Distinct gene expression profiles in adult rat brains after acute MK-801 and cocaine treatments

European Neuropsychopharmacology (2006) 16, 211 — 219

www.elsevier.com/locate/euroneuro

Distinct gene expression profiles in adult rat brains after acute MK-801 and cocaine treatments Markus Storvik, Pekka Tiikkainen, Martijn van Iersel, Garry Wong* Department of Neurobiology, A.I. Virtanen Institute, and Department of Biochemistry, University of Kuopio, P.O. Box 1627, Kuopio 70211, Finland Received 10 May 2005; received in revised form 27 July 2005; accepted 23 August 2005

KEYWORDS MK-801; Cocaine; Gene expression; Microarray; Glutamate; Dopamine; Addiction

Abstract Uncompetitive N-methyl-d-aspartate (NMDA) receptor antagonists have been suggested to attenuate the self-administration and rewarding effects of psychostimulants. Microarrays containing 14,500 rat cDNAs were hybridized to identify alterations in gene expression levels in rat brain regions elicited by the uncompetitive NMDA receptor antagonist MK-801 (dizocilpine, 1 mg/kg), the dopamine agonist cocaine (20 mg/kg), or combined treatment (MK-801 15 min prior to cocaine) 4 h after injections. Total genes up regulated (Zratio N 2) in parietal cortex and nucleus accumbens were 111 and 158, respectively. Total genes down regulated (Z-ratio b 2) in the same tissues were 360 and 166, respectively. These genes fell into multiple molecular function gene ontology (GO) categories, but were highly represented in catalytic activities (44% of all genes), signal transduction (14%), protein (20%), nucleotide (18%), and nucleic acid (15%) binding. In nucleus accumbens, genes up regulated by MK-801 (87 genes) did not overlap those up regulated by cocaine (46 genes). Genes down regulated by MK-801 (33 genes) consisted of 2 overlapping genes with those down regulated by cocaine (89 genes). In parietal cortex, low numbers of overlapping regulated genes were also observed. Combined treatments also indicated low numbers (0—10) of genes commonly regulated when compared with single treatments alone. In situ hybridisation studies indicated significant increases in b-ZIP transcription factors (CREM, ICER, CBP, and c-fos) elicited by MK-801 and decreases in c-fos elicited by cocaine. The results indicate independent gene expression signatures following acute MK-801 and cocaine administration that appears to be largely non-overlapping and context dependent. D 2005 Elsevier B.V. and ECNP. All rights reserved.

1. Introduction * Corresponding author. Tel.: +358 17 162 108; fax: +358 17 163 030. E-mail address: [email protected] (G. Wong).

Use of addictive drugs leads to short and long-term alterations in brain neurochemistry. These changes require gene transcription that is regulated by multiple transcrip-

0924-977X/$ - see front matter D 2005 Elsevier B.V. and ECNP. All rights reserved. doi:10.1016/j.euroneuro.2005.08.007

212 tion factors including CREB (cAMP response element binding protein). CREB also modulates the reinforcing effects of cocaine and is important in memory and gating of behavioral responses to emotional stimuli (Carlezon et al., 1998; Nestler et al., 2001; Nestler, 2001; Barrot et al., 2002). Genes regulated by CREB include other transcription factors such as immediate early genes that can cause further downstream changes in gene expression (Nestler et al., 2001; McClung and Nestler, 2003). Previous studies have demonstrated alterations in CREB transcription factor level and function after acute and chronic administration of drugs of abuse. These studies suggest a prominent role for CREB in mediation of their neurochemical effects (Nestler, 1993; Konradi et al., 1996; Widnell et al., 1996; Carlezon et al., 1998; Barrot et al., 2002; Tang et al., 2003). Down regulation of CREB activity is mediated through several mechanisms including negative feedback through heterodimerization with the cAMP response element modulator (CREM) and the inducible cAMP early repressor (ICER). These b-ZIP (basic motif/leucine zipper) transcription factors are responsive to cAMP and intracellular calcium. ICER is produced from the CREM gene using an alternative promoter located internally and the translated protein product structurally contains only the leucine zipper domain. ICER heterodimerizes with CREB/ATF-1 family and AP-1 family transcription factors and represses their activity Molina et al., 1993; Della Fazia et al., 1997; Mioduszewska et al., 2003). ICER itself is induced by CREB-activity and thus acts in a negative feedback loop. While most splice forms of CREM and ICER repress transcription by heterodimerizing with phosphorylated CREB or by competitively binding to cAMP response element (CRE) sequences, the CREM(act) form activates transcription (Foulkes et al., 1991, 1992). We have previously characterized the levels of transcription factor isoforms CREM and inducible cAMP early repressor (ICER) after induction by the high affinity uncompetitive NMDA-antagonist MK-801 [(+)-5-methyl-10,11-dihydro-5Hdibenzo[a,d]cyclohepten-5,10-imine maleate] (Storvik et al., 2000). Several studies have suggested that NMDAantagonist agents might prevent development of addictive behaviors through an undetermined mechanism (Makimura et al., 1996; Popik and Skolnick, 1996; Li et al., 2000). Ibogaine, a plant alkaloid with NMDA-antagonistic properties has been shown to reduce mice morphine consumption, and cocaine self-administration has been shown to be blocked by MK-801 (Popik et al., 1995; Schenk et al., 1993). Moreover, co-administration of dextromethorphan with morphine has been shown to attenuate rewarding effects of morphine and related dopamine releases at the nucleus accumbens (Huang et al., 2003). The aim of this study was to investigate alterations in gene expression patterns in the rat brain produced by acute administration of the uncompetitive NMDA receptor antagonist MK-801 and compare this with administration of the indirect dopamine agonist cocaine. While previous studies have suggested that acute cocaine treatment can increase CREB activity (McClung and Nestler, 2003), we and others have shown that MK-801 can increase CREM/ICER activity, which opposes CREB (Konopka et al., 1998; Storvik et al., 2000). We have used cDNA microarrays to produce a large

M. Storvik et al. set of gene expression data, and confirmed results by in situ hybridizations. Expression of CREB-family transcription factors, immediate early genes, and genes altered by cocaine treatment were studied. We were able to identify several genes with altered expression in response to MK-801 and cocaine treatment. These molecules play a role in neuronal activity, neuronal plasticity, adaptive responses and addictive behaviors. The lack of overlap between gene expression profiles elicited by acute administration of each agent alone suggests distinct transcriptional program responses. The lack of overlap between combined and single treatments suggests that the transcriptional responses of single agents are context dependent. The characterization of all of these gene changes may lead to better understanding of the neurochemical dynamics underlying the effects of uncompetitive NMDA receptor antagonists and their relationship with cocaine.

2. Experimental approaches 2.1. Experimental animals Male Wistar rats (initial weight 180—240 g, National Laboratory Animal Center, University of Kuopio, Finland) were kept under standard conditions. All animal treatments were approved by the local experimental animal committee, and have been carried out in accordance with guidelines of the Society for Neuroscience. The dose of MK-801 was chosen based on previous reports that 1 mg/kg is sufficient to block specifically NMDA receptors (Wong et al., 1986). Although the dose is high, it does not yet produce toxic effects (Olney et al., 1991). The dose of cocaine (20 mg/kg) is moderate to high and previously shown to induce immediate early gene expression in rat brain and also alter brain reward functions and behavioral changes (Thiriet et al., 2000; Kenny et al., 2003a,b). Animals were injected intraperitoneally with saline (control), MK-801 (dizocilpine maleate; RBI, Natick, MA) (1 mg/kg), cocaine (Tamro, Finland) (20 mg/kg), or in a combined treatment in which MK-801 was injected 15 min prior to cocaine. Four hours after drug treatments, the rats were narcotized with CO2 and decapitated. For the microarray study, the brain regions were quickly dissected and stored in 80 8C. For the in situ study, the brains were rapidly removed, rinsed in phosphate buffered saline (pH 7.5), placed on dry ice and stored at 80 8C.

2.2. cDNA microarrays Rat microarrays (Norwegian Microarray Consortium, Trondheim, Norway) with 14,500 sequence verified cDNA clones printed in duplicate on Corning CMT Gaps II slides were used in the study.

2.3. RNA extraction, probe synthesis and hybridization Samples of frozen tissue from rat parietal cortex or nucleus accumbens were placed into TRIzol reagent (GIBCO, Langley, OK, USA), homogenized, and total RNA

Distinct gene expression profiles in adult rat brains after acute MK-801 and cocaine treatments extracted. DNA was removed by DNase I treatment (Ambion, UK). Tissues from two animals were pooled to create 3 samples from 6 animals in each treatment group. Three microarrays were used for each treatment group. Probes were synthesized from total RNA (20 cg) by reverse transcription (Amersham Biosciences, Little Chalfont, UK) with incorporation of Cy3 and Cy5 labeled nucleotides. Microarrays were hybridized in buffer consisting of labeled cDNAs, human Cot-1 DNA (10 cg), and yeast tRNA (20 cg) (Invitrogen, Carlsbad, CA) in 3  SSC (1  SSC; 150 mM NaCl, 15 mM sodium citrate) + 0.3% SDS in a total volume of 28 cl. Hybridization was performed at 55 8C for 18 h. The arrays were washed in 0.2  SSC with 0.1% SDS, in 0.2  SSC, and in 0.1  SSC, 3 min in each and quickly rinsed in isopropanol. The microarrays were scanned (ScanArray 5000, Packard Bioscience, Meriden, CT) and datasets were prepared by quantitating microarray spots from the image using TIGR Spotfinder software (Saeed et al., 2003).

2.4. Microarray data analysis Microarray datasets were evaluated using spreadsheet and GeneSpring 6.0 (Silicon Genetics, CA, U.S.A.) software. The data points that were present in at least four of six replicate spots were taken to further analysis. The original dataset contained a high number of low-expressed genes. The lowest-expressing genes, representing ~20% of all genes, were removed from the analysis using a cutoff defined by unspecific binding determined using arabidopsis spike controls printed on the microarrays. Datasets were normalized by the LOWESS method (Workman et al., 2002) and the deviation between replicates was used as a quality control measure. The threshold for significant up and down regulation was based on the variance of the dataset using the modified Ztransformation method, which made it possible to compare differentially expressed datasets (Vawter et al., 2002; Kim et al., 2003; Cheadle et al., 2003). The fold ratios of individual chips were averaged in Z-transformation. The genes of which passed the threshold of Z-ratio b 2 or N 2 by average value were then required to pass the threshold in all 3 individual replicate chips.

213

2.6. Verification of candidate genes and transcription factors using in situ hybridization Rat brains stored at 80 8C were cut into 14 cM thick sections in coronal orientation with a cryostat. Sections were mounted on Superfrost microscope slides (Mentzel Gla ¨ser, Germany) with one control treated section in addition to one or more drug treated sections on each slide. In situ hybridization was performed as described previously (Storvik et al., 2000). Briefly, the antisense oligonucleotides of rat CREB (5V-TGGCTGGGCCGCCTGGATGACCCCATGGACCTGGA), CREM (5V-CAGACTCCCTGGTGAGGCAGCCATCACCACACCTT), ICER (5V-CAGTTTCATCTCCAGTTACAGCCATGTTGGGCT), CBP (5V-AGCTCTGACAGTTGTTTATGTTTGGACGCAGCATC), c-fos (5V GCAGCGGGAGGATGACGCCTCGTAGTCCGCGTTGAAACCCGAGAA), RGS2 (5V-ACACTGGTTCTACAGCACGGCACAGCATTCACTCT), GPC19 (5V-GTTTGGTGGGTTTGAGTTGATGGGCCAGGCGAGCT) and GRIP-2 (5V-GTCGCCCGGCTCGAGGGTGCCAGTCCTGTGCGCCA) mRNAs were 3Vend labeled to a specific activity of 1—3  107 cpm/pmol using terminal deoxynucleotidyl transferase (Finnzymes, Espoo, Finland) and a 20 : 1 molar ratio of a-[33P]-dATP (3000 Ci/mmol, New England Nuclear, Boston, MA) to probe. Hybridization was performed for 21 h at 42 8C on paraformaldehyde postfixed sections in the presence of 1—2  103 cpm/cl of labeled probe in buffer containing 50% formamide, 4  SSC) and 10% dextran sulfate. After incubation, the sections were washed and opposed to ˙max films (Amersham Life Sciences, INC., BuckHyperfilm-o ¨ inghamshire, England) for 1—3 weeks and developed for 5 min in d-19 (Kodak, France). Quantitation of optical

2.5. Microarray annotation From a total of 14,500 cDNA clones printed on the microarray, almost 7600 (52%) were unknown ESTs. Because of the high number of unidentified sequences and discovered errors in the annotations, there was a need for reannotation according to similarity in order to increase the information of the genes and functional groups. The ESTs were reannotated with comparisons against all entries in the last available release of the GenBank (#137) and EMBL (#75) sequences using the BlastN program. In order to facilitate the process, a minimalistic BLAST-parser (http://www.uku.fi/aivi/supplementary_information.htm) was written for filtering and parsing the results. The percentage of unknown ESTs diminished to 42%, similar to the level seen in EST projects (Yu et al., 2003). Reannotated ESTs here are referred to as genes.

Figure 1 Venn diagram of genes regulated by MK-801, cocaine, or combined treatments in parietal cortex or nucleus accumbens. Threshold for up and down regulation was Z-ratio score b 2 or N 2 present in all 3 biological replicates. Genelists containing ratios can be found from the supplemental data at http://www.uku.fi/aivi/supplementary_information.htm.

214

M. Storvik et al.

densities from in situ hybridization was performed using a video-based image analysis system (MCID M4, Imaging Research, Inc., St. Catharines, Ontario, Canada). The anatomical brain regions were determined according to Paxinos and Watson (Paxinos and Watson, 1986). Statistical analysis was performed with Student’s t-test or one-way analysis of variance (ANOVA) followed by Dunnett’s post hoc test.

to ubiquitin specific protease 8, secretory granule neuroendocrine protein 1, shank 1, and 3 unknown genes; from nucleus accumbens, solute carrier family 2 and regulator of G-protein signaling 5. The genes altered in each treatment group represented b 1.5% of all genes represented on the microarray. The complete lists of up and down regulated genes are available as supplementary data (http://www.uku.fi/aivi/supplementary_information.htm).

3. Results 3.2. Gene groups in different treatments 3.1. Microarray experiments In order to find trends using the information of the molecular function of the genes with altered expression, the genes were classified according to gene ontology (GO) annotation (Fig. 2). The GO term groups with the most representation from the regulated genes included genes with catalytic activities (44% of all genes), genes related to signal transduction (14%), and genes related to protein (20%), nucleotide (18%), and nucleic acid (15%) binding. A high percentage (15%) of nucleic acid binding associated genes in parietal cortex after MK-801 treatment was observed. Approximately 10% of all genes fell into this category, which was also observed in parietal cortex cocaine down regulated genes (~30% of all genes affected by the treatment). A group that was highly represented in all treatments was intracellular signal transduction genes. In nucleus accumbens, the most represented GO groups were similar to those in parietal

down-regulated genes up-regulated genes

Number of genes

12 10 8 6 4 2 0 14

E

12 10 8 6 4 2 0 14

F

antigen bind. protein bind. nucleotide bind. nucleic acid bind. metal ion bind. receptor bind. glycosaminoglycan bind. lipid bind. transferase act. hydrolase act. kinase act. ligase act. helicase act. lyase act. oxidoreductase act. small prot. conjug. act. chaperone act. enzyme regulator act. motor act. signal transducer act. structural molecule act. transcription regulator act. translation regulator act. transporter act.

Number of genes

C

14

Number of genes

Number of genes

B

D

18 16 14 12 10 8 6 4 2 0 18 16 14 12 10 8 6 4 2 0 18 16 14 12 10 8 6 4 2 0

Number of genes

Number of genes

A

down-regulated genes up-regulated genes

12 10 8 6 4 2 0 antigen bind. protein bind. nucleotide bind. nucleic acid bind. metal ion bind. receptor bind. glycosaminoglycan bind. lipid bind. transferase act. hydrolase act. kinase act. ligase act. helicase act. lyase act. oxidoreductase act. small prot. conjug. act. chaperone act. enzyme regulator act. motor act. signal transducer act. structural molecule act. transcription regulator act. translation regulator act. transporter act.

Rats were injected with saline (control), MK-801, cocaine, or both MK-801 and cocaine in a combined treatment. Brains were collected 4 h after injections. Triplicate biological replicate cDNA microarray assays were performed for each sample group (Fig. 1). Total genes up regulated (Z-ratio N 2, all 3 biological replicates) in parietal cortex and nucleus accumbens were 111 and 158, respectively. Among these, no overlapping regulated genes were observed. Total genes down regulated (Z-ratio b2, all 3 biological replicates) in parietal cortex and nucleus accumbens were 360 and 166, respectively. Among these, 7 and 2 overlapping genes were observed, in parietal cortex and nucleus accumbens, respectively. The overlapping genes down regulated were: from parietal cortex, male hormone-dependent gene, moderately similar

Figure 2 Gene ontology (GO) groups for molecular function of the regulated genes in the parietal cortex (A—C) and nucleus accumbens (D—F). GO groups were obtained and clustered with eGOn internet service. Functional categories are listed at the bottom and number of genes on the side. The treatments are as indicated: A,D) MK-801; B,E) MK-801 + cocaine; C,F) cocaine.

Distinct gene expression profiles in adult rat brains after acute MK-801 and cocaine treatments Cocaine

cortex, but the ratios of the up regulated and down regulated were different between the regions (Fig. 2).

220

MK-801

8

200

3.3. In situ hybridization of CREB-related transcription factors % of saline

160 140

8

120 100

8

80 60 40 20 0 CREM

ICER

CREB

CBP

c-fos

Figure 4 Quantitation of in situ autoradiograms. Autoradiographic films were obtained as described in Experimental approaches. Values represent percent of control (saline treated) F standard error quantitated from parietal cortex. Data were obtained from 6 independent rat sample brains. Statistical analysis was performed with one-way analysis of variance (ANOVA) followed by Dunnett’s post hoc test. *p b 0.05.

Treatment Saline

CREM

MK-801 + Cocaine

8

180

Expression level changes of several transcription factor transcripts were studied by in situ hybridizations (Fig. 3). MK-801 alone or combined with cocaine significantly increased in parietal cortex b-ZIP family members CREM (166% F 9.9%, 167% F 9.4%, mean F S.E.M., n = 6, respectively), and ICER (170% F 6.6%, 190% F 12%, respectively (Fig. 4). MK-801 alone increased modestly CBP levels (114% F 4.0%). MK-801 combined with cocaine decreased CREB (82% F 6.7%) and increased c-fos (123% F 6.2%) (Figs. 3 and 4) in parietal cortex. RGS2 in nucleus accumbens and GPC 19 in parietal cortex were up regulated by MK-801 (144% F 12% and 153% F 15%, respectively), while GRIP-2 was down regulated (78% F 12%) in parietal cortex (data not shown). All values were mean F standard error from 6 independent rat brains per treatment. The expression patterns of the genes known to contain CRE-elements were inspected. Analysis of the upstream

Gene symbol

215

Cocaine

MK-801

MK-801 + Cocaine

par ctx

ICER

CREB

CBP

c-fos

Figure 3 In situ hybridization autoradiograms of CREM, ICER, CREB, CREB binding protein (CBP), and c-fos. Coronal sections from rats treated with saline, MK-801, cocaine, or combined treatments were obtained as described in the Experimental approaches. The parietal cortex is indicated (par ctx). The oligonucleotide probes were radiolabelled and hybridized to the indicated sections and opposed to film for up to 3 weeks.

216

M. Storvik et al.

promoter sequences was performed using the EZ-retrieve www-tool (Zhang et al., 2002). After analysis of MK-801 and xcocaine regulated genes with MatInspector 2 (Quandt et al., 1995), down regulated genes in nucleus accumbens had on average 0.6 CRE-elements whereas the up regulated genes had on average one cAMP-response element (data not shown).

3.4. Up and down regulated genes from transcriptional processes A list of genes up or down regulated by cocaine or MK801 and cocaine and annotated as related to transcrip-

Table 1

tion are shown in Table 1. The list shows a wide range of genes representing different aspects of the transcriptional process including: transcription factors (mouse hepatic nuclear factor 4, transacting transcription factor 3, and transcription factor 2); nuclear proteins (histone deacetylase 2, pericentriolar material 1, nuclear protein TIF1 isoform, similar to human chromodomain helicase-DNA binding protein 4); and transcription complex proteins (similar to nuclear receptor corepressor 2, human RNA polymerase III transcription initiation factor B). These categories were spread across different brain regions, treatments, and up and down regulated genes.

List of regulated genes classified as related to transcriptional regulation

Accession Parietal cortex, cocaine AA963212 AI029547 AA924126 AA957075 AI058500 AA957837 AI059183

Z-ratio 2.12 3.38 3.36 2.63 2.43 2.02 2.06

Annotation Mouse hepatic nuclear factor 4 EST with weak similarity to regulatory factor X subunit 5 trans-acting transcription factor 3 Histone deacetylase 2 Mouse mRNA for GT12 protein Mouse teashirt 3 (Tsh3) EST with strong similarity to YY1 associated factor 2

Parietal cortex, MK-801 + cocaine AA866433 2.03 AI030924 2.15 AI058871 2.11 AI059175 2.18 AI385136 2.46 LF-B3 2.11 AI059173 2.07 AA998503 2.37 AI058649 2.18 AA997522 2.06 AI059707 2.28

Neural precursor cell expr, developmentally down regulated gene 8 Myogenin Mouse, Similar to nuclear receptor corepressor 2 Pericentriolar material 1 Moderately similar to T08667 hypothetical protein DKFZp547O0510.1 Transcription factor 2, hepatic Human RNA polymerase III transcription initiation factor B’’ short Mouse Hox-3.1 gene and Hox-3.2—Hox-3.1 intergenic region Nuclear protein TIF1 isoform Highly similar to 2120310B RNA polymerase II elongation factor Similar to enthoprotin

Nucleus accumbens, cocaine AA899619 AI044843 AA818691 AA999177 AI059048 AA859478 AI059254 AA819064 AA996588 AA925795

Rh type C glycoprotein Thyroid hormone-response protein-1 Myogenic factor 6 (herculin) Moderately similar to HIRA-interacting protein 3 Highly similar to transcription factor SP3 Aryl hydrocarbon receptor EST with moderate similarity to zinc finger protein 313 Paired-like homeodomain transcription factor 3 Mesenchyme homeobox 2 Proteasomal ATPase (SUG1)

2.76 2.56 3.23 2.61 3.86 2.37 2.29 2.26 2.24 2.19

Nucleus accumbens, MK-801 + cocaine AA900970 2.20 AA956746 2.30 AA999177 3.08 AI044215 2.20 AA997973 2.16 AA996446 2.58 AI059315 2.06

Homeobox gene A4 Highly similar to human chromodomain helicase-DNA-binding protein 4 Moderately similar to HIRA-interacting protein 3 Human KAISO-like zinc finger protein 1 Mouse, core binding factor beta Achaete—scute complex (Drosophila) homolog-like 1 Similar to tyrosine kinase-associated leucine zipper protein LAZipII

The gene identifier, Z-ratio, and closest similarity are presented. Regions and treatments are as indicated.

Distinct gene expression profiles in adult rat brains after acute MK-801 and cocaine treatments

4. Discussion We have investigated the acute effects of NMDA receptor antagonist MK-801 and indirect dopamine agonist cocaine on gene expression in rat brain by using DNA-microarrays. Using Z-transformation, it was possible to compare between differently expressed microarray datasets. When genes with altered expression were grouped by gene ontology terms, three overrepresented groups were apparent throughout the data: enzymes, intracellular messengers, and transcription factors. The total number of genes up regulated or down regulated by cocaine or MK-801 in nucleus accumbens were similar (158 vs. 166, Fig. 1), and the distribution of genes in GO groups was nearly identical. Nonetheless, the genes formed non overlapping groups supporting the notion that these agents regulate different gene sets. For example, genes up regulated in nucleus accumbens by either MK-801 or cocaine included RGS-family genes, although the same family member was not altered. Previous studies have demonstrated increase in expression of some signal transduction related genes (Toyooka et al., 2002; Lee et al., 2003), receptor subtypes (Toyooka et al., 2002; Storvik et al., 2003) as well as transcription factors (Konopka et al., 1998; Storvik et al., 2000; Marvanova et al., 2004) in parietal cortex and other brain regions after NMDA-antagonist treatment. Cocaine did not up regulate any signal transducers in parietal cortex, and down regulated only PKC and Pik3c3. This suggests very different effects on kinases in parietal cortex after cocaine or MK-801 treatment. The expression of CREM and ICER were induced in parietal cortex by MK-801, but unaffected by cocaine alone, which suggests that cocaine does not activate CREB-mediated transcription in parietal cortex. This is supported by the decrease of c-fos mRNA levels, which are influenced via CRE response elements, in parietal cortex by cocaine treatment. In the microarray experiment, numerous transcription factors and transcription regulating proteins had altered expression. CREB-binding protein (CBP) was associated with numerous genes in the sample sets. CBP is a calcium activated regulator of CREB activity (Hardingham et al., 1999; Hu et al., 1999; Bito and Takemoto-Kimura, 2003). GRIP-2, which was regulated by MK-801 and by cocaine, is closely related to GRIP-1 which activates CBP (Monroy et al., 2003). CCAAT/enhancer-binding protein (C/EBP) family uses CBP as a coactivator and C/EBPdelta can regulate CBP phosphorylation (Kovacs et al., 2003). A sequence similar to C/EBP-induced protein (AA818928) was down regulated by MK-801 in parietal cortex. These findings suggest that CBP is a target of signaling pathways altered by NMDA-antagonists and cocaine. CBP serves in integration of additional signal transduction pathways (Chawla et al., 1998; Hardingham et al., 1999) and mediates both positive and negative transcriptional responses to the JAK/STAT and Ras/Map signal pathways, and regulates also activation of AP-1 proteins and NF-kB (Horvai et al., 1997). In the present study, several genes associated with CBP were up regulated after MK-801 and combined MK-801 + cocaine treatments. Since all of these results indicate indirectly a role for CBP in mediating the effects of these agents, more direct studies would be needed before the significance of CBP can be determined. Using in silico analysis of promoter sequences, CRE was

217

found to be more enriched in genes up regulated by MK-801 (data not shown). Results comparing the gene promoters from TRANSFAC databases (Quandt et al., 1995; Wingender et al., 2000) gave similar results (data not shown). Since many transcription related proteins were found to be altered in the microarray studies, the precise transcription factors responsible for these changes are likely to be multiple. The results shown here indicate that CREB/CREM/ ICER may be among them since these genes were increased in the in situ hybridizations, CRE was found to be enriched in genes regulated by MK-801, and a previous study showed increases in CRE bound complexes within 1 h of MK-801 treatment in parietal cortex, that could be super shifted with CREB and CREM antibody at 8 h [15]. These time points are near the 4 h treatment periods from which the microarray data are derived. It should also be noted that many of the transcription factors used in the in situ studies were not found to be altered in the microarray study. In the present study, the basal levels of these transcripts are quite low, especially CREM, ICER, and c-fos, and this may account for their absence in the list of altered transcripts. Overall, the prevention of several cocaine induced gene expression alterations produced by MK-801 would suggest a potential pathway by which NMDA antagonists could attenuate the neurochemical properties of cocaine. Additional results, which show a large number of transcriptionally related molecules as regulated by either MK-801 or cocaine treatment suggests that interactions between the 2 agents are complex. The list of transcriptionally related proteins altered by MK-801 and cocaine is large and diverse (Table 1). No apparent pattern can be discerned. CREB and the modulators CREM and ICER may be important in mediating actions of addictive agents, but this study suggests that many more molecules are involved, perhaps indirectly. Altogether, these results suggest separate actions of MK801 and cocaine on gene expression. Whether NMDA antagonists can be used to block the addictive properties of cocaine therapeutically remains to be seen. The data here suggest that these 2 molecules operate at distinct and nonoverlapping networks at the gene expression level. As gene network systems become better defined, it should eventually be possible to discern whether, where, and when gene changes elicited by MK-801 and cocaine eventually merge.

Acknowledgements The authors thank Drs. Merja Lakso and Katarzyna Majak for professional assistance. We are indebted to Dr. M. Minna Laine and Jarno Tuimala of the Center for Scientific Computing for bioinformatics assistance. Drs. Petri Hyytia and Raimo Tuominen provided helpful discussion and comments to the manuscript. The Norwegian Microarray Consortium is gratefully acknowledged for producing the rat 15K microarray and making them available for academic use. This study was supported by a grant from the Academy of Finland (M.S. and G.W.).

References Barrot, M., Olivier, J.D., Perrotti, L.I., DiLeone, R.J., Berton, O., Eisch, A.J., Impey, S., Storm, D.R., Neve, R.L., Yin, J.C.,

218 Zachariou, V., Nestler, E.J., 2002. CREB activity in the nucleus accumbens shell controls gating of behavioral responses to emotional stimuli. Proc. Natl. Acad. Sci. U. S. A. 99, 11435 – 11440. Bito, H., Takemoto-Kimura, S., 2003. Ca(2+)/CREB/CBP-dependent gene regulation: a shared mechanism critical in long-term synaptic plasticity and neuronal survival. Cell Calcium 34, 425 – 430. Carlezon, W.A. Jr., Thome, J., Olson, V.G., Lane-Ladd, S.B., Brodkin, E.S., Hiroi, N., Duman, R.S., Neve, R.L., Nestler, E.J., 1998. Regulation of cocaine reward by CREB. Science 282, 2272 – 2275. Chawla, S., Hardingham, G.E., Quinn, D.R., Bading, H., 1998. CBP: a signal-regulated transcriptional coactivator controlled by nuclear calcium and CaM kinase IV. Science 281, 1505 – 1509. Cheadle, C., Vawter, M.P., Freed, W.J., Becker, K.G., 2003. Analysis of microarray data using z score transformation. J. Mol. Diagnostics 5, 73 – 81. Della Fazia, M.A., Servillo, G., Sassone-Corsi, P., 1997. Cyclic AMP signalling and cellular proliferation: regulation of CREB and CREM. FEBS Lett. 410, 22 – 24. Foulkes, N.S., Laoide, B.M., Schlotter, F., Sassone-Corsi, P., 1991. Transcriptional antagonist cAMP-responsive element modulator (CREM) down-regulates c-fos cAMP-induced expression. Proc. Natl. Acad. Sci. U. S. A. 88, 5448 – 5452. Foulkes, N.S., Mellstrom, B., Benusiglio, E., Sassone-Corsi, P., 1992. Developmental switch of CREM function during spermatogenesis: from antagonist to activator. Nature (Lond) 355, 80 – 84. Hardingham, G.E., Chawla, S., Cruzalegui, F.H., Bading, H., 1999. Control of recruitment and transcription-activating function of CBP determines gene regulation by NMDA receptors and l-type calcium channels. Neuron 22, 789 – 798. Horvai, A.E., Xu, L., Korzus, E., Brard, G., Kalafus, D., Mullen, T.M., Rose, D.W., Rosenfeld, M.G., Glass, C.K., 1997. Nuclear integration of JAK/STAT and Ras/AP-1 signaling by CBP and p300. Proc. Natl. Acad. Sci. U. S. A. 94, 1074 – 1079. Hu, S.C., Chrivia, J., Ghosh, A., 1999. Regulation of CBP-mediated transcription by neuronal calcium signaling. Neuron 22, 799 – 808. Huang, E.Y., Liu, T.C., Tao, P.L., 2003. Co-administration of dextromethorphan with morphine attenuates morphine rewarding effect and related dopamine releases at the nucleus accumbens. Naunyn-Schmiedeberg’s Arch. Pharmacol. 368, 386 – 392. Kenny, P.J., Koob, G.F., Markou, A., 2003. Conditioned facilitation of brain reward function after repeated cocaine administration. Behav. Neurosci. 117, 1103 – 1107. Kenny, P.J., Polis, I., Koob, G.F., Markou, A., 2003. Low dose cocaine self-administration transiently increases but high dose cocaine persistently decreases brain reward function in rats. Eur. J. Neurosci. 17, 191 – 195. Kim, Y.H., Lee, J.H., Lim do, S., Shim, W.J., Ro, Y.M., Park, G.H., Becker, K.G., Cho-Chung, Y.S., Kim, M.K., 2003. Gene expression profiling of oxidative stress on atrial fibrillation in humans. Exp. Mol. Med. 35, 336 – 349. Konopka, D., Szklarczyk, A.W., Filipkowski, R.K., Trauzold, A., Nowicka, D., Hetman, M., Kaczmarek, L., 1998. Plasticity-and neurodegeneration-linked cyclic-AMP responsive element modulator/inducible cyclic-AMP early repressor messenger RNA expression in the rat brain. Neuroscience 86, 499 – 510. Konradi, C., Leveque, J.C., Hyman, S.E., 1996. Amphetamine and dopamine-induced immediate early gene expression in striatal neurons depends on postsynaptic NMDA receptors and calcium. J. Neurosci. 16, 4231 – 4239. Kovacs, K.A., Steinmann, M., Magistretti, P.J., Halfon, O., Cardinaux, J.R., 2003. CCAAT/enhancer-binding protein family members recruit the coactivator CREB-binding protein and trigger its phosphorylation. J. Biol. Chem. 278, 36959 – 36965.

M. Storvik et al. Lee, K.H., Ahn, J.I., Yu, D.H., Koh, H.C., Kim, S.H., Yang, B.H., Lee, Y.S., 2003. Dextromethorphan alters gene expression in rat brain hippocampus and cortex. Int. J. Mol. Med. 11, 559 – 568. Li, Y., White, F.J., Wolf, M.E., 2000. Pharmacological reversal of behavioral and cellular indices of cocaine sensitization in the rat. Psychopharmacology (Berl) 151, 175 – 183. Makimura, M., Sugimoto, H., Shinomiya, K., Kabasawa, Y., Fukuda, H., 1996. Inhibitory effect of the NMDA receptor antagonist, dizocilpine (MK-801), on the development of morphine dependence. J. Toxicol. Sci. 21, 135 – 141. Marvanova, M., Lakso, M., Wong, G., 2004. Identification of genes regulated by memantine and MK-801 in adult rat brain by cDNA microarray analysis. Neuropsychopharmacology 29, 1070 – 1079. McClung, C.A., Nestler, E.J., 2003. Regulation of gene expression and cocaine reward by CREB and DeltaFosB. Nat. Neurosci. 6, 1208 – 1215. Mioduszewska, B., Jaworski, J., Kaczmarek, L., 2003. Inducible cAMP early repressor (ICER) in the nervous systema ˜ a transcriptional regulator of neuronal plasticity and programmed cell death. J. Neurochem. 87, 1313 – 1320. Molina, C.A., Foulkes, N.S., Lalli, E., Sassone-Corsi, P., 1993. Inducibility and negative autoregulation of CREM: an alternative promoter directs the expression of ICER, an early response repressor. Cell 75, 875 – 886. Monroy, M.A., Schott, N.M., Cox, L., Chen, J.D., Ruh, M., Chrivia, J.C., 2003. SNF2-related CBP activator protein (SRCAP) functions as a coactivator of steroid receptor-mediated transcription through synergistic interactions with CARM-1 and GRIP-1. Mol. Endocrinol. 17, 2519 – 2528. Nestler, E.J., 1993. Cellular responses to chronic treatment with drugs of abuse. Crit. Rev. Neurobiol. 7, 23 – 39. Nestler, E.J., 2001. Neurobiology. Total recalla ˜ the memory of addiction. Science 292, 2266 – 2267. Nestler, E.J., Barrot, M., Self, D.W., 2001. DeltaFosB: a sustained molecular switch for addiction. Proc. Natl. Acad. Sci. U. S. A. 98, 11042 – 11046. Olney, J.W., Labruyere, J., Wang, G., Wozniak, D.F., Price, M.T., Sesma, M.A., 1991. NMDA antagonist neurotoxicity: mechanism and prevention. Science 254, 1515 – 1518. Paxinos, G., Watson, C., 1986. The Rat Brain in Stereotaxic Coordinates. Academic Press, Sydney. Popik, P., Skolnick, P., 1996. The NMDA antagonist memantine blocks the expression and maintenance of morphine dependence. Pharmacol. Biochem. Behav. 53, 791 – 797. Popik, P., Layer, R.T., Fossom, L.H., Benveniste, M., Geter-Douglass, B., Witkin, J.M., Skolnick, P., 1995. NMDA antagonist properties of the putative antiaddictive drug, ibogaine. J. Pharmacol. Exp. Ther. 275, 753 – 760. Quandt, K., Frech, K., Karas, H., Wingender, E., Werner, T., 1995. MatInd and MatInspector: new fast and versatile tools for detection of consensus matches in nucleotide sequence data. Nucleic. Acids Res. 23, 4878 – 4884. Saeed, A.I., Sharov, V., White, J., Li, J., Liang, W., Bhagabati, N., Braisted, J., Klapa, M., Currier, T., Thiagarajan, M., Sturn, A., Snuffin, M., Rezantsev, A., Popov, D., Ryltsov, A., Kostukovich, E., Borisovsky, I., Liu, Z., Vinsavich, A., Trush, V., Quackenbush, J., 2003. TM4: a free, open-source system for microarray data management and analysis. Biotechniques 34, 374 – 378. Schenk, S., Valadez, A., Worley, C.M., McNamara, C., 1993. Blockade of the acquisition of cocaine self-administration by the NMDA antagonist MK-801 (dizocilpine). Behav. Pharmacol. 4, 652 – 659. Storvik, M., Lindu ˆ`n, A.M., Kontkanen, O., Lakso, M., Castru ˆ`n, E., Wong, G., 2000. Induction of cAMP response element modulator (CREM) and inducible cAMP early repressor (ICER) expression in rat brain by uncompetitive N-methyl-d-aspartate receptor antagonists. J. Pharmacol. Exp. Ther. 294, 52 – 60.

Distinct gene expression profiles in adult rat brains after acute MK-801 and cocaine treatments Storvik, M., Lindu ˆ`n, A.M., Lakso, M., Wong, G., 2003. Subunit selective decrease of AMPA and metabotropic glutamate receptor mRNA expression in rat brain by systemic administration of the NMDA receptor blocker MK-801. J. Mol. Neurosci. 21, 29 – 34. Tang, W.X., Fasulo, W.H., Mash, D.C., Hemby, S.E., 2003. Molecular profiling of midbrain dopamine regions in cocaine overdose victims. J. Neurochem. 85, 911 – 924. Thiriet, N., Aunis, D., Zwiller, J., 2000. C-fos and egr-1 immediateearly gene induction by cocaine and cocaethylene in rat brain: a comparative study. Ann. N. Y. Acad. Sci. 914, 46 – 57. Toyooka, K., Usui, M., Washiyama, K., Kumanishi, T., Takahashi, Y., 2002. Gene expression profiles in the brain from phencyclidinetreated mouse by using DNA microarray. Ann. N. Y. Acad. Sci. 965, 10 – 20. Vawter, M.P., Crook, J.M., Hyde, T.M., Kleinman, J.E., Weinberger, D.R., Becker, K.G., Freed, W.J., 2002. Microarray analysis of gene expression in the prefrontal cortex in schizophrenia: a preliminary study. Schizophr. Res. 58, 11 – 20. Widnell, K.L., Self, D.W., Lane, S.B., Russell, D.S., Vaidya, V.A., Miserendino, M.J., Rubin, C.S., Duman, R.S., Nestler, E.J., 1996. Regulation of CREB expression: in vivo evidence for a functional role in morphine action in the nucleus accumbens. J. Pharmacol. Exp. Ther. 276, 306 – 315.

219

Wingender, E., Chen, X., Hehl, R., Karas, H., Liebich, I., Matys, V., Meinhardt, T., Pruss, M., Reuter, I., Schacherer, F., 2000. TRANSFAC: an integrated system for gene expression regulation. Nucleic. Acids Res. 28, 316 – 319. Wong, E.H., Kemp, J.A., Priestley, T., Knight, A.R., Woodruff, G.N., Iversen, L.L., 1986. The anticonvulsant MK-801 is a potent Nmethyl-d-aspartate antagonist. Proc. Natl. Acad. Sci. U. S. A. 83, 7104 – 7108. Workman, C., Jensen, L.J., Jarmer, H., Berka, R., Gautier, L., Nielser, H.B., Saxild, H.H., Nielsen, C., Brunak, S., Knudsen, S., 2002. A new non-linear normalization method for reducing variability in DNA microarray experiments. Genome. Biol. 3 (research0048). Yu, J., Farjo, R., MacNee, S.P., Baehr, W., Stambolian, D.E., Swaroop, A., 2003. Annotation and analysis of 10,000 expressed sequence tags from developing mouse eye and adult retina. Genome. Biol. 4, R65. Zhang, H., Ramanathan, Y., Soteropoulos, P., Recce, M.L., Tolias, P.P., 2002. EZ-retrieve: a web-server for batch retrieval of coordinate-specified human DNA sequences and underscoring putative transcription factor-binding sites. Nucleic. Acids Res. 30, e121.