Sqstm1 in activation of Nrf2 during xenophagy

FEBS Letters 588 (2014) 822–828

journal homepage: www.FEBSLetters.org

Dissection of the role of p62/Sqstm1 in activation of Nrf2 during xenophagy Ryosuke Ishimura a, Keiji Tanaka b, Masaaki Komatsu a,c,⇑ a

Protein Metabolism Project, Tokyo Metropolitan Institute of Medical Science, Tokyo 156-8506, Japan Laboratory of Protein Metabolism, Tokyo Metropolitan Institute of Medical Science, Tokyo 156-8506, Japan c Department of Biochemistry, School of Medicine, Niigata University, Niigata 951-8510, Japan b

a r t i c l e

i n f o

Article history: Received 21 October 2013 Revised 3 January 2014 Accepted 15 January 2014 Available online 1 February 2014 Edited by Renee Tsolis Keywords: Autophagy p62 Nrf2 Keap1 Xenophagy

a b s t r a c t Upon infection of a cell by Salmonella, p62/Sqstm1 assembles on the microbes; simultaneously, p62/ Sqstm1 is phosphorylated at Ser351, leading to inactivation of Keap1, which is responsible for degrading Nrf2. Thus, cytoprotective Nrf2 targets are induced at the same time that autophagosomes entrap the microbes (xenophagy). However, the detailed role of p62/Sqstm1 during xenophagy has remained unclear. Here we show that translocation of p62/Sqstm1 to invasive Salmonella precedes Ser351 phosphorylation. Furthermore, in addition to Ser351 phosphorylation, oligomerization of p62/Sqstm1 is also required for localization of Keap1 onto microbes, which is followed by Nrf2 activation. Our data reveal the sequential dynamics of p62/Sqstm1 in response to bacterial infection. Ó 2014 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

1. Introduction p62/Sqstm1 (hereafter, p62) serves as a signaling hub for diverse cellular events such as amino-acid sensing, the oxidative stress response, and immunological signaling [1]. In addition, p62 has been proposed to serve as an adaptor protein between selective autophagy and ubiquitin signaling, because it has the ability to interact with both ubiquitin chains and the autophagosomelocalizing protein LC3 through its Uba (Ubiquitin-associated domain, aa 391–436) and LIR (LC3-interacting region, aa 337–343) domains, respectively [2]. Indeed, p62 localizes on autophagic cargos including ubiquitin-positive protein aggregates, damaged mitochondria, and invasive bacterial cells, and is ultimately degraded by autophagy [3]. In addition, p62 has an N-terminal PB1 (Phox1 and Bem1p, aa 20–102) domain that is involved in selfoligomerization and is essential for efficient autophagic degradation of p62 [4,5]. The reciprocal relationship between p62’s roles as signaling hub and autophagic adaptor has not been entirely elucidated. We recently showed that p62 activates the Keap1–Nrf2 pathway [6,7], one of the major cellular defense mechanisms against oxidative and electrophilic stresses. Under normal conditions, the transcription factor Nrf2 (nuclear factor erythroid 2-related factor ⇑ Corresponding author. E-mail address: [email protected] (M. Komatsu).

2) is constitutively degraded through the ubiquitin–proteasome pathway; its binding partner, Keap1 (kelch-like ECH-associated protein 1), is an adaptor of the ubiquitin ligase complex that targets Nrf2 [8]. Exposure to electrophiles, reactive oxygen species, and nitric oxide instigates modification of the cysteine residues of Keap1, leading to its inactivation. As a result, Nrf2 is stabilized, and it subsequently translocates to the nucleus to induce the transcription of numerous cytoprotective genes through heterodimerization with small Maf proteins. p62 also regulates the Keap1– Nrf2 pathway via a non-canonical mechanism: phosphorylation of Ser351 of the KIR (Keap1-interacting region, aa 346–359) of p62 causes p62’s affinity for Keap1 to significantly increase [7]. As a result, Nrf2 is stabilized, and it then translocates to the nucleus to induce its transcriptional targets; this process is independent of modification of Keap1 by oxidants. The activation of Nrf2 through the phosphorylation of p62 occurs under conditions that induce selective autophagy. The ubiquitinated autophagic cargos, together with phosphorylated p62 and the Keap1 complex, are degraded by autophagy, leading to elimination of cytotoxic components [7,9]. However, the temporal order of translocation and of phosphorylation of p62 during selective autophagy has been not yet determined. In order to clarify the role of p62 in activation of Nrf2 during selective autophagy, we utilized Salmonella enterica serovar Typhimurium (S. typhimurium). Approximately 20% of Salmonella Typhimurium invading through endocytosis rupture the endosome,

http://dx.doi.org/10.1016/j.febslet.2014.01.045 0014-5793/Ó 2014 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

R. Ishimura et al. / FEBS Letters 588 (2014) 822–828

which becomes a trigger for not only ubiquitination but also for recruitment of adaptor proteins such as p62 followed by their elimination by autophagy (xenophagy) [10–12]. This bacterium has been used extensively to study xenophagic pathways. In this study, we generated p62-deficient cells that express GFP-tagged wild-type or mutant p62, and examined the effect of p62 oligomerization and ubiquitin-chain binding on Nrf2 activation during infection by S. typhimurium. 2. Materials and methods 2.1. Cell culture MEFs (mouse embryonic fibroblasts) were prepared as described previously [5]. Immortalized MEFs were established by infecting MEFs with a recombinant retrovirus carrying a temperature-sensitive simian virus 40 large T antigen. MEFs were grown in Dulbecco’s modified Eagle medium (DMEM) containing 10% fetal bovine serum, 5 U/ml penicillin, and 50 lg/ml streptomycin. Tetracycline-regulated GFP-p62–expressing cell lines were generated using a reverse tet-regulated retroviral vector, as previously reported [5]. To induce expression of wild-type or mutant p62, cells were treated with 250 ng/ml of doxycycline (Dox, Sigma) for 24 h. 2.2. Bacterial infection and colony-formation assay Salmonella enterica serovar Typhimurium SR-11 x3181, used as the wild-type strain, was cultured routinely in supplemented lysogeny broth (LB) [13]. Bacteria were grown overnight at 37 °C, diluted 1:33, and then subcultured for 3 h in LB without antibiotics. The bacterial inocula were prepared by pelleting at 10 000  g for 2 min, and then added to host cells at multiplicities of infection of 1000 at 37 °C in an atmosphere containing 5% CO2. Colony-formation assays were performed as previously described [7,13]. 2.3. Immunological analyses Nuclear fractions from cells were prepared using the NE-PER Nuclear and Cytosolic Extraction Reagents (Thermo Scientific). Samples were separated using the NuPAGE system (Invitrogen) on 12% Bis-Tris gels in MOPS-NuPAGE buffer, and then transferred to polyvinylidene difluoride (PVDF) membranes. Antibodies against p62 (Progen Biotechnik, GP62-C), Keap1 (Proteintech Group, Inc.), ubiquitin (Santa Cruz Biotechnology, Inc., P4D1), actin (Chemicon International, Inc., MAB1501R), GFP (Invitrogen), Lamin B (Santa Cruz Biotechnology, Inc., M-20), and Nrf2 (Santa Cruz Biotechnology, Inc., H-300) were purchased from the indicated suppliers. Anti–phosphorylated p62 polyclonal antibody was raised in rabbits using the peptide Cys + KEVDP(pS)TGELQSL as an antigen [7]. Immunoprecipitation was conducted as described previously [14]. 2.4. Immunocytochemistry MEFs grown on coverslips were fixed in 4% paraformaldehyde in PBS for 10 min, permeabilized with 0.1% Triton X-100 in PBS for 5 min, blocked with 0.1% (w/v) gelatin (Sigma–Aldrich) in PBS for 30 min, and then incubated overnight with primary antibodies against p62 (Progen Biotechnik, GP62-C) and/or phosphorylated p62. After washing, cells were incubated with Alexa Fluor–conjugated goat anti–guinea pig and/or anti–rabbit IgG secondary antibodies (Invitrogen) for 60 min. Cells were imaged using a confocal laser-scanning microscope (Olympus, Inc., FV1000) with a UPlanSApo 100  NA 1.40 oil objective lens. Z-projection stack images were acquired with z steps of 0.5 lm. Image contrast and

823

brightness were adjusted using Photoshop CS4 (Adobe Systems, Inc.). 2.5. Quantitative real-time PCR (qRT-PCR) Using the Transcriptor First-Strand cDNA Synthesis Kit (Roche Applied Science), cDNA was synthesized from 1 lg of total RNA. Quantitative PCR was performed using LightCyclerÒ 480 Probes Master mix (Roche Applied Science) on a LightCyclerÒ 480 (Roche Applied Science). Signals were normalized to b-glucuronidase (Gus). The sequences of the primers used were as follows: Ho-1 Left, GGTCAGGTGTCCAGAGAAGG; Ho-1 Right, CTTCCAGGGCCGTGTAGATA; Gus Left, CTCTGGTGGCCTTACCTGA; and Gus Right, CTCAGTTGTTGTCACCTTCACC. 3. Results and discussion 3.1. Significance of each domain of p62 on its degradation The p62 protein contains an N-terminal region that includes the PB1 and zinc finger domains (aa 122–167), a central region containing the LIR and KIR, and a C-terminal region encompassing the UBA (Fig. 1A). Double mutation of Lys7 and Asp69 of the PB1 domain to Ala (K7A/D69A) prevents self-oligomerization [4]. A phosphorylation-mimetic mutant in which Ser351 of the KIR is substituted with Glu (S351E) has higher affinity for endogenous Keap1 than either wild-type p62 or the phosphorylation-defective S351A mutant [7]; however, replacement of Thr352 with Ala (T352A) abolishes the p62–Keap1 interaction [6]. Mutation of Phe408 of the Uba domain to Val (F408V) disrupts the capacity of p62 to associate with endogenous ubiquitinated proteins [15]. Initially, to determine the importance of each domain in the autophagic degradation of p62, we generated p62-knockout MEFs in which GFP-tagged wildtype or mutant p62 proteins can be transiently expressed in response to Dox (doxycycline). Wild-type and mutant GFP-p62 proteins were efficiently expressed in these MEFs upon treatment with Dox for 24 h (Fig. 1B). Immunoblot analysis with anti-GFP antibody revealed significantly lower levels of free GFP in cells expressing K7A/D69A (Fig. 1B), implying insufficient degradation of this mutant protein in lysosomes. We characterized each p62 mutant by immunoprecipitation and immunoblot analysis (Fig. 1C). Removal of Dox markedly decreased the expression of wildtype GFP-p62 in p62 / MEFs after 6 h, and only small amounts of GFP-p62 (31.2%) remained 18 h after removal of Dox (Fig. 1D, E and Fig. S1). The degradation rates of the S351E, S351A, and T352A mutants were similar to that of wild-type p62 (Fig. 1D, E and Fig. S1). By contrast, when a mutant form of GFP-p62 that is defective in oligomerization was expressed in p62 / MEFs, the rates of the degradation were much slower than that of wild-type p62 (Fig. 1D, E and Fig. S1). The percentage of K7A/D69A protein remaining 18 h after removal of Dox was 70.5% (Fig. 1E). In addition, the degradation of the F408V mutant tended to be delayed, although the effect was not statistically significant (Fig. 1D, E and Fig. S1). We did not observe any puncta in cells expressing K7A/ D69A (data not shown), consistent with previous findings that oligomerization is crucial for localization of p62 on sites of autophagosome formation [16,17]. These results suggest that oligomerization of p62 is necessary for its degradation through autophagy under normal culture conditions. 3.2. Effect of defective oligomerization and impaired ubiquitin-binding of p62 on the phosphorylation of Ser351 during xenophagy In the next series of experiments, we examined whether defective oligomerization or impaired ubiquitin-chain binding has an

824

R. Ishimura et al. / FEBS Letters 588 (2014) 822–828

A

346

wild-type

KIR

391

PB1 20

Zinc 102 122

D

359

GFP-p62

436

UBA

167 337

LIR

Chase

343

PB1

Zinc

S351E 64

p62

UBA

D69A

64

GFP-p62

Phosphorylation-mimetic mutant PB1

S351A

GFP-p62

Oligomerization-defective mutant K7A

WT

0 6 12 18 0 6 12 18 0 6 12 18 (h)

Zinc

GFP

UBA S351E

39

Phosphorylation-defective mutant PB1

Zinc

UBA

Actin

(kDa)

S351A

Keap1 interaction-defective mutant PB1

Zinc

UBA

PB1

Zinc

T352A

GFP-p62

T352A

Chase

Ubiquitin-chain binding defective mutant UBA

F408V

0 6 12 18 0

K7A D69A

6 12 18 0 6 12 18 (h) 64

GFP-p62

F408V

p62 64

GFP-p62

B

wild-type -

GFP-p62 Doxycyclin -

+

-

+

p62 KO K7A WT S351A S351E T352A F408V D69A - + - + - + - + - + - +

GFP-p62

GFP 39

Actin 64

(kDa)

E

51

p62 GFP-p62

64 51 39 28

GFP GFP

wild-type GFP -p62

p62 KO

wild-type

100

* 80

p62 KO

*

60 40 20 0

0

6

GFP-p62 WT GFP-p62 S351A GFP-p62 S351E

WT S351A S351E T352A F408V K7A D69A WT S351A S351E T352A F408V K7A D69A

C

39 (kDa)

Actin

Degradation rate of GFP-p62 (%)

p62

12

18

(h)

G GFP-p62 T352A GFP-p62 F408V GFP-p62 K7A D69A

64

p62

51

p62 (p-S351)

64 51

Keap1

64 191 97 64 51 39

Ubiquitin

28 19 14

Actin

39

Lysate

IP:GFP(p62)

(kDa)

(kDa)

Fig. 1. Turnover of p62 mutants. (A) Domain structure of p62 and the mutants used in this study. (B) MEFs were cultured for 24 h in the presence or absence of Dox. Cell lysates were then subjected to NuPAGE, followed by immunoblotting with the indicated antibodies. Data are representative of three separate experiments. (C) Immunoprecipitation assay. Anti-GFP immunoprecipitates were subjected to immunoblot analysis with antibodies against p62, phospho-p62 (S351), Keap1, and ubiquitin. (D) MEFs were cultured for 24 h in the presence of Dox to induce expression of GFP-p62 or mutants. Subsequently, the cells were cultured in the absence of Dox and lysed at the indicated times. The cell lysates were then subjected to NuPAGE, followed by immunoblotting with the indicated antibodies. Data are representative of three separate experiments. (E) Quantitative densitometry of immunoblotting data shown in (D) and the ratios of p62 relative to actin. Immunoblots were performed in triplicate. Data are means ± S.E. of three determinations. ⁄P < 0.05.

825

R. Ishimura et al. / FEBS Letters 588 (2014) 822–828

xenophagy [19]. Thus, localization of p62 on ubiquitin-positive structures, rather the adaptor function related to selective autophagy, might be responsible for Nrf2 activation. 3.3. Localization of Keap1 to invasive S. typhimurium in p62-knockout MEFs harboring each p62 mutant As reported recently [7], immunofluorescence analysis showed that not only endogenous p62 but also GFP-p62 expressed in p62-deficient MEFs were translocated to invasive S. typhimurium (Fig. 3A). Approximately 20% of the bacteria were positive for p62 or GFP-p62 (Fig. 3B). We also observed localization of S351A, S351E, and T352A on the S. typhimurium to the same extent as wild-type p62 (Fig. 3A and B). In agreement with biochemical results (Fig. 2A), endogenous p62, GFP-p62, and S351E were labeled by phospho-Ser351 specific antibody, whereas S351A and T352A were not (Fig. 3A and B). K7A/D69A still localized onto the microbe, probably due to its ability to associate with ubiquitinated proteins (Fig. 1C), but was not subject to phosphorylation (Fig. 3A and B). Meanwhile, F408V did not localize onto bacteria at all (Fig. 3A and B). Next, to investigate translocation of Keap1 induced by Ser351 phosphorylation of p62 to invasive S. typhimurium, we introduced mCherry-tagged Keap1 into wild-type or p62-knockout MEFs harboring either wild-type or mutant p62. Wild-type MEFs exhibited recruitment of mCherry-Keap1 onto p62-positive S. typhimurium, and loss of p62 completely inhibited this shift (Fig. 3C). As predicted, this transfer of mCherry-Keap1 occurred in parallel with phosphorylation of p62 at Ser351: specifically, expression of GFP-p62 wild-type and S351E reversed the inhibition

B

p62

51

p62 GFP-p62

20000

10000

0 GFP -p62

64 51 39

Atg7 KO

p62 KO

wild-type

C

-

64

K7A D69A

GFP-p62

30000

F408V

+

T352A

-

40000

S351E

+

p62 KO K7A WT S351A S351E T352A F408V D69A - + - + - + - + - + - +

WT

-

S351A

Infection -

-

-

wild-type GFP-p62

50000

Bacterial uptake estimated by CFA (The number of colonies)

A

-

impact on phosphorylation of p62 at Ser351 during xenophagy. Upon S. typhimurium infection of p62-deficient MEFs expressing GFP-p62, phosphorylation of Ser351 markedly increased (Fig. 2A and Fig. S2). Phosphorylation of endogenous p62 at Ser351 in wild-type MEFs was also induced by infection (Fig. 2A and Fig. S2). By contrast, neither F408V nor K7A/D69A was phosphorylated at Ser351 (Fig. 2A and Fig. S2), indicating that interaction with ubiquitinated proteins and oligomerization of p62 are necessary for phosphorylation of Ser351 during xenophagy. Immunoblot analysis with anti-GFP antibody revealed that even in the MEFs expressing GFP-fused wild-type p62, the amount of free GFP hardly increased upon infection of S. typhimurium (Fig. 2A and Fig. S2), suggesting that a small amount of p62 is targeted to the S. typhimurium and degraded by autophagy. On the other hand, p62-deficient MEFs exhibited the uptake of S. typhimurium as well as the intracellular growth to the same extent as wild-type MEFs, regardless of the expression of p62 mutants (Fig. 2B, C and Fig. S3). Consistent with previous report [10], autophagy-incompetent MEFs (Atg7knockout MEFs) were more permissive for intracellular growth by S. Typhimurium than wild-type and p62-knockout MEFs (Fig. 2C). In contrast to our observations, a previous study reported that knockdown of p62 enhances efficiency of intracellular replication of S. typhimurium [11]. These conflicting observations might be attributed to methodological differences; alternatively, other adaptors such as Nbr1 might compensate for the lack of p62 during cargo recognition [18]. Very recently, Fujita et al. reported that core Atg proteins such as Atg16 and FIP200 directly interact with ubiquitinated endosomal proteins when S. typhimurium within endosomes rupture endosomal membranes, a process that drives

35 30

28

GFP GFP GFP-p-p62 64 51

p62(p-S351)

15 10 5

wild-type

p62 KO

-

K7A D69A

F408V

T352A

1 8 1 8 1 8 1 8 1 8 1 8 1 8 1 8 1 8 S351E

GFP -p62

WT

0

S351A

39 (kDa)

-

Actin

20

-

* p-p62

Fold-replication

25

Atg7 KO

Fig. 2. Effect of each p62 mutant on phosphorylation of p62 at Ser351 during xenophagy. (A) MEFs were cultured for 24 h in the presence of Dox to induce expression of GFPp62 or mutants. Next, the MEFs were infected with S. typhimurium for 20 min, and then washed to remove the inoculum. After 6 h, whole-cell lysates were prepared and subjected to immunoblot analyses with the indicated antibodies. Our phospho-Ser351–specific antibody cross-reacted with S351E, but not S351A or T352A. Data are representative of three independent experiments. Asterisk indicates a non-specific band. (B) Bacterial uptake was quantified by CFA. MEFs expressing GFP-p62 or mutants were infected with S. typhimurium, and then washed to remove the inoculum. After 1 h, the MEFs were lysed, and the cell lysates were plated on LB agar. The number of colonies was counted after a 24-h incubation at 37 °C. The means ± S.E. of three independent experiments are shown. (C) Growth of S. typhimurium after cell invasion. After infection, MEFs harboring the indicated p62 mutant were washed to remove extracellular S. typhimurium, and then lysed at the indicated time points post-infection. The cell lysates were plated on LB agar, and the number of colonies was counted after a 24-h incubation at 37 °C. For purposes of normalization, the number of colonies from wildtype MEFs after a 1 h infection was defined as 1. The means ± S.E. of three independent experiments are shown. ⁄⁄⁄P < 0.001.

R. Ishimura et al. / FEBS Letters 588 (2014) 822–828

GFP -p62

B

p62 KO

wild-type -

WT

-

S351A

S351E

T352A

F408V K7A D69A p62-positive Salmonella (%)

Hoechest

20 15

GFP

Hoechest p62

100

25

p-S351 positive Salmonella /p62 positive Salmonella (%)

A

WT

-

S351A

S351E

T352A

F408V K7A D69A

Hoechest mCherry -Keap1 Merged

p62 mCherry -Keap1

20 0

GFP -p62

wild-type p62 KO

100

GFP

Hoechest

-

40

D

p62 KO

Merged

-

wild-type p62 KO

wild-type

GFP -p62

WT S351A S351E T352A F408V K7A D69A

0

GFP -p62

60

80 60 40 20 0

WT S351A S351E T352A K7A D69A

C

5

mCherry-Keap1 positive Salmonella /p62 positive Salmonella (%)

p62 Merged (p-S351)

p62 Merged (p-S351)

10

80

WT S351A S351E T352A K7A D69A

826

GFP -p62

wild-type p62 KO

E

p62 KO

wild-type

GFP-p62

-

-

WT

S351A

S351E

Infection 0 1 3 6 0 1 3 6 0 1 3 6 0 1 3 6 Nrf2

T352A

F408V

K7A D69A

0 1 3 6 0 1 3 6 0 1 3 6 0 1 3 6 (h) 64

Nrf2 LaminB LaminB

F

4

* **

*

3.5 Relative mRNA (Ho-1)

64 (kDa)

*

3

*

**

2.5 2 1.5 1 0.5

F408V K7A D69A

T352A

S351E

S351A

-

wild-type

WT

GFP -p62

-

0 Infection - + - + - + - + - + - + - + - +

p62 KO

Fig. 3. Effect of each p62 mutant on translocation of Keap1 to invasive S. typhimurium. (A) MEFs were cultured for 24 h in the presence of Dox to induce expression of GFP-p62 or mutants. Next, the MEFs were infected with S. typhimurium for 20 min, and then washed to remove the inoculum. After 6 h, MEFs were immunostained with anti-p62 antibody. In the case of wild-type MEFs, we conducted double immunostaining with antibodies against p62 and p62 phosphorylated at Ser351. Scale bars, 10 lm. (B) The percentages of bacteria positive for p62 and of p62-positive bacteria detected by p-S351 antibody were determined by fluorescence microscopy shown in (A). The average ± S.E. is shown for three independent experiments where at least 100 bacteria were counted. (C) mCherry-tagged Keap1 was introduced into wild-type or p62knockout MEFs harboring either GFP-tagged wild-type or mutant p62. The MEFs were treated as shown in (A) and then observed by fluorescence microscopy. In the case of wild-type MEFs, we immunostained with anti-p62 antibody. Scale bars, 10 lm. (D) The percentage of the p62-positive bacteria associated with mCherry-Keap1 was determined by fluorescence microscopy shown in (C). The average ± S.E. is shown for three independent experiments where at least 100 bacteria were counted. (E) Immunoblot analysis during xenophagy. Wild-type and p62-deficient MEFs harboring a series of p62 mutants were inoculated with S. typhimurium as in (A). Thereafter, nuclear fractions were prepared at the indicated time points and subjected to immunoblot analyses with the antibodies specified. Data are representative of three independent experiments. (F) Quantitation of mRNA levels of the Nrf2 target gene Ho-1 in wild-type and p62-knockout MEFs harboring a series of p62 mutants. Values were normalized to the amount of mRNA in non-infected wild-type MEFs. Data are means ± S.E. of three experiments. ⁄P < 0.05 and ⁄⁄P < 0.01.

827

R. Ishimura et al. / FEBS Letters 588 (2014) 822–828

p62 TBK1

P S403 p62 Ub S. typhimurium

Ub

p62 mTORC1 p62 and/or P unknown kinase Ub S. typhimurium

Ub P p62 p62

p62 P p62 P Ub

S351 P

Nrf2 Keap1

S. typhimurium

Ub P p62 P p62 P

p62 Keap1 P p62 P Keap1 P Ub S. typhimurium

Nrf2

Ub P p62 Keap1 P p62 P Keap1

Activation Fig. 4. Schematic model of Nrf2 activation through phosphorylation of p62 during xenophagy. Ub, ubiquitin; TBK1, TANK-Binding Kinase 1; mTORC1, mammalian target of rapamycin complex 1.

(Fig. 3C and D). Finally, we examined whether Nrf2-activation in response to infection with S. typhimurium was restored by introduction of wild-type p62 or mutants into p62-deficient MEFs. As expected, upon infection with S. typhimurium, wild-type but not p62-deficient MEFs exhibited nuclear accumulation of Nrf2 and induction of the Nrf2 target Ho-1 (heme oxygenase-1) (Fig. 3E and F). Although the reduced levels of nuclear Nrf2 and of Ho-1 expression were significantly increased by expression of GFP-p62 or of S351E into p62 / MEFs, no such restorations were observed in cells expressing the other mutants (Fig. 3E and F). In conclusion, translocation of p62 to invasive microbes precedes phosphorylation of Ser351. Furthermore, in addition to Ser351 phosphorylation, oligomerization of p62 is also necessary for translocation of Keap1 onto p62-positive microbes; translocation is followed by robust Nrf2 activation. Taken together with previous studies [7,20,21], these results indicate that in response to infection by microbes, Ser403 of the p62 UBA is initially phosphorylated by TANK-Binding Kinase 1 (TBK1), which promotes the translocation of p62 to microbes positive for ubiquitin (Fig. 4). Subsequently, Ser351 of the p62 KIR is phosphorylated, followed by sequestration of Keap1 on the microbes (Fig. 4). At that time, oligomerization of p62 is indispensable for phosphorylation at Ser351; the oligomerization might be necessary for recognition of p62 by a responsible kinase. As a result, Nrf2 is stabilized, and it then translocates into the nucleus to induce cytoprotective Nrf2 targets. Collectively, our results reveal a mechanism for activation of Keap1–Nrf2 system via p62, with invasive microbes serving as scaffolds. Although we did not realize any difference between wild-type and p62-knockout MEFs in the Salmonella growth (Fig. 2C and Fig. S3), this might be at least partly attributed to a property of host cells (i.e., MEFs) used in this study. As shown in Fig. 3B and D, a fraction of Salmonella invading into MEFs, approximately 20%, were positive for p62, p-S351-p62 and Keap1, which might be insufficient for realization of the physiological consequences. Further analysis with more specific cells such as macrophages will reveal the physiological significance. Very recently, we reported that in macrophages lacking Atg7, an essential gene for autophagy, accumulated p62 activates Nrf2 and thereby induces expression of Nrf2 targets genes encoding the scavenger receptors MARCO and MSR1, resulting in increased phagocytosis of Mycobacterium tuberculosis [22]. However, the physiological role of this pathway, by which uptake of microbes is enhanced under defective autophagy, remains unclear. Initially, as we propose here, infection of M. tuberculosis should cause Nrf2 activation through Ser351 phosphorylation of p62 on Ser351.

According to our earlier report [22], Nrf2 activation in macrophages induces gene expression of scavenger receptors, leading to an increased number of M. tuberculosis in phagosomes. At the same time, Nrf2 may activate expression of enzymes related to the pentose phosphate pathway (PPP) to generate nicotinamide adenine dinucleotide phosphate, which increases the level of reactive oxygen species in phagosomes through activation of NADPH oxidase, ultimately leading to sterilization. Indeed, Nrf2 regulates expression of enzymes involved in the PPP in cancer cells [23]. Further analysis will clarify the complex physiological role of Nrf2 activation by p62. Acknowledgments This work was supported by a Grant-in-Aid for Scientific Research on Innovative Areas (25111006) and a Grant from the Funding Program for Next Generation World-Leading Researchers (LS132). Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.febslet. 2014.01.045. References [1] Moscat, J. and Diaz-Meco, M.T. (2009) P62 at the crossroads of autophagy, apoptosis, and cancer. Cell 137, 1001–1004. [2] Johansen, T. and Lamark, T. (2011) Selective autophagy mediated by autophagic adapter proteins. Autophagy 7, 279–296. [3] Mizushima, N. and Komatsu, M. (2011) Autophagy: renovation of cells and tissues. Cell 147, 728–741. [4] Lamark, T., Perander, M., Outzen, H., Kristiansen, K., Overvatn, A., Michaelsen, E., Bjorkoy, G. and Johansen, T. (2003) Interaction codes within the family of mammalian Phox and Bem1p domain-containing proteins. J. Biol. Chem. 278, 34568–34581. [5] Ichimura, Y., Kumanomidou, T., Sou, Y.S., Mizushima, T., Ezaki, J., Ueno, T., Kominami, E., Yamane, T., Tanaka, K. and Komatsu, M. (2008) Structural basis for sorting mechanism of p62 in selective autophagy. J. Biol. Chem. 283, 22847–22857. [6] Komatsu, M., Kurokawa, H., Waguri, S., Taguchi, K., Kobayashi, A., Ichimura, Y., Sou, Y.S., Ueno, I., Sakamoto, A., Tong, K.I., Kim, M., Nishito, Y., Iemura, S., Natsume, T., Ueno, T., Kominami, E., Motohashi, H., Tanaka, K. and Yamamoto, M. (2010) The selective autophagy substrate p62 activates the stress responsive transcription factor Nrf2 through inactivation of Keap1. Nat. Cell Biol. 12, 213–223. [7] Ichimura, Y., Waguri, S., Sou, Y.S., Kageyama, S., Hasegawa, J., Ishimura, R., Saito, T., Yang, Y., Kouno, T., Fukutomi, T., Hoshii, T., Hirao, A., Takagi, K., Mizushima, T., Motohashi, H., Lee, M.S., Yoshimori, T., Tanaka, K., Yamamoto,

828

[8]

[9]

[10]

[11]

[12]

[13]

[14]

[15]

R. Ishimura et al. / FEBS Letters 588 (2014) 822–828 M. and Komatsu, M. (2012) Phosphorylation of p62 activates the Keap1-Nrf2 pathway during selective autophagy. Mol. Cell 51, 618–631. Taguchi, K., Motohashi, H. and Yamamoto, M. (2011) Molecular mechanisms of the Keap1-Nrf2 pathway in stress response and cancer evolution. Genes Cells 16, 123–140. Taguchi, K., Fujikawa, N., Komatsu, M., Ishii, T., Unno, M., Akaike, T., Motohashi, H. and Yamamoto, M. (2012) Keap1 degradation by autophagy for the maintenance of redox homeostasis. Proc. Natl. Acad. Sci. USA 109, 13561– 13566. Birmingham, C.L., Smith, A.C., Bakowski, M.A., Yoshimori, T. and Brumell, J.H. (2006) Autophagy controls Salmonella infection in response to damage to the Salmonella-containing vacuole. J. Biol. Chem. 281, 11374–11383. Zheng, Y.T., Shahnazari, S., Brech, A., Lamark, T., Johansen, T. and Brumell, J.H. (2009) The adaptor protein p62/SQSTM1 targets invading bacteria to the autophagy pathway. J. Immunol. 183, 5909–5916. Cemma, M., Kim, P.K. and Brumell, J.H. (2011) The ubiquitin-binding adaptor proteins p62/SQSTM1 and NDP52 are recruited independently to bacteriaassociated microdomains to target Salmonella to the autophagy pathway. Autophagy 7, 341–345. Kageyama, S., Omori, H., Saitoh, T., Sone, T., Guan, J.L., Akira, S., Imamoto, F., Noda, T. and Yoshimori, T. (2011) The LC3 recruitment mechanism is separate from Atg9L1-dependent membrane formation in the autophagic response against Salmonella. Mol. Biol. Cell 22, 2290–2300. Tatsumi, K., Yamamoto-Mukai, H., Shimizu, R., Waguri, S., Sou, Y.S., Sakamoto, A., Taya, C., Shitara, H., Hara, T., Chung, C.H., Tanaka, K., Yamamoto, M. and Komatsu, M. (2011) The Ufm1-activating enzyme Uba5 is indispensable for erythroid differentiation in mice. Nat. Commun. 2, 181. Seibenhener, M.L., Babu, J.R., Geetha, T., Wong, H.C., Krishna, N.R. and Wooten, M.W. (2004) Sequestosome 1/p62 is a polyubiquitin chain binding protein involved in ubiquitin proteasome degradation. Mol. Cell. Biol. 24, 8055–8068.

[16] Bjorkoy, G., Lamark, T., Brech, A., Outzen, H., Perander, M., Overvatn, A., Stenmark, H. and Johansen, T. (2005) P62/SQSTM1 forms protein aggregates degraded by autophagy and has a protective effect on huntingtin-induced cell death. J. Cell Biol. 171, 603–614. [17] Itakura, E. and Mizushima, N. (2011) P62 Targeting to the autophagosome formation site requires self-oligomerization but not LC3 binding. J. Cell Biol. 192, 17–27. [18] Kirkin, V., McEwan, D.G., Novak, I. and Dikic, I. (2009) A role for ubiquitin in selective autophagy. Mol. Cell 34, 259–269. [19] Fujita, N., Morita, E., Itoh, T., Tanaka, A., Nakaoka, M., Osada, Y., Umemoto, T., Saitoh, T., Nakatogawa, H., Kobayashi, S., Haraguchi, T., Guan, J.L., Iwai, K., Tokunaga, F., Saito, K., Ishibashi, K., Akira, S., Fukuda, M., Noda, T. and Yoshimori, T. (2013) Recruitment of the autophagic machinery to endosomes during infection is mediated by ubiquitin. J. Cell Biol. 203, 115–128. [20] Matsumoto, G., Wada, K., Okuno, M., Kurosawa, M. and Nukina, N. (2011) Serine 403 phosphorylation of p62/SQSTM1 regulates selective autophagic clearance of ubiquitinated proteins. Mol. Cell 44, 279–289. [21] Pilli, M., Arko-Mensah, J., Ponpuak, M., Roberts, E., Master, S., Mandell, M.A., Dupont, N., Ornatowski, W., Jiang, S., Bradfute, S.B., Bruun, J.A., Hansen, T.E., Johansen, T. and Deretic, V. (2012) TBK-1 promotes autophagy-mediated antimicrobial defense by controlling autophagosome maturation. Immunity 37, 223–234. [22] Bonilla, D.L., Bhattacharya, A., Sha, Y., Xu, Y., Xiang, Q., Kan, A., Jagannath, C., Komatsu, M. and Eissa, N.T. (2013) Autophagy regulates phagocytosis by modulating the expression of scavenger receptors. Immunity 39, 537–547. [23] Mitsuishi, Y., Taguchi, K., Kawatani, Y., Shibata, T., Nukiwa, T., Aburatani, H., Yamamoto, M. and Motohashi, H. (2012) Nrf2 redirects glucose and glutamine into anabolic pathways in metabolic reprogramming. Cancer Cell 22, 66–79.