- Email: [email protected]
Distribution of Ca2+-Activated k+ channels, SK2 and SK3, in the normal and Hirschsprung’s disease bowel
Distribution of Ca 2ⴙ -Activated K ⴙ Channels, SK2 and SK3, in the Normal and Hirschsprung’s Disease Bowel By Anna Piaseczna Piotrowska, Valeria Solari, and Prem Puri Dublin, Ireland
Purpose: The aim of this study was to investigate the expression and distribution of SK2 and SK3 channels in the normal and Hirschsprung’s disease (HD) bowel. Methods: Full-thickness colonic specimens were collected at pull-through operation from 10 patients with HD and from 6 patients during bladder augmentation. Reverse transcriptase-polymerase chain reaction (RT-PCR) analysis for SK2 and SK3 channels and double immunostaining using anti SK2/c-kit, SK3/c-kit, SK2/␣-SMA, and SK2/PGP 9,5 antibodies was performed. Immunolocalization was detected using laser scanning microscopy. Results: RT-PCR analysis showed strong expression of SK2 and SK3 mRNA in the normal human bowel and significantly reduced SK3 expression in the aganglionic bowel (P ⬍ .05). In the normal colon, double labeling immunohistochemistry
T
HE NORMAL MOTILITY of the gastrointestinal tract depends on the enteric nervous system, the smooth muscle cells, and interstitial cells of Cajal (ICCs). ICCs are specialized cells in the gastrointestinal tract (GIT) that are of mesenchymal origin and fundamental to the physiologic function of gastrointestinal smooth muscles.1-4 They play an essential part in the generation of electrical slow-wave activity of gut motility and additionally act as intermediaries between enteric nerves and smooth muscle cells (SMCs).5-10 Two different types of ICCs have been identified in the human GIT using antibodies to c-kit protein and immunohistochemical techniques.3,4,10,11 The first type of ICCs are bipolar cells with 2 long processes. They are scattered throughout the circular and longitudinal muscle layers and at the innermost part of circular muscle, and are referred to as intramuscular ICCs (ICCs-IM).4,10,11 These ICCs are associated closely with nerve fibers. FuncFrom the Children’s Research Centre, Our Lady’s Hospital for Sick Children and University College Dublin, Ireland. Presented at the 54th Annual Meeting of the Section on Surgery of the American Academy of Pediatrics, Boston, Massachusetts, October 18-20, 2002. Address reprint requests to Professor Prem Puri, MS, FRCS, FRCS (Ed), FACS, Director of Research, Children’s Research Centre, Our Lady’s Hospital for Sick Children, Crumlin, Dublin 12, Ireland. © 2003 Elsevier Inc. All rights reserved. 0022-3468/03/3806-0034$30.00/0 doi:10.1016/S0022-3468(03)00138-6 978
showed strong SK3 immunoreactivity (IR) colocalizing in the c-kit–positive ICCs. In the aganglionic bowel, SK3 IR was reduced markedly in the sparsely found ICCs. There was strong SK2 IR mainly in smooth muscles in the normal and aganglionic bowel. Conclusions: The results of this study provide the first evidence for the presence of SK2 and SK3 channels and for the immunocolocalization of SK3 channels in the ICCs in the normal human colon. Decreased expression SK3 channels in the aganglionic bowel may contribute to motility dysfunction in HD. J Pediatr Surg 38:978-983. © 2003 Elsevier Inc. All rights reserved. INDEX WORDS: Ca2⫹-activated K⫹ channels, gastrointestinal tract, interstitial cells of Cajal, Hirschsprung’s disease.
tionally, they mediate neurotransmission to SMCs,4,10,11 and modify slow-wave activity.4,10,11 The second type of ICCs are located in the region of the myenteric plexus and are referred to as myenteric ICCs (ICCs-MY). These cells are triangular or stellate in shape with multiple long processes forming a dense network around the myenteric plexus.4,10,11 They are pacemaker cells generating the electrical slow-wave activity that is propagated to the smooth muscle syncytium via gap junction and determines the characteristic frequency of phasic contractions of GIT.1-10,12 A deficiency of ICCs in the aganglionic bowel may contribute to motility dysfunction in Hirschsprung’s disease by defective generation of electrical pacemaker activity.11,21,22 Small conductance Ca2⫹-activated K⫹ (SK) channel play a fundamental role in all excitable cells.13-16 These cells are potassium selective and activated by an increase in the level of intracellular calcium such as occurs during an action potential. The activation of SK channels causes membrane hyperpolarization, which inhibits cell firing.13-16 The intracellular calcium increase evoked by action potential firing decays slowly, allowing SK channel activation to generate a long-lasting hyperpolarization, termed the slow after hyperpolarization (sAHP).13-18 Although 4 subtypes of SK channels (SK1, SK2, SK3, and SK4 channels) have been reported to be expressed in the mammalian tissue, there is little information on SK channel expression in the GIT.14-16 In the gut, the exJournal of Pediatric Surgery, Vol 38, No 6 (June), 2003: pp 978-983
HIRSCHSPRUNG’S DISEASE
979
pression of SK4 channels has been detected in the human stomach, small intestine, and colon.17,20 The aim of this study was to investigate the expression and distribution of SK2 and SK3 channels in the normal and Hirschsprung’s disease (HD) bowel. MATERIALS AND METHODS
Reverse Transcription Polymerase Chain Reaction Total RNA was prepared using the RNeasy Mini Kit (Qiagen, Crawley, West Sussex, UK) from 30- to 35-mg snap frozen tissue samples that had been ground to a fine powder in liquid nitrogen with a mortar and pestle. Integrity of RNA was validated by agarose gel by direct visualization of 18S and 28S rRNA bands and by measurement of optical density at 260 nm. cDNA synthesis was performed using RETROscript Kit (Ambion, Austin, TX) following manufacture’s instructions. Approximately 5 g of each purified RNA sample was reverse transcribed using 2.5 mol/L oligo(dT) priming, 2.5 mmol/L dNTP, and 100 U of MMLV reverse transcriptase (RT) in a 32-L reaction. For each sample, a mock reaction without addition of reverse transcriptase was performed to control for amplification from contaminating DNA. The reverse transcribed cDNA (3 L) was amplified in a final volume reaction of 50 L by palymerase chain reaction (PCR) under standard conditions using 1.5 mmol/L MgCl2, 125 mol/L dNTP, 1U AmpliTaq Gold (Applied Biosystems, Branchburg, NJ), and 0.4 mol/L of the specific primer. Primer sequences are indicated as follow: for human SK2, 5⬘ GCGTCGCTGTATTCCTTAGC 3⬘ (sense) and 5⬘GCATGACTCTGGCAATCAGA 3⬘ (antisense), for human SK3 5⬘TGGGAAAGGTGTCTGTCTCC 3⬘ (sense) and 5⬘ GTTCCATCTTGACGCTCCTC 3⬘ (antisense) and for the human glyceraldehyde-3phosphate dehydrogenase (GAPDH) 5⬘GGAGTCAACGGATTTGGT 3⬘ (sense) and 5⬘ GTGATGGGATTTCCATTGAT 3⬘ (antisense). Negative controls were included in each reaction. PCR amplification for SK2 and SK3 (35 cycles at 95°C for 5 minutes, 58°C for 1 minute, 72°C for 1 minute, followed by 72°C for 10 minutes) and GAPDH (35 cycles at 95°C for 5 minutes, 54°C for 1 minute, 72°C for 1 minute, followed by 72°C for 10 minutes) were performed in a thermal cycler (model Primus 96-plus; MWG-Biotech, Ebersberg, Germany). PCR products were analyses by 2.5% agarose gel electrophoresis stained with ethidium bromide and exposed to ultraviolet light. Relative amounts of SK2 and SK3 levels were expressed as a ratio of the band divided by that of the housekeeping gene GAPDH. The identity of the product was confirmed by direct cycle nucleotide sequencing (MWGBiotech).
Statistics Data are reported as means ⫾ SD. Differences between the means were tested by analysis of variance (ANOVA) and Student’s t test. A P value less than .05 was considered significant.
Immunohistochemistry Full-thickness colonic specimens were collected at pull-through operation from 10 patients with HD and from 6 patients during bladder augmentation. Specimens were fixed in Zamboni’s solution for 24 hours at 4°C and embedded in the Tissue-Tek OCT compound (Sakura, Netherlands) and 8-m sections cut. To prevent nonspecific absorption of immunoglobulin, the sections were coated with 5% normal goat serum. For fluorescence, double staining sections were incubated with the primary rabbit antihuman SK-3 antibody (0.6 g/mL, Alomone, Jerusalem, Israel)/mouse monoclonal c-kit oncoprotein antibody (NCL-cKIT, dilution 1:200, Novocastra Newcastle upon Tyne, UK), and rabbit antihuman SK-2 antibody
Fig 1. Ethidium bromide–stained agarose gel of representative samples of SK2 channel (334 bp) and SK3 channel (296 bp) and GAPDH (206 bp). Lanes 2, 4, 6, are normal colon samples, whereas 3, 5, 7 are aganglionic samples of HD patients. Lane 1 is a molecular weight size marker.
(0.6 g/mL, Alomone)/mouse monoclonal alpha smooth mouse actin (␣-SMA; dilution 1:100, Novocastra), and rabbit antihuman SK-2 antibody (0.6 g/mL, Alomone)/mouse monoclonal protein gene product–9.5 (PGP-9.5; dilution 1:20, Novocastra). As secondary antibody, goat antirabbit Alexa Fluor 594 and goat antimouse Alexa Fluor 488 (dilution 1:500; Molecular Probes, Leiden, The Netherlands) were used. Staining specimens were mounted in fluorescence mounting medium (Dako, Ely, UK) and covered by glass. Nonspecific labeling was checked by omitting the respective primary antibodies. Staining results were observed with a confocal laserscanning microscope (Bio-Rad 2000, Bio-Rad, Hemel Hempstead, UK).
RESULTS
SK2 and SK3 mRNA expression was detected in all specimens using RT-PCR. PCR amplification of cDNA with the primers sets resulted in production of a single DNA band in each reaction, which was of the predicted molecular weight size on agarose gel electrophoresis. The nucleotide sequence of the amplified products was confirmed by sequencing. No amplification was observed in the negative controls. Intensity of the bands of SK3 was much weaker in the aganglionic bowel samples compared with controls (0.6 ⫾ 0.1 v 1.9 ⫾ 0.3; P ⬍ .005; Fig 1). mRNA SK2 levels were similar in the aganglionic colon as in the control bowel. C-kit immunoreactivity (IR) was seen in the intramuscular ICCs (ICCs-IM), which appear as long thin, bipolar cells with only one or 2 long processes. ICCs-IM were in abundance in the circular and longitudinal muscle layers and in the innermost part of the circular muscle (Fig 2A). Myenteric ICCs (ICCs-MY) were stellatelike cells with large cell bodies and several processes intermingling with each other and surrounding the myenteric plexus. Numerous c-kit–positive ICCs-MY were observed in the
980
PIOTROWSKA, SOLARI, AND PURI
Fig 2. C-kit IR and SK3 IR in the circular muscle layer in the normal colon. (A) C-kit–positive ICCs-IM in the circular muscle. (B) SK2 channel IR in the circular muscle. (C) Double labelling with c-kit and SK2 channels shows the immunocolocalisation of SK2 channels in the ICCs-IM.
normal colon forming a dense network around the myenteric plexus (Fig 3A). In the normal colon, immunoreactivity of anti-SK3 channel antibody was observed as bipolar cells in appearance with short processes in the circular and longitudinal muscle layers and at the innermost part of circular muscle (Fig 2B) and as multipolar cells with multiple processes forming an interconnecting network around the myenteric plexus (Fig 3B). Double labeling of the anti-SK3 channel and anti– c-kit demonstrated immunocolocalization of SK3 channels in the ICCs-IM (Fig 2C)
Fig 3. C-kit IR and SK3 IR in the myenteric plexus in the normal colon. (A) C-kit–positive cells around the ganglions in the myenteric plexus. (B) SK3 channels IR around ganglia in the myenteric plexus. (C) Double labelling with c-kit/SK3 channels shows immunocolocalization SK3 channels in the ICCs-MY.
and ICCs-MY (Fig 3C). The characteristic proteins for the contractile apparatus of SMCs, ␣-SMA was expressed strongly in the longitudinal and circular muscle layer, muscularis mucosa, and in the muscle layer of blood vessels in the normal (Fig 4A) and aganglionic colon. SK2 channel IR was seen strongly in the longitudinal and circular smooth muscle layer in the normal (Fig 4B) and aganglionic colon. Double labeling anti-SK2 channel and ␣-SMA showed immunocolocalization of SK2 channels on the SMCs and around the blood vessels in the normal (Fig 4C) and aganglionic colon. There was
HIRSCHSPRUNG’S DISEASE
981
Fig 4. ␣-SMA IR and SK2 channels IR in the longitudinal and circular muscle layers in the normal colon. (A) ␣-SMA IR in the muscle layer. (B) SK2 channels IR in the muscle layer. (C) Double labelling with ␣-SMA/SK2 channels shows immunocolocalization of SK2 channels in the smooth muscle cells in the colon and in the muscle cells of blood vessel.
lack of c-kit and anti-SK3 immunoreactivity in the aganglionic colon (Fig 5A). Double labeling anti-SK2 channel and c-kit antibody showed lack of immunolocalization of SK2 channel and c-kit IR-ICCs in the human colon, normal, and aganglionic. Double labeling ␣-SMA/ SK2 channel showed immunolocalisation of SK2 channels in SMCs (Fig 5B). PGP 9.5 was expressed strongly in the ganglia cells of myenteric plexus, submucosal ganglia, muscularis mucosa, and some nerve fibers in the smooth muscle layer in the normal colon. In the aganglionic bowel, PGP 9.5
immunoreactivity was observed in the hypertrophic nerve trunks. Double staining anti–SK-2 channel and PGP 9.5 did not show immunocolocalization of SK2 channels in the PGP 9.5–positive neurons (Fig 5C). DISCUSSION
In the present study we investigated the tissue distribution of SK2 and SK3 channels in the normal and aganglionic human bowel. The most striking findings in this study were (1) SK3 and SK2 channels are strongly expressed in the normal human colon, and there is
Fig 5. (A) Double labelling c-kit/ SK3 channels in the aganglionic colon shows lack of expression of both antibodies. (B) Double labelling ␣-SMA/ SK2 channels in the longitudinal and circular muscle in the aganglionic colon shows immunolocalization of SK2 channels in the muscle cells in the muscle layer. (C) Double labelling PGP 9.5/SK2 channels in the normal colon shows lack of immunolocalization of SK2 channels in the PGP 9.5 IR myenteric ganglion and nerve fibers.
982
PIOTROWSKA, SOLARI, AND PURI
markedly decreased expression of SK3 channels but not SK2 channels in the aganglionic bowel and (2) double labeling immunohistochemical studies showed that SK3 are specifically present in the ICCs. The current study also shows decreased expression of SK3 channels in the aganglionic bowel. Lack or decrease of this ion channel in the GIT can markedly reduce the slow-wave activity and may be partly responsible for the motility dysfunction in the aganglionic bowel. Spontaneous electrical rhythmicity is a fundamental property of SMCs and is essential for pacemaking the motility of gastrointestinal muscles.13,17-19,23 The rhythmicity forms a slow wave in the membrane potential of smooth muscle cells. The slow wave is suggested to be generated in ICCs-MY and propagate to electrically coupled SMCs in the GIT.14-16,18,23-25 Functional studies showed that the decrease in ICCs was accompanied by a loss of electrical rhythmicity and reduced neuronal responses in the bowel.2,3,6-9,24-27 The amplitude and frequency of the slow wave of cultured ICCs were reduced in a low Ca2⫹ concentration in extracellular solution.12,15 Recent study suggests that intracellular Ca2⫹ or Ca2⫹ release from stores may regulate the mechanism that initiates the slow waves, and the mechanisms responsible for either inward or outward currents in the slow wave of ICCs may be Ca2⫹ dependent.16,25,28 Inhibiting the Ca2⫹ release markedly reduced the slow-wave frequency in the dog and mouse small intestine.23 We have shown that SK3 IR is specifically immunocolocalized in both types of ICCs in the human colon. Fujita et al16 showed that SK3 channels were expressed specifically in ICCs and participate in the repolarization of the slow wave in ICCs in the rat intestine. Klemm and Lang14 showed that SK3 IR cells in the guinea pig
intestine cells have a distribution similar to c-kit IR ICCs. They also showed that SK3 IR ICCs are closely opposed to enteric motor nerve fibers and directly activated by nerve-released nitric oxide (NO).14 It is likely that the activation of SK3 IR ICCs by NO is via a rise in internal Ca2⫹, although it is possible that NO directly activates these SK3 channels.14,19,29 and ATP.15,28 Our study also showed marked reduction of SK3 IR and ICCs IR in the aganglionic colon. It is currently accepted that deficient expression of ICCs in the aganglionic bowel may contribute to motility dysfunction in Hirschsprung’s disease (HD) by defective generation of electrical pacemaker activity.4,8,21-23 The lack of expression of SK3 channels in the aganglionic colon observed in this study suggests that the spontaneous electrical rhythmicity of SMCs, which is activated by SK3 channels, may be impaired in HD. The current study also showed SK2 IR in the smooth muscle cells in the human normal and aganglionic colon. SK2 channel was not expressed in the c-kit IR ICCs and PGP 9.5 IR neurones in the human colon. Klemm and Lang14 presented studies in which a light evenly distributed SK2-IR on the plasmalemma of many of the single myocytes isolated from guinea pig colon and stomach has been presented. They observed similar immunostaining within circular and longitudinal muscle layer in the whole-mount or sectioned preparations. They speculate that the SK2 channels are probably located in the nuclear membrane of myocytes and play an essential role in many cell processes, such as Ca2⫹ mobilization and signal-specific regulation of gene transcription.14 Intensive physiological studies are needed to better elucidate the function of this channel.
REFERENCES 1. Huizinga JD, Robinson TL, Thomsen L: The search for the origin of rhythmicity in intestinal contraction: From tissue to single cells. Neurogastroenterol Mot 12:3-9, 2000 2. Huizinga JD, Thuneberg L, Klu¨ ppel M, et al: W/kit gene required for interstitial cells of Cajal and for intestinal pacemaker activity. Nature 373:347-349, 1995 ¨ rdo¨ g T, Koh SD, et al: A novel pacemaker 3. Sanders KM, O mechanism drives gastrointestinal rhythmicity. News Physiol Sci 15: 291-298, 2000 4. Ward SM, Sanders KM: Physiology and pathophysiology of the interstitial cell of Cajal: From Bench to bedside I. Functional development and plasticity of interstitial cells of Cajal networks. Am J Physiol Gastrointest Liver Physiol 281:G602-G611, 2001 5. Pluja L, Alberti E, Fernandez E, et al: Evidence supporting presence of two pacemakers in rat colon. Am J Physiol Gastrointest Liver Physiol 281:G255-G266, 2001 6. Mikkelsen HB, Malysz J, Huizinga JD, et al: Action potential generation, Kit receptor immunohistochemistry and morphology of steel-Dickie mutant mouse small intestine. Neurogastroenterol Mot 10:11-26, 1998 7. Ward SM, Burns AJ, Torihashi S, et al: Impaired development of
interstitial cells and intestinal electrical rhytmicity in steel mutants. Am J Physiol 269:C1577-C1585, 1995 8. Ward SM, Beckett EAH, Wang XY, et al: Interstitial cells of Cajal mediate cholinergic neurotransmission from enteric motor neurons. J Neuroscience 20:1393-1403, 2000 9. Lee JCF, Thuneberg L, Berezin I, et al: Generation of slow waves in membrane potential is an intrinsic property of interstitial cells of Cajal. Am J Physiol Gastrointest Liver Physiol 277:G409-G423, 1999 10. Romert P, Mikkelsen HB: C-kit immunoreactive interstitial cells of Cajal in the human small and large intestine. Histochem Cell Biol 109:195-202, 1998 11. Rolle U, Piaseczna Piotrowska A, Nemeth L, et al: Altered distribution of interstitial cells of Cajal in Hirschsprung’s disease. Arch Pathol Lab Med 126:928-933, 2002 12. Koh SD, Sanders KM, Ward SM: Spontaneus electrical rhythmicity in cultured interstitial cells of Cajal from the murine small intestine. J Physiol 519:203-213, 1998 13. Vergara C, Latorre R, Marrion NV, et al: Calcium-activated potassium channels. Curr Opin Neurobiol 8:321-329, 1998 14. Klemm MF, Lang RJ: Distribution of Ca2⫹-activated K⫹ chan-
HIRSCHSPRUNG’S DISEASE
nel (SK2 and SK3) immunoreactivity in intestinal smooth muscles of the guinea pig. Clin Exper Pharmacol Physiol 29:18-25, 2002 15. Koh SD, Dick GM, Sanders KM: Small-conductance Ca2⫹dependent K⫹ channel activated by ATP in murine colonic smooth muscle. Am J Physiol Cell Physiol 273:C2010-C2021, 1997 16. Fujita A, Takeuchi T, Saitoh N, et al: Expression of Ca2⫹-activated K⫹ channels, SK3, in the interstitial cells of Cajal in the gastrointestinal tract. Am J Physiol Cell Physiol 281:C1727-C1733, 2001 17. Sanders KM: Ionic mechanisms of electrical rhythmicity in gastrointestinal smooth muscles. Annu Rev Physiol 54:439-453, 1992 18. Horowitz B, Ward SM, Sanders KM: Cellular and molecular basis for electrical rhythmicity in gastrointestinal muscles. Annu Rev Physiol 61:1943, 1999 19. Vogalis F, Goyal RK: Activation of small-conductance Ca2⫹dependent K⫹ channels by purinergic agonists in smooth muscle cells of the mouse ileum. J Physiol 502:497-508, 1997 20. Ishii M, Silvia CH, Hirschberg B, et al: A human intermediate conductance calcium- activated potassium channel. Proc Natl Acad Sci USA 94:11651-11656, 1997 21. Yamataka A, Kato Y, Tibboel D, et al: A lack of intestinal pacemaker (c-kit) in aganglionic bowel of patients with Hirschsprung’s disease. J Pediatr Surg 30:441-444, 1995 22. Vanderwinden JM, Rumessen JJ, Liu H, et al: Interstitial cells of Cajal in human colon and in Hirschsprung’s disease. Gastroenterology 111:901-910, 1996
983
23. Huizinga JD, Tuneberg L, Wanderwinden JM, et al: Interstitial cells of Cajal as targets for pharmacological intervention in gastrointestinal motor disorders. Trends Pharmacol Sci 18:393-403, 1997 24. Torihasi SH, Ward SM, Nishikawa SI, et al: c-kit-dependent development of interstitial cells and electrical activity in the murine gastrointestinal tract. Cell Tissue Res 280:97-111, 1995 ¨ rdo¨ g T, Koh SD, et al: Pacemaking in interstitial 25. Ward SM, O cells of Cajal depends upon calcium handling by endoplasmic reticulum and mitochondria. J Physiol 525:355-361, 2000 26. Maeda H, Yamagata A, Nishikawa S, et al: Requirement of c-kit for development of intestinal pacemaker system. Development 116: 369-375, 1992 27. Malysz J, Thuneberg L, Mikkelsen HB, et al: Action potential generation in the small intestine of W mutant mice that lack interstitial cells of Cajal. Am J Physiol Gastrointest Liver Physiol 271:G387G399, 1996 28. Szewczyk A: The intracellulare potassium and chloride channels: Properties pharmacology and function. Mol Member Biol 15:4958, 1998 29. Kishi M, Takeuchi T, Suthamnatpong N, et al: VIP- and PACAP-mediated nonadrenergic, noncholinergic inhibition in longitudinal muscle of rat distal colon: Involvement of activation of charybdotoxin–and apamin-sensitive K⫹ channels. Br J Pharmacol 119:623630, 1996
Purpose: The aim of this study was to investigate the expression and distribution of SK2 and SK3 channels in the normal and Hirschsprung’s disease (HD) bowel. Methods: Full-thickness colonic specimens were collected at pull-through operation from 10 patients with HD and from 6 patients during bladder augmentation. Reverse transcriptase-polymerase chain reaction (RT-PCR) analysis for SK2 and SK3 channels and double immunostaining using anti SK2/c-kit, SK3/c-kit, SK2/␣-SMA, and SK2/PGP 9,5 antibodies was performed. Immunolocalization was detected using laser scanning microscopy. Results: RT-PCR analysis showed strong expression of SK2 and SK3 mRNA in the normal human bowel and significantly reduced SK3 expression in the aganglionic bowel (P ⬍ .05). In the normal colon, double labeling immunohistochemistry
T
HE NORMAL MOTILITY of the gastrointestinal tract depends on the enteric nervous system, the smooth muscle cells, and interstitial cells of Cajal (ICCs). ICCs are specialized cells in the gastrointestinal tract (GIT) that are of mesenchymal origin and fundamental to the physiologic function of gastrointestinal smooth muscles.1-4 They play an essential part in the generation of electrical slow-wave activity of gut motility and additionally act as intermediaries between enteric nerves and smooth muscle cells (SMCs).5-10 Two different types of ICCs have been identified in the human GIT using antibodies to c-kit protein and immunohistochemical techniques.3,4,10,11 The first type of ICCs are bipolar cells with 2 long processes. They are scattered throughout the circular and longitudinal muscle layers and at the innermost part of circular muscle, and are referred to as intramuscular ICCs (ICCs-IM).4,10,11 These ICCs are associated closely with nerve fibers. FuncFrom the Children’s Research Centre, Our Lady’s Hospital for Sick Children and University College Dublin, Ireland. Presented at the 54th Annual Meeting of the Section on Surgery of the American Academy of Pediatrics, Boston, Massachusetts, October 18-20, 2002. Address reprint requests to Professor Prem Puri, MS, FRCS, FRCS (Ed), FACS, Director of Research, Children’s Research Centre, Our Lady’s Hospital for Sick Children, Crumlin, Dublin 12, Ireland. © 2003 Elsevier Inc. All rights reserved. 0022-3468/03/3806-0034$30.00/0 doi:10.1016/S0022-3468(03)00138-6 978
showed strong SK3 immunoreactivity (IR) colocalizing in the c-kit–positive ICCs. In the aganglionic bowel, SK3 IR was reduced markedly in the sparsely found ICCs. There was strong SK2 IR mainly in smooth muscles in the normal and aganglionic bowel. Conclusions: The results of this study provide the first evidence for the presence of SK2 and SK3 channels and for the immunocolocalization of SK3 channels in the ICCs in the normal human colon. Decreased expression SK3 channels in the aganglionic bowel may contribute to motility dysfunction in HD. J Pediatr Surg 38:978-983. © 2003 Elsevier Inc. All rights reserved. INDEX WORDS: Ca2⫹-activated K⫹ channels, gastrointestinal tract, interstitial cells of Cajal, Hirschsprung’s disease.
tionally, they mediate neurotransmission to SMCs,4,10,11 and modify slow-wave activity.4,10,11 The second type of ICCs are located in the region of the myenteric plexus and are referred to as myenteric ICCs (ICCs-MY). These cells are triangular or stellate in shape with multiple long processes forming a dense network around the myenteric plexus.4,10,11 They are pacemaker cells generating the electrical slow-wave activity that is propagated to the smooth muscle syncytium via gap junction and determines the characteristic frequency of phasic contractions of GIT.1-10,12 A deficiency of ICCs in the aganglionic bowel may contribute to motility dysfunction in Hirschsprung’s disease by defective generation of electrical pacemaker activity.11,21,22 Small conductance Ca2⫹-activated K⫹ (SK) channel play a fundamental role in all excitable cells.13-16 These cells are potassium selective and activated by an increase in the level of intracellular calcium such as occurs during an action potential. The activation of SK channels causes membrane hyperpolarization, which inhibits cell firing.13-16 The intracellular calcium increase evoked by action potential firing decays slowly, allowing SK channel activation to generate a long-lasting hyperpolarization, termed the slow after hyperpolarization (sAHP).13-18 Although 4 subtypes of SK channels (SK1, SK2, SK3, and SK4 channels) have been reported to be expressed in the mammalian tissue, there is little information on SK channel expression in the GIT.14-16 In the gut, the exJournal of Pediatric Surgery, Vol 38, No 6 (June), 2003: pp 978-983
HIRSCHSPRUNG’S DISEASE
979
pression of SK4 channels has been detected in the human stomach, small intestine, and colon.17,20 The aim of this study was to investigate the expression and distribution of SK2 and SK3 channels in the normal and Hirschsprung’s disease (HD) bowel. MATERIALS AND METHODS
Reverse Transcription Polymerase Chain Reaction Total RNA was prepared using the RNeasy Mini Kit (Qiagen, Crawley, West Sussex, UK) from 30- to 35-mg snap frozen tissue samples that had been ground to a fine powder in liquid nitrogen with a mortar and pestle. Integrity of RNA was validated by agarose gel by direct visualization of 18S and 28S rRNA bands and by measurement of optical density at 260 nm. cDNA synthesis was performed using RETROscript Kit (Ambion, Austin, TX) following manufacture’s instructions. Approximately 5 g of each purified RNA sample was reverse transcribed using 2.5 mol/L oligo(dT) priming, 2.5 mmol/L dNTP, and 100 U of MMLV reverse transcriptase (RT) in a 32-L reaction. For each sample, a mock reaction without addition of reverse transcriptase was performed to control for amplification from contaminating DNA. The reverse transcribed cDNA (3 L) was amplified in a final volume reaction of 50 L by palymerase chain reaction (PCR) under standard conditions using 1.5 mmol/L MgCl2, 125 mol/L dNTP, 1U AmpliTaq Gold (Applied Biosystems, Branchburg, NJ), and 0.4 mol/L of the specific primer. Primer sequences are indicated as follow: for human SK2, 5⬘ GCGTCGCTGTATTCCTTAGC 3⬘ (sense) and 5⬘GCATGACTCTGGCAATCAGA 3⬘ (antisense), for human SK3 5⬘TGGGAAAGGTGTCTGTCTCC 3⬘ (sense) and 5⬘ GTTCCATCTTGACGCTCCTC 3⬘ (antisense) and for the human glyceraldehyde-3phosphate dehydrogenase (GAPDH) 5⬘GGAGTCAACGGATTTGGT 3⬘ (sense) and 5⬘ GTGATGGGATTTCCATTGAT 3⬘ (antisense). Negative controls were included in each reaction. PCR amplification for SK2 and SK3 (35 cycles at 95°C for 5 minutes, 58°C for 1 minute, 72°C for 1 minute, followed by 72°C for 10 minutes) and GAPDH (35 cycles at 95°C for 5 minutes, 54°C for 1 minute, 72°C for 1 minute, followed by 72°C for 10 minutes) were performed in a thermal cycler (model Primus 96-plus; MWG-Biotech, Ebersberg, Germany). PCR products were analyses by 2.5% agarose gel electrophoresis stained with ethidium bromide and exposed to ultraviolet light. Relative amounts of SK2 and SK3 levels were expressed as a ratio of the band divided by that of the housekeeping gene GAPDH. The identity of the product was confirmed by direct cycle nucleotide sequencing (MWGBiotech).
Statistics Data are reported as means ⫾ SD. Differences between the means were tested by analysis of variance (ANOVA) and Student’s t test. A P value less than .05 was considered significant.
Immunohistochemistry Full-thickness colonic specimens were collected at pull-through operation from 10 patients with HD and from 6 patients during bladder augmentation. Specimens were fixed in Zamboni’s solution for 24 hours at 4°C and embedded in the Tissue-Tek OCT compound (Sakura, Netherlands) and 8-m sections cut. To prevent nonspecific absorption of immunoglobulin, the sections were coated with 5% normal goat serum. For fluorescence, double staining sections were incubated with the primary rabbit antihuman SK-3 antibody (0.6 g/mL, Alomone, Jerusalem, Israel)/mouse monoclonal c-kit oncoprotein antibody (NCL-cKIT, dilution 1:200, Novocastra Newcastle upon Tyne, UK), and rabbit antihuman SK-2 antibody
Fig 1. Ethidium bromide–stained agarose gel of representative samples of SK2 channel (334 bp) and SK3 channel (296 bp) and GAPDH (206 bp). Lanes 2, 4, 6, are normal colon samples, whereas 3, 5, 7 are aganglionic samples of HD patients. Lane 1 is a molecular weight size marker.
(0.6 g/mL, Alomone)/mouse monoclonal alpha smooth mouse actin (␣-SMA; dilution 1:100, Novocastra), and rabbit antihuman SK-2 antibody (0.6 g/mL, Alomone)/mouse monoclonal protein gene product–9.5 (PGP-9.5; dilution 1:20, Novocastra). As secondary antibody, goat antirabbit Alexa Fluor 594 and goat antimouse Alexa Fluor 488 (dilution 1:500; Molecular Probes, Leiden, The Netherlands) were used. Staining specimens were mounted in fluorescence mounting medium (Dako, Ely, UK) and covered by glass. Nonspecific labeling was checked by omitting the respective primary antibodies. Staining results were observed with a confocal laserscanning microscope (Bio-Rad 2000, Bio-Rad, Hemel Hempstead, UK).
RESULTS
SK2 and SK3 mRNA expression was detected in all specimens using RT-PCR. PCR amplification of cDNA with the primers sets resulted in production of a single DNA band in each reaction, which was of the predicted molecular weight size on agarose gel electrophoresis. The nucleotide sequence of the amplified products was confirmed by sequencing. No amplification was observed in the negative controls. Intensity of the bands of SK3 was much weaker in the aganglionic bowel samples compared with controls (0.6 ⫾ 0.1 v 1.9 ⫾ 0.3; P ⬍ .005; Fig 1). mRNA SK2 levels were similar in the aganglionic colon as in the control bowel. C-kit immunoreactivity (IR) was seen in the intramuscular ICCs (ICCs-IM), which appear as long thin, bipolar cells with only one or 2 long processes. ICCs-IM were in abundance in the circular and longitudinal muscle layers and in the innermost part of the circular muscle (Fig 2A). Myenteric ICCs (ICCs-MY) were stellatelike cells with large cell bodies and several processes intermingling with each other and surrounding the myenteric plexus. Numerous c-kit–positive ICCs-MY were observed in the
980
PIOTROWSKA, SOLARI, AND PURI
Fig 2. C-kit IR and SK3 IR in the circular muscle layer in the normal colon. (A) C-kit–positive ICCs-IM in the circular muscle. (B) SK2 channel IR in the circular muscle. (C) Double labelling with c-kit and SK2 channels shows the immunocolocalisation of SK2 channels in the ICCs-IM.
normal colon forming a dense network around the myenteric plexus (Fig 3A). In the normal colon, immunoreactivity of anti-SK3 channel antibody was observed as bipolar cells in appearance with short processes in the circular and longitudinal muscle layers and at the innermost part of circular muscle (Fig 2B) and as multipolar cells with multiple processes forming an interconnecting network around the myenteric plexus (Fig 3B). Double labeling of the anti-SK3 channel and anti– c-kit demonstrated immunocolocalization of SK3 channels in the ICCs-IM (Fig 2C)
Fig 3. C-kit IR and SK3 IR in the myenteric plexus in the normal colon. (A) C-kit–positive cells around the ganglions in the myenteric plexus. (B) SK3 channels IR around ganglia in the myenteric plexus. (C) Double labelling with c-kit/SK3 channels shows immunocolocalization SK3 channels in the ICCs-MY.
and ICCs-MY (Fig 3C). The characteristic proteins for the contractile apparatus of SMCs, ␣-SMA was expressed strongly in the longitudinal and circular muscle layer, muscularis mucosa, and in the muscle layer of blood vessels in the normal (Fig 4A) and aganglionic colon. SK2 channel IR was seen strongly in the longitudinal and circular smooth muscle layer in the normal (Fig 4B) and aganglionic colon. Double labeling anti-SK2 channel and ␣-SMA showed immunocolocalization of SK2 channels on the SMCs and around the blood vessels in the normal (Fig 4C) and aganglionic colon. There was
HIRSCHSPRUNG’S DISEASE
981
Fig 4. ␣-SMA IR and SK2 channels IR in the longitudinal and circular muscle layers in the normal colon. (A) ␣-SMA IR in the muscle layer. (B) SK2 channels IR in the muscle layer. (C) Double labelling with ␣-SMA/SK2 channels shows immunocolocalization of SK2 channels in the smooth muscle cells in the colon and in the muscle cells of blood vessel.
lack of c-kit and anti-SK3 immunoreactivity in the aganglionic colon (Fig 5A). Double labeling anti-SK2 channel and c-kit antibody showed lack of immunolocalization of SK2 channel and c-kit IR-ICCs in the human colon, normal, and aganglionic. Double labeling ␣-SMA/ SK2 channel showed immunolocalisation of SK2 channels in SMCs (Fig 5B). PGP 9.5 was expressed strongly in the ganglia cells of myenteric plexus, submucosal ganglia, muscularis mucosa, and some nerve fibers in the smooth muscle layer in the normal colon. In the aganglionic bowel, PGP 9.5
immunoreactivity was observed in the hypertrophic nerve trunks. Double staining anti–SK-2 channel and PGP 9.5 did not show immunocolocalization of SK2 channels in the PGP 9.5–positive neurons (Fig 5C). DISCUSSION
In the present study we investigated the tissue distribution of SK2 and SK3 channels in the normal and aganglionic human bowel. The most striking findings in this study were (1) SK3 and SK2 channels are strongly expressed in the normal human colon, and there is
Fig 5. (A) Double labelling c-kit/ SK3 channels in the aganglionic colon shows lack of expression of both antibodies. (B) Double labelling ␣-SMA/ SK2 channels in the longitudinal and circular muscle in the aganglionic colon shows immunolocalization of SK2 channels in the muscle cells in the muscle layer. (C) Double labelling PGP 9.5/SK2 channels in the normal colon shows lack of immunolocalization of SK2 channels in the PGP 9.5 IR myenteric ganglion and nerve fibers.
982
PIOTROWSKA, SOLARI, AND PURI
markedly decreased expression of SK3 channels but not SK2 channels in the aganglionic bowel and (2) double labeling immunohistochemical studies showed that SK3 are specifically present in the ICCs. The current study also shows decreased expression of SK3 channels in the aganglionic bowel. Lack or decrease of this ion channel in the GIT can markedly reduce the slow-wave activity and may be partly responsible for the motility dysfunction in the aganglionic bowel. Spontaneous electrical rhythmicity is a fundamental property of SMCs and is essential for pacemaking the motility of gastrointestinal muscles.13,17-19,23 The rhythmicity forms a slow wave in the membrane potential of smooth muscle cells. The slow wave is suggested to be generated in ICCs-MY and propagate to electrically coupled SMCs in the GIT.14-16,18,23-25 Functional studies showed that the decrease in ICCs was accompanied by a loss of electrical rhythmicity and reduced neuronal responses in the bowel.2,3,6-9,24-27 The amplitude and frequency of the slow wave of cultured ICCs were reduced in a low Ca2⫹ concentration in extracellular solution.12,15 Recent study suggests that intracellular Ca2⫹ or Ca2⫹ release from stores may regulate the mechanism that initiates the slow waves, and the mechanisms responsible for either inward or outward currents in the slow wave of ICCs may be Ca2⫹ dependent.16,25,28 Inhibiting the Ca2⫹ release markedly reduced the slow-wave frequency in the dog and mouse small intestine.23 We have shown that SK3 IR is specifically immunocolocalized in both types of ICCs in the human colon. Fujita et al16 showed that SK3 channels were expressed specifically in ICCs and participate in the repolarization of the slow wave in ICCs in the rat intestine. Klemm and Lang14 showed that SK3 IR cells in the guinea pig
intestine cells have a distribution similar to c-kit IR ICCs. They also showed that SK3 IR ICCs are closely opposed to enteric motor nerve fibers and directly activated by nerve-released nitric oxide (NO).14 It is likely that the activation of SK3 IR ICCs by NO is via a rise in internal Ca2⫹, although it is possible that NO directly activates these SK3 channels.14,19,29 and ATP.15,28 Our study also showed marked reduction of SK3 IR and ICCs IR in the aganglionic colon. It is currently accepted that deficient expression of ICCs in the aganglionic bowel may contribute to motility dysfunction in Hirschsprung’s disease (HD) by defective generation of electrical pacemaker activity.4,8,21-23 The lack of expression of SK3 channels in the aganglionic colon observed in this study suggests that the spontaneous electrical rhythmicity of SMCs, which is activated by SK3 channels, may be impaired in HD. The current study also showed SK2 IR in the smooth muscle cells in the human normal and aganglionic colon. SK2 channel was not expressed in the c-kit IR ICCs and PGP 9.5 IR neurones in the human colon. Klemm and Lang14 presented studies in which a light evenly distributed SK2-IR on the plasmalemma of many of the single myocytes isolated from guinea pig colon and stomach has been presented. They observed similar immunostaining within circular and longitudinal muscle layer in the whole-mount or sectioned preparations. They speculate that the SK2 channels are probably located in the nuclear membrane of myocytes and play an essential role in many cell processes, such as Ca2⫹ mobilization and signal-specific regulation of gene transcription.14 Intensive physiological studies are needed to better elucidate the function of this channel.
REFERENCES 1. Huizinga JD, Robinson TL, Thomsen L: The search for the origin of rhythmicity in intestinal contraction: From tissue to single cells. Neurogastroenterol Mot 12:3-9, 2000 2. Huizinga JD, Thuneberg L, Klu¨ ppel M, et al: W/kit gene required for interstitial cells of Cajal and for intestinal pacemaker activity. Nature 373:347-349, 1995 ¨ rdo¨ g T, Koh SD, et al: A novel pacemaker 3. Sanders KM, O mechanism drives gastrointestinal rhythmicity. News Physiol Sci 15: 291-298, 2000 4. Ward SM, Sanders KM: Physiology and pathophysiology of the interstitial cell of Cajal: From Bench to bedside I. Functional development and plasticity of interstitial cells of Cajal networks. Am J Physiol Gastrointest Liver Physiol 281:G602-G611, 2001 5. Pluja L, Alberti E, Fernandez E, et al: Evidence supporting presence of two pacemakers in rat colon. Am J Physiol Gastrointest Liver Physiol 281:G255-G266, 2001 6. Mikkelsen HB, Malysz J, Huizinga JD, et al: Action potential generation, Kit receptor immunohistochemistry and morphology of steel-Dickie mutant mouse small intestine. Neurogastroenterol Mot 10:11-26, 1998 7. Ward SM, Burns AJ, Torihashi S, et al: Impaired development of
interstitial cells and intestinal electrical rhytmicity in steel mutants. Am J Physiol 269:C1577-C1585, 1995 8. Ward SM, Beckett EAH, Wang XY, et al: Interstitial cells of Cajal mediate cholinergic neurotransmission from enteric motor neurons. J Neuroscience 20:1393-1403, 2000 9. Lee JCF, Thuneberg L, Berezin I, et al: Generation of slow waves in membrane potential is an intrinsic property of interstitial cells of Cajal. Am J Physiol Gastrointest Liver Physiol 277:G409-G423, 1999 10. Romert P, Mikkelsen HB: C-kit immunoreactive interstitial cells of Cajal in the human small and large intestine. Histochem Cell Biol 109:195-202, 1998 11. Rolle U, Piaseczna Piotrowska A, Nemeth L, et al: Altered distribution of interstitial cells of Cajal in Hirschsprung’s disease. Arch Pathol Lab Med 126:928-933, 2002 12. Koh SD, Sanders KM, Ward SM: Spontaneus electrical rhythmicity in cultured interstitial cells of Cajal from the murine small intestine. J Physiol 519:203-213, 1998 13. Vergara C, Latorre R, Marrion NV, et al: Calcium-activated potassium channels. Curr Opin Neurobiol 8:321-329, 1998 14. Klemm MF, Lang RJ: Distribution of Ca2⫹-activated K⫹ chan-
HIRSCHSPRUNG’S DISEASE
nel (SK2 and SK3) immunoreactivity in intestinal smooth muscles of the guinea pig. Clin Exper Pharmacol Physiol 29:18-25, 2002 15. Koh SD, Dick GM, Sanders KM: Small-conductance Ca2⫹dependent K⫹ channel activated by ATP in murine colonic smooth muscle. Am J Physiol Cell Physiol 273:C2010-C2021, 1997 16. Fujita A, Takeuchi T, Saitoh N, et al: Expression of Ca2⫹-activated K⫹ channels, SK3, in the interstitial cells of Cajal in the gastrointestinal tract. Am J Physiol Cell Physiol 281:C1727-C1733, 2001 17. Sanders KM: Ionic mechanisms of electrical rhythmicity in gastrointestinal smooth muscles. Annu Rev Physiol 54:439-453, 1992 18. Horowitz B, Ward SM, Sanders KM: Cellular and molecular basis for electrical rhythmicity in gastrointestinal muscles. Annu Rev Physiol 61:1943, 1999 19. Vogalis F, Goyal RK: Activation of small-conductance Ca2⫹dependent K⫹ channels by purinergic agonists in smooth muscle cells of the mouse ileum. J Physiol 502:497-508, 1997 20. Ishii M, Silvia CH, Hirschberg B, et al: A human intermediate conductance calcium- activated potassium channel. Proc Natl Acad Sci USA 94:11651-11656, 1997 21. Yamataka A, Kato Y, Tibboel D, et al: A lack of intestinal pacemaker (c-kit) in aganglionic bowel of patients with Hirschsprung’s disease. J Pediatr Surg 30:441-444, 1995 22. Vanderwinden JM, Rumessen JJ, Liu H, et al: Interstitial cells of Cajal in human colon and in Hirschsprung’s disease. Gastroenterology 111:901-910, 1996
983
23. Huizinga JD, Tuneberg L, Wanderwinden JM, et al: Interstitial cells of Cajal as targets for pharmacological intervention in gastrointestinal motor disorders. Trends Pharmacol Sci 18:393-403, 1997 24. Torihasi SH, Ward SM, Nishikawa SI, et al: c-kit-dependent development of interstitial cells and electrical activity in the murine gastrointestinal tract. Cell Tissue Res 280:97-111, 1995 ¨ rdo¨ g T, Koh SD, et al: Pacemaking in interstitial 25. Ward SM, O cells of Cajal depends upon calcium handling by endoplasmic reticulum and mitochondria. J Physiol 525:355-361, 2000 26. Maeda H, Yamagata A, Nishikawa S, et al: Requirement of c-kit for development of intestinal pacemaker system. Development 116: 369-375, 1992 27. Malysz J, Thuneberg L, Mikkelsen HB, et al: Action potential generation in the small intestine of W mutant mice that lack interstitial cells of Cajal. Am J Physiol Gastrointest Liver Physiol 271:G387G399, 1996 28. Szewczyk A: The intracellulare potassium and chloride channels: Properties pharmacology and function. Mol Member Biol 15:4958, 1998 29. Kishi M, Takeuchi T, Suthamnatpong N, et al: VIP- and PACAP-mediated nonadrenergic, noncholinergic inhibition in longitudinal muscle of rat distal colon: Involvement of activation of charybdotoxin–and apamin-sensitive K⫹ channels. Br J Pharmacol 119:623630, 1996