- Email: [email protected]
Distinct temporal patterns of Transaldolase 1 gene expression in future migratory and sedentary brown trout (Salmo trutta)
Aquaculture 260 (2006) 326 – 336 www.elsevier.com/locate/aqua-online
Distinct temporal patterns of Transaldolase 1 gene expression in future migratory and sedentary brown trout (Salmo trutta) Ursula Amstutz a , Thomas Giger a , Alexis Champigneulle b , Philip J.R. Day c , Carlo R. Largiadèr a,d,⁎ a
c
CMPG (Computational and Molecular Population Genetics Lab), Zoological Institute, University of Bern, Baltzerstrasse 6, CH-3012 Bern, Switzerland b Station d'Hydrobiologie Lacustre de Thonon, INRA (Institute National de la Recherche Agronomique), 75 avenue de Corzent, F-74203 Thonon-les-Bains, France Centre for Integrated Genomic Medical Research, University of Manchester, Stopford Building, Oxford Road, Manchester, M13 9PT, UK d Institute of Clinical Chemistry, Inselspital, University Hospital, University of Bern, CH-3010 Bern, Switzerland Received 2 November 2005; received in revised form 7 June 2006; accepted 9 June 2006
Abstract The occurrence of sedentary and migratory life-history forms is common in several salmonid fish species. A cDNA microarray study, investigating differences between these life-history forms at the level of the transcriptome, identified the transaldolase 1 gene (Taldo1) as being differently expressed in liver between sedentary and migratory brown trout populations just before the onset of migration. The aim of the study presented here was to gain further knowledge about the potential role of this gene during preparatory changes associated with the migratory life-history and the time of onset of this expression difference by investigating its expression levels in several juvenile age stages of sedentary and freshwater-migratory brown trout. A quantitative real-time PCR assay was established for the Taldo1 gene to measure its expression levels in liver samples of brown trout and Atlantic salmon. Taldo1 transcript levels were significantly lower in migratory brown trout and Atlantic salmon at the onset of migration compared to sedentary trout of the same age, confirming the results obtained by cDNA microarray technology. Comparison of Taldo1 expression patterns with changes in body condition factor led to the hypothesis that the observed lower levels of Taldo1 expression in migratory individuals are associated with the depletion of lipid stores during premigratory adaptations, potentially related to the smoltification process observed in anadromous salmonids, and a joint reduction in de novo lipid synthesis. Analysis of three juvenile stages of morphologically undifferentiated future migratory and sedentary brown trout revealed a significantly elevated expression level of the Taldo1 gene in future migratory trout compared to sedentary individuals three and a half month before the onset of migration, indicating an early signal potentially useful for predicting the future lifehistory of an individual. These results suggest that physiological differences between life-history forms might be measurable before morphological differentiation and that further study of such younger age stages could reveal new insights into the regulation and initiation of life-history related physiological, morphological and behavioural changes. © 2006 Elsevier B.V. All rights reserved. Keywords: Life-history; Brown trout; Salmo trutta; Transaldolase 1; Gene expression; Real-time PCR
1. Introduction ⁎ Corresponding author. Tel.: +41 31 632 95 45; fax: +41 31 632 89 66. E-mail address: [email protected] (C.R. Largiadèr). 0044-8486/$ - see front matter © 2006 Elsevier B.V. All rights reserved. doi:10.1016/j.aquaculture.2006.06.007
Brown trout (Salmo trutta) is an ecologically very diverse species also showing considerable variation in life-
U. Amstutz et al. / Aquaculture 260 (2006) 326–336
history, encompassing sea migratory (anadromous) fish, lake-dwelling trout and resident individuals that never leave their native rivers (Elliott, 1994). This life-history variation, as in other salmonid species, is likely to be influenced by a complex interaction of environmental and genetic factors (Jonsson and Jonsson, 1993; Klemetsen et al., 2003). Migratory individuals undergo several preparatory adaptations prior to migration, involving dramatic morphological, physiological and behavioural changes (Hoar, 1988). This process, called smoltification in anadromous populations, has been studied quite extensively in various salmonid species, since it is of interest not only to ecologists and evolutionary biologists, but also to the aquaculture industry. The desired phenotype in aquaculture of salmonid fish is the smolt phenotype, due to its adaptability to sea-water, the larger size of the fish, the higher quality of the meat and the less territorial behaviour compared to sedentary phenotypes, thus allowing rearing at higher densities. Species showing a high amount of plasticity in life-history traits, such as the brown trout, are ideal model organisms to study the genetic basis and the regulating mechanisms underlying smoltification and related processes (Elliott, 1994; Klemetsen et al., 2003). Since there are similarities in these pre-migratory changes between different salmonid species, findings from brown trout studies may also be transferable to other species with greater aquacultural importance. The genetic basis and the mechanisms underlying the regulation and initiation of migratory behaviour and the parr–smolt transformation are very complex and still poorly understood (Stefansson et al., 2003). Most of the studies on physiological characteristics affected by smoltification revealed changes just before or during smolting (Ewing and Rodgers, 1998; Ebbesson et al., 2000; Shrimpton et al., 2000). However, in Atlantic salmon, the decision to undergo smoltification and subsequent downstream migration the next spring is thought to be made earlier in the life of future migratory individuals (Saunders et al., 1994). Therefore, it would be of great interest to also find physiological signs of future migratory behaviour already in earlier age stages, which could give additional insights into the initiation of migratory behaviour and potentially be used to phenotype individuals early before morphological differentiation (Nielsen et al., 2003, 2004), thus giving room for economic optimizations in aquaculture. So far, relatively few studies addressed smoltification or processes related to migratory behaviour at the level of changes in gene expression (Dann et al., 2003; Dukes et al., 2004), most of them focusing on genes and pathways already known to be involved in these processes, such as growth hormones and Na+, K+-ATPase (Agustsson et al., 2003; Richards et al., 2003).
327
Recently, it has been shown that the application of cDNA microarrays (Schena et al., 1995) represents a powerful approach for the identification of new candidate genes involved in pre-migratory changes potentially related to the smoltification process (Giger, 2005; Giger et al., 2006). In this study, gene expression levels of about 900 genes were measured in liver tissue of six brown trout populations, three of which were sedentary, two lake-migratory and one anadromous, and a Scottish hatchery strain of Atlantic salmon (S. salar). Migratory phenotypes with a smolt-like appearance were sampled at the same age stage as sedentary individuals, just before leaving their natal streams. A top candidate among the 268 genes that contributed to a general difference between migratory and sedentary populations, thus showing strong life-history correlated expression differences, was the gene encoding for transaldolase 1 (Taldo1; EC 2.2.1.2.), which is further investigated in the study presented here. Using a real-time quantitative PCR approach (Bustin, 2000), these expression differences were partly confirmed (Giger, 2005), since validation of cDNA microarray measurements by an independent method is strongly recommended (Wurmbach et al., 2003). Due to its high sensitivity and large dynamic range, real-time quantitative PCR (Bustin, 2000) has recently become the method of choice to accurately measure the expression of a single gene in biological samples. It is also the recommended method for the validation of microarray data (Bustin, 2000; Rajeevan et al., 2001; Ginzinger, 2002). Taldo1 is the key enzyme of the non-oxidative branch of the pentose phosphate pathway, an alternative pathway of glucose metabolism, in which glucose is oxidised, generating NADPH and 5-carbon sugar intermediates, such as ribose-5-phosphate (Mayes, 1990; Berg et al., 2002, pp. 559–581). Whereas ribose-5-phosphate is needed for nucleic acid synthesis, NADPH is required for the reductive synthesis of energy-rich biological molecules such as fatty acids and steroids. Thus, the pentose phosphate pathway is thought to play a particularly important role in liver and adipose tissue (Cabezas et al., 1999). The aim of the study presented here was to gain further knowledge about the time of onset of the observed changes in Taldo1 expression and the potential role of Taldo1 during pre-migratory adaptations in natural, landlocked brown trout populations, migratory individuals of which display smoltification-like changes similar to those observed in anadromous fish. Although these freshwater-migratory individuals may not undergo the complete process of smoltification, thus limiting the conclusions that can be drawn in relation to this process, this study system enabled the discrimination of morphologically undifferentiated future migratory and sedentary
328
U. Amstutz et al. / Aquaculture 260 (2006) 326–336
individuals in a natural setting, while minimising confounding environmental and genetic effects. Therefore, transcript levels of the Taldo1 gene in liver tissue could be measured in three different juvenile stages to obtain temporal expression patterns of this gene before and during morphological differentiation of life-history forms. To this purpose, we established a real-time quantitative PCR assay for the measurement of mRNA levels of the Taldo1 gene in brown trout and Atlantic salmon liver. Furthermore, in order to fully confirm the findings from previous cDNA microarray experiments and to assess the reproducibility of these results, sedentary and migratory brown trout at the age stage just before downstream migration were analysed from two different years. 2. Materials and methods 2.1. Study system and biological material The temporal analysis of Taldo1 gene expression dynamics was carried out using brown trout individuals originating from the river Redon, an affluent of Lake Geneva (Fig. 1). The particular advantage of this study system is based on the same river harbouring two brown trout populations (Fig. 1), which are geographically very close, yet have been separated by an insurmountable artificial dam for more than 40 years (Champigneulle et al.,
2003). Due to this very recent separation, the two populations are not only in geographical proximity, but also genetically closely related (Giger et al., 2006). Whereas the population above the barrier is entirely sedentary (Champigneulle et al., 1988), the vast majority of the sub-yearlings from the population below the obstacle develops smolt characteristics such as schooling behaviour, streamlined shape and body silvering (cf. Figure S1 in Giger et al., 2006) and migrates into the lake. As migratory individuals from this population do not migrate into the sea, it is unclear whether they undergo the complete process of smoltification including saltwater adaptation. However, since these individuals clearly develop morphological and behavioural changes that are similar to smolting, as it is also the case for other lake-dwelling brown trout populations and landlocked salmon (Schulz, 1999; Kiiskinen et al., 2002; Nilsen et al., 2003; Olsson and Greenberg, 2004), physiological processes associated with migration in anadromous populations may also occur in this population of fish. Furthermore, Giger et al. (2006) observed that global gene expression levels in liver tissue of this freshwater-migratory population are more similar to those of an anadromous brown trout population than to those of sedentary populations. This indicates that in these populations, similar processes are taking place in liver tissue of all populations with a migratory life-history, independent of whether they migrate to the sea or a lake.
Fig. 1. Map of brown trout sampling locations in the French part of the Lake Geneva area. 1: Redon migratory population (46°21′03″N, 6°24′06″E); 2: Redon sedentary population (46°20′06″N, 6°25′21″E); 3: Chevenne sedentary population (46°17′50″N, 6°47′6″E); W: Weir, migration obstacle.
U. Amstutz et al. / Aquaculture 260 (2006) 326–336
This almost complete physical separation of sedentary and migratory individuals allows the study of lifehistory related traits under natural conditions and at age stages, when the two different forms are not morphologically distinguishable yet, which was crucial since we had to sacrifice the fish for our studies. Even though it is not possible to entirely rule out environmental effects in this setting, as would be in the case of a common garden experiment, the study of life-history related processes under such natural conditions nevertheless seems particularly important, since they seem to be determined by the interaction of genetic and environmental factors (Hoar, 1988; Jonsson and Jonsson, 1993; Klemetsen et al., 2003). In order to minimise potential confounding genetic and environmental effects, which are not related to life-history differences, we have chosen these genetically closely related populations (Giger et al., 2006), which, due to the geographical proximity, share a highly similar environment. 2.2. Sampling The samples used for the verification of the cDNA microarray data included 15 individuals of age class 1+ each from the resident (RSED) and migratory (RMIG) brown trout population from the river Redon (Fig. 1) collected in late April 2003, just before the onset of down-stream migration of the smolt-like fish. Additionally, another 15 individuals of the same age were caught from a sedentary brown trout population (CSED) in the Chevenne river (Fig. 1) in early June of the same year, as well as 10 Atlantic salmon smolts (SMIG) from a domesticated strain, which were kept in 250 litre recirculating freshwater tanks at 12 °C. For the temporal analysis of the Taldo1 gene expression dynamics, 20 individuals were sampled each from the two Redon populations in November 2004, January, March and May 2005, all belonging to the 2004 cohort (aged 0+, becoming 1+ in spring). All trout were caught by electrofishing and immediately killed with an overdose of the anesthetic 2-phenoxyethanol (Sigma). Liver samples were immediately extracted, transferred into the RNA stabilizing agent RNAlater (Ambion) and subsequently
329
stored at −30 °C. Before extraction of the liver tissue, fork length and wet weight of all trout were measured. Exact sampling dates, sample sizes, mean fork length and mean wet weight for all populations and sampling events are given in Supplementary Table 1. 2.3. Selection of reference genes for normalisation of real-time PCR measurements Essential for the success of any real-time PCR experiment is the use of suitable reference genes for normalisation of the data to account for experimentally introduced variation in the amount and quality of starting material (Bustin, 2000; Bustin et al., 2005; Huggett et al., 2005). The availability of microarray data (Giger, 2005) enabled us to identify and select the most stably expressed genes among about a thousand genes for the use as reference genes in the real-time PCR analysis. In more detail, Giger (2005) measured expression levels of genes expressed in liver of brown trout and Atlantic salmon using cDNA microarrays containing 1098 gene probes. From this data, three genes were selected to be used for the normalisation of the real-time PCR data, which showed an expression level in the range of Taldo1, maximal homogeneity of population mean expression levels and minimal variance (as measured by the coefficient of variation, CV) in expression levels within populations. The three genes selected encode for the ribosomal protein L10 (RPL10), the coagulation factor VII (FVII) and prosaposin, as established by sequence comparison with annotated protein databases (Giger, 2005). To our knowledge, none of these genes has ever been reported to be involved in smoltification or associated processes. 2.4. Real-time PCR analysis Total RNA was extracted using the Absolutely RNA RT-PCR Miniprep kit (Stratagene). Reverse transcription was performed as described by Giger (2006). TaqMan™ probes and primers were designed and manufactured by Applied Biosystems, Assay-by-Design, for the Taldo1 gene and the three reference genes RPL10, FVII and prosaposin. A preliminary study (Giger et al., in press)
Table 1 TaqMan probes and primer sequences of the real-time quantitative PCR assays for the Taldo1 gene and the three reference genes Gene
TaqMan probe
Forward primer
Reverse primer
Amplicon size (bp)
Taldo1 RPL10 FVII Prosaposin
5′CCTCAGGTCCGCCCTTG 5′CCCGTCTGGAGCCTGT 5′TATTCCCCTGCGACCACCA 5′CTGACCTGTGCAAGCAG
5′GCCGCCTACCAGCATCT 5′CCTTCCATGTCATCCGTATCAACAA 5′TCGTGGATAGAGACACCAAGGA 5′ACCTTCGTCAACTCTCTGATCGA
5′AGCTTGTCCATGGTGTTGGT 95 5′AGACATGATCACCTGACCGATTC 134 5′TGCCCTCTTCTACGTCAATGTTG 69 5′GAGCGTACTGGCTGACGTA 100
330
U. Amstutz et al. / Aquaculture 260 (2006) 326–336
Table 2 Pair-wise correlations between the three reference genes and their geometric mean (GM): Correlation coefficient R (below diagonal) and corresponding p-values (above diagonal) vs.
Prosaposin
Prosaposin FVII RPL10 GM
0.741 0.889 0.947
FVII
RPL10
GM
<0.001
<0.001 <0.001
<0.001 <0.001 <0.001
0.784 0.893
0.956
showed no indication for the occurrence of different splice variants for Taldo1, thus levels of only one single transcript needed to be measured. All assays were designed to span exon–exon junctions in order to minimise co-amplification of contaminating genomic DNA. Sequences of primers and probes are given in Table 1. For each assay, the reaction efficiency and the optimal cDNA input amount were determined by running a series of five dilutions ranging from 1:1 (corresponding to cDNA synthesised from 50 ng of total RNA) to 1:1024 for one migratory and one sedentary Redon individual of the 2003 sampling, each in duplicate. From the slopes of the resulting standard curves, the reaction efficiency (E) was calculated using the equation E = 10− 1 / slope as described in the instructions provided by the manufacturer (Applied Biosystems). The average efficiency of these two samples was used for all subsequent calculations. All reactions were carried out on an ABI Prism 7000 Sequence Detection System (Applied Biosystems). One reaction contained 12.5 μl TaqMan™ 2× Universal PCR Master Mix, No AmpErase UNG (Applied Biosystems), 1.25 μl 20× Assay Mix (TaqMan™ Assay-by-Design, Applied Biosystems) and cDNA synthesized from 12.5 ng total RNA, made up with DEPC treated water to add up to
a final reaction volume of 25 μl. The same thermal profile was used as recommended by the manufacturer (2 min at 50 °C, 10 min at 90 °C, 40 cycles with 15 s at 95 °C and 1 min at 60 °C). For each sample, separate reactions for the four genes were run in duplicate on a 96-well optical plate and repeated also in duplicate on another plate, including repetition of the reverse transcription step, to account for experimental error within, as well as between plates, resulting in a total of four measurements of each gene per sample. The starting template quantity was determined as described by Peirson et al. (2003, Eq. 2) for the Taldo1 gene and the three reference genes. To correct for technical variation in starting material and sample quality, the measurements for Taldo1 were normalized to the geometric mean of the three reference genes as proposed by Vandesompele et al. (2002). This method was recently stated to be robust and appropriate if rather fine expression differences are to be measured (Huggett et al., 2005). Sample sizes ranged from eight to ten individuals per sampling event and population, resulting in a total of 115 individuals analysed by real-time PCR (exact numbers are given in Supplementary Table 1). 2.5. Calculations and statistical analysis For all trout sampled in the river Redon, a condition factor was calculated for each individual analysed by realtime PCR using the equation CF = (weight / length3) × 100 (Fulton, 1902). Wet weight of the fish was measured in grams; fork length was measured in centimetres. All statistical analyses were performed using the statistics software R for Windows (R Development Core Team, 2004). To assess the correlation between two
Fig. 2. Box plots of normalised Taldo1 expression levels assessed in three (microarray) respectively five (real-time PCR) brown trout and one Atlantic salmon population by cDNA microarray analysis (a) and real-time quantitative PCR (b). The whiskers indicate the 1.5 interquartile ranges. Abbreviations: SMIG: Atlantic salmon, RMIG03: Redon migratory population, sampled in 2003, RMIG05: Redon migratory population sampled in 2005, RSED03: Redon sedentary population sampled in 2003, RSED05: Redon sedentary population sampled in 2005, CSED: Chevenne sedentary population.
U. Amstutz et al. / Aquaculture 260 (2006) 326–336
331
Table 3 P-values (above diagonal) and fold-changes in Taldo1 expression (below diagonal) of pair-wise comparisons between sedentary and migratory brown trout populations and one Atlantic salmon population at the smolt stage Smig Smig Rmig03 Rmig05 Rsed03 Rsed05 Csed
1.8 2.3 3.1 4.4 4.7
Rmig03
Rmig05
Rsed03
Rsed05
Csed
0.002**
0.002** 0.155n.s.
<0.001*** <0.001*** 0.074n.s.
<0.001*** <0.001*** <0.001*** 0.011*
<0.001*** <0.001*** <0.001*** 0.010* 0.681n.s.
1.3 1.7 2.5 2.6
1.3 1.9 2.0
1.4 1.5
1.1
Comparisons between life-history forms are indicated in bold.
variables, the Pearson's product moment correlation coefficient R was calculated. Population mean expression levels of the Taldo1 gene were tested for statistically significant differences by performing permutation tests with 100,000 permutations (Maindonald and Braun, 2004); significant differences were established at the 0.05 level. Fold-changes in gene expression were calculated by dividing the larger of two population means by the smaller one. 3. Results 3.1. Stable expression of reference genes Employing the method proposed by Pfaffl et al. (2004), pair-wise correlations between unnormalised raw measurements of the three reference genes RPL10, FVII and prosaposin were used to assess the stability of the expression of these genes. All three genes showed strong and highly significant correlations with coefficients between 0.74 and 0.89 (Table 2), which is in a similar range as reported by Pfaffl et al. (2004) (R-values: 0.72–0.80) for commonly used reference genes. All three reference genes were also tightly correlated to their geometric mean (R > 0.89; Table 2), indicating its suitability for the normalisation of the Taldo1 measurements. Given the strong correlations of the three reference genes with their geometric mean with none of them performing systematically worse than the two others, normalisation to the geometric mean of these three genes can be considered the optimal normalisation strategy for this study.
(Fig. 2b). The findings from the cDNA microarray experiment proved to be reproducible over different years as well, as also in the year 2005, migratory brown trout at the same age stage (RMIG05) showed significantly lower Taldo1 transcript levels than the sedentary population (RSED05), when measured by real-time PCR. All pair-wise comparisons across life-history phenotypes were highly significant (Table 3, above diagonal) with migratory populations always showing a lower Taldo1 expression level, except for one comparison between migratory brown trout sampled in May 2005 (RMIG05) and sedentary brown trout individuals sampled in April 2003 (RSED03). This lack of significance can easily be explained by the generally higher levels of Taldo1 transcripts in the year 2005 compared to the samples from the year 2003, since the Taldo1 expression level is also significantly higher in the sedentary population from 2005 (RSED05) compared to the same population sampled in 2003 (RSED03).
3.2. Confirmation of cDNA microarray screening results Normalised expression levels of the Taldo1 gene obtained by cDNA microarray assessment are shown in Fig. 2a. Analysis of the same samples by real-time quantitative PCR showed the same pattern with Taldo1 expression being the lowest in salmon smolts (SMIG) and the highest in the Chevenne sedentary population (CSED)
Fig. 3. Correlation between log2 transformed individual Taldo1 expression levels in liver of brown trout and Atlantic salmon obtained by cDNA microarray and by real-time PCR analysis, respectively.
332
U. Amstutz et al. / Aquaculture 260 (2006) 326–336
Measurements by real-time PCR and cDNA microarray analysis were highly significantly correlated (R = 0.77, p < 0.00001, Fig. 3) with a correlation coefficient in the same range as assessed by Dallas et al. (2005). The fold-changes in gene expression between two populations were found to be consistently higher when determined by real-time PCR than when assessed by microarray analysis, which is in agreement with other findings (Yuen et al., 2002; Dallas et al., 2005). All foldchanges between populations assessed by real-time PCR are shown in Table 3, population mean expression levels are given in Supplementary Table 1.
Table 4 Fold-changes in Taldo1 expression, sample sizes (n) and p-values of comparisons between future migratory and sedentary brown trout at different age stages
3.3. Temporal expression dynamics of the Taldo1 gene
March, expression of the Taldo1 gene decreased in both populations and reached almost identical levels in March. Afterwards, Taldo1 transcript levels showed a strong increase in the Redon sedentary population, whereas they slightly continued to decrease in the migratory population, resulting in a highly significant difference between the two populations in May, right before the onset of migration. Comparison of Taldo1 expression dynamics with the temporal dynamics of the condition factor of the fish revealed a very similar pattern in the second half of the time series with the condition factor showing low levels in both populations in March with a subsequent strong increase in the sedentary population (Fig. 4). As Taldo1 levels, condition factors were significantly lower in individuals ready for migration than in the sedentary trout of the same age (p < 0.001 in the 2003 samples, p < 0.05 in the 2005 samples).
Temporal changes in Taldo1 expression were more pronounced in future migratory than in sedentary trout (Fig. 4). In November, about six month before the onset of migration, no significant difference in Taldo1 transcript levels was found between 0+ individuals of the two populations (Table 4). Whereas Taldo1 expression subsequently slightly decreased in the Redon sedentary population (RSED), a strong increase was found in the future migratory individuals (RMIG), displaying the highest level of Taldo1 expression measured throughout the entire time series (Fig. 4). Due to this strong increase in the migratory population, Taldo1 expression was found to be significantly different in the two populations in January (Table 4), three and a half month before the onset of downstream migration. Between January and
Sampling date
Age
n (RMIG / RSED)
Fold-changea
p-value
Apr 03 Nov 04 Jan 05 Mar 05 May 05
1+ 0+ 0+ 1+ 1+
9 9 9 10 10
− 1.684 − 1.188 +1.542 +1.006 − 1.899
<0.001*** 0.193n.s. 0.033* 0.967n.s. <0.001***
/ 10 / 10 / 10 / 10 / 10
a
Fold-changes are indicated as the expression of the Taldo1 gene in the migratory population with respect to the sedentary population.
Fig. 4. Temporal dynamics of Taldo1 expression and body condition factor in juvenile brown trout. Filled symbols: Redon migratory population, open symbols: Redon sedentary population, circles: Taldo 1 expression level, triangles: condition factor. Error bars represent the standard error of the mean (SE). Corresponding population mean Taldo1 expression levels and condition factors are given in Supplementary Table 1.
U. Amstutz et al. / Aquaculture 260 (2006) 326–336
4. Discussion Our real-time quantitative PCR analysis clearly confirmed the lower hepatic expression level of the Taldo1 gene observed in the cDNA microarray screening in brown trout preparing for downstream migration, compared to resident individuals of the same age. Furthermore, we found that this expression difference is reproducible over years. These results strengthen the hypothesis that this gene might be involved in premigratory adaptations similar to the smoltification process and thus suggest that also the metabolic pathway in which Taldo1 is located, the pentose phosphate pathway, is altered during the development of the migratory phenotype. Additionally, in agreement with our findings, the same gene expression pattern was observed in three brown trout populations from Denmark using cDNA microarray technology, with one sedentary population showing high levels of Taldo1 expression and lower transcript levels in two migratory populations, one of which is freshwater-migratory and the other one anadromous (Giger, 2005; Giger et al., 2006). This finding suggests that the observed pattern is common to both anadromous and freshwater-migratory populations, as already indicated by the low level of Taldo1 transcripts observed in Atlantic salmon smolts in this study. Interestingly, differences in Taldo1 expression between resident and migratory brown trout were also detected in younger age stages of the two populations studied. Trout undergoing downstream migration the next spring showed a very pronounced peak in Taldo1 expression in January, thus greatly preceding morphological differentiation, which is not seen in the sedentary individuals. In future migratory trout, the highest level of Taldo1 expression throughout the entire study was found at this peak in January, whereas the highest expression levels in sedentary individuals were seen in November and May. This results in very distinct temporal expression patterns of this gene in juvenile stages of these two populations, suggesting that the decision to follow a migratory lifehistory in the next spring is made earlier in the life of these fish and that already in winter, physiological differences are measurable. However, the reproducibility of this finding needs to be assessed in other populations, ideally also including anadromous ones, to clearly establish that the observed early gene expression difference is associated to the different life-histories and not locally variable environmental factors. If these early distinct temporal expression patterns should indeed prove to be generally observable in sedentary and migratory fish, this gene could potentially be used to
333
phenotype individuals for their future life-history strategy already at this age stage. Since this expression difference was found in freshwater-dwelling populations, it is probably not related to saltwater adaptation and thus its application would not be restricted to anadromous populations, as it might be the case for Na+, K+-ATPase, which has previously been used as an indicator for smoltification (Nielsen et al., 2004). An important question that arises from our data is how the Taldo1 gene and the pentose phosphate pathway could functionally be linked to the pre-migratory changes observed in this population and potentially also the smoltification process. Since the two major roles of the pentose phosphate pathway are the production of NADPH for reductive biosyntheses and the generation of ribose-5-phosphate for nucleic acid synthesis, a link is likely to be found in either one or both of those functions. In our time series analysis, we found similar temporal patterns of Taldo1 expression and body condition factor in spring. Indeed, the observed decrease of the body condition factor in the migratory individuals in spring is a known characteristic of smoltification of anadromous populations (Hoar, 1988; Sundell et al., 1998), since the bodies of the fish become more streamlined during this time. This can be explained by the depletion of energy reserves, including lipid stores, which is also observed during the parr–smolt transformation (Hoar, 1976; Sheridan, 1989), in combination with increased growth rates (Fessler and Wagner, 1969; McCormick et al., 1998). This smoltification-associated lipid depletion is due to an increase in lipolytic activity, as well as a decrease in de novo lipid synthesis (Sheridan and Kao, 1998). Assuming that the pre-migratory adaptations occurring in this landlocked brown trout population are similar to the changes in carbohydrate metabolism observed during smoltification, our results are in good agreement with these previous findings, since the pentose phosphate pathway, in which Taldo1 is involved, provides NADPH for lipid synthesis. In teleost fish, liver is believed to be the principal site of lipogenesis (Barroso et al., 1998), thus a decrease in lipogenesis during general pre-migratory adaptations and smoltification should be particularly pronounced in liver tissue. From this, we can therefore hypothesise that the observed lower level of Taldo1 transcripts in brown trout at the onset of migration is due to a decreased level of lipid synthesis and thus a decreased need for NADPH generated by the pentose phosphate pathway. This hypothesis is further strengthened by the fact that the Taldo1 expression pattern we found in the sedentary population is similar to the lipid and condition factor dynamics of sedentary trout observed in other studies (Cunjak and Power, 1987; Cunjak, 1988).
334
U. Amstutz et al. / Aquaculture 260 (2006) 326–336
However, in the earlier sampling events, the pattern of Taldo1 expression, especially the pronounced peak in Taldo1 expression in future migratory individuals in January, was not found to correspond to the body condition factor. One explanation for this lack of correlation might be that Taldo1 and the pentose phosphate cycle assume another primary function at this age stage than just before migration. Indeed, the pentose phosphate cycle plays a broader metabolic role than just providing energy for fatty acid synthesis (Cabezas et al., 1999) and is very flexible in adjusting its output to the needs of the cell (Berg et al., 2002, pp. 559–581). Actually, the pentose phosphate pathway can be divided into two parts, an oxidative branch, in which glucose-6-phosphate is oxidised to ribulose-5-phosphate and NADPH is generated, and a non-oxidative branch, which converts the 5-carbon sugars generated into glycolysis intermediates and thus functions as a link to glycolysis. The reactions of the oxidative branch are irreversible, whereas those in the nonoxidative part all work in both directions (Berg et al., 2002, pp. 559–581). This gives the non-oxidative part of the pentose phosphate pathway and its key enzyme, Taldo1, the potential to control the balance between the two branches and thus also the relative amounts of different products generated (Cabezas et al., 1999). Thus, a different level of Taldo1 expression could also lead to a shift in the amount of ribose-5-phosphate generated, relative to the amount of NADPH produced. Therefore, the peak in Taldo1 expression in future migratory trout in January could also be the result of a higher need for ribose for the synthesis of nucleic acids. High needs of a cell for ribose can be due to either high mitotic activity or a high level of RNA synthesis resulting in a large amount of proteins synthesised. Considering the numerous metabolic pathways and other functions in which liver tissue is involved, it is of course not possible to tell from this study, what such proteins could be. Thus, more detailed studies are needed, focusing on these younger age stages, to find out whether this burst in Taldo1 expression in future migratory brown trout is indeed associated with the future life-history of these individuals and whether it is linked to lipid synthesis, high mitotic activity, increased transcription of certain proteins yet to be identified or even another pathway linked to the pentose phosphate cycle. The latter question could be addressed by comparing Taldo1 expression patterns with the expression dynamics of enzymes of the oxidative part of the pentose phosphate pathway, such as its key enzyme, glucose-6phosphate dehydrogenase, to get an impression on the relative importance and the interaction of these two branches during juvenile development of the different lifehistory forms and pre-migratory adaptations.
In conclusion, our results, in combination with the cDNA microarray measurements (Giger et al., 2006), strongly indicate that the Taldo1 enzyme and the pentose phosphate pathway are involved in preparatory changes preceding migration and potentially also in the parr– smolt transformation. With this preliminary study, we were thus able to identify a pathway previously not known to be involved in the development of migratory behaviour, providing a basis for further research on the Taldo1 gene in this context and opening new perspectives to study these smoltification-related processes and their underlying mechanisms. For example, uncovering the mechanisms regulating Taldo1 expression and the pentose phosphate pathway in the liver of juvenile age stages could reveal new insights into the regulation of other traits involved in pre-migratory adaptations or smoltification. Interestingly, human Taldo1 expression was found to be regulated by the transcription factor ZNF143 (Grossman et al., 2004). A homologue of this protein was found in other fish species (Myslinski et al., 2004), thus identification of this protein in salmonids seems feasible and would provide an interesting starting point to study the regulation of Taldo1 expression in the context of the physiological preparation for migration in both anadromous and freshwater-migratory life-history forms. Furthermore, in rainbow trout (Oncorhynchus mykiss), somatostatins were found to influence the activity of another enzymes of the pentose phosphate cycle (Eilertson and Sheridan, 1993). Somatostatins are suspected to be involved in the smoltification process (Sheridan et al., 1998), thus further study of their influence on the pentose phosphate pathway and Taldo1 expression could potentially elucidate links to other processes altered during the development of the migratory phenotype. Investigation of intermediates and secondary products of the hepatic pentose phosphate pathway (Wamelink et al., 2005) might enable studying this pathway in a less invasive way. Identification and localisation of such a metabolite showing altered levels in pre-smolts could thus eventually lead to the development of a phenotyping method for determining future life-histories of yet undifferentiated individuals without killing them. Finally, our finding of a significantly elevated expression level of the Taldo1 gene in future migratory trout compared to sedentary individuals three and a half month before the onset of migration, suggests that global gene expression profiling at these early age stages could be a promising approach for identifying factors regulating the initiation of migratory behaviour and potentially also the smoltification process.
U. Amstutz et al. / Aquaculture 260 (2006) 326–336
Acknowledgements We would like to thank David Bittner for assistance in the field and valuable discussions, Oliver Muehlemann and his group at the IZB, University of Bern, for their support concerning the real-time quantitative PCR experiments, and two anonymous reviewers for constructive comments on earlier versions of the manuscript. This work was supported by the Swiss National Science Foundation grant No. 3100-067136.01 to Carlo R. Largiadèr. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j. aquaculture.2006.06.007. References Agustsson, T., Sundell, K., Sakamoto, T., Ando, M., Björnsson, B.T., 2003. Pituitary gene expression of somatolactin, prolactin, and growth hormone during Atlantic salmon parr–smolt transformation. Aquaculture 222 (1–4), 229–238. Barroso, J.B., Peragón, J., Contreras-Jurado, C., Carcía-Salguero, L., Corpas, F.J., Esteban, F.J., Peinado, M.A., De La Higuera, M., Lupiáñez, J.A., 1998. Impact of starvation-refeeding on kinetics and protein expression of trout liver NADPH-production systems. Am. J. Physiol., Regul. Integr. Comp. Physiol. 274, 1578–1587. Berg, J.M., Tymoczko, J.L., Stryer, L., 2002. Biochemistry, 5th ed. W.H. Freeman and Company, New York. 1064 pp. Bustin, S.A., 2000. Absolute quantification of mRNA using real-time reverse transcription polymerase chain reaction assays. J. Mol. Endocrinol. 25, 169–193. Bustin, S.A., Benes, V., Nolan, T., Pfaffl, M.W., 2005. Quantitative realtime RT-PCR — a perspective. J. Mol. Endocrinol. 34, 597–601. Cabezas, H., Raposo, R.R., Meléndez-Hevia, E., 1999. Activity and metabolic roles of the pentose phosphate cycle in several rat tissues. Mol. Cell. Biochem. 201, 57–63. Champigneulle, A., Melhaoui, M., Maisse, G., Baglinière, J.L., Gillet, C., Gerdeaux, D., 1988. Preliminary study of the brown trout (Salmo trutta L.) in the river Redon, a small tributary of Lake Leman. Bull. Fr. Pech. Piscic. 310, 59–76. Champigneulle, A., Melhaoui, M., Gillet, C., Caudron, A., 2003. Stocking fed fry and demography of the brown trout (Salmo trutta L.) population of the river Redon, a Lake Leman's affluent fragmented by a weir. Bull. Fr. Pech. Piscic. 369, 17–93. Cunjak, R.A., 1988. Physiological consequences of overwintering in streams: the cost of acclimatization? Can. J. Fish. Aquat. Sci. 45, 443–452. Cunjak, R.A., Power, G., 1987. The feeding and energetics of streamresident trout in winter. J. Fish. Biol. 31, 493–511. Dann, S.G., Allison, W.T., Levin, D.B., Hawryshyn, C.W., 2003. Identification of a unique transcript down-regulated in the retina of rainbow trout (Oncorhynchus mykiss) at smoltification. J. Exp. Biol. 206 (24), 4475–4486. Dallas, P.B., Gottardo, N.G., Firth, M.J., Beesley, A.H., Hoffmann, K., Terry, P.A., Freitas, J.R., Boag, J.M., Cummings, A.J., Kees, U.R., 2005. Gene expression levels assessed by oligonucleotide micro-
335
array analysis and quantitative real-time RT-PCR — how well do they correlate? BMC Genomics 6 (Art. No. 59). Dukes, J.P., Deaville, R., Bruford, M.W., Youngson, A.F., Jordan, W.C., 2004. Odorant receptor gene expression changes during the parr–smolt transformation in Atlantic salmon. Mol. Ecol. 13 (9), 2851–2857. Ebbesson, L.O.E., Björnsson, B.T., Stefansson, S.O., Ekström, P., 2000. Free plasma thyroxine levels in coho salmon, Oncorhynchus kisutch, during parr–smolt transformation: comparison with total thyroxine, total triiodothyronine, and growth hormone levels. Fish Physiol. Biochem. 22, 45–50. Eilertson, C.D., Sheridan, M.A., 1993. Differential effects of somatostatin-14 and somatostatin-25 on carbohydrate and lipid metabolism in rainbow trout Oncorhynchus mykiss. Gen. Comp. Endocrinol. 92 (1), 62–70. Elliott, J.M., 1994. Quantitative Ecology of the Brown Trout. Oxford Univ. Press, Oxford. 298 pp. Ewing, R.D., Rodgers, J.D., 1998. Changes in physiological indices of smolting during seaward migration of wild coho salmon, Oncorhynchus kisutch. Aquaculture 168, 69–83. Fessler, J.L., Wagner, H.H., 1969. Some morphological and biochemical changes in steelhead trout during the parr–smolt transformation. J. Fish. Res. Board Canada 26, 2823–2841. Fulton, T., 1902. Rate of growth of seas fishes. Sci. Invest. Fish. Div. Scot. Rept., vol. 20. Giger, T., 2005. Relationships between transcriptome diversity, genetic variability and phenotypic differences in brown trout (Salmo trutta L.). PhD thesis, University of Bern, Zoological Institute, Computational and Molecular Population Genetics Lab. Giger, T., Excoffier, L., Day, P.J.R., Champigneulle, A., Hansen, M.M., Powell, R., Largiadèr, C.R., 2006. Life history shapes gene expression in salmonids. Curr. Biol. 16, R281–R282. Giger, T., Amstutz, U., Excoffier, L., Champigneulle, A., Day, P.J.R., Powell, R., Largiadèr, C.R., in press. The genetic basis of smoltification: functional genomics tools facilitate the search for the needle in the haystack. In: Harris, G., Millner, N.J. (Eds.), Sea Trout: Biology Conservation and Management. Proceedings of the First International Sea Trout Symposium, Cardiff, July 2004. Blackwell Scientific Publications, Oxford. Ginzinger, D.G., 2002. Gene quantification using real-time quantitative PCR: an emerging technology hits the mainstream. Exp. Hematol. 30, 503–512. Grossman, C.E., Qian, Y., Banki, K., Perl, A., 2004. ZNF143 mediates basal and tissue-specific expression of human transaldolase. J. Biol. Chem. 279 (13), 12190–12205. Hoar, W.S., 1976. Smolt transformation: evolution, behaviour and physiology. J. Fish. Res. Board Can. 33, 1233–1252. Hoar, W.S., 1988. The physiology of smolting salmonids. In: Hoar, W.S., Randall, D.J. (Eds.), Fish Physiology. Academic Press, New York, pp. 275–343. Huggett, J., Dheda, K., Bustin, S., Zumla, L., 2005. Real-time RT-PCR normalisation; strategies and considerations. Genes Immun. 6, 279–284. Jonsson, B., Jonsson, N., 1993. Partial migration — niche shift versus sexual-maturation in fishes. Rev. Fish Biol. Fish. 3, 348–365. Kiiskinen, P., Hyvärinen, H., Piironen, J., 2002. Smolting and seasonal variation in the smolt characteristics of one- and two-year-old Saimaa landlocked salmon under fish farm conditions. J. Fish Biol. 60, 1015–1030. Klemetsen, A., Amundsen, P.A., Dempson, J.B., Jonsson, B., Jonsson, N., O'Connell, M.F., Mortensen, E., 2003. Atlantic salmon Salmo salar L., brown trout Salmo trutta L. and Arctic charr Salvelinus
336
U. Amstutz et al. / Aquaculture 260 (2006) 326–336
alpinus (L.): a review of aspects of their life histories. Ecol. Freshw. Fish 12, 1–59. Maindonald, J., Braun, W.J., 2004. DAAG: Data Analysis And Graphics. R package version 0.46. http://www.stats.uwo.ca/DAAG. Mayes, P.A., 1990. The pentose phosphate pathway and other pathways of hexose metabolism. In: Murray, R.K., Granner, D.K., Mayes, P.A., Rodwell, V.W. (Eds.), Harper's Biochemistry. Appleton and Lange, Norwalk, CT. McCormick, S.D., Hansen, L.P., Quinn, T.P., Saunders, R.L., 1998. Movement, migration and smolting of Atlantic salmon (Salmo salar). Can. J. Fish. Aquat. Sci. 55 (Suppl. 1), 77–92. Myslinski, E., Krol, A., Carbon, P., 2004. Characterization of snRNA and snRNA-type genes in the pufferfish Fugu rubripes. Gene 330, 149–158. Nielsen, C., Aarestrup, K., Norum, U., Madsen, S.S., 2003. Premigratory differentiation of wild brown trout into migrant and resident individuals. J. Fish Biol. 63, 1184–1196. Nielsen, C., Aarestrup, K., Norum, U., Madsen, S.S., 2004. Future migratory behaviour predicted from premigratory levels of gill Na+/K+-ATPase activity in individual wild brown trout (Salmo trutta). J. Exp. Biol. 207, 527–533. Nilsen, T.O., Ebbesson, L.O.E., Stefansson, S.O., 2003. Smolting in anadromous and landlocked strains of Atlantic salmon (Salmo salar). Aquaculture 222, 71–82. Olsson, I.C., Greenberg, L.A., 2004. Partial migration in a landlocked brown trout population. J. Fish Biol. 65, 106–121. Peirson, S.N., Butler, J.N., Foster, R.G., 2003. Experimental validation of novel and conventional approaches to quantitative real-time PCR data analysis. Nucleic Acids Res. 31 (14), e73. Pfaffl, M.W., Tichopad, A., Prgomet, C., Neuvians, T., 2004. Determination of stable housekeeping genes, differentially regulated target genes and sample integrity: BestKeeper — Excel-based tool using pair-wise correlations. Biotechnol. Lett. 26, 509–515. R Development Core Team, 2004. R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria. http://www.R-project.org. Rajeevan, M.S., Vernon, S.D., Taysavang, N., Unger, E.R., 2001. Validation of array-based gene expression profiles by real-time (kinetic) RT-PCR. J. Mol. Diagnostics 3 (1), 26–31. Richards, J.G., Semple, J.W., Bystriansky, J.S., Schulte, P.M., 2003. Na+/K+-ATPase α-isoform switching in gills of rainbow trout (Oncorhynchus mykiss) during salinity transfer. J. Exp. Biol. 206, 4475–4486. Saunders, R.L., Harmon, P.R., Knox, D.E., 1994. Smolt development and subsequent sexual maturity in previously mature male Atlantic salmon (Salmo salar). Aquaculture 121, 79–93.
Schena, M., Shalon, D., Davis, R.W., Brown, P.O., 1995. Quantitative monitoring of gene-expression patterns with a complementaryDNA microarray. Science 270, 467–470. Schulz, U.H., 1999. Downstream migration of European lake trout Salmo trutta f. lacustris L., and resident brown trout, Salmo trutta f. fario L., progeny in a Lake Constance affluent river. Fish. Manage. Ecol. 6, 187–194. Sheridan, M.A., 1989. Alterations in lipid metabolism accompanying smoltification and seawater adaptation of salmonid fish. Aquaculture 82, 191–203. Sheridan, M.A., Kao, Y.H., 1998. Regulation of metamorphosisassociated changes in the lipid metabolism of selected vertebrates. Am. Zool. 38 (2), 350–368. Sheridan, M.A., Eilertson, C.D., Kerstetter, T.H., 1998. Changes in plasma somatostatin associated with seawater adaptation and stunting of coho salmon Oncorhynchus kisutch. Aquaculture 168, 195–203. Shrimpton, J.M., Björnsson, B.T., McCormick, S.D., 2000. Can Atlantic salmon smolt twice? Endocrine and biochemical changes during smolting. Can. J. Fish. Aquat. Sci. 57, 1969–1976. Stefansson, S.O., McGinnity, P., Björnsson, B.Th., Schreck, C.B., McCormick, S.D., 2003. The importance of smolt development to salmon conservation, culture and management: perspectives from the 6th International Workshop on Salmonid Smoltification. Aquaculture 222, 1–14. Sundell, K., Dellefors, C., Björnsson, B.Th., 1998. Wild and hatcheryreared brown trout, Salmo trutta, differ in smolt related characteristics during parr–smolt transformation. Aquaculture 167, 53–65. Vandesompele, J., De Preter, K., Pattyn, F., Poppe, B., Van Roy, N., De Paepe, A., Speleman, F., 2002. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 3 (7), 0034.1–0034.11. Wamelink, M.M., Struys, E.A., Huck, J.H., Roos, B., van der Knaap, M.S., Jakobs, C., Verhoeven, N.M., 2005. Quantification of sugar phosphate intermediates of the pentose phosphate pathway by LC-MS/MS: application to two new inherited defects of metabolism. J. Chromatogr., B, Analyt. Technol. Biomed. Life Sci. 823 (1), 18–25. Wurmbach, E., Yuen, T., Sealfon, S.C., 2003. Focused microarray analysis. Methods 31, 306–316. Yuen, T., Wurmbach, E., Pfeffer, R.L., Ebersole, B.J., Sealfon, S.C., 2002. Accuracy and calibration of commercial oligonucleotide and custom cDNA microarrays. Nucleic Acids Res. 30 (10), e48.
Distinct temporal patterns of Transaldolase 1 gene expression in future migratory and sedentary brown trout (Salmo trutta) Ursula Amstutz a , Thomas Giger a , Alexis Champigneulle b , Philip J.R. Day c , Carlo R. Largiadèr a,d,⁎ a
c
CMPG (Computational and Molecular Population Genetics Lab), Zoological Institute, University of Bern, Baltzerstrasse 6, CH-3012 Bern, Switzerland b Station d'Hydrobiologie Lacustre de Thonon, INRA (Institute National de la Recherche Agronomique), 75 avenue de Corzent, F-74203 Thonon-les-Bains, France Centre for Integrated Genomic Medical Research, University of Manchester, Stopford Building, Oxford Road, Manchester, M13 9PT, UK d Institute of Clinical Chemistry, Inselspital, University Hospital, University of Bern, CH-3010 Bern, Switzerland Received 2 November 2005; received in revised form 7 June 2006; accepted 9 June 2006
Abstract The occurrence of sedentary and migratory life-history forms is common in several salmonid fish species. A cDNA microarray study, investigating differences between these life-history forms at the level of the transcriptome, identified the transaldolase 1 gene (Taldo1) as being differently expressed in liver between sedentary and migratory brown trout populations just before the onset of migration. The aim of the study presented here was to gain further knowledge about the potential role of this gene during preparatory changes associated with the migratory life-history and the time of onset of this expression difference by investigating its expression levels in several juvenile age stages of sedentary and freshwater-migratory brown trout. A quantitative real-time PCR assay was established for the Taldo1 gene to measure its expression levels in liver samples of brown trout and Atlantic salmon. Taldo1 transcript levels were significantly lower in migratory brown trout and Atlantic salmon at the onset of migration compared to sedentary trout of the same age, confirming the results obtained by cDNA microarray technology. Comparison of Taldo1 expression patterns with changes in body condition factor led to the hypothesis that the observed lower levels of Taldo1 expression in migratory individuals are associated with the depletion of lipid stores during premigratory adaptations, potentially related to the smoltification process observed in anadromous salmonids, and a joint reduction in de novo lipid synthesis. Analysis of three juvenile stages of morphologically undifferentiated future migratory and sedentary brown trout revealed a significantly elevated expression level of the Taldo1 gene in future migratory trout compared to sedentary individuals three and a half month before the onset of migration, indicating an early signal potentially useful for predicting the future lifehistory of an individual. These results suggest that physiological differences between life-history forms might be measurable before morphological differentiation and that further study of such younger age stages could reveal new insights into the regulation and initiation of life-history related physiological, morphological and behavioural changes. © 2006 Elsevier B.V. All rights reserved. Keywords: Life-history; Brown trout; Salmo trutta; Transaldolase 1; Gene expression; Real-time PCR
1. Introduction ⁎ Corresponding author. Tel.: +41 31 632 95 45; fax: +41 31 632 89 66. E-mail address: [email protected] (C.R. Largiadèr). 0044-8486/$ - see front matter © 2006 Elsevier B.V. All rights reserved. doi:10.1016/j.aquaculture.2006.06.007
Brown trout (Salmo trutta) is an ecologically very diverse species also showing considerable variation in life-
U. Amstutz et al. / Aquaculture 260 (2006) 326–336
history, encompassing sea migratory (anadromous) fish, lake-dwelling trout and resident individuals that never leave their native rivers (Elliott, 1994). This life-history variation, as in other salmonid species, is likely to be influenced by a complex interaction of environmental and genetic factors (Jonsson and Jonsson, 1993; Klemetsen et al., 2003). Migratory individuals undergo several preparatory adaptations prior to migration, involving dramatic morphological, physiological and behavioural changes (Hoar, 1988). This process, called smoltification in anadromous populations, has been studied quite extensively in various salmonid species, since it is of interest not only to ecologists and evolutionary biologists, but also to the aquaculture industry. The desired phenotype in aquaculture of salmonid fish is the smolt phenotype, due to its adaptability to sea-water, the larger size of the fish, the higher quality of the meat and the less territorial behaviour compared to sedentary phenotypes, thus allowing rearing at higher densities. Species showing a high amount of plasticity in life-history traits, such as the brown trout, are ideal model organisms to study the genetic basis and the regulating mechanisms underlying smoltification and related processes (Elliott, 1994; Klemetsen et al., 2003). Since there are similarities in these pre-migratory changes between different salmonid species, findings from brown trout studies may also be transferable to other species with greater aquacultural importance. The genetic basis and the mechanisms underlying the regulation and initiation of migratory behaviour and the parr–smolt transformation are very complex and still poorly understood (Stefansson et al., 2003). Most of the studies on physiological characteristics affected by smoltification revealed changes just before or during smolting (Ewing and Rodgers, 1998; Ebbesson et al., 2000; Shrimpton et al., 2000). However, in Atlantic salmon, the decision to undergo smoltification and subsequent downstream migration the next spring is thought to be made earlier in the life of future migratory individuals (Saunders et al., 1994). Therefore, it would be of great interest to also find physiological signs of future migratory behaviour already in earlier age stages, which could give additional insights into the initiation of migratory behaviour and potentially be used to phenotype individuals early before morphological differentiation (Nielsen et al., 2003, 2004), thus giving room for economic optimizations in aquaculture. So far, relatively few studies addressed smoltification or processes related to migratory behaviour at the level of changes in gene expression (Dann et al., 2003; Dukes et al., 2004), most of them focusing on genes and pathways already known to be involved in these processes, such as growth hormones and Na+, K+-ATPase (Agustsson et al., 2003; Richards et al., 2003).
327
Recently, it has been shown that the application of cDNA microarrays (Schena et al., 1995) represents a powerful approach for the identification of new candidate genes involved in pre-migratory changes potentially related to the smoltification process (Giger, 2005; Giger et al., 2006). In this study, gene expression levels of about 900 genes were measured in liver tissue of six brown trout populations, three of which were sedentary, two lake-migratory and one anadromous, and a Scottish hatchery strain of Atlantic salmon (S. salar). Migratory phenotypes with a smolt-like appearance were sampled at the same age stage as sedentary individuals, just before leaving their natal streams. A top candidate among the 268 genes that contributed to a general difference between migratory and sedentary populations, thus showing strong life-history correlated expression differences, was the gene encoding for transaldolase 1 (Taldo1; EC 2.2.1.2.), which is further investigated in the study presented here. Using a real-time quantitative PCR approach (Bustin, 2000), these expression differences were partly confirmed (Giger, 2005), since validation of cDNA microarray measurements by an independent method is strongly recommended (Wurmbach et al., 2003). Due to its high sensitivity and large dynamic range, real-time quantitative PCR (Bustin, 2000) has recently become the method of choice to accurately measure the expression of a single gene in biological samples. It is also the recommended method for the validation of microarray data (Bustin, 2000; Rajeevan et al., 2001; Ginzinger, 2002). Taldo1 is the key enzyme of the non-oxidative branch of the pentose phosphate pathway, an alternative pathway of glucose metabolism, in which glucose is oxidised, generating NADPH and 5-carbon sugar intermediates, such as ribose-5-phosphate (Mayes, 1990; Berg et al., 2002, pp. 559–581). Whereas ribose-5-phosphate is needed for nucleic acid synthesis, NADPH is required for the reductive synthesis of energy-rich biological molecules such as fatty acids and steroids. Thus, the pentose phosphate pathway is thought to play a particularly important role in liver and adipose tissue (Cabezas et al., 1999). The aim of the study presented here was to gain further knowledge about the time of onset of the observed changes in Taldo1 expression and the potential role of Taldo1 during pre-migratory adaptations in natural, landlocked brown trout populations, migratory individuals of which display smoltification-like changes similar to those observed in anadromous fish. Although these freshwater-migratory individuals may not undergo the complete process of smoltification, thus limiting the conclusions that can be drawn in relation to this process, this study system enabled the discrimination of morphologically undifferentiated future migratory and sedentary
328
U. Amstutz et al. / Aquaculture 260 (2006) 326–336
individuals in a natural setting, while minimising confounding environmental and genetic effects. Therefore, transcript levels of the Taldo1 gene in liver tissue could be measured in three different juvenile stages to obtain temporal expression patterns of this gene before and during morphological differentiation of life-history forms. To this purpose, we established a real-time quantitative PCR assay for the measurement of mRNA levels of the Taldo1 gene in brown trout and Atlantic salmon liver. Furthermore, in order to fully confirm the findings from previous cDNA microarray experiments and to assess the reproducibility of these results, sedentary and migratory brown trout at the age stage just before downstream migration were analysed from two different years. 2. Materials and methods 2.1. Study system and biological material The temporal analysis of Taldo1 gene expression dynamics was carried out using brown trout individuals originating from the river Redon, an affluent of Lake Geneva (Fig. 1). The particular advantage of this study system is based on the same river harbouring two brown trout populations (Fig. 1), which are geographically very close, yet have been separated by an insurmountable artificial dam for more than 40 years (Champigneulle et al.,
2003). Due to this very recent separation, the two populations are not only in geographical proximity, but also genetically closely related (Giger et al., 2006). Whereas the population above the barrier is entirely sedentary (Champigneulle et al., 1988), the vast majority of the sub-yearlings from the population below the obstacle develops smolt characteristics such as schooling behaviour, streamlined shape and body silvering (cf. Figure S1 in Giger et al., 2006) and migrates into the lake. As migratory individuals from this population do not migrate into the sea, it is unclear whether they undergo the complete process of smoltification including saltwater adaptation. However, since these individuals clearly develop morphological and behavioural changes that are similar to smolting, as it is also the case for other lake-dwelling brown trout populations and landlocked salmon (Schulz, 1999; Kiiskinen et al., 2002; Nilsen et al., 2003; Olsson and Greenberg, 2004), physiological processes associated with migration in anadromous populations may also occur in this population of fish. Furthermore, Giger et al. (2006) observed that global gene expression levels in liver tissue of this freshwater-migratory population are more similar to those of an anadromous brown trout population than to those of sedentary populations. This indicates that in these populations, similar processes are taking place in liver tissue of all populations with a migratory life-history, independent of whether they migrate to the sea or a lake.
Fig. 1. Map of brown trout sampling locations in the French part of the Lake Geneva area. 1: Redon migratory population (46°21′03″N, 6°24′06″E); 2: Redon sedentary population (46°20′06″N, 6°25′21″E); 3: Chevenne sedentary population (46°17′50″N, 6°47′6″E); W: Weir, migration obstacle.
U. Amstutz et al. / Aquaculture 260 (2006) 326–336
This almost complete physical separation of sedentary and migratory individuals allows the study of lifehistory related traits under natural conditions and at age stages, when the two different forms are not morphologically distinguishable yet, which was crucial since we had to sacrifice the fish for our studies. Even though it is not possible to entirely rule out environmental effects in this setting, as would be in the case of a common garden experiment, the study of life-history related processes under such natural conditions nevertheless seems particularly important, since they seem to be determined by the interaction of genetic and environmental factors (Hoar, 1988; Jonsson and Jonsson, 1993; Klemetsen et al., 2003). In order to minimise potential confounding genetic and environmental effects, which are not related to life-history differences, we have chosen these genetically closely related populations (Giger et al., 2006), which, due to the geographical proximity, share a highly similar environment. 2.2. Sampling The samples used for the verification of the cDNA microarray data included 15 individuals of age class 1+ each from the resident (RSED) and migratory (RMIG) brown trout population from the river Redon (Fig. 1) collected in late April 2003, just before the onset of down-stream migration of the smolt-like fish. Additionally, another 15 individuals of the same age were caught from a sedentary brown trout population (CSED) in the Chevenne river (Fig. 1) in early June of the same year, as well as 10 Atlantic salmon smolts (SMIG) from a domesticated strain, which were kept in 250 litre recirculating freshwater tanks at 12 °C. For the temporal analysis of the Taldo1 gene expression dynamics, 20 individuals were sampled each from the two Redon populations in November 2004, January, March and May 2005, all belonging to the 2004 cohort (aged 0+, becoming 1+ in spring). All trout were caught by electrofishing and immediately killed with an overdose of the anesthetic 2-phenoxyethanol (Sigma). Liver samples were immediately extracted, transferred into the RNA stabilizing agent RNAlater (Ambion) and subsequently
329
stored at −30 °C. Before extraction of the liver tissue, fork length and wet weight of all trout were measured. Exact sampling dates, sample sizes, mean fork length and mean wet weight for all populations and sampling events are given in Supplementary Table 1. 2.3. Selection of reference genes for normalisation of real-time PCR measurements Essential for the success of any real-time PCR experiment is the use of suitable reference genes for normalisation of the data to account for experimentally introduced variation in the amount and quality of starting material (Bustin, 2000; Bustin et al., 2005; Huggett et al., 2005). The availability of microarray data (Giger, 2005) enabled us to identify and select the most stably expressed genes among about a thousand genes for the use as reference genes in the real-time PCR analysis. In more detail, Giger (2005) measured expression levels of genes expressed in liver of brown trout and Atlantic salmon using cDNA microarrays containing 1098 gene probes. From this data, three genes were selected to be used for the normalisation of the real-time PCR data, which showed an expression level in the range of Taldo1, maximal homogeneity of population mean expression levels and minimal variance (as measured by the coefficient of variation, CV) in expression levels within populations. The three genes selected encode for the ribosomal protein L10 (RPL10), the coagulation factor VII (FVII) and prosaposin, as established by sequence comparison with annotated protein databases (Giger, 2005). To our knowledge, none of these genes has ever been reported to be involved in smoltification or associated processes. 2.4. Real-time PCR analysis Total RNA was extracted using the Absolutely RNA RT-PCR Miniprep kit (Stratagene). Reverse transcription was performed as described by Giger (2006). TaqMan™ probes and primers were designed and manufactured by Applied Biosystems, Assay-by-Design, for the Taldo1 gene and the three reference genes RPL10, FVII and prosaposin. A preliminary study (Giger et al., in press)
Table 1 TaqMan probes and primer sequences of the real-time quantitative PCR assays for the Taldo1 gene and the three reference genes Gene
TaqMan probe
Forward primer
Reverse primer
Amplicon size (bp)
Taldo1 RPL10 FVII Prosaposin
5′CCTCAGGTCCGCCCTTG 5′CCCGTCTGGAGCCTGT 5′TATTCCCCTGCGACCACCA 5′CTGACCTGTGCAAGCAG
5′GCCGCCTACCAGCATCT 5′CCTTCCATGTCATCCGTATCAACAA 5′TCGTGGATAGAGACACCAAGGA 5′ACCTTCGTCAACTCTCTGATCGA
5′AGCTTGTCCATGGTGTTGGT 95 5′AGACATGATCACCTGACCGATTC 134 5′TGCCCTCTTCTACGTCAATGTTG 69 5′GAGCGTACTGGCTGACGTA 100
330
U. Amstutz et al. / Aquaculture 260 (2006) 326–336
Table 2 Pair-wise correlations between the three reference genes and their geometric mean (GM): Correlation coefficient R (below diagonal) and corresponding p-values (above diagonal) vs.
Prosaposin
Prosaposin FVII RPL10 GM
0.741 0.889 0.947
FVII
RPL10
GM
<0.001
<0.001 <0.001
<0.001 <0.001 <0.001
0.784 0.893
0.956
showed no indication for the occurrence of different splice variants for Taldo1, thus levels of only one single transcript needed to be measured. All assays were designed to span exon–exon junctions in order to minimise co-amplification of contaminating genomic DNA. Sequences of primers and probes are given in Table 1. For each assay, the reaction efficiency and the optimal cDNA input amount were determined by running a series of five dilutions ranging from 1:1 (corresponding to cDNA synthesised from 50 ng of total RNA) to 1:1024 for one migratory and one sedentary Redon individual of the 2003 sampling, each in duplicate. From the slopes of the resulting standard curves, the reaction efficiency (E) was calculated using the equation E = 10− 1 / slope as described in the instructions provided by the manufacturer (Applied Biosystems). The average efficiency of these two samples was used for all subsequent calculations. All reactions were carried out on an ABI Prism 7000 Sequence Detection System (Applied Biosystems). One reaction contained 12.5 μl TaqMan™ 2× Universal PCR Master Mix, No AmpErase UNG (Applied Biosystems), 1.25 μl 20× Assay Mix (TaqMan™ Assay-by-Design, Applied Biosystems) and cDNA synthesized from 12.5 ng total RNA, made up with DEPC treated water to add up to
a final reaction volume of 25 μl. The same thermal profile was used as recommended by the manufacturer (2 min at 50 °C, 10 min at 90 °C, 40 cycles with 15 s at 95 °C and 1 min at 60 °C). For each sample, separate reactions for the four genes were run in duplicate on a 96-well optical plate and repeated also in duplicate on another plate, including repetition of the reverse transcription step, to account for experimental error within, as well as between plates, resulting in a total of four measurements of each gene per sample. The starting template quantity was determined as described by Peirson et al. (2003, Eq. 2) for the Taldo1 gene and the three reference genes. To correct for technical variation in starting material and sample quality, the measurements for Taldo1 were normalized to the geometric mean of the three reference genes as proposed by Vandesompele et al. (2002). This method was recently stated to be robust and appropriate if rather fine expression differences are to be measured (Huggett et al., 2005). Sample sizes ranged from eight to ten individuals per sampling event and population, resulting in a total of 115 individuals analysed by real-time PCR (exact numbers are given in Supplementary Table 1). 2.5. Calculations and statistical analysis For all trout sampled in the river Redon, a condition factor was calculated for each individual analysed by realtime PCR using the equation CF = (weight / length3) × 100 (Fulton, 1902). Wet weight of the fish was measured in grams; fork length was measured in centimetres. All statistical analyses were performed using the statistics software R for Windows (R Development Core Team, 2004). To assess the correlation between two
Fig. 2. Box plots of normalised Taldo1 expression levels assessed in three (microarray) respectively five (real-time PCR) brown trout and one Atlantic salmon population by cDNA microarray analysis (a) and real-time quantitative PCR (b). The whiskers indicate the 1.5 interquartile ranges. Abbreviations: SMIG: Atlantic salmon, RMIG03: Redon migratory population, sampled in 2003, RMIG05: Redon migratory population sampled in 2005, RSED03: Redon sedentary population sampled in 2003, RSED05: Redon sedentary population sampled in 2005, CSED: Chevenne sedentary population.
U. Amstutz et al. / Aquaculture 260 (2006) 326–336
331
Table 3 P-values (above diagonal) and fold-changes in Taldo1 expression (below diagonal) of pair-wise comparisons between sedentary and migratory brown trout populations and one Atlantic salmon population at the smolt stage Smig Smig Rmig03 Rmig05 Rsed03 Rsed05 Csed
1.8 2.3 3.1 4.4 4.7
Rmig03
Rmig05
Rsed03
Rsed05
Csed
0.002**
0.002** 0.155n.s.
<0.001*** <0.001*** 0.074n.s.
<0.001*** <0.001*** <0.001*** 0.011*
<0.001*** <0.001*** <0.001*** 0.010* 0.681n.s.
1.3 1.7 2.5 2.6
1.3 1.9 2.0
1.4 1.5
1.1
Comparisons between life-history forms are indicated in bold.
variables, the Pearson's product moment correlation coefficient R was calculated. Population mean expression levels of the Taldo1 gene were tested for statistically significant differences by performing permutation tests with 100,000 permutations (Maindonald and Braun, 2004); significant differences were established at the 0.05 level. Fold-changes in gene expression were calculated by dividing the larger of two population means by the smaller one. 3. Results 3.1. Stable expression of reference genes Employing the method proposed by Pfaffl et al. (2004), pair-wise correlations between unnormalised raw measurements of the three reference genes RPL10, FVII and prosaposin were used to assess the stability of the expression of these genes. All three genes showed strong and highly significant correlations with coefficients between 0.74 and 0.89 (Table 2), which is in a similar range as reported by Pfaffl et al. (2004) (R-values: 0.72–0.80) for commonly used reference genes. All three reference genes were also tightly correlated to their geometric mean (R > 0.89; Table 2), indicating its suitability for the normalisation of the Taldo1 measurements. Given the strong correlations of the three reference genes with their geometric mean with none of them performing systematically worse than the two others, normalisation to the geometric mean of these three genes can be considered the optimal normalisation strategy for this study.
(Fig. 2b). The findings from the cDNA microarray experiment proved to be reproducible over different years as well, as also in the year 2005, migratory brown trout at the same age stage (RMIG05) showed significantly lower Taldo1 transcript levels than the sedentary population (RSED05), when measured by real-time PCR. All pair-wise comparisons across life-history phenotypes were highly significant (Table 3, above diagonal) with migratory populations always showing a lower Taldo1 expression level, except for one comparison between migratory brown trout sampled in May 2005 (RMIG05) and sedentary brown trout individuals sampled in April 2003 (RSED03). This lack of significance can easily be explained by the generally higher levels of Taldo1 transcripts in the year 2005 compared to the samples from the year 2003, since the Taldo1 expression level is also significantly higher in the sedentary population from 2005 (RSED05) compared to the same population sampled in 2003 (RSED03).
3.2. Confirmation of cDNA microarray screening results Normalised expression levels of the Taldo1 gene obtained by cDNA microarray assessment are shown in Fig. 2a. Analysis of the same samples by real-time quantitative PCR showed the same pattern with Taldo1 expression being the lowest in salmon smolts (SMIG) and the highest in the Chevenne sedentary population (CSED)
Fig. 3. Correlation between log2 transformed individual Taldo1 expression levels in liver of brown trout and Atlantic salmon obtained by cDNA microarray and by real-time PCR analysis, respectively.
332
U. Amstutz et al. / Aquaculture 260 (2006) 326–336
Measurements by real-time PCR and cDNA microarray analysis were highly significantly correlated (R = 0.77, p < 0.00001, Fig. 3) with a correlation coefficient in the same range as assessed by Dallas et al. (2005). The fold-changes in gene expression between two populations were found to be consistently higher when determined by real-time PCR than when assessed by microarray analysis, which is in agreement with other findings (Yuen et al., 2002; Dallas et al., 2005). All foldchanges between populations assessed by real-time PCR are shown in Table 3, population mean expression levels are given in Supplementary Table 1.
Table 4 Fold-changes in Taldo1 expression, sample sizes (n) and p-values of comparisons between future migratory and sedentary brown trout at different age stages
3.3. Temporal expression dynamics of the Taldo1 gene
March, expression of the Taldo1 gene decreased in both populations and reached almost identical levels in March. Afterwards, Taldo1 transcript levels showed a strong increase in the Redon sedentary population, whereas they slightly continued to decrease in the migratory population, resulting in a highly significant difference between the two populations in May, right before the onset of migration. Comparison of Taldo1 expression dynamics with the temporal dynamics of the condition factor of the fish revealed a very similar pattern in the second half of the time series with the condition factor showing low levels in both populations in March with a subsequent strong increase in the sedentary population (Fig. 4). As Taldo1 levels, condition factors were significantly lower in individuals ready for migration than in the sedentary trout of the same age (p < 0.001 in the 2003 samples, p < 0.05 in the 2005 samples).
Temporal changes in Taldo1 expression were more pronounced in future migratory than in sedentary trout (Fig. 4). In November, about six month before the onset of migration, no significant difference in Taldo1 transcript levels was found between 0+ individuals of the two populations (Table 4). Whereas Taldo1 expression subsequently slightly decreased in the Redon sedentary population (RSED), a strong increase was found in the future migratory individuals (RMIG), displaying the highest level of Taldo1 expression measured throughout the entire time series (Fig. 4). Due to this strong increase in the migratory population, Taldo1 expression was found to be significantly different in the two populations in January (Table 4), three and a half month before the onset of downstream migration. Between January and
Sampling date
Age
n (RMIG / RSED)
Fold-changea
p-value
Apr 03 Nov 04 Jan 05 Mar 05 May 05
1+ 0+ 0+ 1+ 1+
9 9 9 10 10
− 1.684 − 1.188 +1.542 +1.006 − 1.899
<0.001*** 0.193n.s. 0.033* 0.967n.s. <0.001***
/ 10 / 10 / 10 / 10 / 10
a
Fold-changes are indicated as the expression of the Taldo1 gene in the migratory population with respect to the sedentary population.
Fig. 4. Temporal dynamics of Taldo1 expression and body condition factor in juvenile brown trout. Filled symbols: Redon migratory population, open symbols: Redon sedentary population, circles: Taldo 1 expression level, triangles: condition factor. Error bars represent the standard error of the mean (SE). Corresponding population mean Taldo1 expression levels and condition factors are given in Supplementary Table 1.
U. Amstutz et al. / Aquaculture 260 (2006) 326–336
4. Discussion Our real-time quantitative PCR analysis clearly confirmed the lower hepatic expression level of the Taldo1 gene observed in the cDNA microarray screening in brown trout preparing for downstream migration, compared to resident individuals of the same age. Furthermore, we found that this expression difference is reproducible over years. These results strengthen the hypothesis that this gene might be involved in premigratory adaptations similar to the smoltification process and thus suggest that also the metabolic pathway in which Taldo1 is located, the pentose phosphate pathway, is altered during the development of the migratory phenotype. Additionally, in agreement with our findings, the same gene expression pattern was observed in three brown trout populations from Denmark using cDNA microarray technology, with one sedentary population showing high levels of Taldo1 expression and lower transcript levels in two migratory populations, one of which is freshwater-migratory and the other one anadromous (Giger, 2005; Giger et al., 2006). This finding suggests that the observed pattern is common to both anadromous and freshwater-migratory populations, as already indicated by the low level of Taldo1 transcripts observed in Atlantic salmon smolts in this study. Interestingly, differences in Taldo1 expression between resident and migratory brown trout were also detected in younger age stages of the two populations studied. Trout undergoing downstream migration the next spring showed a very pronounced peak in Taldo1 expression in January, thus greatly preceding morphological differentiation, which is not seen in the sedentary individuals. In future migratory trout, the highest level of Taldo1 expression throughout the entire study was found at this peak in January, whereas the highest expression levels in sedentary individuals were seen in November and May. This results in very distinct temporal expression patterns of this gene in juvenile stages of these two populations, suggesting that the decision to follow a migratory lifehistory in the next spring is made earlier in the life of these fish and that already in winter, physiological differences are measurable. However, the reproducibility of this finding needs to be assessed in other populations, ideally also including anadromous ones, to clearly establish that the observed early gene expression difference is associated to the different life-histories and not locally variable environmental factors. If these early distinct temporal expression patterns should indeed prove to be generally observable in sedentary and migratory fish, this gene could potentially be used to
333
phenotype individuals for their future life-history strategy already at this age stage. Since this expression difference was found in freshwater-dwelling populations, it is probably not related to saltwater adaptation and thus its application would not be restricted to anadromous populations, as it might be the case for Na+, K+-ATPase, which has previously been used as an indicator for smoltification (Nielsen et al., 2004). An important question that arises from our data is how the Taldo1 gene and the pentose phosphate pathway could functionally be linked to the pre-migratory changes observed in this population and potentially also the smoltification process. Since the two major roles of the pentose phosphate pathway are the production of NADPH for reductive biosyntheses and the generation of ribose-5-phosphate for nucleic acid synthesis, a link is likely to be found in either one or both of those functions. In our time series analysis, we found similar temporal patterns of Taldo1 expression and body condition factor in spring. Indeed, the observed decrease of the body condition factor in the migratory individuals in spring is a known characteristic of smoltification of anadromous populations (Hoar, 1988; Sundell et al., 1998), since the bodies of the fish become more streamlined during this time. This can be explained by the depletion of energy reserves, including lipid stores, which is also observed during the parr–smolt transformation (Hoar, 1976; Sheridan, 1989), in combination with increased growth rates (Fessler and Wagner, 1969; McCormick et al., 1998). This smoltification-associated lipid depletion is due to an increase in lipolytic activity, as well as a decrease in de novo lipid synthesis (Sheridan and Kao, 1998). Assuming that the pre-migratory adaptations occurring in this landlocked brown trout population are similar to the changes in carbohydrate metabolism observed during smoltification, our results are in good agreement with these previous findings, since the pentose phosphate pathway, in which Taldo1 is involved, provides NADPH for lipid synthesis. In teleost fish, liver is believed to be the principal site of lipogenesis (Barroso et al., 1998), thus a decrease in lipogenesis during general pre-migratory adaptations and smoltification should be particularly pronounced in liver tissue. From this, we can therefore hypothesise that the observed lower level of Taldo1 transcripts in brown trout at the onset of migration is due to a decreased level of lipid synthesis and thus a decreased need for NADPH generated by the pentose phosphate pathway. This hypothesis is further strengthened by the fact that the Taldo1 expression pattern we found in the sedentary population is similar to the lipid and condition factor dynamics of sedentary trout observed in other studies (Cunjak and Power, 1987; Cunjak, 1988).
334
U. Amstutz et al. / Aquaculture 260 (2006) 326–336
However, in the earlier sampling events, the pattern of Taldo1 expression, especially the pronounced peak in Taldo1 expression in future migratory individuals in January, was not found to correspond to the body condition factor. One explanation for this lack of correlation might be that Taldo1 and the pentose phosphate cycle assume another primary function at this age stage than just before migration. Indeed, the pentose phosphate cycle plays a broader metabolic role than just providing energy for fatty acid synthesis (Cabezas et al., 1999) and is very flexible in adjusting its output to the needs of the cell (Berg et al., 2002, pp. 559–581). Actually, the pentose phosphate pathway can be divided into two parts, an oxidative branch, in which glucose-6-phosphate is oxidised to ribulose-5-phosphate and NADPH is generated, and a non-oxidative branch, which converts the 5-carbon sugars generated into glycolysis intermediates and thus functions as a link to glycolysis. The reactions of the oxidative branch are irreversible, whereas those in the nonoxidative part all work in both directions (Berg et al., 2002, pp. 559–581). This gives the non-oxidative part of the pentose phosphate pathway and its key enzyme, Taldo1, the potential to control the balance between the two branches and thus also the relative amounts of different products generated (Cabezas et al., 1999). Thus, a different level of Taldo1 expression could also lead to a shift in the amount of ribose-5-phosphate generated, relative to the amount of NADPH produced. Therefore, the peak in Taldo1 expression in future migratory trout in January could also be the result of a higher need for ribose for the synthesis of nucleic acids. High needs of a cell for ribose can be due to either high mitotic activity or a high level of RNA synthesis resulting in a large amount of proteins synthesised. Considering the numerous metabolic pathways and other functions in which liver tissue is involved, it is of course not possible to tell from this study, what such proteins could be. Thus, more detailed studies are needed, focusing on these younger age stages, to find out whether this burst in Taldo1 expression in future migratory brown trout is indeed associated with the future life-history of these individuals and whether it is linked to lipid synthesis, high mitotic activity, increased transcription of certain proteins yet to be identified or even another pathway linked to the pentose phosphate cycle. The latter question could be addressed by comparing Taldo1 expression patterns with the expression dynamics of enzymes of the oxidative part of the pentose phosphate pathway, such as its key enzyme, glucose-6phosphate dehydrogenase, to get an impression on the relative importance and the interaction of these two branches during juvenile development of the different lifehistory forms and pre-migratory adaptations.
In conclusion, our results, in combination with the cDNA microarray measurements (Giger et al., 2006), strongly indicate that the Taldo1 enzyme and the pentose phosphate pathway are involved in preparatory changes preceding migration and potentially also in the parr– smolt transformation. With this preliminary study, we were thus able to identify a pathway previously not known to be involved in the development of migratory behaviour, providing a basis for further research on the Taldo1 gene in this context and opening new perspectives to study these smoltification-related processes and their underlying mechanisms. For example, uncovering the mechanisms regulating Taldo1 expression and the pentose phosphate pathway in the liver of juvenile age stages could reveal new insights into the regulation of other traits involved in pre-migratory adaptations or smoltification. Interestingly, human Taldo1 expression was found to be regulated by the transcription factor ZNF143 (Grossman et al., 2004). A homologue of this protein was found in other fish species (Myslinski et al., 2004), thus identification of this protein in salmonids seems feasible and would provide an interesting starting point to study the regulation of Taldo1 expression in the context of the physiological preparation for migration in both anadromous and freshwater-migratory life-history forms. Furthermore, in rainbow trout (Oncorhynchus mykiss), somatostatins were found to influence the activity of another enzymes of the pentose phosphate cycle (Eilertson and Sheridan, 1993). Somatostatins are suspected to be involved in the smoltification process (Sheridan et al., 1998), thus further study of their influence on the pentose phosphate pathway and Taldo1 expression could potentially elucidate links to other processes altered during the development of the migratory phenotype. Investigation of intermediates and secondary products of the hepatic pentose phosphate pathway (Wamelink et al., 2005) might enable studying this pathway in a less invasive way. Identification and localisation of such a metabolite showing altered levels in pre-smolts could thus eventually lead to the development of a phenotyping method for determining future life-histories of yet undifferentiated individuals without killing them. Finally, our finding of a significantly elevated expression level of the Taldo1 gene in future migratory trout compared to sedentary individuals three and a half month before the onset of migration, suggests that global gene expression profiling at these early age stages could be a promising approach for identifying factors regulating the initiation of migratory behaviour and potentially also the smoltification process.
U. Amstutz et al. / Aquaculture 260 (2006) 326–336
Acknowledgements We would like to thank David Bittner for assistance in the field and valuable discussions, Oliver Muehlemann and his group at the IZB, University of Bern, for their support concerning the real-time quantitative PCR experiments, and two anonymous reviewers for constructive comments on earlier versions of the manuscript. This work was supported by the Swiss National Science Foundation grant No. 3100-067136.01 to Carlo R. Largiadèr. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j. aquaculture.2006.06.007. References Agustsson, T., Sundell, K., Sakamoto, T., Ando, M., Björnsson, B.T., 2003. Pituitary gene expression of somatolactin, prolactin, and growth hormone during Atlantic salmon parr–smolt transformation. Aquaculture 222 (1–4), 229–238. Barroso, J.B., Peragón, J., Contreras-Jurado, C., Carcía-Salguero, L., Corpas, F.J., Esteban, F.J., Peinado, M.A., De La Higuera, M., Lupiáñez, J.A., 1998. Impact of starvation-refeeding on kinetics and protein expression of trout liver NADPH-production systems. Am. J. Physiol., Regul. Integr. Comp. Physiol. 274, 1578–1587. Berg, J.M., Tymoczko, J.L., Stryer, L., 2002. Biochemistry, 5th ed. W.H. Freeman and Company, New York. 1064 pp. Bustin, S.A., 2000. Absolute quantification of mRNA using real-time reverse transcription polymerase chain reaction assays. J. Mol. Endocrinol. 25, 169–193. Bustin, S.A., Benes, V., Nolan, T., Pfaffl, M.W., 2005. Quantitative realtime RT-PCR — a perspective. J. Mol. Endocrinol. 34, 597–601. Cabezas, H., Raposo, R.R., Meléndez-Hevia, E., 1999. Activity and metabolic roles of the pentose phosphate cycle in several rat tissues. Mol. Cell. Biochem. 201, 57–63. Champigneulle, A., Melhaoui, M., Maisse, G., Baglinière, J.L., Gillet, C., Gerdeaux, D., 1988. Preliminary study of the brown trout (Salmo trutta L.) in the river Redon, a small tributary of Lake Leman. Bull. Fr. Pech. Piscic. 310, 59–76. Champigneulle, A., Melhaoui, M., Gillet, C., Caudron, A., 2003. Stocking fed fry and demography of the brown trout (Salmo trutta L.) population of the river Redon, a Lake Leman's affluent fragmented by a weir. Bull. Fr. Pech. Piscic. 369, 17–93. Cunjak, R.A., 1988. Physiological consequences of overwintering in streams: the cost of acclimatization? Can. J. Fish. Aquat. Sci. 45, 443–452. Cunjak, R.A., Power, G., 1987. The feeding and energetics of streamresident trout in winter. J. Fish. Biol. 31, 493–511. Dann, S.G., Allison, W.T., Levin, D.B., Hawryshyn, C.W., 2003. Identification of a unique transcript down-regulated in the retina of rainbow trout (Oncorhynchus mykiss) at smoltification. J. Exp. Biol. 206 (24), 4475–4486. Dallas, P.B., Gottardo, N.G., Firth, M.J., Beesley, A.H., Hoffmann, K., Terry, P.A., Freitas, J.R., Boag, J.M., Cummings, A.J., Kees, U.R., 2005. Gene expression levels assessed by oligonucleotide micro-
335
array analysis and quantitative real-time RT-PCR — how well do they correlate? BMC Genomics 6 (Art. No. 59). Dukes, J.P., Deaville, R., Bruford, M.W., Youngson, A.F., Jordan, W.C., 2004. Odorant receptor gene expression changes during the parr–smolt transformation in Atlantic salmon. Mol. Ecol. 13 (9), 2851–2857. Ebbesson, L.O.E., Björnsson, B.T., Stefansson, S.O., Ekström, P., 2000. Free plasma thyroxine levels in coho salmon, Oncorhynchus kisutch, during parr–smolt transformation: comparison with total thyroxine, total triiodothyronine, and growth hormone levels. Fish Physiol. Biochem. 22, 45–50. Eilertson, C.D., Sheridan, M.A., 1993. Differential effects of somatostatin-14 and somatostatin-25 on carbohydrate and lipid metabolism in rainbow trout Oncorhynchus mykiss. Gen. Comp. Endocrinol. 92 (1), 62–70. Elliott, J.M., 1994. Quantitative Ecology of the Brown Trout. Oxford Univ. Press, Oxford. 298 pp. Ewing, R.D., Rodgers, J.D., 1998. Changes in physiological indices of smolting during seaward migration of wild coho salmon, Oncorhynchus kisutch. Aquaculture 168, 69–83. Fessler, J.L., Wagner, H.H., 1969. Some morphological and biochemical changes in steelhead trout during the parr–smolt transformation. J. Fish. Res. Board Canada 26, 2823–2841. Fulton, T., 1902. Rate of growth of seas fishes. Sci. Invest. Fish. Div. Scot. Rept., vol. 20. Giger, T., 2005. Relationships between transcriptome diversity, genetic variability and phenotypic differences in brown trout (Salmo trutta L.). PhD thesis, University of Bern, Zoological Institute, Computational and Molecular Population Genetics Lab. Giger, T., Excoffier, L., Day, P.J.R., Champigneulle, A., Hansen, M.M., Powell, R., Largiadèr, C.R., 2006. Life history shapes gene expression in salmonids. Curr. Biol. 16, R281–R282. Giger, T., Amstutz, U., Excoffier, L., Champigneulle, A., Day, P.J.R., Powell, R., Largiadèr, C.R., in press. The genetic basis of smoltification: functional genomics tools facilitate the search for the needle in the haystack. In: Harris, G., Millner, N.J. (Eds.), Sea Trout: Biology Conservation and Management. Proceedings of the First International Sea Trout Symposium, Cardiff, July 2004. Blackwell Scientific Publications, Oxford. Ginzinger, D.G., 2002. Gene quantification using real-time quantitative PCR: an emerging technology hits the mainstream. Exp. Hematol. 30, 503–512. Grossman, C.E., Qian, Y., Banki, K., Perl, A., 2004. ZNF143 mediates basal and tissue-specific expression of human transaldolase. J. Biol. Chem. 279 (13), 12190–12205. Hoar, W.S., 1976. Smolt transformation: evolution, behaviour and physiology. J. Fish. Res. Board Can. 33, 1233–1252. Hoar, W.S., 1988. The physiology of smolting salmonids. In: Hoar, W.S., Randall, D.J. (Eds.), Fish Physiology. Academic Press, New York, pp. 275–343. Huggett, J., Dheda, K., Bustin, S., Zumla, L., 2005. Real-time RT-PCR normalisation; strategies and considerations. Genes Immun. 6, 279–284. Jonsson, B., Jonsson, N., 1993. Partial migration — niche shift versus sexual-maturation in fishes. Rev. Fish Biol. Fish. 3, 348–365. Kiiskinen, P., Hyvärinen, H., Piironen, J., 2002. Smolting and seasonal variation in the smolt characteristics of one- and two-year-old Saimaa landlocked salmon under fish farm conditions. J. Fish Biol. 60, 1015–1030. Klemetsen, A., Amundsen, P.A., Dempson, J.B., Jonsson, B., Jonsson, N., O'Connell, M.F., Mortensen, E., 2003. Atlantic salmon Salmo salar L., brown trout Salmo trutta L. and Arctic charr Salvelinus
336
U. Amstutz et al. / Aquaculture 260 (2006) 326–336
alpinus (L.): a review of aspects of their life histories. Ecol. Freshw. Fish 12, 1–59. Maindonald, J., Braun, W.J., 2004. DAAG: Data Analysis And Graphics. R package version 0.46. http://www.stats.uwo.ca/DAAG. Mayes, P.A., 1990. The pentose phosphate pathway and other pathways of hexose metabolism. In: Murray, R.K., Granner, D.K., Mayes, P.A., Rodwell, V.W. (Eds.), Harper's Biochemistry. Appleton and Lange, Norwalk, CT. McCormick, S.D., Hansen, L.P., Quinn, T.P., Saunders, R.L., 1998. Movement, migration and smolting of Atlantic salmon (Salmo salar). Can. J. Fish. Aquat. Sci. 55 (Suppl. 1), 77–92. Myslinski, E., Krol, A., Carbon, P., 2004. Characterization of snRNA and snRNA-type genes in the pufferfish Fugu rubripes. Gene 330, 149–158. Nielsen, C., Aarestrup, K., Norum, U., Madsen, S.S., 2003. Premigratory differentiation of wild brown trout into migrant and resident individuals. J. Fish Biol. 63, 1184–1196. Nielsen, C., Aarestrup, K., Norum, U., Madsen, S.S., 2004. Future migratory behaviour predicted from premigratory levels of gill Na+/K+-ATPase activity in individual wild brown trout (Salmo trutta). J. Exp. Biol. 207, 527–533. Nilsen, T.O., Ebbesson, L.O.E., Stefansson, S.O., 2003. Smolting in anadromous and landlocked strains of Atlantic salmon (Salmo salar). Aquaculture 222, 71–82. Olsson, I.C., Greenberg, L.A., 2004. Partial migration in a landlocked brown trout population. J. Fish Biol. 65, 106–121. Peirson, S.N., Butler, J.N., Foster, R.G., 2003. Experimental validation of novel and conventional approaches to quantitative real-time PCR data analysis. Nucleic Acids Res. 31 (14), e73. Pfaffl, M.W., Tichopad, A., Prgomet, C., Neuvians, T., 2004. Determination of stable housekeeping genes, differentially regulated target genes and sample integrity: BestKeeper — Excel-based tool using pair-wise correlations. Biotechnol. Lett. 26, 509–515. R Development Core Team, 2004. R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria. http://www.R-project.org. Rajeevan, M.S., Vernon, S.D., Taysavang, N., Unger, E.R., 2001. Validation of array-based gene expression profiles by real-time (kinetic) RT-PCR. J. Mol. Diagnostics 3 (1), 26–31. Richards, J.G., Semple, J.W., Bystriansky, J.S., Schulte, P.M., 2003. Na+/K+-ATPase α-isoform switching in gills of rainbow trout (Oncorhynchus mykiss) during salinity transfer. J. Exp. Biol. 206, 4475–4486. Saunders, R.L., Harmon, P.R., Knox, D.E., 1994. Smolt development and subsequent sexual maturity in previously mature male Atlantic salmon (Salmo salar). Aquaculture 121, 79–93.
Schena, M., Shalon, D., Davis, R.W., Brown, P.O., 1995. Quantitative monitoring of gene-expression patterns with a complementaryDNA microarray. Science 270, 467–470. Schulz, U.H., 1999. Downstream migration of European lake trout Salmo trutta f. lacustris L., and resident brown trout, Salmo trutta f. fario L., progeny in a Lake Constance affluent river. Fish. Manage. Ecol. 6, 187–194. Sheridan, M.A., 1989. Alterations in lipid metabolism accompanying smoltification and seawater adaptation of salmonid fish. Aquaculture 82, 191–203. Sheridan, M.A., Kao, Y.H., 1998. Regulation of metamorphosisassociated changes in the lipid metabolism of selected vertebrates. Am. Zool. 38 (2), 350–368. Sheridan, M.A., Eilertson, C.D., Kerstetter, T.H., 1998. Changes in plasma somatostatin associated with seawater adaptation and stunting of coho salmon Oncorhynchus kisutch. Aquaculture 168, 195–203. Shrimpton, J.M., Björnsson, B.T., McCormick, S.D., 2000. Can Atlantic salmon smolt twice? Endocrine and biochemical changes during smolting. Can. J. Fish. Aquat. Sci. 57, 1969–1976. Stefansson, S.O., McGinnity, P., Björnsson, B.Th., Schreck, C.B., McCormick, S.D., 2003. The importance of smolt development to salmon conservation, culture and management: perspectives from the 6th International Workshop on Salmonid Smoltification. Aquaculture 222, 1–14. Sundell, K., Dellefors, C., Björnsson, B.Th., 1998. Wild and hatcheryreared brown trout, Salmo trutta, differ in smolt related characteristics during parr–smolt transformation. Aquaculture 167, 53–65. Vandesompele, J., De Preter, K., Pattyn, F., Poppe, B., Van Roy, N., De Paepe, A., Speleman, F., 2002. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 3 (7), 0034.1–0034.11. Wamelink, M.M., Struys, E.A., Huck, J.H., Roos, B., van der Knaap, M.S., Jakobs, C., Verhoeven, N.M., 2005. Quantification of sugar phosphate intermediates of the pentose phosphate pathway by LC-MS/MS: application to two new inherited defects of metabolism. J. Chromatogr., B, Analyt. Technol. Biomed. Life Sci. 823 (1), 18–25. Wurmbach, E., Yuen, T., Sealfon, S.C., 2003. Focused microarray analysis. Methods 31, 306–316. Yuen, T., Wurmbach, E., Pfeffer, R.L., Ebersole, B.J., Sealfon, S.C., 2002. Accuracy and calibration of commercial oligonucleotide and custom cDNA microarrays. Nucleic Acids Res. 30 (10), e48.