Display and release of the Plasmodium falciparum circumsporozoite protein using the autotransporter MisL of Salmonella enterica

Plasmid 50 (2003) 12–27 www.elsevier.com/locate/yplas

Display and release of the Plasmodium falciparum circumsporozoite protein using the autotransporter MisL of Salmonella enterica s Villegas Sepulveda,c Patricia Ruiz-Olvera,a,b Fernando Ruiz-Perez,a Nicola Araceli Santiago-Machuca,a Rogelio Maldonado-Rodrıguez,b Guadalupe Garcia-Elorriaga,a and Cesar Gonz alez-Bonillaa,* a

Unidad de Investigaci on M edica en Inmunologıa e Infectologıa, Hospital de Infectologıa ‘‘Dr. Daniel M endez Hern andez,’’ Centro M edico ‘‘La Raza,’’ IMSS, Mexico, D.F. b Escuela Nacional de Ciencias Biol ogicas del IPN, M exico, D.F. c Biomedicina Molecular, Centro de Investigaci on y de Estudios Avanzados del IPN, M exico, D.F. Received 17 February 2003, revised 1 May 2003

Abstract The Salmonella enterica MisL (protein of membrane insertion and secretion) is an autotransporter with high homology to AIDA-I (adhesin involved in diffuse adherence) of enteropathogenic Escherichia coli. Considering that it has been reported that the MisL b translocator domain is able to display heterologous passenger peptides to the bacterial surface, we developed a system to display proteins and release them to the external environment by means of proteolytic cleavage. Plasmids were constructed encoding 8 or 53 repeats of the NANP (Asp–Ala–Asp–Pro) tetrapeptide, which is the main B cell epitope of the Plasmodium falciparum circumsporozoitic protein (CSP), fused to the the MisL b-domain and including the recognition cleavage sequence from the E. coli OmpT surface protease. E. coli XL-10Gold and BL21(DE3) (OmpT positive and negative, respectively) and Salmonella enterica serovar Typhimurium SL3261 (Aro A
) were transformed with the plasmids and, both expression and localization of the fusion proteins were assessed by Western blot, indirect immunofluorescence, and flow cytometry, using a monoclonal antibody against (NANP)3 . Higher expression of the (NANP)8 and (NANP)53 fusion proteins was demonstrated on the bacterial surface of the OmpT negative E. coli strains and the (NANP)53 in the culture supernatant of E. coli XL-10Gold indicating a protease mediated cleavage. The flow cytometry analysis suggested 71 and 98% cleavage efficiency for the (NANP)8 and (NANP)53 , respectively, in E. coli XL10Gold. Similar results were obtained in S. enterica serovar Typhimurium SL3261, suggesting the involvement of other proteases related to OmpT. These results demonstrate that MisL may be used for the autodisplay and release of passenger proteins in attenuated Salmonella or E. coli strains, which may have several applications in vaccine design. Ó 2003 Published by Elsevier Science (USA). Keywords: Autodisplay; Salmonella enterica; MisL; Plasmodium falciparum; Live vector vaccines; Circumsporozoite protein

* Corresponding author. Fax: (55)5583-0626. E-mail address: [email protected] (C. Gonzalez-Bonilla).

0147-619X/03/$ - see front matter Ó 2003 Published by Elsevier Science (USA). doi:10.1016/S0147-619X(03)00047-7

P. Ruiz-Olvera et al. / Plasmid 50 (2003) 12–27

1. Introduction Gram negative bacteria have evolved five different mechanisms to secrete proteins to the external environment. During the transportation process from the cytosol to the bacterial surface, secreted proteins have to travel to the internal membrane, the periplasmic space, reach the outer membrane, and frequently be processed and released to the external milieu. Proteins secreted by the type I, III, and IV systems reach the bacterial surface through a channel, which crosses both the inner and outer membranes in a one step process without the intervention of periplasmic chaperone proteins, whereas proteins belonging to the type II and V systems are first translocated to the periplasmic space following the general secretion pathway (GSP) and then through the outer membrane (Burns, 1999; Salmond and Reeves, 1993; Sharff et al., 2001; Stathopoulos et al., 2000). The type IV secretion system is similar the type III, although both may involve cell to cell transfer, type IV system mediate transfer of a variety of biomolecules specially DNA–protein complexes between bacterial cells or between bacteria and eukaryotic cells. The type V system comprises the proteins also known as autotransporters because they form their own pore to reach the outer membrane by means of three different functional domains. Classic autotransporters contain a Nterminal leader peptide which allows the protein to cross from the inner membrane to the periplasmic space by a sec dependent mechanism. The leader sequence is trimmed and the C-terminal translocator b-domain forms a barrel which is inserted in the outer membrane, and finally, the N-terminal passenger a-domain which travels through the pore to the external environment and contains the biological activity of the protein. In some autotransporters the pore appears to be a monomer; like in the BrkA, which is a 103 kDa outer membrane protein of Bordetella pertussis that mediates resistance to antibody-dependent killing by complement (Shannon and Fernandez, 1999). However, it has been demonstrated that some autotransporters form more complicated pores, the IgA protease from Neisseria gonorrhoeae assembles on the bacterial surface forming a multimeric translocation channel (Veiga et al., 2002). Once on the surface, the passenger

13

domain may remain anchored to the outer membrane or be cleaved by auto proteolytic mechanisms or by the action of bacterial surface proteases (Fink et al., 2001). Autotransporters comprise a wide variety of proteins related with bacterial virulence; which include IgA proteases of N. gonorrhoeae, Neisseria menigitidis or Haemophilus influenzae (Henderson and Nataro, 2001; Jose et al., 1995; Klauser et al., 1993; Maurer et al., 1997; Poulsen et al., 1992) serine proteases from Enterobacteriaceae (Al Hasani et al., 2000; Dozois et al., 2000; Guyer et al., 2000; Henderson et al., 1999), adhesins from E. coli (Benz and Schmidt, 1989; Leininger et al., 1991; Lindenthal and Elsinghorst, 1999; St III and Cutter, 2000) and other virulence factors, such as VirG of Shigella which is involved in the bacterial spreading through epithelial cells (Suzuki et al., 1995). Due to the relative simplicity of the their transporting mechanism, the b-domains from several autotransporters have been employed to express recombinant ‘‘passenger’’ proteins on the surface of enterobacteria with the idea to induce or enhance humoral immune responses. These include the E. coli adhesin involved in diffuse adherence (AIDA-I), which has been demonstrated to promote bacterial surface expression of the peptide antigen tag PEYFK, the cholera toxin B subunit (CtxB) (Maurer et al., 1997), and an enzymatically active b-lactamase (Lattemann et al., 2000); the N. gonorrhoeae IgA protease which was also used to display the cholera toxin B subunit in Salmonella typhimurium (Klauser et al., 1990). Although the factors determining efficient surface expression of foreign antigens are still under investigation, the general notion is that protein size and conformation are two main factors influencing the translocation process. Large proteins, tightly folded or those with internal disulfide bonds may be difficult to translocate through the b-domain, thus the N. gonorrhoeae IgA protease b-domain was able to translocate the CtxB only when the disulphide induced folding in the periplasm was prevented (Klauser et al., 1990). On the other hand, it has been demonstrated that the N. gonorrhoeae IgA protease b-domain is able to promote bacterial surface expression of single chain variable antibody domains (scFv), although at a

14

P. Ruiz-Olvera et al. / Plasmid 50 (2003) 12–27

reduced level, in an active conformation with its disulphide bonds preformed in the periplasm (Veiga et al., 1999). Once the passenger protein is displayed on the bacterial surface, it can be processed by surface proteases and released to the external environment. The E. coli OmpT protease has been successfully used for this purpose as demonstrated by a CtxB fused to the AIDA-1 which was cleaved when expressed in E. coli UT2300 (OmpT+), but not in E. coli UT5600 or JK321 (OmpT-dsbA-) (Maurer et al., 1997). MisL (protein of membrane insertion and secretion) is a protein of unknown function located in the pathogenicity island SPI-3 of Salmonella enterica, which has been proposed as an autotransporter due to its high homology with AIDA-I. We have reported previously that the MisL b-domain is indeed an autotransporter, because it was able to translocate four repeats of the tetrapetide NANP (asp–Ala–Asp–Pro) to the bacterial surface, which is the main B cell epitope of the Plasmodium falciparum circumsporozoitic protein (CSP) and more importantly that antibodies raised against this peptide were able to recognize the native protein on the sporozoite surface (Ruiz-Perez et al., 2002). Since it has been suggested that released antigens may induce better antibody responses (Hess et al., 1996) we designed a system to autodisplay larger proteins and release them to the external milieu, by adding cleavage sequences recognized by OmpT between the translocator b-domain of MisL and the passenger protein. 2. Material and methods 2.1. Bacterial strains, plasmids, and oligonucleotides The bacterial strains, plasmids, and oligonucleotides used in this work are described in Table 1. 2.2. Culture and induction conditions Escherichia coli strains transformed with plasmids pRO-NANP, pRO-T-NANP, pRO-CS, pRO-T-CS, pnirBMisL or pUC19-CSP were cultured in BHI agar plates at 37 °C with 100 lg/ml ampicillin. S. enterica serovar Typhimurim was

supplemented with 0.01% 2,3-dihydroxybenzoic acid (DHB) (Sigma, St. Louis, MO). In order to induce the nirB promoter, a single colony was inoculated in BHI broth supplemented with ampicillin and DHB when necessary, and cultured with agitation (200 rpm). Once the culture reached late logarithmic growth phase (OD600 nm ¼ 1.0), 150 ll (1.5  108 cells) were transferred to 50 ml of thioglycolate medium (Difco Laboratories, Detroit, MI) and induced anaerobically at 37 °C in a BBL GasPak Anaerobic System (Becton–Dickinson Microbiology Systems, Cockeysville, MD). Culture required 6 or 8 h for E. coli and Salmonella strains, respectively, for IFA and FACS to observe maximum surface expression (optimal conditions were determined in several experiments). The bacteria were harvested after 5 or 6 h of culture for E. coli and Salmonella strains, respectively, for Western and dot blot. Bacterial strains transformed with plasmid pUC19-CSP were induced with 1 mM IPTG for 3 h at 37 °C in aerobic conditions. 2.3. Genetic engineering DNA handling was performed following the recommendations of Sambrook (Sambrook and Russell, 2001). Plasmids encoding the fusion proteins MisLb-NANP and MisLb-CSP, including or not the OmpT cleavage site, were constructed as depicted in Figs. 1 and 2. First, pRO-NANP, containing eight repeats of the tetrapeptide NANP, was derived from pnirBMisL-NANP, which contains four repeats of NANP following the strategy described before (Ruiz-Perez et al., 2002). Briefly, pnirBMisL-NANP was digested with NheI and BamHI resulting in two fragments, a 1318 bp fragment containing the MisL b-domain, which was saved and a 2687 bp fragment, which was ligated to a pair of complementary oligonucleotides (Nanp-1 and Nanp-2) containing four repeats of the NANP sequence flanked by open XbaI and BamHI restriction sites (from 50 to 30 ends) and internal NheI and NsiI sites in the 30 end. The resulting plasmid pRO-N was digested with NheI and BamHI and then ligated to the 1318 bp fragment containing the MisL b-domain (Figs. 1A and B). The resulting plasmid pRO-NANP contains an extra NANP4

Table 1 Bacterial strains, plasmids and oligonucleotides used in this work Name Bacterial strain E. coli DH5a

E. coli BL21(DE3) E. coli XL-10Gold

Name Plasmids pnirBMisL

pnirBMisLNANP pRO-NANP pRO-CS pRO-T pRO-TNANP pRO-T-CS

pUC19-CSP

Source

(sup E44, Dlac 169, f80lacZDM15hsdR17, recA1endA1, gyrA96thi-1relA1) (B F-dcm ompT hsdS [rB-mB])

Laboratory collection

(TetR D (mcrA)183D(mcrCBhsdSMR-mrr)173 endA1 supE44 thi-1 recA1 gyr A96 relA1 lac Hte [F 0 pro AB lac Iq ZDM15 Tn10 (tetR Þ Amy CamR ]a (aroA::Tn10)

Laboratory collection Laboratory collection

Nature, 1981, 291, 238–239

Relevant characteristics

Approximate molecular weight (kDa)

Size (kb)

Source or reference

Cloning vector with nir B promoter, signal sequence and translocator b MisL domain Derived from pnirLTBMisL bearing four NANP repeats Derived from pnirLTBMisL bearing eight NANP repeats Derived from pRO-NANP bearing a truncated CSP protein Cloning vector with the nir B promoter, signal sequence and SCOTb Derived from pRO-T, bearing eight NANP repeats, SCOT and the b MisL domain Derived from pRO-T-NANP, bearing a truncated CSP protein, SCOT and the b MisL domain Derived from pUC19, produces a cytosolic CSP protein

55

3.9

Infect. Immun., 2002, 70, 3611–3620

57

4

Infect. Immun., 2002, 70, 3611–3620

60

4

This work

82

4.7

This work

Undetermined

2.7

This work

62

4.1

This work

85

4.8

This work

60a

3.9

J. Infect. Dis. 1994, 169, 927–931

P. Ruiz-Olvera et al. / Plasmid 50 (2003) 12–27

S.enterica serovar Typhimurium SL3261

Characteristics

15

Oligonucleotides Nanp-1

Nanp-2

CSP-1

CSP-2

SCOT-2

pNir1

Characteristics

Use

Source

CT AGA CCA AAC GCT AAT CCT AAC GCC AAT CCA AAC GCA AAT CCT AAC GCT AAT CCA AAC GCT AGC ATG CAT G GA TCC ATG CAT GCT AGC GTT TGG ATT AGC GTT AGG ATT TGC GTT TGG ATT GGC GTT AGG ATT AGC GTT TGG T CCC TGC GCT AGC GAC AAC GAG AAA TTA AGG AAA CCA

Forward oligonucleotide containing open XbaI and BamHI restriction sites and NsiI and NheI sites (bold) codifies four NANP repeats Reverse oligonucleotide containing open XbaI and BamHI restriction sites and NsiI and NheI sites (bold) codifies four NANP repeats Forward primer for the amplification of CSP. Contains a NheI restriction site (bold) Reverse primer for the amplification of CSP. Contains NheI and EcoRI sites (bold) Forward oligonucleotide encodig SCOT. Contains XbaI, NheI, SmaI, XbaI, and BamHI sites (bold)

Cloning NANP

Gibco-BRL

Cloning NANP

Gibco-BRL

Amplification of CSP

Gibco-BRL

Amplification of CSP

Gibco-BRL

Linker(SCOTb )

Gibco-BRL

Reverse oligonucleotide encoding SCOT. Contains XbaI, NheI, SmaI, XbaI and BamHI sites (bold)

SCOTb

Gibco-BRL

Forward primer containing sequence from the NirB promoter.

Sequencing

Gibco-BRL

GGG CCC GCT AGC GAA TTC ATT GTG ACC TTG TCC ATT ACC TTG CTAGAGCTAGCAAACGTCCCG GGGGTGGTGGT GGTGG TAAA CGTG GTG GTGGTGGTGGT CCG TCTAGA ATCTTGTTACTA G GATCCTAGTAACAAGATTCT AGACGGACCACCACCACCAC CACGTTTACCACCACCACCA CCCCCGGGACGTTTGCTAGCT TTCAGGTAAATTTGATACATC AAA

Sequences are presented from 50 to 30 and restriction sites are depicted in bold. a The expected molecular mass is not consistent with the electrophoretic pattern (66 kDa). b SCOT (sequence recognized by OmpT).

P. Ruiz-Olvera et al. / Plasmid 50 (2003) 12–27

SCOT-1

Sequence (50 to 30 )

16

Name

P. Ruiz-Olvera et al. / Plasmid 50 (2003) 12–27

17

Fig. 1. Construction of plasmids pRO-NANP (A–B) and pRO-T-NANP (B–C). These plasmids encode for a fusion protein constituted by the LTB signal sequence, eight repeats of the tetrapeptide NANP which is the main B cell epitope of the P. falciparum CSP and the MisL b-domain. These constructs are under the control of the NirB promoter. In pRO-T-NANP a linker sequence containing two OmpT cleavage sites (K/R) was included between the passenger NANP8 peptide and MisL b-domain. The addition of new passenger sequences was achieved by ligation of double stranded oligonucleotides flanked with open restriction sites to compatible ends in the plasmid.

sequence and downstream a NheI site. An adapter oligonucleotide containing two OmpT recognition K/R sites (designed here as SCOT) was inserted downstream of the NANP encoding sequence following the same strategy. Plasmid pRO-NANP was digested with NheI and BamHI and the 1318 bp fragment saved. The 2747 bp fragment was ligated to a pair of complementary oligonucleotides (SCOT-1 and SCOT-2) designed with flanking XbaI and BamHI restriction sites. The resulting plasmid pRO-T was ligated to the 1318 bp fragment previously obtained, generating plasmid pRO-T-NANP (Figs. 1B and C). Due to the cloning strategy the (NANP)8 peptide contains two flanking and one internal alanine and arginine residues, which do not correspond to the wild-type CSP B cell epitope from P. falciparum (Fig. 2B). A truncated CSP encoding amino acid residues 101–323, was amplified by PCR from pUC19-CSP using primers CSP-1 and CSP-2, which are described in the Table 1. The amplification was performed from 1 pg of DNA, 1 pM of primers, 200 lM dNTPs 1 U Vent DNA polymerase

(Biolabs), first denaturing at 94 °C for 5 min, and then following 30 cycles of annealing 66 °C for 1 min, extension at 72 °C for 1 min and denaturing 95 °C for 1 min with a final extension at 72 °C (Thermocyclator Amplitron II, Thermoline). The PCR product (669 bp) was inserted in the NheI restriction site of plasmids pRO-NANP and pROT-NANP resulting plasmids pRO-CS and pRO-TCS, respectively (Fig. 2A). Both constructions contain 53 NANP repeats of the CSP protein from P. falciparum. Fig. 2B shows the SCOT nucleotide sequence. Figs. 2C and D show the predicted amino acid sequence of the (NANP)8 peptide and the CSP, respectively. Finally, all clones were sequenced. Briefly, 1 lg of plasmid DNA was sequenced with the DNA Big Dye Terminator Cycle Sequencing Kit (Applied Biosystems Foster City, CA, USA) using 8 pM of primer pNir1. The amplification reaction was purified by CENTRISEP Spin columns (Applied Biosystems) and examined in a PE AbiPrism 310 genetic analyzer (Applied Biosystems).

18

P. Ruiz-Olvera et al. / Plasmid 50 (2003) 12–27

Fig. 2. Construction of plasmids pRO-CS and pRO-T-CS. These plasmids contain a fusion synthetic gene encoding the LTB signal sequence, eight NANP repeats, a truncated CSP from P. falciparum, and the MisL b-domain. pRO-T-CS has an adapter with two OmpT cleavage sites (K/R) between the CSP and MisL b-domain. (A) Ligation of the CSP to the plasmids containing eight repeats of NANP. (B,C) Sequence containing OmpT cleavage sites (SCOT), nucleotides and amino acid translation, respectively. (D) Translated amino acids sequence of the CSP.

2.4. Bacterial fractions Different bacterial fractions were obtained from E. coli XL-10Gold and BL21(DE3) transformed with plasmids pRO-NANP pRO-CS, pRO-TNANP, pRO-T-CS, pnirBMisL or pUC19-CSP. Briefly, 50 ml of bacterial cultures obtained under inducing conditions were harvested by centrifugation at 5000g/5 min, washed twice with PBS, pH 7.4 and adjusted to 1  109 cells/ml (OD600 nm ¼ 1.0). Crude protein preparations consisting of solubilized bacteria, were obtained by mixing

1  108 cells with 100 ll of sample buffer (0.5 M Tris, pH 6.8, 2% SDS, 5% b-mercaptoethanol, 10% glycerol, and 0.1% bromophenol blue), boiling for 10 min and collecting the supernatant after centrifugation at 13,000g for 2 min. Periplasmic proteins were obtained from 1  1010 cells resuspended in 10 ml of 30 mM Tris–HCl with 20% sucrose, pH 8.0, in 1 mM EDTA. The cells were incubated in agitation for 10 min at room temperature, the suspension was centrifuged at 8000g/ 10 min, the pellet was resuspended in 300 ll cold 5 mM MgSO4 and shaken on ice for 10 min. The

P. Ruiz-Olvera et al. / Plasmid 50 (2003) 12–27

suspension was centrifuged at 8000g/10 min at 4 °C and the supernatant containing the periplasmic fraction was collected. In order to obtain outer membrane proteins (OMP), 1  1010 cells were resuspended in 10 ml of 10 mM Tris–HCl, pH 8.0, and 10 mM EDTA and then disrupted in a French press (20,000 psi, twice). Undisrupted cells were removed by centrifugation and the supernatant was incubated with 1% Triton X-100 for 30 min and centrifuged to 100,000g for 60 min at 4 °C. The pellet containing OMP was dissolved in 10 mM Tris–EDTA. Protein concentration was quantified in all bacterial fractions and 40 lg samples were further analyzed by electrophoresis under reducing conditions. Culture supernatants were prepared as described (Hess et al., 1990) with some modifications. Briefly, the different bacterial strains were cultured overnight at 37 °C on agar plates supplemented with ampicillin. Then, single colonies were inoculated in 40 ml of thioglycolate and cultured in anaerobic conditions for 6 h. Culture supernatants were prepared by first removing the cells by centrifugation at 1500g for 15 min at 4 °C after adding trichloroacetic acid (TCA) to a final concentration of 10% (w/v). Precipitated proteins were harvested by centrifugation at 13,000g for 1 h at 4 °C. The samples were neutralized using a Trissaturated solution and finally the proteins were solubilized in SDS sample buffer (0.5 M Tris, pH 6.8, 2% SDS, 5% b-mercaptoethanol, 10% glycerol, and 0.1% bromophenol blue) and 50 lg samples were further analyzed by electrophoresis under reducing conditions. 2.5. MisLb-NANP and MisLb-CSP expression depending on the OmpT cleavage sequence Expression of the four fusion proteins, MisLbCSP, MisLb-NANP, MisLb-T-CSP, and MisLbT-NANP (with or without the OmpT cleavage site) was evaluated by Western blot in the different bacterial fractions obtained as described above. Protein samples were electrophoresed in denaturating polyacrylamide gels (SDS–PAGE) (Laemmli, 1970) under reducing and denaturing conditions and then stained with Coomassie blue dye. Western and dot blot was performed by transferring the proteins to nylon membranes

19

(Millipore, Bedford, MA) (Towbin et al., 1979), after blocking the membranes with PBS 5% skim milk for 1 h at 37 °C, they were incubated for 12 h at 37 °C with 2 lg/ml of monoclonal antibody 2A10 diluted in PBS 5% skim milk (2A10 recognizes the NANP epitope from P. falciparum and was kindly donated by Dr. Elizabeth Nardin from the Department of Medical and Molecular Parasitology New York University School of Medicine, New York, NY). The membranes were then incubated with a goat-anti mouse IgG-peroxidase conjugate (1 lg/ml in PBS 5% skim milk) for 1 h at 37 °C. The immunological reaction was revealed with 4-chloro-1-naphthol 30% H2 O2 in PBS, pH 7.4, and between incubations the membranes were washed with PBS 5% skim milk 0.01% Tween 20. 2.6. Evaluation of MisLb-CSP and MisLb-NANP fusion proteins surface expression determined by the OmpT cleavage site The surface expression of the four fusion proteins, MisLb-CSP and MisLb-NANP bearing or not the SCOT, was assessed by indirect immunofluorescence (IFA) and flow cytometry in E. coli XL-10Gold and BL21(DE3), and S. enterica serovar Typhimurium SL3261. The bacterial behavior was compared in the strains transformed with these plasmids. As controls, strains transformed with pnirBMisL and pUC19-CSP were included. After inducing them as described in Section 2, the bacterial strains were harvested, washed twice with PBS, and then incubated with monoclonal antibody 2A10 for 30 min at room temperature with agitation. Then they were washed twice with PBS and incubated with a goat anti-mouse IgG-FITC conjugate (10 lg/ml in PBS plus 1% BSA) for 30 min at room temperature in the dark. The washings were repeated and the samples were resuspended in propidium iodide–PBS (4 mg/L) and spread on slides to view them under fluorescence microscopy (Olympus BX40). Flow cytometry was performed with 400 lL of the cell suspension (1  104 cells) using a Flow cytometer (Beckton– Dickinson, Bedford, MA) and analyzed with the Lysis II (Ver 1.1). Statistical analysis included Kolmogorov–Smirnov test (Watson, 2001).

20

P. Ruiz-Olvera et al. / Plasmid 50 (2003) 12–27

3. Results 3.1. Construction of MisLb-NANP and MisLbCSP fusion proteins With the purpose to evaluate the ability of the MisL translocator b-domain to promote bacterial surface display of proteins with different size and the possibility to release them to external milieu after proteolytic cleavage, two fusion proteins were constructed, each with two different variants of the same repetitive tetrapeptide NANP as described in Section 2. The MisLb-NANP containing eight repeats of the tetrapeptide NANP and the MisLb-CSP which contains a truncated form of

CSP including amino acids 101–322 fused to the eight NANP repeats, consequently this protein bears a total of 53 repeats of the NANP. A variant including the OmpT cleavage site was constructed for each protein. The plasmids encoding these proteins contain the anaerobically inducible nirB promoter controlling the LTB signal peptide followed by 506 amino acids from the MisLa-domain (Da-domain), which were conserved and fused to the passenger proteins in order to ensure their translocation though the pore, and the translocator MisL b-domain (Ruiz-Perez et al., 2002). The SCOT in plasmids pRO-T-NANP and pRO-T-CS contains a 63 bp adapter bearing two OmpT cleavage sites (K/R), which codifies for 26 amino

Fig. 3. Expression of the MisLb-NANP and MisLb-CSP fusion proteins in E. coli BL21(DE3) (OmpT)) and E. coli XL-10Gold (OmpT+) assessed by Western and bot blot. (A) Western blot of solubilized bacterial samples from a 7% SDS–PAGE. Lanes: 1, XL10Gold transformed with pRO-T-CS; 2, BL21(DE3) with pRO-T-CS; 3, XL-10Gold with pRO-CS; 4, XL-10Gold with pRO-TNANP; 5, BL21(DE3) with pRO-T-NANP; 6, BL21(DE3) with pRO-NANP; 7, BL21(DE3) with pnirBMisL; and 8, BL21(DE3) with pUC19-CSP. (B) Western blot of outer membrane proteins from a 10% SDS–PAGE. Lanes and culture conditions are similar to those in (A). (C) Western blot of supernatants from 12.5% SDS–PAGE. Lanes and culture conditions are similar to those in (A). (D) Western blot of solubilized bacterial samples from a 7% SDS–PAGE in S. enterica serovar Typhimurium SL3268. Lane 1, transformed with pRO-NANP; lane 2, pRO-T-NANP; lane 3, transformed with pUC19-CSP; lane 4, transformed with pnirBMisL; lane 5, transformed with pRO-CS; and lane 6: transformed with pRO-T-CS. (E) Dot blot of supernatants from S. enterica serovar Typhimurium SL3261 transformed with different plasmids. 1, pRO-CS; 2, pRO-T-CS; 3, pNirBMisL; 4, pUC19-CSP; 5, pRO-NANP; and 6, pRO-T-NANP.

P. Ruiz-Olvera et al. / Plasmid 50 (2003) 12–27

acid residues as described by Hanke et al. (1992) with some modifications and was inserted between the passenger protein and the Da-domain. 3.2. The MisLb-NANP and MisLb-CSP fusion proteins are produced in E. coli Expression of the fusion proteins MisLb-NANP and MisLb-CSP was examined by Western blot in protein preparations obtained from different bacterial compartments. E. coli XL-10 Gold (OmpT+) and BL21(DE3) (OmpT)) were transformed with the four different plasmids, using as controls pUC19-CSP (cytoplasmic CSP expression) and pnirBLTBMisL (lacks the passenger domain). The fusion proteins consisted of the following constituents, the MisL b-domain (280 amino acids, 32 kDa), an Da-domain (226 amino acids, 26 kDa) and the passenger domains NANP (32 amino acids, 4 kDa) or CSP (223 amino acids, 25 kDa). All bacterial strains were first induced by anaerobiosis, except for pUC19-CSP which was induced with IPTG. The Western blot clearly demonstrated the expression of the (NANP)8 and CSP passenger proteins in solubilized bacteria and OMP preparations (Fig. 3). The MisLb-CSP fusion protein exhibited the expected 90 kDa molecular weight in both E. coli XL-10Gold and BL21(DE3), but when this fusion protein included the OmpT cleavage (K/R) site and was expressed in E. coli (OmpT+) an extra band of 25 kDa was observed in the crude protein samples (Fig. 3A, lane1). This band was not observed in OmpT negative strain transformed with pRO-T-CS (Fig. 3A, lane 2). These results suggest that OmpT protease mediated the protein processing, although other proteases missing in E. coli BL21(DE3) such as Lon or other expressed by E. coli XL-10Gold could be involved in the protein cleavage. The Western blot shows several bands suggesting protein degradation by other proteases (Fig. 3A, lanes 1 and 3), However, in E. coli BL21(DE3) (OmpT)) presented a single band (Fig. 3A, lane2). It has to be considered that the OmpT protease may cut also between two basic amino acids and the CSP has a R/K sequence six amino acids from the beginning of the cloned sequence. However, this result is consistent with other recombinant

21

CSP constructs expressed by other bacterial strains which show several bands in Western blot (RuizPerez et al., 2002). Moreover, the fusion proteins were not detected in periplasmic extracts, therefore it may be suggested that they are not retained in this compartment and may be promptly translocated to the external membrane (data not shown). The expected 60 kDa band corresponding to the MisLb-NANP fusion protein was revealed in total protein and OMP samples (Fig. 3A, lanes 4–6 and 3B, lanes 6–8), although the fusion protein could not be demonstrated in the culture supernatant of E. coli XL-10Gold transformed with the plasmid bearing the SCOT, this may be explained by the small size of the passenger peptide (NANP)8 . As expected, control bacterial strains transformed with pnirBLTBMisL did not show any band because this plasmid did not contain a passenger protein (Fig. 3A, lane 7 and 3B, lane 7), while E. coli BL21(DE3) transformed with pUC19-CSP exhibited a band in solubilized bacterial preparations but not in OMP extracts because this plasmid produces a cytosolic CSP (Fig. 3A lane 8 and 3B, lane 8). When comparing all bacterial strains transformed with pRO-T-CS (encodes for the CSP and the linker with the OmpT cleavage site), the most important finding was that a 25 kDa band was revealed by the 2A10 antibody only in supernatant precipitates from E. coli XL-10Gold (OmpT+), thus suggesting specific OmpT mediated proteolytic cleavage between the Da-MisL domain with release of the (NANP)53 (Fig. 3C, lane 1). Expression of MisLb-CSP and MisLb-NANP fusion proteins was also confirmed in Salmonella by Western blot from solubilized bacterial samples (Fig. 3D), when S. enterica serovar Typhimurium SL3261 was transformed with pRO-CS or pRO-TCS a 83 kDa protein was demonstrated (Fig. 3D, lanes 5 and 6), whereas strains transformed with pRO-NANP and pRO-T-NANP showed a a 60 kDa protein (Fig. 3D, lanes 5 and 6). Interestingly important protein degradation was observed in those Salmonella strains producing (NANP)53 . The small NANP and CSP released to the external milieu from MisLb-NANP and MisLb-CSP fusion proteins containing the SCOT were detected by dot blot in Salmonella strains (Fig. 3E, lanes 2 and 6).

22

P. Ruiz-Olvera et al. / Plasmid 50 (2003) 12–27

Fig. 4. Surface expression of the MisLb-NANP and MisLb-CSP fusion proteins, and their variants bearing the OmpT cleavage sequence, in E. coli BL21(DE3) (OmpT)) and XL-10Gold (OmpT+) strains. The (NANP)3 epitope was detected by IFA using the 2A10 monoclonal antibody and a FITC-conjugated goat anti-mouse IgG as secondary antibody. (A) E. coli BL21(DE3) transformed with pRO-T-NANP. (B) E. coli XL-10Gold transformed with pRO-T-NANP; (C) E. coli BL21(DE3) transformed with pRO-T-CS; (D) E. coli XL-10Gold transformed with pRO-T-CS; (E) E. coli XL-10Gold transformed with pnirBMisL; (F) E. coli XL-10Gold transformed with pUC19-CSP; (G) S. enterica serovar Typhimurium SL3261 transformed with pRO-NANP; and (H) S. enterica serovar Typhimurium SL3261 transformed with pRO-CS.

3.3. The MisLb-NANP and MisLb-CSP fusion proteins are expressed on the bacterial surface of E. coli and Salmonella strains Fig. 4 compares the surface expression of the MisLb-NANP and MisLb-CSP fusion proteins in OmpT positive or negative bacterial strains and Salmonella strains, which was assessed by IFA performed with the 2A10 monoclonal antibody. Controls included E. coli strains transformed with pUC19-CSP (cytosolic CSP expression), which should not show fluorescence, thus demonstrating that under the experimental conditions the monoclonal antibody recognized the (NANP)3 epitope only on the bacterial surface (not shown). Clear surface expression of the fusion proteins MisLb-NANP and MisLb-CSP containing the SCOT was demonstrated in E. coli BL21(DE3) (OmpT)) (Figs. 4A and C), in contrast only slight fluorescence was observed in E. coli XL-10Gold (OmpT+) (Figs. 4B and D), this result was expected and suggests that the passenger antigen was released from the bacterial surface. The protein expression in Salmonella strains were positive the same manner that expressed in E. coli strains (Fig. 4G and H).

The passenger protein expression on the bacterial surface in OmpT positive and negative E. coli strains was measured by flow cytometry (Fig. 5). Whereas fluorescence intensity was similar in all E. coli BL21(DE3) (OmpT)) transformed plasmids bearing the passenger protein (NANP)8 (Figs. 5B and E) or (NANP)53 (Figs. 5H and K), it was clearly decreased in those E. coli XL-10Gold (OmpT+) strains producing the fusion proteins with the SCOT (NANP)8 (Figs. 5A and D) and (NANP)53 (Figs. 5G and J), thus suggesting an OmpT dependent proteolytic surface processing. The statistical analysis of the surface expression comparing OmpT positive or negative bacterial strains demonstrated 71 and 98% cleavage for the MisLb-NANP and MisLb-CSP fusion proteins, respectively. 3.4. Expression and cleavage of MisLb-NANP and MisLb-CSP fusion proteins in S. enterica serovar Typhimurium SL3261 Salmonella enterica serovar Typhimurium SL3261 (a DaroA
auxotrophic mutant) was transformed with pRO-NANP, pRO-T-NANP, pRO-CS, and pRO-T-CS. The Western blot and

P. Ruiz-Olvera et al. / Plasmid 50 (2003) 12–27

23

Fig. 5. Flow cytometry analysis. MisLb-NANP and MisLb-CSP fusion protein expression on the surface of different bacterial strains. (A) E. coli XL-10Gold transformed with pRO-NANP; (B) E. coli BL21(DE3) transformed with the same plasmid; (C) histogram comparing A and B; (D) E. coli XL-10Gold transformed with pRO-T-NANP; (E) E. coli BL21(DE3) transformed with the same plasmid; (F) histogram comparing D and E; (G) E. coli XL-10Gold transformed with pRO-CS; (H) BL21(DE3) transformed with the same plasmid; (I) histogram comparing G and H; (J) E. coli XL-10Gold transformed with pRO-T-CS; (K) E. coli BL21(DE3) transformed with the same plasmid; and (L) histogram comparing (J) and (K).

IFA of these strains were consistent with the behavior of the fusion proteins in the E. coli (data not shown). The flow cytometry analysis demonstrated that both the (NANP)8 and (NANP)53 passenger proteins were expressed on the bacterial surface of Salmonella and that they were processed when the SCOT was included (Fig. 6). The cleavage efficiency similar to the E. coli strains, approximately 50% when comparing pRO-NANP with pRO-T-NANP (Figs. 6A–C) and almost 100% when comparing pRO-CS with pRO-T-CS (Fig. 6D–F). Nevertheless, whereas the maximum

cleavage activity in E. coli was observed after 6 h of induction by culturing in anaerobic conditions, in Salmonella it was observed after 8 h of culture.

4. Discussion Gram negative attenuated bacterial strains are attractive live vectors of passenger proteins because they have been demonstrated to elicit humoral and cellular immune response against viral, bacterial, and parasite antigens. Although the main factors

24

P. Ruiz-Olvera et al. / Plasmid 50 (2003) 12–27

Fig. 6. Flow cytometry analysis in S. enterica serovar Typhimurium SL3261. Surface expression of MisLb-NANP and MisLb-CSP, and their variant containing the SCOT. (A) Salmonella transformed with pRO-NANP; (B) Salmonella transformed with pRO-TNANP; (C) histogram comparing A and B; (D) Salmonella transformed with pRO-CS; (E) Salmonella transformed with pRO-T-CS; and (F) histogram comparing D and E.

determining the immune response to these passenger antigens are still under discussion, the general notion is that antigen amount and accessibility during the induction phase of the adaptative immune response are two critical factors in its outcome. Antigens profusely displayed on the bacterial surface may induce better antibody response than those produced in the bacterial cytosol. For this reason and because of their simplicity, autotransporters are attractive tools for the development of live bacterial vector vaccines. Several autotransporters have been employed with success to export heterologous passenger proteins to the bacterial surface (autodisplay) (Maurer et al., 1997; RuizPerez et al., 2002; Thanassi and Hultgren, 2000; Veiga et al., 1999). Nevertheless, translocation of passenger antigens may be related to their size and folding, and may be different for each autotransporter b-domain. Therefore, it is difficult to predict whether a protein may be secreted by these systems, and this has to be determined in individual cases. We reported previously that the MisL b-domain was able to translocate four repeats of the tetrapeptide NANP to the bacterial surface, demonstrating that it is indeed an autotransporter

(Ruiz-Perez et al., 2002). Herein we report the ability of the MisL b-domain to display bigger passenger proteins, and a method to release them to the external milieu by protease cleavage. The constructs were assessed in an attenuated Salmonella strain, which offers several theoretical advantages over other bacterial live vectors, because it is able to reach swiftly macrophages and dendritic cells, delivering antigens directly to these main antigen presenting cells, therefore inducing local and systemic, both humoral and cellular immune responses. Moreover, a surprising property of Salmonella vaccine vectors is their ability to induce MHC class I restricted CD8þ cytotoxic responses against the passenger antigens (Shata et al., 2000). Two variants of the main surface protein from P. falciparum sporozoites were fused to the MisL b-domain. One consists of eight repeats of the tetrapeptide NANP, while the other consists of 53 repeats. Both proteins were successfully displayed on the bacterial surface of E. coli and Salmonella as demonstrated by IFA and flow cytometry. The Western blot from solubilized E. coli strains showed a 90 kDa band corresponding to the complete MisLb-CSP fusion protein (b-domain

P. Ruiz-Olvera et al. / Plasmid 50 (2003) 12–27

32 kDa, Da-domain 26 kDa, and CSP25 kDa), and 60 kDa corresponding to the MisLb-NANP (b-domain, Da-domain and eight repeats of NANP, 4 kDa). More importantly, the CSP passenger protein was processed and released by proteolytic cleavage in E. coli XL-10Gold as demonstrated by the 25 kDa band obtained from supernatants. The (NANP)8 was not detectable probably due to its small size. Western blot analysis also suggested that the fusion proteins were not retained in the periplasmic space. However we detected (NANP)8 peptide in supernatants from Salmonella by dot blot. These results may indicate that cleavage and release is feasible in both E. coli and Salmonella strains. Release of the CSP and (NANP)8 passenger proteins was achieved by inserting the OmpT cleavage site between the passenger proteins and the MisL b-domain. OmpT from E. coli is member of the family of outer membrane proteases known as omptins, which are virulence factors of Gram negative bacteria related to the plasminogen activator of Yersinia (Sodeinde and Goguen, 1989). Their proteolytic activity depends on the interaction with lipopolysaccharide (LPS) and they cleave between two consecutive basic amino acid residues (Kramer et al., 2000), mainly K/R, although other amino acid recognition sequences have been reported (Maurer et al., 1997). Omptins, such as OmpT and OmpP, may also degrade recombinant proteins, thus interfering with their production (Matsuo et al., 1999). In the case of passenger autodisplayed proteins with putative OmpT recognition sites in their amino acid sequence, the evaluation of proteolytic processing have led to contradictory results, whereas some authors have reported protein cleavage when the heterologous protein is produced in OmpT positive bacterial strains (Lattemann et al., 2000), others find no evidence of proteolytic cleavage (Shi and Wen, 2001). Hanke et al. (1992) reported two hybrid proteins consisting of the cholesterol esterase/lipase from Pseudomonas fused to the E. coli hemolysin (HlyA). These authors also achieved protein release to the external milieu including an adapter sequence that contained cleavage sites for OmpT. Similar results to E. coli strains were observed in S. enterica serovar Typhimurium SL3261, the

25

flow cytometry demonstrated surface display of MisLb-NANP and MisLb-CSP and fluorescence displacement to the left with MisLb-T-NANP and MisLb-T-CSP, suggesting release of the passenger proteins. Cleavage in S. enterica serovar Typhimurium SL3261 may be explained by the activity of other proteases related to OmpT. Grodberg et al. have demonstrated that the Salmonella E protein encoded by pgtE is highly homologous to OmpT (Grodberg and Dunn, 1989). We estimated the cleavage efficiency for CS and (NANP)8 passenger proteins in E. coli after 6 h of culture to be approximately 98 and 71%, respectively, whereas in S. enterica serovar Typhimurium SL3261 it was 100 and 50%, respectively, after 8 h of culture in anaerobic conditions. Taken together the data presented here reveal that observations made with other autotransporters apply to MisL as well, and demonstrate this protein is able to autodisplay passenger proteins which can be released to the external environment if a protease cleavage recognition site is included after the pore forming translocator domain. To our knowledge this is the first report of successful utilization of the OmpT cleavage sequence in S. enterica serovar Typhimurium for the release of passenger proteins to the external milieu.

Acknowledgments The authors thank Dr. Leopoldo Aguilar Faisal for his technical assistance. This work was in part supported by CONACYT Grant M28958 (P.I: C.G.B) and IMSS Grant FP-2001/056, Reg.2000693-0012 (P.I: C.G:B.). P.R.O., A.S:M., and F.R.P. were recipients of fellowship from CONACYT and IMSS.

References Al Hasani, K., Henderson, I.R., Sakellaris, H., Rajakumar, K., Grant, T., Nataro, J.P., Robins-Browne, R., Adler, B., 2000. The sig A gene which is borne on the she pathogenicity island of Shigella flexneri 2a encodes an exported cytopathic protease involved in intestinal fluid accumulation. Infect. Immun. 68, 2457–2463.

26

P. Ruiz-Olvera et al. / Plasmid 50 (2003) 12–27

Benz, I., Schmidt, M.A., 1989. Cloning and expression of an adhesin (AIDA-I) involved in diffuse adherence of enteropathogenic Escherichia coli. Infect. Immun. 57, 1506–1511. Burns, D.L., 1999. Biochemistry of type IV secretion. Curr. Opin. Microbiol. 2, 25–29. Dozois, C.M., Dho-Moulin, M., Bree, A., Fairbrother, J.M., Desautels, C., Curtiss III, R., 2000. Relationship between the Tsh autotransporter and pathogenicity of avian Escherichia coli and localization and analysis of the Tsh genetic region. Infect. Immun. 68, 4145–4154. Fink, D.L., Cope, L.D., Hansen, E.J., Geme III, J.W., 2001. The Haemophilus influenzae Hap autotransporter is a chymotrypsin clan serine protease and undergoes autoproteolysis via an intermolecular mechanism. J. Biol. Chem. 276, 39492–39500. Grodberg, J., Dunn, J.J., 1989. Comparison of Escherichia coli K-12 outer membrane protease OmpT and Salmonella typhimurium E protein. J. Bacteriol. 171, 2903–2905. Guyer, D.M., Henderson, I.R., Nataro, J.P., Mobley, H.L., 2000. Identification of sat, an autotransporter toxin produced by uropathogenic Escherichia coli. Mol. Microbiol. 38, 53–66. Hanke, C., Hess, J., Schumacher, G., Goebel, W., 1992. Processing by OmpT of fusion proteins carrying the HlyA transport signal during secretion by the Escherichia coli hemolysin transport system. Mol. Gen. Genet. 233, 42–48. Henderson, I.R., Czeczulin, J., Eslava, C., Noriega, F., Nataro, J.P., 1999. Characterization of pic, a secreted protease of Shigella flexneri and enteroaggregative Escherichia coli. Infect. Immun. 67, 5587–5596. Henderson, I.R., Nataro, J.P., 2001. Virulence functions of autotransporter proteins. Infect. Immun. 69, 1231–1243. Hess, J., Gentschev, I., Goebel, W., Jarchau, T., 1990. Analysis of the haemolysin secretion system by PhoA–HlyA fusion proteins. Mol. Gen. Genet. 224, 201–208. Hess, J., Gentschev, I., Miko, D., Welzel, M., Ladel, C., Goebel, W., Kaufmann, S.H., 1996. Superior efficacy of secreted over somatic antigen display in recombinant Salmonella vaccine induced protection against listeriosis. Proc. Natl. Acad. Sci. USA 93, 1458–1463. Jose, J., Jahnig, F., Meyer, T.F., 1995. Common structural features of IgA1 protease-like outer membrane protein autotransporters. Mol. Microbiol. 18, 378–380. Klauser, T., Pohlner, J., Meyer, T.F., 1990. Extracellular transport of cholera toxin B subunit using Neisseria IgA protease beta-domain: conformation-dependent outer membrane translocation. EMBO J. 9, 1991–1999. Klauser, T., Pohlner, J., Meyer, T.F., 1993. The secretion pathway of IgA protease-type proteins in Gram-negative bacteria. Bioessays 15, 799–805. Kramer, R.A., Zandwijken, D., Egmond, M.R., Dekker, N., 2000. In vitro folding, purification and characterization of Escherichia coli outer membrane protease ompT. Eur. J. Biochem. 267, 885–893. Laemmli, U.K., 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature 227, 680–685.

Lattemann, C.T., Maurer, J., Gerland, E., Meyer, T.F., 2000. Autodisplay: functional display of active beta-lactamase on the surface of Escherichia coli by the AIDA-I autotransporter. J. Bacteriol. 182, 3726–3733. Leininger, E., Roberts, M., Kenimer, J.G., Charles, I.G., Fairweather, N., Novotny, P., Brennan, M.J., 1991. Pertactin, an Arg–Gly–Asp-containing Bordetella pertussis surface protein that promotes adherence of mammalian cells. Proc. Natl. Acad. Sci. USA 88, 345–349. Lindenthal, C., Elsinghorst, E.A., 1999. Identification of a glycoprotein produced by enterotoxigenic Escherichia coli. Infect. Immun. 67, 4084–4091. Matsuo, E., Sampei, G., Mizobuchi, K., Ito, K., 1999. The plasmid F OmpP protease, a homologue of OmpT, as a potential obstacle to E. coli-based protein production. FEBS Lett. 461, 6–8. Maurer, J., Jose, J., Meyer, T.F., 1997. Autodisplay: onecomponent system for efficient surface display and release of soluble recombinant proteins from Escherichia coli. J. Bacteriol. 179, 794–804. Poulsen, K., Reinholdt, J., Kilian, M., 1992. A comparative genetic study of serologically distinct Haemophilus influenzae type 1 immunoglobulin A1 proteases. J. Bacteriol. 174, 2913–2921. Ruiz-Perez, F., Leon-Kempis, R., Santiago-Machuca, A., Ortega-Pierres, G., Barry, E., Levine, M., Gonzalez-Bonilla, C., 2002. Expression of the Plasmodium falciparum immunodominant epitope (NANP)(4) on the surface of Salmonella enterica using the autotransporter MisL. Infect. Immun. 70, 3611–3620. Salmond, G.P., Reeves, P.J., 1993. Membrane traffic wardens and protein secretion in Gram-negative bacteria. Trends Biochem. Sci. 18, 7–12. Sambrook, J., Russell, D.W., 2001. Molecular Cloning: A Laboratory Manual, third ed Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, USA. Shannon, J.L., Fernandez, R.C., 1999. The C-terminal domain of the Bordetella pertussis autotransporter BrkA forms a pore in lipid bilayer membranes. J. Bacteriol. 181, 5838–5842. Sharff, A., Fanutti, C., Shi, J., Calladine, C., Luisi, B., 2001. The role of the TolC family in protein transport and multidrug efflux. From stereochemical certainty to mechanistic hypothesis. Eur. J. Biochem. 268, 5011–5026. Shata, T.M., Stevceva, L., Agwale, S., Lewis, K.G., Hone, D.M., 2000. Recent advances with recombinant bacterial vaccine vectors. Mol. Med. Today 6, 66–71. Shi, H., Wen, S.W., 2001. Display of green fluorescent protein on Escherichia coli cell surface. Enzyme Microb. Technol. 28, 25–34. Sodeinde, O.A., Goguen, J.D., 1989. Nucleotide sequence of the plasminogen activator gene of Yersinia pestis: relationship to omp T of Escherichia coli and gene E of Salmonella typhimurium. Infect. Immun. 57, 1517– 1523. St III, G.J., Cutter, D., 2000. The Haemophilus influenzae Hia adhesin is an autotransporter protein that remains unc-

P. Ruiz-Olvera et al. / Plasmid 50 (2003) 12–27 leaved at the C terminus and fully cell associated. J. Bacteriol. 182, 6005–6013. Stathopoulos, C., Hendrixson, D.R., Thanassi, D.G., Hultgren, S.J., St III, G.J., Curtiss III, R., 2000. Secretion of virulence determinants by the general secretory pathway in Gramnegative pathogens: an evolving story. Microbes Infect. 2, 1061–1072. Suzuki, T., Lett, M.C., Sasakawa, C., 1995. Extracellular transport of VirG protein in Shigella. J. Biol. Chem. 270, 30874–30880. Thanassi, D.G., Hultgren, S.J., 2000. Multiple pathways allow protein secretion across the bacterial outer membrane. Curr. Opin. Cell Biol. 12, 420–430. Towbin, H., Staehelin, T., Gordon, J., 1979. Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some

27

applications. Proc. Natl. Acad. Sci. USA 76, 4350– 4354. Veiga, E., de, L.V, Fernandez, L.A., 1999. Probing secretion and translocation of a beta-autotransporter using a reporter single-chain Fv as a cognate passenger domain. Mol. Microbiol. 33, 1232–1243. Veiga, E., Sugawara, E., Nikaido, H., de, L.V., Fernandez, L.A., 2002. Export of autotransported proteins proceeds through an oligomeric ring shaped by C-terminal domains. EMBO J. 21, 2122–2131. Watson, J.V., 2001. Proof without prejudice revisited: immunofluorescence histogram analysis using cumulative frequency subtraction plus ratio analysis of means. Cytometry 43, 55–68. Communicated by S. Levy