was performed on ompB and gltA gene sequences, respectively, with the gene sequences of Rickettsia species obtained from GenBank as references. Rickettsia typhi strain Wilmington was selected as outgroup. The phylogenetic analysis of the remaining part was performed with Mega 5 software v5.1 (Tamura et al., 2011). The alignment was conducted by ClustalW (1.6) (Thompson et al., 1994). The gap opening penalty was 15 and the gap extension penalty was 6.66. The DNA Weight Matrix was ClustalW, and the transition weight was 0.5. Phylogenetic analysis was performed by the maximum likelihood method with 1000 bootstrap replications.
PCR amplification of tick pools
Results
A total of 83 adult ticks was pooled and disrupted in liquid nitrogen by pestles. DNA was extracted from the obtained powder using the phenol-chloroform extraction method (Wen et al., 2002). The 16S rRNA gene was amplified from the obtained DNA with the primers 16S F and 16S R (Table 1) (Zhang and Chen, 2010) in 50 L PCR mixtures containing 200 nM of each primer, 100 mM of each dNTP, 5 L 10× rTaq PCR buffer (Takara, Dalian, China), and 2.5U of rTaq DNA polymerase (Takara, Dalian, China). PCR conditions were as follows: one cycle at 94 ◦ C for 5 min; 25 cycles at 94 ◦ C for 30 s; 55 ◦ C for 40 s; 72 ◦ C for 90 s, and one cycle at 72 ◦ C for 10 min. The PCR was processed using ABI GeneAmp® PCR System 9700. Agarose gel with target fragments was purified using TIANgel Midi Purification Kit (Tiangen, Beijing, China) according to the manufacturer’s instructions. The purified product was then cloned to pMD-18T vector (Takara, Dalian, China) and introduced in the E. coli DH5␣ (Tiangen, Beijing, China). A single colony was cultured and sequenced on an Applied Biosystems 3730XL capillary sequencer with the vector primers M13F (5 -TGTAAAACGACGGCCAGT-3 ) and M13R (5 -CAGGAAACAGCTATGACC-3 ).
Bacterial diversity
Materials and methods Collection and identification of ticks
Sequence analysis The clones were sequenced from both ends using the primers M13F and M13R of the vector by standard techniques. Low-quality parts and vector sequences of each sequence were trimmed off. Then, the 2 sequences from one single clone were assembled from both ends to one sequence. Primer sequences of each obtained assembled sequence were cut off to avoid affecting the results. Thereafter, the obtained sequences were analyzed by the “Classifier” program (version 2.6) of Ribosomal Database Project II (Cole et al., 2005). The Classifier algorithm returns a confidence value with which a 16S rRNA gene sequence can be assigned to OTUs (genus and higher) that is represented by a set of sequences, based on the number of times, out of 100 trials, that random subsets of the query sequence match sequences assigned to that taxon. The algorithm also returns the name of the taxon to which the sequence was most often assigned in those 100 trials.
A total of 500 clones of the fragment amplified with the primers 16S 27F and 16S 1492R was sequenced from both ends, and 452 high-quality assembled sequences were obtained (GenBank nos. KJ453898–KJ454349). The details of the assignments are shown in Fig. 1. The dominant phylum was the Proteobacteria, accounting for 62.8% of all the clones of the 16S rRNA gene at the confidence level 80%. The other phyla were assigned to the Bacteroidetes, the Firmicutes, and the Actinobacteria and accounted for 13.5%, 12.4%, and 11.3%, respectively. The tick-borne pathogens Rickettsia raoultii and Rickettsia slovaca were found to exist in D. niveus ticks. Opportunistic pathogens like Pseudochrobactrum and Massilia were also found in moderate frequencies. Also environmental soil microorganisms such as Sphingobium and Acinetobacter were detected. Identification of Rickettsia and phylogenetic analysis Two clones were shown to belong to the genus Rickettsia which is recognized as a medically important arthropod-vectored taxon of pathogens. The closest Rickettsia species was Rickettsia raoultii strain Khabarovsk (ref|NR 043755.1|) with 2 different base pairs resulting from BlastN analysis of the two 16S rRNA clones initially identified to belong to the genus Rickettsia. Further identification of Rickettsia targeting at ompB and gltA genes produced the amplicons of 576 bp (618 bp with primer) and 1136 bp (1178 bp with primer), respectively. Clones of each gene were obtained as previously described. All the obtained 10 gltA (JQ664720–JQ664729) sequences were most similar to that of the R. raoultii strain Khabarovsk (GenBank accession no. DQ365810). One of the obtained partial 11 ompB gene sequences (GenBank accession no. JQ320350) was most similar to R. slovaca (GenBank accession no. AF123723) with 98.8% identity while the other 10 (GenBank accession no. JQ320340–JQ320349) displayed 99.7–99.8% identity with the R. raoultii strain Khabarovsk. For the phylogenetic analysis (Fig. 2), 10 obtained sequences of the rickettsial gltA gene clustered close to R. raoultii. Also 10 of the
566
L. Zhuang et al. / Ticks and Tick-borne Diseases 5 (2014) 564–568
Table 1 Rickettsia PCR conditions and amplicon sizes. Gene
Description
Primer sequence (5 -3 )
Positiona
Amplicon size
PCR annealing conditions
16S rRNA
16S ribosomal RNA
30–1492
1463 bp
55 ◦ C/30 s
ompB
Outer membrane protein B
99–716
618 bp
53 ◦ C/30 s
gltA
Citrate synthase
F: GAGAGTTTGATCCTGGCTCAG R: TACGGCTACCTTGTTACGAC F: GGGTGCTGCTACACAGCAGAA R: CCGTCACCGATATTAATTGCC F: ATGACTAATGGCAATAATAA R: ATTGCAAAAAGTACAGTGAACA
131–1308
1178 bp
50 ◦ C/30 s
a
The position is marked according to the whole genome of R. slovaca 13-B (GenBank: CP002428).
in I. ricinus (Stojek and Dutkiewicz, 2004). There is no evidence that these microbes are part of the internal autochthonous tick microflora. Some of them might be acquired by ticks during their host-seeking period on the vegetation or in the soil litter. In China, 5 species of tick-transmitted spotted fever group (SFG) rickettsiae, namely R. sibirica (Zhang et al., 2006), Rickettsia mongolotimona (Raoult et al., 1996), Rickettsia heilongjiangiensis, Rickettsia hulinii (Zhang et al., 2000a), and the BJ-90 strain (Zhang et al., 2000b) were previously isolated from ticks. Molecular evidence of R. raoultii and R. slovaca in Dermacentor silvarum ticks were reported in northeastern and northwestern China (Cao et al., 2008; Tian et al., 2012). Serological evidence of Rickettsia japonica (Lin et al., 1999), Rickettsia conorii, Rickettsia akari (Chen et al., 1999) also exists. A seroepidemiological survey was once taken in Tacheng, in which 14% of the 86 studied healthy persons were SFG rickettsiapositive (Feng et al., 1986), indicating the existence of Rickettsia in the area. In our study, most of the clones of the ompB and gltA genes clustered with R. raoultii according to phylogenetic analysis, suggesting the occurrence of R. raoultii in the collected ticks. One of the clones (R2001) clustered with R. slovaca. Human infection with R. raoultii and R. slovaca has been associated with TIBOLA/DEBONEL (tickborne lymphadenopathy/Dermacentor-borne necrosis erythema
11 obtained ompB gene sequences clustered close to R. raoultii, and one had the highest similarity (98.8%) with R. slovaca. Discussion The existing studies on Dermacentor are mainly restricted to the detection and description of single tick-borne pathogens. Our study showed the microflora of field-collected D. niveus ticks. It reflected the variety of microbes, which were symbionts, pathogens, or normal microflora of D. niveus ticks. In a previous study on the I. ricinus microbiome (Carpi et al., 2011), high-throughput sequencing techniques were adopted, and even more genera were found. Similar to our study, the Proteobacteria were found to be the dominant bacterial phylum, followed by the Actinobacteria, the Bacteroidetes and the Firmicutes, but another phylum, the Spirochaetes, was also detected in I. ricinus. This discrepancy might be due to the difference in tick species, collection sites, and the high-throughput sequencing capacity. Similar to previous studies, many of the organisms detected in our study seem to be similar to those recovered from various environmental sources, such as Arthrobacter found in Dermacentor reticulatus (Egyed and Makrai, 2014), Acinetobacter in Amblyomma americanum (Clay et al., 2008; Heise et al., 2010), and Pseudomonas
Pseudoalteromonas
A
unclassified_Idiomarinaceae
B
Myroides unclassified_Flavobacteriaceae
unclassified_Alteromonadales 0
Oceanisphaera
5
10
15
20
25
30
35
40
unclassified_Aeromonadaceae Erwinia
Gamma proteobacteria
Providencia
Sporosarcina
Escherichia/Shigella
C
unclassified_Bacillaceae 2
Halomonas
Staphylococcus
Thalassolituus
Jeotgalicoccus
Marinospirillum
Facklamia
unclassified_Oceanospirillaceae
0
Pseudomonas
5
10
15
20
25
30
Psychrobacter Enhydrobacter Acinetobacter Tomitella
unclassified_Pseudomonadales
Alpha proteobacteria
Nocardiopsis
Sphingobium
Brevibacterium
Rickesia
Jonesia
Pseudochrobactrum
Leucobacter
Phyllobacterium
Gulosibacter
Undibacterium
unclassified_Microbacteriaceae
Massilia
Beta proteobacteria
D
Tsukamurella
Roseovarius
Brachybacterium
Alcaligenes
Georgenia
Paenalcaligenes
Arthrobacter
Pusillimonas
unclassified_Micrococcineae
unclassified_Alcaligenaceae 0
20
40
60
80
100 120 140 160
0
5
10
15
20
25
30
35
Fig. 1. Assignments of all 452 clones of universal 16s rRNA gene amplicons classified by the RDP classifier under the confidence threshold 80%. (A) Proteobacteria; (B) Bacteroidetes; (C) Firmicutes; (D) Actinobacteria.
L. Zhuang et al. / Ticks and Tick-borne Diseases 5 (2014) 564–568
55
JQ664721 R. sp. clone 11 JQ664729 R. sp. clone 2 DQ365804 R. raoultii strain Khabarovsk JQ664722 R. sp. clone 12 EU036985 R. raoultii strain Elanda-23/95 JQ664727 R. sp. clone 1 59 JQ664720 R. sp. clone 10 JQ664723 R. sp. clone 3 JQ664726 R. sp. clone 9 JQ664728 R. sp. clone 4 65 JQ664725 R. sp. clone 7 DQ365803 R. raoultii strain Marne JQ664724 R. sp. clone 5 66 HM050289 R. aeschlimannii strain RH15 AY259084 R. aeschlimannii CP003319 R. massiliae str. AZT80 61 98 CP003319 R. massiliae str. AZT80 CP003307 R. rickettsii str. Arizona 98 CP003305 R. rickettsii str. Brazil 82 CP003318 R. rickettsii str. Hauke CP001227 R. peacockii str. Rustic AF178035 R. sp. BJ-90 DQ097081 R. mongolotimonae isolate URRMTMFEe65 62 HM050296 R. sibirica strain RH05 67 90 HM050279 R. sibirica AF172943 R. sp. HL-93 AY285776 R. heilongjiangensis 86 CP002912 R. heilongjiangensis 054 86 AP011533 R. japonica YH 90 U59724 R. japonica YM CP003375 R. slovaca str. D-CWPP CP002428 R. slovaca 13-B AE017197 R. typhi str. Wilmington
JQ320347 R. sp. clone. 7 JQ320349 R. sp. clone. 9 JQ320346 R. sp. clone. 6 JQ320345 R. sp. clone. 5 JQ320343 R. sp. clone. 3 64 JQ320341 R. sp. clone. 12 DQ365797 R. raoultii strain Marne JQ320340 R. sp. clone. 10 95 JQ320348 R. sp. clone. 8 JQ320344 R. sp. clone. 4 JQ320342 R. sp. clone. 2 70 DQ365798 R. raoultii strain Khabarovsk EU036984 R. raoultii strain Elanda-23/95 97 AF123714 R. massiliae 98 DQ503428 R. massiliae strain AZT80 HM050278 R. aeschlimannii strain RH15 98 AF123705 R. aeschlimannii 74 CP003318 R. rickettsii str. Hauke 99 CP003307 R. rickettsii str. Arizona 84 CP003305 R. rickettsii str. Brazil CP001227 R. peacockii str. Rustic JQ320350 R. sp. clone.1 98 CP002428 R. slovaca 13-B 77 AF123723 R. slovaca AY331393 R. sp. BJ-90 54 AF123722 R. sibirica 99 DQ423362 R. mongolotimonae strain PoTiRp53 84 DQ423364 R. mongolotimonae strain PoHu10991 99 CP002912 R. heilongjiangensis 054 AY260451 R. heilongjiangensis AY260452 R. hulinensis 100 AP011533 R. japonica YH 64 100 AF123713 R. japonica AE017197 R.typhi str. Wilmington
0.0 2
567
0.0 1
Fig. 2. (A) Phylogenetic tree of bacteria belonging to rickettsiae inferred from comparison of the ompB gene sequences. Clones 1 to 12 represent the ompB gene sequences derived from partial rickettsial ompB gene clones. (B) Phylogenetic tree of bacteria belonging to rickettsiae inferred from comparison of the gltA gene sequences. Clones 1 to 12 represent the gltA gene sequences derived from partial rickettsial gltA gene clones.
and lymphadenopathy) in previous studies (Parola et al., 2009; Raoult et al., 1997). The big difference between the number of clones of R. raoultii and R. slovaca suggests that the dominant Rickettsia in D. niveus in the study area is R. raoultii. The presence of R. raoultii and R. slovaca in the current study further emphasizes the regional risk of human and domestic animal infection with these pathogens, due to the vector competency of D. niveus. We propose that an enhanced emphasis should be placed on these pathogens in hospital diagnostics and in wildlife management strategies in these areas. This study indicated the application of metagenomics as an early-warning surveillance of bacterial tick-borne diseases. However, it was subject to limitations. For further investigation of the bacterial diversity, a larger sample size of D. niveus should be examined. High-throughput sequencing techniques which have made significant progress in revealing a diverse microbial community including viruses, bacteria, protozoans, and fungi (Carpi et al., 2011; Cox-Foster et al., 2007; Culley et al., 2006) should be used in the future. Other abundant tick species in this area such as Hyalomma asiaticum and Haemaphysalis erinacei turanica (Deng and Jiang, 1991; Yin et al., 2010) should be studied as well, for a better understanding of the bacterial community carried by these ticks. Further studies should include investigation on the possible occurrence of Rickettsia species in livestock and the human population. The actual role of D. niveus ticks in carrying and transmitting Rickettsia species need to be elucidated using pathology tests and animal transmission experiments in the future.
Acknowledgments This study was supported by the Natural Science Foundation of China (81222037, 81130086, 81072250) and Chinese Basic Research Project (2010CB530201).
References Anderson, J.F.L., Magnarelli, A., 2008. Biology of ticks. Infectious Disease Clinics of North America 22, 195–215. Baker, G.C., Smith, J.J., Cowan, D.A., 2003. Review and re-analysis of domain-specific 16S primers. Journal of Microbiological Methods 55, 541–555. Belongia, E.A., 2002. Epidemiology and impact of coinfections acquired from Ixodes ticks. Vector Borne and Zoonotic Diseases 2, 265–273. Cao, W.C., Zhan, L., De Vlas, S.J., Wen, B.H., Yang, H., Richardus, J.H., Habbema, J.D., 2008. Molecular detection of spotted fever group Rickettsia in Dermacentor silvarum from a forest area of northeastern China. Journal of Medical Entomology 45, 741–744. Carpi, G., Cagnacci, F., Wittekindt, N.E., Zhao, F., Qi, J., Tomsho, L.P., Drautz, D.I., Rizzoli, A., Schuster, S.C., 2011. Metagenomic profile of the bacterial communities associated with Ixodes ricinus ticks. PloS One 6, e25604. Chen, Z., Zhang, M., He, J., 1999. Study of SFG Rickettsia in animals from Ninghua, Fujian province. Chinese Journal of Vector Biology and Control 5, 18. Clay, K., Klyachko, O., Grindle, N., Civitello, D., Oleske, D., Fuqua, C., 2008. Microbial communities and interactions in the lone star tick, Amblyomma americanum. Molecular Ecology 17, 4371–4381. Cole, J.R., Chai, B., Farris, R.J., Wang, Q., Kulam, S.A., McGarrell, D.M., Garrity, G.M., Tiedje, J.M., 2005. The Ribosomal Database Project (RDP-II): sequences and tools for high-throughput rRNA analysis. Nucleic Acids Research 33, D294–D296. Cox-Foster, D.L., Conlan, S., Holmes, E.C., Palacios, G., Evans, J.D., Moran, N.A., Quan, P.L., Briese, T., Hornig, M., Geiser, D.M., Martinson, V., vanEngelsdorp, D., Kalkstein, A.L., Drysdale, A., Hui, J., Zhai, J., Cui, L., Hutchison, S.K., Simons, J.F., Egholm, M., Pettis, J.S., Lipkin, W.I., 2007. A metagenomic survey of microbes in honey bee colony collapse disorder. Science 318, 283–287. Culley, A.I., Lang, A.S., Suttle, C.A., 2006. Metagenomic analysis of coastal RNA virus communities. Science 312, 1795–1798. Deng, G., Jiang, Z., 1991. Economic Insect Fauna in China, vol. 39. Science Press, Beijing. Egyed, L., Makrai, L., 2014. Cultivable internal bacterial flora of ticks isolated in Hungary. Experimental Applied Acarology 63, 107–122. Feng, F.Y.L., Bai, T., Lu, Y., 1986. The seroepidemiological survey of Rickettsia in Shawan County, Tacheng, Xinjiang Uygur Autonomous Region. Chinese Journal of Zoonoses 2, 1. Fernandez de Mera, I.G., Zivkovic, Z., Bolanos, M., Carranza, C., Perez-Arellano, J.L., Gutierrez, C., de la Fuente, J., 2009. Rickettsia massiliae in the Canary Islands. Emerging Infectious Diseases 15, 1869–1870. Heise, S.R., Elshahed, M.S., Little, S.E., 2010. Bacterial diversity in Amblyomma americanum (Acari: Ixodidae) with a focus on members of the genus Rickettsia. Journal of Medical Entomology 47, 258–268. Lin, Y., Sun, X., Zhan, Z., 1999. Serology and pathology study of SFG Rickettsia in Hainan Island. Chinese Journal of Zoonoses 2, 5.
568
L. Zhuang et al. / Ticks and Tick-borne Diseases 5 (2014) 564–568
Murrell, A., Dobson, S.J., Yang, X., Lacey, E., Barker, S.C., 2003. A survey of bacterial diversity in ticks, lice and fleas from Australia. Parasitology Research 89, 326–334. Pace, N.R., 1997. A molecular view of microbial diversity and the biosphere. Science 276, 734–740. Parola, P., Rovery, C., Rolain, J.M., Brouqui, P., Davoust, B., Raoult, D., 2009. Rickettsia slovaca and R. raoultii in tick-borne rickettsioses. Emerging Infectious Diseases 15, 1105–1108. Raoult, D., Brouqui, P., Roux, V., 1996. A new spotted-fever-group rickettsiosis. Lancet 348, 412. Raoult, D., Berbis, P., Roux, V., Xu, W., Maurin, M., 1997. A new tick-transmitted disease due to Rickettsia slovaca. Lancet 350, 112–113. Roux, V., Rydkina, E., Eremeeva, M., Raoult, D., 1997. Citrate synthase gene comparison, a new tool for phylogenetic analysis, and its application for the rickettsiae. International Journal of Systematic Bacteriology 47, 252–261. Rudolf, I., Mendel, J., Sikutova, S., Svec, P., Masarikova, J., Novakova, D., Bunkova, L., Sedlacek, I., Hubalek, Z., 2009. 16S rRNA gene-based identification of cultured bacterial flora from host-seeking Ixodes ricinus, Dermacentor reticulatus and Haemaphysalis concinna ticks, vectors of vertebrate pathogens. Folia Microbiologica 54, 419–428. Sanogo, Y.O., Parola, P., Shpynov, S., Camicas, J.L., Brouqui, P., Caruso, G., Raoult, D., 2003. Genetic diversity of bacterial agents detected in ticks removed from asymptomatic patients in northeastern Italy. Annals of the New York Academy of Sciences 990, 182–190. Stojek, N.M., Dutkiewicz, J., 2004. Studies on the occurrence of Gram-negative bacteria in ticks: Ixodes ricinus as a potential vector of Pasteurella. Annals of Agricultural and Environmental Medicine 11, 319–322. Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S., 2011. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Molecular Biology and Evolution 28, 2731–2739.
Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Research 22, 4673–4680. Tian, Z.C., Liu, G.Y., Shen, H., Xie, J.R., Luo, J., Tian, M.Y., 2012. First report on the occurrence of Rickettsia slovaca and Rickettsia raoultii in Dermacentor silvarum in China. Parasites Vectors 5, 19. van Overbeek, L., Gassner, F., van der Plas, C.L., Kastelein, P., Nunes-da Rocha, U., Takken, W., 2008. Diversity of Ixodes ricinus tick-associated bacterial communities from different forests. FEMS Microbiology Ecology 66, 72–84. Wen, B., Jian, R., Zhang, Y., Chen, R., 2002. Simultaneous detection of Anaplasma marginale and a new Ehrlichia species closely related to Ehrlichia chaffeensis by sequence analyses of 16S ribosomal DNA in Boophilus microplus ticks from Tibet. Journal of Clinical Microbiology 40, 3286–3290. Yin, X.P., Ye, Z.H., Jiao, W.A., Ma, D.H., Zhang, J.G., 2010. Tick fauna and monitoring of tick host animals at Alataw Pass. Chinese Journal of Vector Biology and Control 4, 375–377. Zhang, H., Chen, L., 2010. Phylogenetic analysis of 16S rRNA gene sequences reveals distal gut bacterial diversity in wild wolves (Canis lupus). Molecular Biology Reports 37, 4013–4022. Zhang, J.Z., Fan, M.Y., Wu, Y.M., Fournier, P.E., Roux, V., Raoult, D., 2000a. Genetic classification of “Rickettsia heilongjiangii” and “Rickettsia hulinii”, two Chinese spotted fever group rickettsiae. Journal of Clinical Microbiology 38, 3498–3501. Zhang, J.Z., Fan, M.Y., Yu, X.J., Raoult, D., 2000b. Phylogenetic analysis of the Chinese Rickettsia isolate BJ-90. Emerging Infectious Diseases 6, 432–433. Zhang, L., Jin, J., Fu, X., Raoult, D., Fournier, P.E., 2006. Genetic differentiation of Chinese isolates of Rickettsia sibirica by partial ompA gene sequencing and multispacer typing. Journal of Clinical Microbiology 44, 2465–2467.
Contents lists available at ScienceDirect
Ticks and Tick-borne Diseases journal homepage: www.elsevier.com/locate/ttbdis
Original article
Discovery of Rickettsia species in Dermacentor niveus Neumann ticks by investigating the diversity of bacterial communities Lu Zhuang a , Cheng-Yan Wang b , Yi-Gang Tong a , Fang Tang c , Hong Yang a , Wei Liu a,∗ , Wu-Chun Cao a,∗ a State Key Laboratory of Pathogen and Biosecurity, Beijing Institute of Microbiology and Epidemiology, 20 Dong-Da St., Fengtai District, Beijing 100071, PR China b SinoGenoMax Co., 3 Yong-Chang-Bei Rd., Beijing Economic-Technological Development Area, Beijing 100176, PR China c Center for Diseases Control and Prevention of Chinese Peoples’ Armed Police Forces, Beijing 102613, PR China
a r t i c l e
i n f o
Article history: Received 22 March 2013 Received in revised form 7 March 2014 Accepted 1 April 2014 Available online 18 June 2014 Keywords: Tick Rickettsia China 16s rRNA Microbial diversity
a b s t r a c t Ticks (Dermacentor niveus Neumann) were collected from Tacheng, Xinjiang Uygur Autonomous Region, and their bacterial diversity was investigated using the 16S RNA gene library method from one pooled sample. A total of 452 clones was successfully sequenced and assigned to 4 phyla. The dominant phylum was the Proteobacteria, accounting for 62.8% of all the clones of the 16S rRNA gene at the confidence level 80%. The other sequences were assigned to the phyla Bacteroidetes, Firmicutes, Actinobacteria and accounted for 13.5%, 12.4%, and 11.3%, respectively. These results provide an insight into the bacterial diversity associated with D. niveus ticks in the natural environment of Tacheng. They indicate the occurrence of Rickettsia raoultii and Rickettsia slovaca in D. niveus ticks in this area, and as a consequence, cases of TIBOLA/DEBONEL may occur (tick-borne lymphadenopathy/Dermacentor-borne necrosis erythema and lymphadenopathy). © 2014 Published by Elsevier GmbH.
Introduction Ticks are efficient vectors of multiple pathogens due to their interactions with a wide spectrum of vertebrate hosts during their life cycle. As a result, they have the opportunity to acquire a large array of different types of organisms that are present in the blood of these hosts. The microbial community in ticks includes viruses, bacteria, protozoa, and fungi, which serve as symbionts, commensals, and as pathogens (Anderson and Magnarelli, 2008). Multiple human pathogens can be carried by a single tick (Belongia, 2002), and exposure to a single tick may cause the risk of multiple infections. Therefore, the exploration of microbial populations from ticks might help to identify the pathogens causing human disease. Culture-dependent (Murrell et al., 2003; Rudolf et al., 2009) techniques were applied by Sanogo et al. (2003) studying the microbial populations in ticks. In the Czech Republic, culturedependent methods were used to identify the microorganisms from host-seeking Ixodes ricinus (I. ricinus), Dermacentor reticulatus, and Haemaphysalis concinna ticks, from which strains
∗ Corresponding authors. Tel.: +86 10 63896082; fax: +86 10 63896082. E-mail addresses: [email protected] (W. Liu), [email protected], [email protected] (W.-C. Cao). http://dx.doi.org/10.1016/j.ttbdis.2014.04.004 1877-959X/© 2014 Published by Elsevier GmbH.
of medical importance were found, including Advenella incenata, Corynebacterium aurimucosum, Microbacterium oxydans, M. schleiferi, Staphylococcus spp., and Stenotrophomonas maltophilia (Rudolf et al., 2009). In recent years, the method of metagenomics has been increasingly applied for exploration of microbial communities present in complex ecosystems. The small-subunit ribosomal RNA library method based on amplifying the 16S rRNA gene directly offers an effective way to identify bacterial and archaeal diversity from environmental samples and to estimate dynamics in a complex microbial community (Pace, 1997). The 16s rRNA gene has several conserved regions shared by a large number of bacterial species and variable regions which could be used to clarify the taxonomic affinities of a wide range of taxa (Baker et al., 2003). Universal primers are designed according to the conserved regions to amplify as many bacterial species as possible, and then the clonal library of the PCR product is screened for microbial taxa. Once microbial taxa of interest are identified, further investigation might be performed to test the existence of the specific microbes efficiently. For example, an investigation on I. ricinus ticks collected from the Netherlands disclosed the presence of Candidatus Neoehrlichia mikurensis, Rickettsia australis, and Borrelia species by this method (van Overbeek et al., 2008). Dermacentor niveus Neumann has been recorded as one of the dominant tick species at the sampling site. It is a parasite of humans
L. Zhuang et al. / Ticks and Tick-borne Diseases 5 (2014) 564–568
and a wide range of livestock (Deng and Jiang, 1991; Yin et al., 2010). The city of Tacheng was selected as the sampling site, as it is the key region in bridging China, Central Asia, and Europe, with a high density of D. niveus, a tick species that might transmit pathogens causing widespread infectious diseases. Here, we evaluated the bacterial diversity in D. niveus ticks collected from Tacheng using the 16S rRNA gene library approach. This characterization of the bacterial community in D. niveus is a fundamental step toward understanding its role as a vector in carrying and transmitting known and yet to be discovered pathogens in these as well as in adjacent regions.
565
Identification of Rickettsia and phylogenetic analysis
The field investigation was carried out in August 2008. Ticks were collected by dragging over the vegetation layer at Yumin town (82◦ 54 E, 46◦ 12 N) in Tacheng city, Xinjiang Uygur Autonomous Region. Morphologic features were used to identify species and developmental stage of the collected ticks by an entomologist (Y. Sun). Live ticks were then stored in 70% ethanol at −80 ◦ C until nucleic acid extraction.
After having evidence of the occurrence of Rickettsia, we performed a PCR with Rickettsia-specific PCR primers (Table 1) for the ompB and gltA genes for further identification of Rickettsia (Fernandez de Mera et al., 2009; Roux et al., 1997) using the previously obtained DNA as target. The PCR products were analyzed on a 1.5% agarose gel. Fragments of the right size were then purified, cloned to pMD-18T vector (Takara, Dalian, China), and introduced in the E. coli DH5␣. A single colony was cultured and sequenced. The clones were sequenced by standard techniques, and clean data were obtained as previously described. Blast search were then performed against nucleotide collection (nr/nt) database on the website of NCBI (http://www.ncbi.nlm.nih.gov/). Phylogenetic analysis was performed on ompB and gltA gene sequences, respectively, with the gene sequences of Rickettsia species obtained from GenBank as references. Rickettsia typhi strain Wilmington was selected as outgroup. The phylogenetic analysis of the remaining part was performed with Mega 5 software v5.1 (Tamura et al., 2011). The alignment was conducted by ClustalW (1.6) (Thompson et al., 1994). The gap opening penalty was 15 and the gap extension penalty was 6.66. The DNA Weight Matrix was ClustalW, and the transition weight was 0.5. Phylogenetic analysis was performed by the maximum likelihood method with 1000 bootstrap replications.
PCR amplification of tick pools
Results
A total of 83 adult ticks was pooled and disrupted in liquid nitrogen by pestles. DNA was extracted from the obtained powder using the phenol-chloroform extraction method (Wen et al., 2002). The 16S rRNA gene was amplified from the obtained DNA with the primers 16S F and 16S R (Table 1) (Zhang and Chen, 2010) in 50 L PCR mixtures containing 200 nM of each primer, 100 mM of each dNTP, 5 L 10× rTaq PCR buffer (Takara, Dalian, China), and 2.5U of rTaq DNA polymerase (Takara, Dalian, China). PCR conditions were as follows: one cycle at 94 ◦ C for 5 min; 25 cycles at 94 ◦ C for 30 s; 55 ◦ C for 40 s; 72 ◦ C for 90 s, and one cycle at 72 ◦ C for 10 min. The PCR was processed using ABI GeneAmp® PCR System 9700. Agarose gel with target fragments was purified using TIANgel Midi Purification Kit (Tiangen, Beijing, China) according to the manufacturer’s instructions. The purified product was then cloned to pMD-18T vector (Takara, Dalian, China) and introduced in the E. coli DH5␣ (Tiangen, Beijing, China). A single colony was cultured and sequenced on an Applied Biosystems 3730XL capillary sequencer with the vector primers M13F (5 -TGTAAAACGACGGCCAGT-3 ) and M13R (5 -CAGGAAACAGCTATGACC-3 ).
Bacterial diversity
Materials and methods Collection and identification of ticks
Sequence analysis The clones were sequenced from both ends using the primers M13F and M13R of the vector by standard techniques. Low-quality parts and vector sequences of each sequence were trimmed off. Then, the 2 sequences from one single clone were assembled from both ends to one sequence. Primer sequences of each obtained assembled sequence were cut off to avoid affecting the results. Thereafter, the obtained sequences were analyzed by the “Classifier” program (version 2.6) of Ribosomal Database Project II (Cole et al., 2005). The Classifier algorithm returns a confidence value with which a 16S rRNA gene sequence can be assigned to OTUs (genus and higher) that is represented by a set of sequences, based on the number of times, out of 100 trials, that random subsets of the query sequence match sequences assigned to that taxon. The algorithm also returns the name of the taxon to which the sequence was most often assigned in those 100 trials.
A total of 500 clones of the fragment amplified with the primers 16S 27F and 16S 1492R was sequenced from both ends, and 452 high-quality assembled sequences were obtained (GenBank nos. KJ453898–KJ454349). The details of the assignments are shown in Fig. 1. The dominant phylum was the Proteobacteria, accounting for 62.8% of all the clones of the 16S rRNA gene at the confidence level 80%. The other phyla were assigned to the Bacteroidetes, the Firmicutes, and the Actinobacteria and accounted for 13.5%, 12.4%, and 11.3%, respectively. The tick-borne pathogens Rickettsia raoultii and Rickettsia slovaca were found to exist in D. niveus ticks. Opportunistic pathogens like Pseudochrobactrum and Massilia were also found in moderate frequencies. Also environmental soil microorganisms such as Sphingobium and Acinetobacter were detected. Identification of Rickettsia and phylogenetic analysis Two clones were shown to belong to the genus Rickettsia which is recognized as a medically important arthropod-vectored taxon of pathogens. The closest Rickettsia species was Rickettsia raoultii strain Khabarovsk (ref|NR 043755.1|) with 2 different base pairs resulting from BlastN analysis of the two 16S rRNA clones initially identified to belong to the genus Rickettsia. Further identification of Rickettsia targeting at ompB and gltA genes produced the amplicons of 576 bp (618 bp with primer) and 1136 bp (1178 bp with primer), respectively. Clones of each gene were obtained as previously described. All the obtained 10 gltA (JQ664720–JQ664729) sequences were most similar to that of the R. raoultii strain Khabarovsk (GenBank accession no. DQ365810). One of the obtained partial 11 ompB gene sequences (GenBank accession no. JQ320350) was most similar to R. slovaca (GenBank accession no. AF123723) with 98.8% identity while the other 10 (GenBank accession no. JQ320340–JQ320349) displayed 99.7–99.8% identity with the R. raoultii strain Khabarovsk. For the phylogenetic analysis (Fig. 2), 10 obtained sequences of the rickettsial gltA gene clustered close to R. raoultii. Also 10 of the
566
L. Zhuang et al. / Ticks and Tick-borne Diseases 5 (2014) 564–568
Table 1 Rickettsia PCR conditions and amplicon sizes. Gene
Description
Primer sequence (5 -3 )
Positiona
Amplicon size
PCR annealing conditions
16S rRNA
16S ribosomal RNA
30–1492
1463 bp
55 ◦ C/30 s
ompB
Outer membrane protein B
99–716
618 bp
53 ◦ C/30 s
gltA
Citrate synthase
F: GAGAGTTTGATCCTGGCTCAG R: TACGGCTACCTTGTTACGAC F: GGGTGCTGCTACACAGCAGAA R: CCGTCACCGATATTAATTGCC F: ATGACTAATGGCAATAATAA R: ATTGCAAAAAGTACAGTGAACA
131–1308
1178 bp
50 ◦ C/30 s
a
The position is marked according to the whole genome of R. slovaca 13-B (GenBank: CP002428).
in I. ricinus (Stojek and Dutkiewicz, 2004). There is no evidence that these microbes are part of the internal autochthonous tick microflora. Some of them might be acquired by ticks during their host-seeking period on the vegetation or in the soil litter. In China, 5 species of tick-transmitted spotted fever group (SFG) rickettsiae, namely R. sibirica (Zhang et al., 2006), Rickettsia mongolotimona (Raoult et al., 1996), Rickettsia heilongjiangiensis, Rickettsia hulinii (Zhang et al., 2000a), and the BJ-90 strain (Zhang et al., 2000b) were previously isolated from ticks. Molecular evidence of R. raoultii and R. slovaca in Dermacentor silvarum ticks were reported in northeastern and northwestern China (Cao et al., 2008; Tian et al., 2012). Serological evidence of Rickettsia japonica (Lin et al., 1999), Rickettsia conorii, Rickettsia akari (Chen et al., 1999) also exists. A seroepidemiological survey was once taken in Tacheng, in which 14% of the 86 studied healthy persons were SFG rickettsiapositive (Feng et al., 1986), indicating the existence of Rickettsia in the area. In our study, most of the clones of the ompB and gltA genes clustered with R. raoultii according to phylogenetic analysis, suggesting the occurrence of R. raoultii in the collected ticks. One of the clones (R2001) clustered with R. slovaca. Human infection with R. raoultii and R. slovaca has been associated with TIBOLA/DEBONEL (tickborne lymphadenopathy/Dermacentor-borne necrosis erythema
11 obtained ompB gene sequences clustered close to R. raoultii, and one had the highest similarity (98.8%) with R. slovaca. Discussion The existing studies on Dermacentor are mainly restricted to the detection and description of single tick-borne pathogens. Our study showed the microflora of field-collected D. niveus ticks. It reflected the variety of microbes, which were symbionts, pathogens, or normal microflora of D. niveus ticks. In a previous study on the I. ricinus microbiome (Carpi et al., 2011), high-throughput sequencing techniques were adopted, and even more genera were found. Similar to our study, the Proteobacteria were found to be the dominant bacterial phylum, followed by the Actinobacteria, the Bacteroidetes and the Firmicutes, but another phylum, the Spirochaetes, was also detected in I. ricinus. This discrepancy might be due to the difference in tick species, collection sites, and the high-throughput sequencing capacity. Similar to previous studies, many of the organisms detected in our study seem to be similar to those recovered from various environmental sources, such as Arthrobacter found in Dermacentor reticulatus (Egyed and Makrai, 2014), Acinetobacter in Amblyomma americanum (Clay et al., 2008; Heise et al., 2010), and Pseudomonas
Pseudoalteromonas
A
unclassified_Idiomarinaceae
B
Myroides unclassified_Flavobacteriaceae
unclassified_Alteromonadales 0
Oceanisphaera
5
10
15
20
25
30
35
40
unclassified_Aeromonadaceae Erwinia
Gamma proteobacteria
Providencia
Sporosarcina
Escherichia/Shigella
C
unclassified_Bacillaceae 2
Halomonas
Staphylococcus
Thalassolituus
Jeotgalicoccus
Marinospirillum
Facklamia
unclassified_Oceanospirillaceae
0
Pseudomonas
5
10
15
20
25
30
Psychrobacter Enhydrobacter Acinetobacter Tomitella
unclassified_Pseudomonadales
Alpha proteobacteria
Nocardiopsis
Sphingobium
Brevibacterium
Rickesia
Jonesia
Pseudochrobactrum
Leucobacter
Phyllobacterium
Gulosibacter
Undibacterium
unclassified_Microbacteriaceae
Massilia
Beta proteobacteria
D
Tsukamurella
Roseovarius
Brachybacterium
Alcaligenes
Georgenia
Paenalcaligenes
Arthrobacter
Pusillimonas
unclassified_Micrococcineae
unclassified_Alcaligenaceae 0
20
40
60
80
100 120 140 160
0
5
10
15
20
25
30
35
Fig. 1. Assignments of all 452 clones of universal 16s rRNA gene amplicons classified by the RDP classifier under the confidence threshold 80%. (A) Proteobacteria; (B) Bacteroidetes; (C) Firmicutes; (D) Actinobacteria.
L. Zhuang et al. / Ticks and Tick-borne Diseases 5 (2014) 564–568
55
JQ664721 R. sp. clone 11 JQ664729 R. sp. clone 2 DQ365804 R. raoultii strain Khabarovsk JQ664722 R. sp. clone 12 EU036985 R. raoultii strain Elanda-23/95 JQ664727 R. sp. clone 1 59 JQ664720 R. sp. clone 10 JQ664723 R. sp. clone 3 JQ664726 R. sp. clone 9 JQ664728 R. sp. clone 4 65 JQ664725 R. sp. clone 7 DQ365803 R. raoultii strain Marne JQ664724 R. sp. clone 5 66 HM050289 R. aeschlimannii strain RH15 AY259084 R. aeschlimannii CP003319 R. massiliae str. AZT80 61 98 CP003319 R. massiliae str. AZT80 CP003307 R. rickettsii str. Arizona 98 CP003305 R. rickettsii str. Brazil 82 CP003318 R. rickettsii str. Hauke CP001227 R. peacockii str. Rustic AF178035 R. sp. BJ-90 DQ097081 R. mongolotimonae isolate URRMTMFEe65 62 HM050296 R. sibirica strain RH05 67 90 HM050279 R. sibirica AF172943 R. sp. HL-93 AY285776 R. heilongjiangensis 86 CP002912 R. heilongjiangensis 054 86 AP011533 R. japonica YH 90 U59724 R. japonica YM CP003375 R. slovaca str. D-CWPP CP002428 R. slovaca 13-B AE017197 R. typhi str. Wilmington
JQ320347 R. sp. clone. 7 JQ320349 R. sp. clone. 9 JQ320346 R. sp. clone. 6 JQ320345 R. sp. clone. 5 JQ320343 R. sp. clone. 3 64 JQ320341 R. sp. clone. 12 DQ365797 R. raoultii strain Marne JQ320340 R. sp. clone. 10 95 JQ320348 R. sp. clone. 8 JQ320344 R. sp. clone. 4 JQ320342 R. sp. clone. 2 70 DQ365798 R. raoultii strain Khabarovsk EU036984 R. raoultii strain Elanda-23/95 97 AF123714 R. massiliae 98 DQ503428 R. massiliae strain AZT80 HM050278 R. aeschlimannii strain RH15 98 AF123705 R. aeschlimannii 74 CP003318 R. rickettsii str. Hauke 99 CP003307 R. rickettsii str. Arizona 84 CP003305 R. rickettsii str. Brazil CP001227 R. peacockii str. Rustic JQ320350 R. sp. clone.1 98 CP002428 R. slovaca 13-B 77 AF123723 R. slovaca AY331393 R. sp. BJ-90 54 AF123722 R. sibirica 99 DQ423362 R. mongolotimonae strain PoTiRp53 84 DQ423364 R. mongolotimonae strain PoHu10991 99 CP002912 R. heilongjiangensis 054 AY260451 R. heilongjiangensis AY260452 R. hulinensis 100 AP011533 R. japonica YH 64 100 AF123713 R. japonica AE017197 R.typhi str. Wilmington
0.0 2
567
0.0 1
Fig. 2. (A) Phylogenetic tree of bacteria belonging to rickettsiae inferred from comparison of the ompB gene sequences. Clones 1 to 12 represent the ompB gene sequences derived from partial rickettsial ompB gene clones. (B) Phylogenetic tree of bacteria belonging to rickettsiae inferred from comparison of the gltA gene sequences. Clones 1 to 12 represent the gltA gene sequences derived from partial rickettsial gltA gene clones.
and lymphadenopathy) in previous studies (Parola et al., 2009; Raoult et al., 1997). The big difference between the number of clones of R. raoultii and R. slovaca suggests that the dominant Rickettsia in D. niveus in the study area is R. raoultii. The presence of R. raoultii and R. slovaca in the current study further emphasizes the regional risk of human and domestic animal infection with these pathogens, due to the vector competency of D. niveus. We propose that an enhanced emphasis should be placed on these pathogens in hospital diagnostics and in wildlife management strategies in these areas. This study indicated the application of metagenomics as an early-warning surveillance of bacterial tick-borne diseases. However, it was subject to limitations. For further investigation of the bacterial diversity, a larger sample size of D. niveus should be examined. High-throughput sequencing techniques which have made significant progress in revealing a diverse microbial community including viruses, bacteria, protozoans, and fungi (Carpi et al., 2011; Cox-Foster et al., 2007; Culley et al., 2006) should be used in the future. Other abundant tick species in this area such as Hyalomma asiaticum and Haemaphysalis erinacei turanica (Deng and Jiang, 1991; Yin et al., 2010) should be studied as well, for a better understanding of the bacterial community carried by these ticks. Further studies should include investigation on the possible occurrence of Rickettsia species in livestock and the human population. The actual role of D. niveus ticks in carrying and transmitting Rickettsia species need to be elucidated using pathology tests and animal transmission experiments in the future.
Acknowledgments This study was supported by the Natural Science Foundation of China (81222037, 81130086, 81072250) and Chinese Basic Research Project (2010CB530201).
References Anderson, J.F.L., Magnarelli, A., 2008. Biology of ticks. Infectious Disease Clinics of North America 22, 195–215. Baker, G.C., Smith, J.J., Cowan, D.A., 2003. Review and re-analysis of domain-specific 16S primers. Journal of Microbiological Methods 55, 541–555. Belongia, E.A., 2002. Epidemiology and impact of coinfections acquired from Ixodes ticks. Vector Borne and Zoonotic Diseases 2, 265–273. Cao, W.C., Zhan, L., De Vlas, S.J., Wen, B.H., Yang, H., Richardus, J.H., Habbema, J.D., 2008. Molecular detection of spotted fever group Rickettsia in Dermacentor silvarum from a forest area of northeastern China. Journal of Medical Entomology 45, 741–744. Carpi, G., Cagnacci, F., Wittekindt, N.E., Zhao, F., Qi, J., Tomsho, L.P., Drautz, D.I., Rizzoli, A., Schuster, S.C., 2011. Metagenomic profile of the bacterial communities associated with Ixodes ricinus ticks. PloS One 6, e25604. Chen, Z., Zhang, M., He, J., 1999. Study of SFG Rickettsia in animals from Ninghua, Fujian province. Chinese Journal of Vector Biology and Control 5, 18. Clay, K., Klyachko, O., Grindle, N., Civitello, D., Oleske, D., Fuqua, C., 2008. Microbial communities and interactions in the lone star tick, Amblyomma americanum. Molecular Ecology 17, 4371–4381. Cole, J.R., Chai, B., Farris, R.J., Wang, Q., Kulam, S.A., McGarrell, D.M., Garrity, G.M., Tiedje, J.M., 2005. The Ribosomal Database Project (RDP-II): sequences and tools for high-throughput rRNA analysis. Nucleic Acids Research 33, D294–D296. Cox-Foster, D.L., Conlan, S., Holmes, E.C., Palacios, G., Evans, J.D., Moran, N.A., Quan, P.L., Briese, T., Hornig, M., Geiser, D.M., Martinson, V., vanEngelsdorp, D., Kalkstein, A.L., Drysdale, A., Hui, J., Zhai, J., Cui, L., Hutchison, S.K., Simons, J.F., Egholm, M., Pettis, J.S., Lipkin, W.I., 2007. A metagenomic survey of microbes in honey bee colony collapse disorder. Science 318, 283–287. Culley, A.I., Lang, A.S., Suttle, C.A., 2006. Metagenomic analysis of coastal RNA virus communities. Science 312, 1795–1798. Deng, G., Jiang, Z., 1991. Economic Insect Fauna in China, vol. 39. Science Press, Beijing. Egyed, L., Makrai, L., 2014. Cultivable internal bacterial flora of ticks isolated in Hungary. Experimental Applied Acarology 63, 107–122. Feng, F.Y.L., Bai, T., Lu, Y., 1986. The seroepidemiological survey of Rickettsia in Shawan County, Tacheng, Xinjiang Uygur Autonomous Region. Chinese Journal of Zoonoses 2, 1. Fernandez de Mera, I.G., Zivkovic, Z., Bolanos, M., Carranza, C., Perez-Arellano, J.L., Gutierrez, C., de la Fuente, J., 2009. Rickettsia massiliae in the Canary Islands. Emerging Infectious Diseases 15, 1869–1870. Heise, S.R., Elshahed, M.S., Little, S.E., 2010. Bacterial diversity in Amblyomma americanum (Acari: Ixodidae) with a focus on members of the genus Rickettsia. Journal of Medical Entomology 47, 258–268. Lin, Y., Sun, X., Zhan, Z., 1999. Serology and pathology study of SFG Rickettsia in Hainan Island. Chinese Journal of Zoonoses 2, 5.
568
L. Zhuang et al. / Ticks and Tick-borne Diseases 5 (2014) 564–568
Murrell, A., Dobson, S.J., Yang, X., Lacey, E., Barker, S.C., 2003. A survey of bacterial diversity in ticks, lice and fleas from Australia. Parasitology Research 89, 326–334. Pace, N.R., 1997. A molecular view of microbial diversity and the biosphere. Science 276, 734–740. Parola, P., Rovery, C., Rolain, J.M., Brouqui, P., Davoust, B., Raoult, D., 2009. Rickettsia slovaca and R. raoultii in tick-borne rickettsioses. Emerging Infectious Diseases 15, 1105–1108. Raoult, D., Brouqui, P., Roux, V., 1996. A new spotted-fever-group rickettsiosis. Lancet 348, 412. Raoult, D., Berbis, P., Roux, V., Xu, W., Maurin, M., 1997. A new tick-transmitted disease due to Rickettsia slovaca. Lancet 350, 112–113. Roux, V., Rydkina, E., Eremeeva, M., Raoult, D., 1997. Citrate synthase gene comparison, a new tool for phylogenetic analysis, and its application for the rickettsiae. International Journal of Systematic Bacteriology 47, 252–261. Rudolf, I., Mendel, J., Sikutova, S., Svec, P., Masarikova, J., Novakova, D., Bunkova, L., Sedlacek, I., Hubalek, Z., 2009. 16S rRNA gene-based identification of cultured bacterial flora from host-seeking Ixodes ricinus, Dermacentor reticulatus and Haemaphysalis concinna ticks, vectors of vertebrate pathogens. Folia Microbiologica 54, 419–428. Sanogo, Y.O., Parola, P., Shpynov, S., Camicas, J.L., Brouqui, P., Caruso, G., Raoult, D., 2003. Genetic diversity of bacterial agents detected in ticks removed from asymptomatic patients in northeastern Italy. Annals of the New York Academy of Sciences 990, 182–190. Stojek, N.M., Dutkiewicz, J., 2004. Studies on the occurrence of Gram-negative bacteria in ticks: Ixodes ricinus as a potential vector of Pasteurella. Annals of Agricultural and Environmental Medicine 11, 319–322. Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S., 2011. MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Molecular Biology and Evolution 28, 2731–2739.
Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Research 22, 4673–4680. Tian, Z.C., Liu, G.Y., Shen, H., Xie, J.R., Luo, J., Tian, M.Y., 2012. First report on the occurrence of Rickettsia slovaca and Rickettsia raoultii in Dermacentor silvarum in China. Parasites Vectors 5, 19. van Overbeek, L., Gassner, F., van der Plas, C.L., Kastelein, P., Nunes-da Rocha, U., Takken, W., 2008. Diversity of Ixodes ricinus tick-associated bacterial communities from different forests. FEMS Microbiology Ecology 66, 72–84. Wen, B., Jian, R., Zhang, Y., Chen, R., 2002. Simultaneous detection of Anaplasma marginale and a new Ehrlichia species closely related to Ehrlichia chaffeensis by sequence analyses of 16S ribosomal DNA in Boophilus microplus ticks from Tibet. Journal of Clinical Microbiology 40, 3286–3290. Yin, X.P., Ye, Z.H., Jiao, W.A., Ma, D.H., Zhang, J.G., 2010. Tick fauna and monitoring of tick host animals at Alataw Pass. Chinese Journal of Vector Biology and Control 4, 375–377. Zhang, H., Chen, L., 2010. Phylogenetic analysis of 16S rRNA gene sequences reveals distal gut bacterial diversity in wild wolves (Canis lupus). Molecular Biology Reports 37, 4013–4022. Zhang, J.Z., Fan, M.Y., Wu, Y.M., Fournier, P.E., Roux, V., Raoult, D., 2000a. Genetic classification of “Rickettsia heilongjiangii” and “Rickettsia hulinii”, two Chinese spotted fever group rickettsiae. Journal of Clinical Microbiology 38, 3498–3501. Zhang, J.Z., Fan, M.Y., Yu, X.J., Raoult, D., 2000b. Phylogenetic analysis of the Chinese Rickettsia isolate BJ-90. Emerging Infectious Diseases 6, 432–433. Zhang, L., Jin, J., Fu, X., Raoult, D., Fournier, P.E., 2006. Genetic differentiation of Chinese isolates of Rickettsia sibirica by partial ompA gene sequencing and multispacer typing. Journal of Clinical Microbiology 44, 2465–2467.