Disruption of LH-induced testosterone biosynthesis in testicular Leydig cells by triclosan: Probable mechanism of action

Toxicology 250 (2008) 124–131

Contents lists available at ScienceDirect

Toxicology journal homepage: www.elsevier.com/locate/toxicol

Disruption of LH-induced testosterone biosynthesis in testicular Leydig cells by triclosan: Probable mechanism of action Vikas Kumar a , Chandrajeet Balomajumder b , Partha Roy a,∗ a b

Molecular Endocrinology Laboratory, Department of Biotechnology, Indian Institute of Technology Roorkee, Roorkee 247667, Uttarakhand, India Fluid Particle Research Laboratory, Department of Chemical Engineering, Indian Institute of Technology Roorkee, Roorkee 247667, Uttarakhand, India

a r t i c l e

i n f o

Article history: Received 30 April 2008 Received in revised form 26 June 2008 Accepted 26 June 2008 Available online 9 July 2008 Keywords: Triclosan Leydig cells Steroidogenesis Adenylyl cyclase

a b s t r a c t Triclosan (TCS) is an antimicrobial chemical widely used in different commercial preparations. The present study demonstrated the mechanism of action of TCS-induced anti-androgenecity in rat Leydig cells. Treatment of purified cells with increasing concentrations of TCS (0.001, 0.01, 0.1, 1 and 10 ␮M) resulted in a significantly decreased activity of adenylyl cyclase enzyme which was followed by a decreased synthesis of cAMP. This decreased cAMP level resulted in the disruption of entire steroidogenic cascade causing a depressed synthesis of testosterone. However, TCS-induced decrease in the production of testosterone returned to normalcy when cells were treated with forskolin (an adenylyl cyclase activator). Transcription followed by translational of four prominent steroidogenic enzyme/proteins, cytochrome P450 side chain cleavage (P450scc), 3␤-hydroxysteroid dehydrogenase (3␤-HSD), 17␤-hydroxysteroid dehydrogenase (17␤-HSD) and steroidogenic acute regulatory (StAR) protein, also decreased in a dose-dependent manner in TCS-treated Leydig cells as determined by RT-PCR, enzyme assay and Western blot. These results suggested that the disruption of the activity of adenylyl cyclase enzyme by TCS in turn leads to the disruption of intermediate steroidogenic cascade causing a depressed testosterone production. The study further confirmed the anti-androgenic activity of TCS in Leydig cells with highest effective concentration at 1 ␮M. © 2008 Elsevier Ireland Ltd. All rights reserved.

1. Introduction In modern life, we use several types of synthetic chemicals for different applications; however, prevalent uses of these chemicals are posing severe threat to human/animal health. Many of these chemicals affect the endocrine system of body and are known as endocrine disrupting chemicals (EDC). In brief EDC are the compounds that disturb the balanced endocrine orchestra of the body causing several severe complications (Kumar et al., 2008; Roy and Pereira, 2005). A possible link have been suggested between exposure to EDC and occurrence of a number of diseases like reduced fecundity, abnormal fetal development, delayed onset of puberty, cryptorchadism, abnormal lactation, testicular dysfunction and even various types of cancers (Sharpe and Irvine, 2004; Roy and Pereira, 2005; Darbre, 2006; Guillette, 2006). Toilet articles like soap, shampoo, detergents, disinfectants, cosmetics and pharmaceutical products consists of a number of antimicrobial agents and preservatives (Cabana et al., 2007;

∗ Corresponding author. Fax: +91 1332 273560. E-mail address: [email protected] (P. Roy). 0300-483X/$ – see front matter © 2008 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.tox.2008.06.012

Lakeram et al., 2006). The unremitting use of these chemicals results in their occurrence at detectable concentrations in different places like in ground water and soil, in human blood, milk, various organs and tissues (Darbre, 2006; Dayan, 2006; Heidler et al., 2006; Nakada et al., 2006). Triclosan (TCS; 2,4,4 -trichloro2 -hydroxydiphenyl ether), a chlorophenol, is an antimicrobial agent widely used as a preservative in toothpaste, soap, shampoo, and cosmetics (Black and Howes, 1975) and has been frequently detected in wastewater effluents (Heidler et al., 2006). TCS and its chlorinated derivatives are readily converted into various dibenzop-dioxins by heat and ultraviolet irradiation which may be harmful for body system (Kanetoshi et al., 1998a,b). Exposure of TCS to the human and wildlife may be a consequence of its presence in the cosmetics and other human use articles as well as its presence in the environment at a detectable level. This chemical has been reported to be absorbed from the gastrointestinal tract and across the skin and has been detected even in human breast milk (Dayan, 2006). In general, TCS has been known to be a highly toxic chemical for aquatic flora and fauna (Tatarazako et al., 2004). It has been included in the probable list of endocrine disruptors on account of its resemblance with known non-steroidal estrogens (e.g. diethylestradiol, bisphenol A). The nature of the endocrine disrupting effect of TCS is

V. Kumar et al. / Toxicology 250 (2008) 124–131

controversial and various studies indicate it to be of different nature viz. estrogenic or weak androgenic or anti-androgenic. Ishibashi et al. (2004) demonstrated that metabolite of TCS may be a weak estrogenic compound with the potential to induce vitellogenin in male medaka while in female it decreased the hatchability as well as delayed the hatching (Ishibashi et al., 2004). On the other hand, 14 days exposure of TCS in Japanese medaka fry (Oryzias latipes) resulted in a weak androgenic effect (Foran et al., 2000). TCS has also been shown to be anti-androgenic inhibiting transcriptional activity induced by testosterone (Chen et al., 2007). Physiologically, testosterone is synthesized in Leydig cells under acute and chronic stimulation by LH (Gail and Hedger, 1992). When LH binds to its receptor, it activates Gs protein and stimulates adenylyl cyclase, increasing the concentration of intracellular cAMP (Dufau, 1988). This increased level of cAMP, in turn, results in activation of various agents of steroidogenic cascade causing an increased production of testosterone (acute effect of LH) (Stocco and Clark, 1997; Lin et al., 2001). Thus, a balanced functioning of the adenylyl cyclase is a prerequisite for a sustained biosynthesis of testosterone by Leydig cells (Marinero et al., 1996; Lin et al., 2001). The aim of the present study was to explore the mode of action of TCS as the anti-androgenic EDC using an in vitro approach on isolated Leydig cell primary culture. This study demonstrated that TCS depressed the cAMP production by decreasing the activity of adenylyl cyclase enzyme which in turn depresses the steroidogenic cascade of Leydig cells resulting in a decreased testosterone biosynthesis. 2. Materials and methods 2.1. Chemicals M-199 and gentamicin were obtained from Invitrogen Corporation (Carlsbad, CA, USA). Tricolosan was from SD Fine-Chem Ltd (Mumbai, India) and was almost 99% pure. MTT and Tween were from Himedia (Mumbai, India). Isobutyl-methylxanthine, percoll, bovine serum albumin, bovine lipoprotein, creatine phosphate, creatine phosphokinase, ␥-globulin and theophylline were all procured from Sigma (St. Louis, MO, USA). cAMP antibody, steroids and LH used in this study were kindly provided by Professor Ilpo Huhtaniemi, Imperial College London, UK. NBT, BCIP and all chemicals related to RNA isolation and RT-PCR were from Bangalore Genei (Bangalore, India). Dowex-AG50-WX4 resins were from BioRad (Hercules, CA, USA). All other general grade chemicals were purchased locally unless otherwise stated. 2.2. Animals Male Wistar albino rats, Rattus norvegicus, were purchased from All India Institute of Medical Sciences (New Delhi, India). Animals were in healthy condition at the time of purchasing and were housed in a well-ventilated animal house with 12 h light:12 h dark schedule. The animals were fed with a balanced animal feed (Ashirwad Animal Feed Industries, Punjab, India) and had free access to normal drinking water. All the experiments were performed according to the guidelines and approval of institutional animal ethics committee. 2.3. Leydig cell isolation and purification Rat testicular Leydig cells were isolated by the method as described earlier (Murugesan et al., 2007). Highly aseptic conditions were maintained throughout the experiment. In short, the capsules covering of testis were removed and decapsulated testes were digested in M-199 medium containing 0.25 mg/ml collagenase (type I) at 34 ◦ C with constant shaking. On completion of incubation, same amount of M-199 media (without collagenase) was added to the tubes to stop collagenase activity and allowed to stand for 10 min followed by careful aspiration of supernatant. The last procedure was repeated once again for removing additional Leydig cells, both the supernatants were combined and centrifuged at 2500 × g for 10 min at 4 ◦ C. The pellet was then resuspended in 1 ml of medium which represented a crude testicular suspension. A discontinuous percoll gradient was maintained carefully in a 15-ml centrifuge tube having 75% at the bottom followed by 60, 45, 30, 15 and finally 5% at the top (each 2 ml). The crude testicular suspension was loaded at the top of the tube followed by centrifugation at 3000 × g for 30 min (4 ◦ C). After centrifugation, most of the purified cells were observed in between 30 and 45% gradient. This portion was transferred carefully to a centrifuge tube containing M-199 media, mixed and centrifuged at 2500 × g for 10 min to remove excess percoll. The procedure was repeated three times more and finally Leydig cells were suspended in

125

1 ml medium. The purity of Leydig cells were assessed by 3␤-hydroxysteroid dehydrogenase (3␤-HSD) staining and viability was checked by routine trypan blue dye exclusion method both of which were found to be 88 and 92%, respectively.

2.4. TCS treatment of Leydig cells The isolated Leydig cells were plated in 24 well plates (Axygen, Mumbai, India) (1 × 105 cells/well) at a volume of 1 ml per well. Throughout the experiment, culture conditions (if otherwise not stated) consisted of M-199 medium supplemented with 2.2 g/l NaHCO3 , 2.4 g/l HEPES, 0.1% BSA, 0.25 g/l bovine lipoprotein and 25 mg/l gentamicin, pH 7.4 for 2 h at 34 ◦ C in 5% CO2 incubator. After 24 h of plating the cells were treated with varying concentrations of TCS for another 2 h in the presence and absence of LH (100 ng/ml) or various other test chemicals.

2.5. Testosterone biosynthesis To observe the effect of TCS on testosterone production, testosterone level in the medium (after 2 h culture of Leydig cells with or without maximally stimulating LH) was assayed. The assays were performed using the commercial enzyme immunoassay kits (DRG Diagnostics, Germany for steroids and Transasia Biomedical, Mumbai for Cholesterol) as per manufacturer’s instructions. Each experiment was performed in quadruplicate to avoid statistical errors and cells having 1% ethanol in the medium were used as vehicle-treated control, throughout the study.

2.6. MTT assay The effects of TCS on viability of cells were estimated by MTT assay. In this assay the reduction of MTT (a yellow tetrazolium salt) to a blue formazan product by the viable cells were measured (West et al., 2001). Briefly, the Leydig cells which were previously incubated for 2 h with different concentrations of TCS were treated with 100 ␮l fresh medium containing 0.5 mg/ml of MTT for 1 h. Following 1 h, the medium was removed and the reduced formazan was dissolved in 100 ␮l acidified (0.04N HCl) isopropanol at room temperature for 25 min. The dissolved formazan concentration was then measured in a plate reader (model UVM 340, Asys Hitech Gmbh, Austria) at 562 nm wavelength. Control (blank) wells contained only isopropanol.

2.7. Semi-quantitative RT-PCR Total RNA was extracted from the cells treated with or without different concentrations of TCS in presence of LH (100 ng/ml) according to the earlier described method (Chomczynski and Sacchi, 1987). The extracted RNA samples were quantified and equal amount of them were transcribed with the help of the RT-PCR kit purchased from Bangalore Genei (Bangalore, India) according to the manufacturer’s instruction. PCR was performed by denaturing at 94 ◦ C for 60 s, annealing at various temperatures (depending on primer pairs used) for 30 s and extension at 72 ◦ C for 60 s followed by varying number of cycles for amplification. The primer sequences, annealing temperature and number of cycles for PCR were all designed according the earlier report by Ohsako et al. (2003) except for steroidogenic acute regulatory (StAR) protein, and glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Primer sequence for StAR was adopted from Murugesan et al. (2007) and for GAPDH were designed with the help of Primer3 software (Steve Rozen and Helen J. Skaletsky, 1998, Primer3) and standardized in the laboratory. The PCR products were then separated on 2% agarose gel and visualized in a gel documentation system (Bio-Rad, USA). The intensity of the bands on gels was converted into digital image with a gel analyzer and the amount of RT-PCR products were quantified with Scion Images software (Scion Corporation, Fredrick, MD, USA). GAPDH PCR products were used as internal standards. Primer sequence, product size, annealing temperature, number of cycles used and gene bank accession number of all primers are given in Table 1. Four RNA samples (for each of the concentrations tested) were used to perform RT-PCR reactions to avoid statistical error.

2.8. Steroidogenic enzyme activities A HLPC-based method was used to measure steroidogenic enzyme activities (Darney et al., 1983). In brief, the cells were incubated with pregnenolone (25 ␮M), progesterone (12.5 ␮M), or androstenedione (12.5 ␮M), substrates for 3␤-HSD, cytochrome P450 C17 (P450C17 ) and 17␤-hydroxysteroid dehydrogenase (17␤-HSD), respectively, in the presence or absence of TCS for 2 h and under maximum stimulation of LH (100 ng/ml). Then the steroid products of each enzyme were extracted from culture medium with hexane and solvent exchanged into methanol which was finally reduced to 50 ␮l. Steroid products were quantified by a reversephase HPLC C18 column (Waters-Millipore Associates Inc., Milford, MA, USA) with methanol/tetrahydrofuran/water (28:16:56) as the mobile phase and 11␤-hydroxyandrostenedione (200 ng/tube) as internal standards. Peaks of ketosteroids were detected by an online UV absorbance detecting system at 240 nm. Integrated peak areas were used to determine individual steroids.

126

V. Kumar et al. / Toxicology 250 (2008) 124–131

Table 1 Primers used for semi-quantitative RT-PCR Gene

Primer sequence

Product size

Cycle used

Annealing temperature (◦ C)

Gene bank accession no.

P450scc (F) P450scc (R)

CGCTCAGTGCTGGTCAAAA TCTGGTAGACGGCGTCGAT

688

23

55

J05156

3␤-HSD (F) 3␤-HSD (R)

CCGCAAGTATCATGACAGA CCGCAAGTATCATGACAGA

547

24

55

M38178

17␤-HSD (F) 17␤-HSD(R)

TTCTGCAAGGCTTTACCAGG ACAAACTCATCGGCGGTCTT

653

26

55

AF035156

StAR (F) StAR (R)

TTGGGCATACTCAACAACCA ATGACACCGCTTTGCTCA

389

25

58

NM031558

GAPDH (F) GAPDH (R)

AGACAGCCGCATCTTCTTGT CTTGCCGTGGGTAGAGTCAT

207

21

58

NM017008

2.9. Western blot analysis Effect of TCS on the translation StAR, 3␤-HSD and 17␤-HSD were measured by co-incubating the cells with 0.01, 1.0 and 10 ␮M concentrations of TCS in the presence of maximally stimulating LH (100 ng/ml). Vehicle-treated cells represented the control group. On completion of incubation the cells were lysed by adding 1× SDS sample buffer (62.5 mM Tris/HCl, pH 6.8, 2% (w/v) SDS, 10% glycerol, 50 mM DTT). Immediately cells were scraped off the plate, extract transferred to a microcentrifuge tube and sonicated for 10–15 s to shear DNA and reduce sample viscosity. The samples were quantified for protein content and an equal amount of protein was used to separate by polyacrylamide gel electrophoresis and electroblotted to PVDF membrane. The membranes were incubated in blocking buffer (Tris-buffered saline with 3% bovine serum albumin), and were probed with rabbit polyclonal anti-StAR (kindly provided by Professor D.M. Stocco, Texas Technical University, U.S.A.; J. Biol. Chem., 269: 28314–28322), anti-3␤-HSD and anti-17␤-HSD antibodies (SantaCruz Biotechnology, Santa Cruz, CA, USA, kindly provided by Dr. A. Bandyopadhyay, Indian Institute of Chemical Biology, Jadavpur, India), all diluted 1:100 in Tris-buffered saline with 1% Tween (v/v). Goat anti-rabbit IgG antibodies (Bangalore Genei, Bangalore, India) conjugated to alkaline phosphatase was then used to probe the primary antibodies (1:1000 in TBS with 1% Tween, v/v). Colour development was performed in 30 ml AP-buffer (100 mM Tris/HCl pH 9.5, 100 mM NaCl, 5 mM MgCl2 ), with 200 ␮l NBT (50 mg/ml) and 100 ␮l BCIP (50 mg/ml). Finally the developed blots were subjected to densitometry using the ␤-actin as internal control. 2.10. Adenylyl cyclase activity Cells from both TCS-treated and vehicle-treated batch were scrapped off the plates and activity of adenylyl cyclase enzyme was assayed by the methods as described earlier (Solomon et al., 1974) with slight variations according to our laboratory conditions. The assay of the homogenate was performed in a final volume of 200 ␮l in a buffer containing 40 mM Tris/HCl (pH 7.5), 5 mM MgCl2 , 0.5 mM cAMP, 0.01% bovine serum albumin, 10 mM creatine phosphate, 0.1 mg/ml creatine phosphokinase, 1 mM [␣-32 P]ATP (approximately 2 ␮Ci) (Board of Radiation and Isotope Technology, Mumbai, India) and 0.25 mM isobutyl-methylxanthine (IBMX). Incubation was carried out at 32 ◦ C for 15 min and the reaction was stopped by immersing the incubation tubes in a boiling water bath for 5 min. The mixture was then clarified by spinning it for 10 min at 7000 × g (4 ◦ C). The supernatants were subjected to chromatography on Dowex-AG50-WX4 columns followed by separation on neutral alumina. The radioactivity in the elutes was then determined in liquid Scintillation counter (Beckman, USA).

pellets were then counted in a ␥-counter (Electronic Corporation of India Ltd., ECIL, Mumbai, India). The intraassay and interassay coefficient of variation was below 6 and 12%, respectively.

2.12. Statistical analysis Origin 6.1 software (Origin lab Corporation, USA) was used for statistical analysis and data were expressed as mean ± S.E.M. For statistical analysis of data, ANOVA followed by multiple two-tail comparison t-test was used and p < 0.05 was considered significant.

3. Results 3.1. Effects of TCS on Leydig cell proliferation On treating the isolated Leydig cells with increasing concentrations of TCS no significant reduction in cellular proliferation was observed till 10 ␮M concentration (Fig. 1). This was further confirmed by observing the cells microscopically which also did not show any alternations in cellular morphology even at the highest concentration tested by us.

3.2. Leydig cell testosterone metabolism is severely affected by TCS TCS severely impairs the LH-induced testosterone production in Leydig cells in a dose-dependent manner (Fig. 2). At a concentration of 1 ␮M it resulted in about 50% inhibition of LH-induced testosterone production which did not show any significant down regulation with increase in the concentration of TCS (10 ␮M).

2.11. cAMP production by Leydig cells To measure the effect of TCS on cAMP production, cells were treated with different concentrations of TCS in the presence of LH for 2 h and cAMP level was measured as compared to that of untreated cells (incubated with 1% ethanol only). Cell culture medium contained IBMX (100 ␮M) to inhibit phosphodiesterase activity. At the end of the incubation, cAMP degradation was blocked by 50 ␮l Tris buffer (0.05 M, pH 7.5) containing 4 mM EDTA and 2 mg/ml theophylline. The cells were scraped into 2 ml of ethanol and disrupted on ice by ultrasonic oscillation followed by transfer into 1.5 ml microfuge tubes. Tubes were dried in a speedvac, followed by resuspension in 250 mM acetate buffer. Tubes were subjected to 800 × g centrifugation and precipitated proteins were discarded. Supernatant was used for the determination of cAMP content by radioimmunoassay as described previously (Harper and Brooker, 1975; Vuorento et al., 1989). Briefly, the cellular extract was incubated in the presence of cAMP-antiserum (kindly donated by Professor Ilpo Huhtaniemi, Imperial College London, UK) and radioiodinated cAMP (kindly provided by Dr. Subeer Majumder, National Institute of Immunology, New Delhi, India) at 4 ◦ C over night. After about 15 h, the antibody bound cAMP were pelleted by adding 0.5% ␥-globulin and 16% polyethylene glycol followed by centrifugation at 3000 rpm for 20 min at 4 ◦ C. The

Fig. 1. Viability of isolated Leydig cells treated with varying concentrations of TCS. The Leydig cells were treated with TCS as described in Section 2 followed by the estimation of the farmazan formation.

V. Kumar et al. / Toxicology 250 (2008) 124–131

127

Fig. 2. Dose-dependent effect of TCS on Leydig cell testosterone production. Leydig cells were treated with different concentrations of TCS with/without LH for 2 h and testosterone level was measured. * Significant level of difference as compared to only LH-treated group (p < 0.05).

3.3. Gene expression analysis demonstrated a concentration-dependent decrease in the expression of prominent steroidogenic enzymes The semi-quantitative RT-PCR analysis of mRNA, extracted from Leydig cells treated with increasing concentrations of TCS (0.001, 0.01, 0.1, 1 and 10 ␮M) in the presence of 100 ng/ml of LH, demonstrated that the transcription of three major steroidogenic enzymes: P450SCC , 3␤-HSD, 17␤-HSD and StAR protein decreased dramatically in a dose-dependent manner as compared to only LH treatment (Fig. 3A). Although at the lowest concentration of TCS treatment (0.001 ␮M) no significant change in transcription was observed for all the four genes tested by us, however, there was almost 60% decrease in transcription at the highest concentration (10 ␮M) of TCS treatment to Leydig cells (Fig. 3B).

3.4. TCS treatment induces concentration-dependent changes in steroidogenic enzymes activities Incubation of Leydig cells with increasing concentrations of TCS (0.001–10 ␮M) induced a statistically significant decrease in the activities of P450C17 (Fig. 4A), 3␤-HSD (Fig. 4B), and 17␤HSD (Fig. 4C) enzymes (p < 0.05). The highest concentration of TCS resulted in almost 50% decrease in enzyme activities for the all the three enzymes under consideration. However, the enzyme activities at both 1 and 10 ␮M concentrations were almost similar indicating the saturation of TCS-induced activity at 1 ␮M concentration.

Fig. 3. RT-PCR analysis to demonstrate the changes in the mRNA expression of P450SCC , 3␤-HSD, 17␤-HSD and StAR genes in Leydig cells treated with different concentration of TCS in the presence of 100 ng/ml of LH for 2 h. (A) The total RNA isolated from Leydig cells were reverse transcribed and cDNA obtained was subjected to PCR. (B) The relative intensity of the signals were quantified by densitometer and normalized against the internal control (GAPDH). Control indicates Leydig cells treated with only LH. *Significant level of difference as compared to control group (p < 0.05).

3.6. TCS causes a dose-dependent decrease in the activity of LH-induced adenylyl cyclase enzyme As shown in Fig. 6, TCS caused the reduction of activity of adenylyl cyclase in a dose-dependent manner. Although it could not down regulate the enzyme activity at the lowest concentration tested (0.001 ␮M), it significantly down regulated it right from the 0.01 ␮M concentration and this trend continued further till 1 ␮M (p < 0.05). Hereafter, it leveled off with no further decease in enzyme activity even after increase in test chemical concentration.

3.7. Leydig cell cAMP production is decreased by TCS treatment The incubation of Leydig cells with increasing concentrations of TCS resulted in a serial decrease in cAMP production. The decrease was 27, 47, 51, 70 and 71% at the concentrations of 0.001, 0.01, 0.1, 1 and 10 ␮M, respectively (Fig. 7).

3.8. Effect of adenylyl cyclase activator/inhibitor on LH-induced testosterone production and their cross-talk with TCS 3.5. Decreased translation of LH-induced 3ˇ-HSD, 17ˇ-HSD and StAR in response to TCS treatment The immunoblot analysis of proteins extracted from Leydig cells treated with three different concentrations of TCS (0.01, 0.1, and 1.0 ␮M) demonstrated that there was a dose-dependent decrease in the expression of 3␤-HSD, 17␤-HSD enzymes and StAR proteins induced by LH (Fig. 5A and B).

Forskolin (an adenylate cyclase activator)-induced testosterone production was significantly down regulated by TCS (p < 0.05) (Fig. 8). On the other hand treating the cells with SQ22536 (a potent adenylate cyclase inhibitor) alone, although there was a significant inhibition of testosterone production by Leydig cells but TCS did not elicit any further down regulation of testosterone production (Fig. 8).

128

V. Kumar et al. / Toxicology 250 (2008) 124–131

Fig. 4. Effects of TCS on activity of P450C17 (A), 3␤-HSD (B) and 17␤-HSD (C) enzyme activity in vitro. The crude enzyme extract was isolated from the Leydig cells treated with different concentrations of TCS in the presence of 100 ng/ml of LH for 2 h, followed by the incubation with respective substrates as described in Section 2. The results are expressed as percent decrease of enzyme activity over control group (treated with only LH) which was given a value of 100. Data are mean ± S.E.M. of four enzymatic reactions of each concentration tested for all the enzymes. *Significant level of difference in enzyme levels as compared to control group (p < 0.05).

4. Discussion In Leydig cells, steroidogenesis is accomplished in several steps most of which are dependent on appropriate levels of cAMP (Beavo and Brunton, 2002; Lin et al., 2001). cAMP is produced from ATP by the action of enzyme adenylyl cyclase, hence, a proper functioning of the enzyme adenylyl cyclase is crucial for maintaining a balanced steroidogenesis. The main rate limiting step of steroidogenic pathway is the transportation of cholesterol from outer to inner mitochondrial membrane by a transmembrane protein, StAR protein, and an appropriate level of cAMP is crucial for this step (Stocco and Clark, 1997; Privalle et al., 1983). In active steroidogenic cells, the expression and activation of StAR is maintained by cAMP modulated PKA under maximal stimulation of LH (Andrew et al., 2007). The present study demonstrated that TCS treatment affected both the foresaid events resulting in a reduced cAMP level and a decreased expression of StAR protein in treated Leydig cells, in spite of constant stimulation by LH. Further, the decrease was found to be dose-dependent. This decreased availability of cAMP might have been caused either by a decreased accessibility of ATP (cAMP precursor) to the adenylyl cyclase enzyme or by a decreased functioning of the enzyme (adenylyl cyclase) itself. In this study TCS treatment did not affect the ATP generating system since ATP level was same in both treated and untreated group of Leydig cells (data not shown), however, results demonstrated a dose-dependent

decrease in the activity of adenylyl cyclase enzyme. Thus, in this study, TCS treatment depressed the adenylyl cyclase enzyme activity leading to a decreased synthesis of cAMP which finally decreased the expression of StAR protein in treated cells. Once the StAR protein transports cholesterol to the inner mitochondrial membrane, expression and availability of P450SCC enzyme is one more regulating step of steroidogenesis (Miller, 1988; Omura and Morohashi, 1995). In our study, results indicated a significant decrease in level of P450SCC enzyme and the decrease was dose-dependent. This may be the outcome of a decreased availability of cholesterol in the inner mitochondrial membrane and therefore gene expression of the protein responsible for the conversion to next intermediate may have been down regulated. In addition, another factor which might have contributed to this event is the depressed cAMP level, since it is also responsible for the phosphorylation of the components of side chain cleavage system (Fauser, 1999). This study also demonstrated a dose-dependent decrease in the activity of the other steroidogenic enzymes viz. P450C17 , 3␤HSD and 17␤-HSD. Besides, transcriptional profiles of 3␤-HSD and 17␤-HSD were also found to be significantly decreased (in a dosedependent manner) in the treated cells. The probable explanation for these findings could be attributed to the decreased delivery of the intermediates resulting in a reduced expression of all enzymes of steroidogenic cascade since it has been known that the

V. Kumar et al. / Toxicology 250 (2008) 124–131

129

Fig. 7. Dose-dependent effects of triclosan on Leydig cell cAMP production. The Leydig cells were incubated with different concentrations of TCS for 2 h in the presence of 100 ng/ml of LH and cAMP level was measured. Each column represents mean ± S.E.M. (n = 4). Control indicates Leydig cells treated with only LH. *Significant level of difference in cAMP levels as compared to control group (p < 0.05).

Fig. 5. (A) Immunoblot analysis of 3␤-HSD, 17␤-HSD and StAR from Leydig cells treated with different concentrations of TCS for 2 h in the presence of 100 ng/ml of LH. Protein extracts from the vehicle-treated Leydig cells were used as control and ␤-actin was used as loading control. (B) The relative intensity of the signals were quantified by densitometer and normalized against the internal control (␤-actin). *Significant level of difference in expression patterns as compared to control group (p < 0.05).

precursors substrates also plays an important role in these enzyme biosynthesis (Sanderson and Vanden, 2003). Further, TCS treatment also resulted in a dose-dependent decrease in the synthesis of testosterone in the Leydig cells. This might have been achieved by a reduced expression of StAR protein as well as a decreased expression and activity of P450SCC , P450C17 , 3␤-HSD and 17␤-HSD enzymes since a balanced status of all of them is required for an optimum testosterone synthesis in active steroidogenic cells.

Fig. 6. Dose-dependent effects of TCS on Leydig cell adenylyl cyclase enzyme activity in vitro. The Leydig cells were incubated with increasing concentrations of TCS for 2 h in the presence of 100 ng/ml of LH and enzyme activity was measured. Each column represents mean ± S.E.M. (n = 4). 0.0 indicates treatment of cells with only LH. *Significant level of difference in adenyl cyclase levels as compared to 0.0 group (p < 0.05).

Further, results showed that TCS inhibited the forskolin (adenylyl cyclase activator)-induced testosterone biosynthesis significantly at highest effective TCS concentration (1 ␮M) tested by us. This further confirmed the direct involvement of TCS on adenylyl cyclase activity since it could mask the effect of forskolin on adenylyl cyclase. While in case of SQ22536 (a potent adenylyl cyclase inhibitor), the rate of inhibition of testosterone production was almost same when the cells were treated either only with SQ22536 or along with TCS, indicating the absence of any additive effects of TCS on SQ22536 action. This could be attributed to several factors like, SQ22536 might have masked the effect of TCS or the latter might need a minimum threshold level of adenylyl cyclase which it can inhibit. All these indicated that the main factor responsible for decreased synthesis of testosterone is TCS-induced cAMP deprivation which is in turn caused by disruption in the activity of adenylyl cyclase enzyme. According to literature, xenobiotics-dependent direct up/down regulation of steroidogenic enzymes and steroidogenesis could be attributed to several factors: (i) their action through arylhydrocar-

Fig. 8. Alteration in testosterone production in Leydig cell treated with adenylyl cyclase activator (forskolin) and adenylyl cyclase inhibitor (SQ22536), for 2 h with/without TCS at a concentration of 1 ␮M. Results are mean ± S.E.M. (n = 4). *Significant level of difference in testosterone levels as compared to only forskolin treatment group (p < 0.05).

130

V. Kumar et al. / Toxicology 250 (2008) 124–131

bon receptor (AhR) (Indarto and Izawa, 2001), (ii) direct binding of these chemicals to steroid receptors, steroidogenic enzymes and proteins associated with steroidogenesis (like StAR protein) (Rice et al., 2006; Sanderson and Vanden, 2003), and (iii) increasing the stability of transcripts and transcriptional rate of the promoter of steroidogenic enzymes (Lin et al., 2006; Lyssimachou et al., 2006). Based on this it could be speculated that in the present study TCS is acting as an anti-androgen due to its interaction with the activity of adenylyl cyclase enzyme. In conclusion, our results demonstrated that TCS acts as a potent endocrine disruptor in Leydig cells and the inhibition of androgen production is initiated when this chemical disrupts the activity of adenylyl cyclase enzyme. This leads to a reduced cAMP availability in Leydig cells disrupting the entire cAMP-dependent steroidogenic pathway viz. a depressed StAR expression, one of the crucial proteins responsible for cholesterol transport to inner mitochondrial membrane, and last but not the least, the down regulation of several key steroidogenic enzymes like P450SCC , P450C17 , 3␤-HSD, and 17␤-HSD. These observations could be further exploited to unravel the exact mechanism of action of TCS like endocrine disruptors both at enzyme and androgen receptor levels. Conflict of interest The authors disclose that there is no conflict of interest. Acknowledgements Kind help of Prof. Ilpo Huhtaniemi, Imperial College London, UK with all steroidal test chemicals and cAMP antibodies is greatly acknowledged. We would also like to thank Prof. D.M. Stocco, Texas Tech University, Lubbock, Texas, for kindly providing StAR antibodies and Dr. Arun Bandyopadhyay, Indian Institute of Chemical Biology, Kolkata, India for other antibodies used in the manuscript. We are also thankful to Dr. Subeer Majumder of National Institute of Immunology, New Delhi, India, for providing the facilities and helping in radio-isotope works. The study was supported by the Ministry of Human Resource and Development as fellowship to V.K., and by the Department of Biotechnology (DBT, no. BT/BCE/08/355/04), Government of India and Council of Scientific and Industrial Research (CSIR, no. 37(1200)/04/EMR II), Government of India as funded projects to P.R. The authors would thus like to thank all these funding agencies. References Andrew, S., June Liu, Barry, R.Z., Haolin, C., 2007. Effect of myxothiazol on Leydig cell steroidogenesis: inhibition of luteinizing hormone mediated testosterone synthesis but stimulation of basal steroidogenesis. Endocrinology 148 (6), 2583–2590. Beavo, J.A., Brunton, L.L., 2002. Cyclic nucleotide research – still expanding after half a century. Nat. Rev. Mol. Cell. Biol. 3, 710–718. Black, J.G., Howes, D.R.T., 1975. Percutaneous absorption and metabolism of Irgasan DP 300. Toxicology 3, 33–47. Cabana, H., Jiwan, J.L., Rozenberg, R., Elisashvili, V., Penninckx, M., Agathos, S.N., Jones, J.P., 2007. Elimination of endocrine disrupting chemicals nonylphenol and bisphenol A and personal care product ingredient triclosan using enzyme preparation from the white rot fungus Coriolopsis polyzona. Chemosphere 67, 770–778. Chen, J., Ahn, K.C., Gee, N.A., Gee, S.J., Hammock, B.D., Lasley, B.L., 2007. Antiandrogenic properties of parabens and other phenolic containing small molecules in personal care products. Toxicol. Appl. Pharmacol. 221, 278–284. Chomczynski, P., Sacchi, N., 1987. Single step method of RNA isolation by acid guanidium thiocyanate–phenol–chloroform extraction. Anal. Biochem. 162, 156–159. Darbre, P.D., 2006. Environmental oestrogens, cosmetics and breast cancer. Res. Clin. Endocrinol. Metab. 20, 121–143. Darney Jr., K.J., Wing, T.Y., Ewing, L.L., 1983. Simultaneous measurement of four testicular ketosteroids by isocratic high-performance liquid chromatography with on-line ultraviolet absorbance detection. J. Chromatogr. 257, 81–90.

Dayan, A.D., 2006. Response to: ethics, data and the pharmaceutical physician. Int. J. Clin. Pract. 60, 1009. Dufau, M.L., 1988. Endocrine regulation and communicating functions of the Leydig cell. Ann. Rev. Physiol. 50, 483–508. Fauser, B.C.J.M., 1999. Molecular biology of steroidogenesis. Molecular Biology in the Reproductive Medicine, vol. 234. Parthenon Publishing, New York, pp. 234– 251. Foran, C.M., Bennett, E.R., Benson, W.H., 2000. Developmental evaluation of a potential non-steroidal estrogen: triclosan. Mar. Environ. Res. 50 (1–5), 153–156. Gail, P.R., Hedger, M.P., 1992. Adult rat Leydig cell cultures: minimum requirements for maintenance of luteinizing hormone responsiveness and testosterone production. Mol. Cell. Endocrinol. 83, 128–132. Guillette, L.J., 2006. Endocrine disrupting contaminants—beyond the dogma. Environ. Health Perspect. 114 (1), 9–12. Harper, J., Brooker, G., 1975. Femtomole sensitive radioimmunoassay for cyclic-AMP and cyclic GMP after 2 -O-acetylation by acetic anhydride in aqueous solution. J. Cycl. Nucleotide Res. 4, 207–218. Heidler, J., Sapkota, A., Halden, R.U., 2006. Partitioning, persistence and accumulation in digested sludge of the topical antiseptic triclocarban during wastewater treatment. Environ. Sci. Technol. 40, 3634–3639. Indarto, D., Izawa, M., 2001. Steroid hormones and endocrine disruptors: recent advances in receptor-mediated actions. Yonago Acta Med. 44, 1–6. Ishibashi, H., Matsumura, N., Hirano, M., Matsuoka, M., Shiratsuchi, H., Ishibashi, Y., Takao, Y., Arizono, K., 2004. Effects of triclosan on the early life stages and reproduction of medaka Oryzias latipes and induction of hepatic vitellogenin. Aquat. Toxicol. 67, 167–179. Kanetoshi, A., Ogawa, H., Katsura, E., Kaneshima, H., Miura, T., 1998a. Formation of polychlorinated dibenzo-p-dioxins upon combustion of commercial textile products containing 2,4,4-trichloro-2-hydroxydiphenyl ether (Irgasan DP300). J. Chromatogr. 442, 289–299. Kanetoshi, A., Ogawa, H., Katsura, E., Kaneshima, H., Miura, T., 1998b. Formation of polychlorinated dibenzo-p-dioxins from 2,4,4 trichloro-2␤-hydroxydiphenyl ether (Irgasan DP300) and its chlorinated derivatives by exposure to sunlight. J. Chromatogr. 454, 145–155. Kumar, V., Chakraborty, A., Gunda, V., Roy, P., 2008. Androgenic endocrine disruptors in wastewater treatment plant effluents in India: their influence on reproductive processes and systemic toxicity in male rats. Toxicol. Appl. Pharmacol. 226 (1), 60–63. Lakeram, M., Lockley, D.J., Sanders, D.J., Pendlington, R., Forbes, B., 2006. Paraben transport and metabolism in the biomimetic artificial membrane permeability assay (BAMPA) and 3-day and 21-day Caco-2 cell systems. J. Biomol. Screen. 12, 84–91. Lin, Ho., Wang, S.W., Wang, R.Y., Paulus, S., 2001. Stimulatory effect of lactate on testosterone production by rat Leydig cells. J. Cell Biochem. 83, 147–154. Lin, T.C., Chien, S.C., Hsu, P.C., Li, L.A., 2006. Mechanistic study of polychlorinated biphenyl 126-induced CYP 11B1 and CYP 11B2 up-regulation. Endocrinology 147, 1536–1544. Lyssimachou, A., Jessen, B.M., Arukew, A., 2006. Brain cytochrome P450 aromatase gene isoforms and activity levels in atlantic salmon after waterborne exposure to nominal environmental concentrations of the pharmaceutical ethynylestradiol and antifoulant tributyltin. Toxicol. Sci. 91, 82–92. Marinero, M.J., Colas, B., Prieto, J.C., López-Ruiz, M.P., 1996. Different sites of action of arachidonic acid on steroidogenesis in rat Leydig cells. Mol. Cell. Endocrinol. 118 (1–2), 193–200. Miller, W.L., 1988. Molecular biology of steroid hormone synthesis. Endocr. Rev. 9, 295–318. Murugesan, P., Muthusamy, T., Balasubramanian, K., Arunakaran, J., 2007. Effects of vitamins C and E on steroidogenic enzymes mRNA expression in polychlorinated biphenyl (Aroclor 1254) exposed adult rat Leydig cells. Toxicology 232, 170–182. Nakada, N., Tanishima, T., Shinohara, H., Kiri, K., Takada, H., 2006. Pharmaceutical chemicals and endocrine disrupters in municipal wastewater in Tokyo and their removal during activated sludge treatment. Water Res. 40, 3297–3303. Ohsako, S., Kubota, K., Kurosawa, S., Takeda, K., Qing, W., Ishimura, R., Tohyma, C., 2003. Alterations of gene expression in adult male rat testis and pituitary shortly after sub-acute administration of the antiandrogen flutmide. J. Reprod. Dev. 49, 275–290. Omura, T., Morohashi, K., 1995. Gene regulation of steroidogenesis. J. Steroid Biochem. Mol. Biol. 53, 19–25. Privalle, C.T., Crivello, J.F., Jefcoate, C.R., 1983. Regulation of intramitochondrial cholesterol transfer to side-chain cleavage cytochrome P450scc in rat adrenal gland. Proc. Natl. Acad. Sci. U.S.A. 80, 702–706. Rice, S., Mason, H.D., Whitehead, S.A., 2006. Phytoestrogens and their low dose combinations inhibit mRNA expression and activity of aromatase in human granulosa-luteal cells. J. Steroid Biochem. Mol. Biol. 101, 216–225. Roy, P., Pereira, B.M.J., 2005. A treatise on hazards of endocrine disruptors and tool to evaluate them. Indian J. Exp. Biol. 43, 975–992. Sanderson, T., Vanden, B.M., 2003. Interactions of xenobiotics with the steroid hormone biosynthesis pathway. Pure Appl. Chem. 75, 1957–1971. Sharpe, R.M., Irvine, D.S., 2004. How strong is the evidence of a link between environmental chemicals and adverse effects on human reproductive health? Br. Med. J. 328, 447–451. Solomon, Y., Londos, C., Rodbell, M., 1974. A highly sensitive adenylate cyclase assay. Anal. Biochem. 58, 541–548. Stocco, D.M., Clark, B.J., 1997. The role of the steroidogenic acute regulatory protein in steroidogenesis. Steroids 62 (29), 36.

V. Kumar et al. / Toxicology 250 (2008) 124–131 Tatarazako, N., Ishibashi, H., Teshima, K., Kishi, K., Arizono, K., 2004. Effects of triclosan on various aquatic organisms. Environ. Sci. 11 (2), 133–140. Vuorento, T., Lahti, A., Hovatta, O., Huhtaniemi, I.T., 1989. Daily measurements of salivary progesterone reveal a high rate of anovulation in healthy students. Scand. J. Clin. Lab. Invest. 49, 395–401.

131

West, L.A., Horvat, R.D., Roess, D.A., Barisas, B.G., Juengel, J.L., Niswender, G.D., 2001. Steroidogenic acute regulatory protein and peripheral-type benzodiazepine receptor associate at the mitochondrial membrane. Endocrinology 142, 502–505.