- Email: [email protected]
Distribution of gonadotropin-inhibitory hormone (GnIH) in male Luchuan piglets
Gene Expression Patterns 28 (2018) 42–53
Contents lists available at ScienceDirect
Gene Expression Patterns journal homepage: www.elsevier.com/locate/gep
Distribution of gonadotropin-inhibitory hormone (GnIH) in male Luchuan piglets
T
Xiaoye Wang, Xun Li∗, Chuanhuo Hu∗∗ College of Animal Science and Technology, Guangxi University, Nanning, Guangxi, 530004, PR China
A R T I C L E I N F O
A B S T R A C T
Keywords: Gonadotropin inhibitory hormone (GnIH) Male piglets Distribution Immunohistochemistry Central nervous system (CNS) and peripheral organs
Gonadotropin inhibitory hormone (GnIH) has emerged as a novel hypothalamic neuropeptide that actively inhibits gonadotropin release in birds and mammals. Recent evidence indicates that GnIH not only acts as a key neurohormone that controls vertebrate reproduction but is also involved in stress response, food intake, and aggressive and sexual behaviors, suggesting a broad physiological role for this neuropeptide. To elucidate its multiple sites of action and potential functions, studying the detailed distribution of GnIH in different organs, except for the hypothalamus-pituitary-ovary/testis axis, is necessary. Therefore, in the present study, in different central nervous system (CNS) and peripheral organs of male Luchuan piglets, the distribution of GnIH was systemically determined using immunohistochemistry, and the expression of GnIH mRNA was investigated using semi-quantitative reverse transcription polymerase chain reaction (RT-PCR). Our results demonstrate that GnIH immune reactive (GnIH-ir) neurons were widely distributed in the pig CNS, but the number and size of the GnIHir neurons varied and exhibited morphological diversity. In the peripheral organs, GnIH immunoreactive cells were observed in the respiratory tract, alimentary tract, endocrine organs, genitourinary tract and lymphatic organs. GnIH mRNA was highly expressed in the CNS, with the highest expression in the hypothalamus. In the peripheral organs, high GnIH mRNA levels were detected in the testis, while no GnIH expression was observed in the liver, lungs and heart et al. These results demonstrated that GnIH might play an important role in modulating a variety of physiological functions and provided the morphological data for further study of GnIH in pigs.
1. Introduction Gonadotropin-inhibitory hormone (GnIH) is a novel hypothalamic neuropeptide that was originally discovered in 2000 in quail as an inhibitory factor for gonadotropin release (Tsutsui et al., 2000; Ubuka et al., 2012a). After over a decade of research, avian GnIH and its orthologs, which share a common C-terminal LPXRFamide (X = L or Q) motif, have been identified and characterized in various species from fish to mammals (Bentley et al., 2008; Smith and Clarke, 2010; Tsutsui et al., 2017; Ubuka et al., 2018). Importantly, as in birds, mammalian GnIH orthologs [RFamide-related peptides (RFRPs)] also act to inhibit gonadotropin release across mammalian species, including rats, hamsters, and sheep (Tsutsui, 2010; Tsutsui et al., 2010; Ullah et al., 2016). An abundance of original research papers have demonstrated that GnIH appears to act similarly across vertebrate species to regulate reproduction in the hypothalamic–pituitary–gonadal (HPG) axis (Clarke et al., 2009; Tsutsui, 2009; Tsutsui et al., 2017). In the brain, GnIH neuronal cell bodies are found in the hypothalamus, and their fibers mostly extend into the diencephalon and midbrain (Kriegsfeld et al., ∗
2006; Tsutsui et al., 2007; Ukena et al., 2003). GnIH neurons project into the external layer of the median eminence, and GnIH fibers are closely associated with many other neurons, such as GnRH, POMC, NPY, orexin, and kisspeptin neurons (Ducret et al., 2009; Kriegsfeld, 2006; Qi et al., 2009; Ubuka et al., 2008). These findings suggested that GnIH neurons may not only inhibit gonadotropin release and synthesis in the pituitary but also regulate various neurons in the brain. In addition, GnIH and GPR147 are expressed in the gonads and accessory reproductive organs (Li et al., 2012; Singh et al., 2011a; Ubuka et al., 2006), indicating that they are possibly involved in autocrine/paracrine regulation of gonadal steroid production and germ cell differentiation and maturation. Although studies on GnIH in the past decade mainly focused on its reproductive physiology, recent evidence has further indicated that GnIH is also involved in several non-reproductive functions, such as appetite regulation, energy metabolism, and anxiety and stress responses (Clarke et al., 2012; Leon et al., 2014; Tsutsui et al., 2012; Wahab et al., 2015) Multiple physiological functions suggest that GnIH might be widely distributed in many tissues. However, there have been
Corresponding author. College of Animal Science and Technology, Guangxi University, Nanning, Guangxi, 530004, PR China. Corresponding author. E-mail addresses: [email protected] (X. Li), [email protected] (C. Hu).
∗∗
https://doi.org/10.1016/j.gep.2018.02.004 Received 14 December 2017; Received in revised form 22 February 2018; Accepted 22 February 2018 Available online 24 February 2018 1567-133X/ © 2018 Elsevier B.V. All rights reserved.
Gene Expression Patterns 28 (2018) 42–53
X. Wang et al.
cloned partial pig GnIH precursor cDNA and demonstrated its distribution and reproductive functions in the pig hypothalamic–pituitary–gonadal (HPG) axis (Li et al., 2012, 2013), further studies on the multiple sites of action and potential functions of pig GnIH are very important. Therefore, the distribution of GnIH in different central nervous system and peripheral organs of male Luchuan piglets was systemically determined using immunohistochemistry (Table 2), and the expression of GnIH mRNA was investigated. Taken together, the results of this study describe the comprehensive anatomical locations of GnIH in pigs and provide the morphological basis for hypothetical physiological functions of GnIH.
Table 1 Primers and reaction conditions of semi-quantitative RT-PCR. Primers
Sequences (5′–3′)
Length (bp)
GnIH
(+)TAACATCCAACATCTTTTGTACAG (−)CGGGTGATGGAGTAAAGTAAC (+)AGGTCGGAGTGAACGGATTTG (−)CAGTCTTCTGGGTGGCAGTGAT
442
GAPDH
549
Table 2 Localization and relative score intensity of GnIH in the central nervous system and the peripheral organs of male Luchuan piglets. Tissues The central nervous system Telencephalon Cerebral cortex Septal region Hippocampus Olfactory bulb Diencephalon Preoptic area Hypothalamic periventricular regions Suprachiasmatic nucleus Supraoptic nucleus Brainstem Midbrain Pons Medulla oblongata Cerebellum Spinalcord The peripheral organs Male Reproductive system Testis Epididymis Accessory glands Endocrine system Thyroid gland Parathyroid gland Adrenal gland Immune system Thymus Lymph nodes Palatine tonsil Spleen Urinary system Kidneys Urinary bladder Digestive tract Esophagus Stomach Small intestines Large intestines Digestive gland Submandibular gland Pancreas Liver Respiratory system Trachea Lungs Cardiovascular system Heart Large artery Muscle tissue and skin
2. Results
GnIH
2.1. Localization of GnIH in male Luchuan piglet tissues ++ ++ + +
2.1.1. Distribution of GnIH immunoreactive cells in the central nervous system Telencephalon: In the cerebral cortex (Fig. 1A–D), intense and numerous GnIH immunoreactive cells were found in the external granular, external pyramidal and internal pyramidal layers, while dispersed labeled GnIH immunoreactive cells were found in the internal molecular, pyramidal and polymorphic layers. The immunoreactivities of the GnIH proteins were mainly localized to the astrocytes and pyramidal cells in the six layers of the cerebral cortex. In addition, clusters of distinct immunoreactive cells and fibers were observed in the septal region, the nucleus of the stria terminalis and the diagonal band (Fig. 1E and F). In the hippocampus, pyramidal cells of the stratum pyramidale exhibited moderate immunoreactivity. Multiple intense and dispersed immunoreactive cells were identified in the stratum multiformis (Fig. 1G–I). In the olfactory bulb (Fig. 1J–L), a few immunoreactive cells were observed in the external plexiform layer, whereas cells with strong immunoreactivity were found in the mitral cell layer. Diencephalon: Clusters of GnIH immunoreactive cells were maximally located in the preoptic area and the hypothalamic periventricular regions, such as the dorsomedial nucleus (DMN), intermediate periventricular nucleus (IPe), paraventricular nucleus (PVN) and arcuate nucleus (Arc) (Fig. 2A–D and 2F). A few moderately immunoreactive cells were also identified in the suprachiasmatic nucleus (SCN) and supraoptic nucleus (SON) (Fig. 2E). Brainstem: Abundant GnIH immunoreactive cells and fibers were generally restricted to the periventricular region of the brainstem. Clusters of distinct immunoreactive cells were observed in the central gray substance of the midbrain and in the dorsal raphe nucleus in the midbrain (Fig. 2G–I). The parabrachial nucleus in the pons also exhibited GnIH-positive cells (Fig. 2J). However, compared to the midbrain and pons, the quantity and distribution of GnIH immunoreactive cells and fibers were increased in the medulla oblongata. Many intense and dispersed immunoreactive cells and fibers were located in the tegmental area. Clusters of cells with intense to moderate immunoreactivity were observed in the central gray substance of the medulla oblongata (CGMB), dorsal raphe nucleus (DR) and inferior olivary nucleus (Fig. 2K–M). Cerebellum: Purkinje cells in the Purkinje cell layer showed intense to moderate levels of GnIH immunoreactivity (Fig. 2N and O). Spinalcord: The quantity and distribution of GnIH immunoreactive cells were localized to the gray matter, which showed intense to moderate staining (Fig. 2P and Q).
+++ +++ + + + + ++ + +
+++ +++ +++/++ ++ +++/++ ++ ++/+ + ++ +++/++ ± ++ +++ +++ ++ ++ +++ +++ ± +++/++ – ± – –
The intensities of signals indicated above represent a subjective consensus of sections examined from the CNS and peripheral organs collected from male Luchuan piglets (N = 3). The signals were estimated as score intensity of immunoreactivity on a scale of to 3 + as: , absence of immunoreactivity; +, mild; ++, moderate; +++, intense; +/−, there was heterogeneity in the signal, e.g., some of the histological units contained signal, and others did not.
2.1.2. Distribution of GnIH immunoreactive cells in the peripheral organs Male Reproductive system: In the testis (Fig. 3A–C), Leydig cells in the testis interstitium as well as the spermatogenic epithelium displayed moderate to strong GnIH immunoreactivity, while the Sertoli cells were negative. In the testicular lobule (Fig. 3D and E), strong GnIH immunoreactivity in the spermatogonium was prominent. In the
no reports demonstrating the comprehensive anatomical locations of GnIH in fish and mammals. There is also a lack of information on the distribution and biological role of GnIH in pigs. Although we have 43
Gene Expression Patterns 28 (2018) 42–53
X. Wang et al.
Fig. 1. Distribution of GnIH immunoreactive cells in the telencephalon of Luchuan male piglets. The GnIH immunostaining results in the cerebral cortex (1A), septal region (1E), diagonal band (1F), hippocampus (1G) and olfactory bulb (1J). High magnification of GnIH immunoreactive cells in external pyramidal (1D) and internal pyramidal (1C) layers of the cerebral cortex (1B); the stratum multiformis (1H) and stratum pyramidale (1I) of the hippocampus; the mitral cell layer the olfactory bulb (1K, 1L). Negative controls in the cerebral cortex (1M), hippocampus (1N) and olfactory bulb (1O) of Luchuan male piglets. The sections were counterstained with hematoxylin. The primary antibody was replaced in the control section with 1% normal horse serum or the preadsorption of the RFRP-3 antiserum with the RFRP-3 antigen (10 g/ml). Scale bar in (1A, 1J, 1M-1O) = 200 μm, (1B, 1G) = 100 μm, (1E, 1F, 1H, 1I, 1K) = 50 μm, (1C, 1D, 1L) = 20 μm.
lymph nodes, the lymphoid nodule in the palatine tonsil exhibited intense to moderate levels of GnIH immunoreactivity, while dispersed GnIH immunoreactive cells localized to the diffuse lymphoid tissue (Fig. 4K). In addition, the stratified squamous epithelium of the palatine tonsil also showed intense GnIH staining (Fig. 4L). In the spleen (Fig. 4M–O), the white pulp displayed strong GnIH staining, whereas no GnIH immunoreactivity was detected in the red pulp. Urinary system: In the kidneys (Fig. 3L and M), the renal corpuscle and medullary ray showed moderate levels of GnIH immunoreactivity, but GnIH signals were weakly detected in the cortical labyrinth and renal medulla. The muscularis of the urinary bladder displayed moderate GnIH immunoreactivity (Fig. 3N and O). Digestive tract: In the esophagus (Fig. 5A–D), the stratified squamous epithelium, esophageal gland and muscularis showed intense to moderate staining. GnIH immunoreactivity was found in the layers of mucosa and the tunica muscularis in all the digestive tract as well as in the layer of submucosa in the esophagus and dodecadactylon. In the stomach (Fig. 5E–H), an intense level of GnIH immunoreactivity was observed in the mucosa, while moderate immunoreactivity was
epididymis (Fig. 3F and G), the small transportation ducts and epididymal ducts showed intense GnIH staining. The multi-tube gland epithelium of the accessory glands including the prostate gland (Fig. 3H and I) and seminal vesicular gland (Fig. 3J and K) also displayed strong staining. Endocrine system: The follicular epithelial cells and parafollicular cells of the thyroid gland showed intense to moderate levels of GnIH immunoreactivity (Fig. 4A and B). In the parathyroid gland (Fig. 4C and D), moderate GnIH staining was detected in the chief cells, while acidophilic cells were strongly positive. In the adrenal cortex (Fig. 4E and F), GnIH was weakly detected in the reticular and fascicular zones, but it was strongly detected in the glomerulosa. No GnIH immunoreactivity was found in the adrenal medulla. Immune system: In the thymus (Fig. 4G and H), a few GnIH immunoreactive cells were weakly detected in the cortex, but they were strongly detected in the medulla. In the lymph nodes (Fig. 4I and J), many moderately immunoreactive cells were distributed in the lymphoid nodules, while some moderately to weakly immunoreactive cells were dispersed in the paracortical area and the medulla. Similar to the 44
Gene Expression Patterns 28 (2018) 42–53
X. Wang et al.
Fig. 2. Distribution of GnIH immunoreactive cells in the diencephalon, brainstem, cerebellum and spinalcord of Luchuan male piglets. The GnIH immunostaining results in the hypothalamic periventricular regions (2A, 2B); SON (2E) and Arc (2F) in the hypothalamus; midbrain (2G); parabrachial nucleus in the pons (2J); CGMB, DR and inferior olivary nucleus in the medulla oblongata (2K, 2M); cerebellum (2N) and spinalcord (2P). High magnification of GnIH immunoreactive cells in the IPe (2C, 2D) of hypothalamus; central gray substance of the midbrain (2H, 2I); tegmental area of the medulla oblongata (2L); Purkinje cell layer of the cerebellum (2O); gray matter of the spinalcord (2Q). Negative controls in the brainstem (2R), cerebellum (2S) and spinalcord (2T) of Luchuan male piglets. The sections were counterstained with hematoxylin. The primary antibody was replaced in the control section with 1% normal horse serum or the preadsorption of the RFRP-3 antiserum with the RFRP-3 antigen (10 g/ml). Scale bar in (2A, 2B, 2G, 2J, 2K, 2M, 2P, 2R-2T) = 200 μm, (2E, 2F, 2L, 2N, 2Q) = 100 μm, (2C, 2D, 2H, 2I, 2O) = 20 μm. Abbreviations: Arc, a rcuate nucleus; SON, supraoptic nucleus; CGMB, central gray substance of the medulla oblongata; DR, dorsal raphe nucleus; IPe, intermediate periventricular nucleus.
tunicamuscularis layers generally showed intense to moderate staining. Digestive gland: Moderate GnIH immunoreactivity was widely distributed in the glandular lobule, secretory duct and interlobular duct of the submandibular gland (Fig. 5M–O). In the pancreas (Fig. 5P and Q), abundant GnIH immunoreactive cells were concentrated in the islet
observed in the tunica muscularis. The location of GnIH immunoreactivity in the intestine was nearly the same as that of the esophagus. In the small and large intestines (Fig. 5I–L), the duodenal glands and lymphoid nodules conspicuously exhibited strong and maximal GnIH immunoreactivity, while the mucosa and 45
Gene Expression Patterns 28 (2018) 42–53
X. Wang et al.
Fig. 3. Distribution of GnIH immunoreactive cells in the male Reproductive system and urinary system of Luchuan male piglets. The GnIH immunostaining results in the testis (3A), epididymis (3D, 3F), prostate gland (3H), seminal vesicular gland (3J), kidneys (3L), and urinary bladder (3N). High magnification of GnIH immunoreactive cells in the interstitium and spermatogenic epithelium of the testis (3B, 3C); small transportation ducts (3E) and epididymal ducts (3G) of the epididymis; multi-tube gland epithelium of the prostate gland (3I) and seminal vesicular gland (3K); renal corpuscle of the kidneys (3M); muscularis of the urinary bladder (3O). Negative controls in the testis (3P), epididymis (3Q), prostate gland (3R), seminal vesicular gland (3S), kidneys (3T), and urinary bladder (3U) of Luchuan male piglets. The sections were counterstained with hematoxylin. The primary antibody was replaced in the control section with 1% normal horse serum or the preadsorption of the RFRP-3 antiserum with the RFRP-3 antigen (10 g/ml). Scale bar in (3A, 3D, 3F, 3H, 3J, 3L, 3P3T) = 200 μm, (3B, 3E, 3N) = 50 μm, (3C, 3G, 3I, 3K, 3M, 3O, 3U) = 20 μm.
46
Gene Expression Patterns 28 (2018) 42–53
X. Wang et al.
Fig. 4. Distribution of GnIH immunoreactive cells in the endocrine system and immune system of Luchuan male piglets. The GnIH immunostaining results in the thyroid gland (4A), parathyroid gland (4C), adrenal cortex (4E), thymus (4G), lymph nodes (4I), palatine tonsil (4K) and spleen (4M). High magnification of GnIH immunostaining in the follicular epithelial cells and parafollicular cells of the thyroid gland (4B); chief cells and acidophilic cells of the parathyroid gland (4D); glomerulosa of the adrenal cortex (4F); medulla of the thymus (4H); lymphoid nodules and paracortical area of the lymph nodes (4J); lymphoid nodule of the palatine tonsil (4L); white pulp of the spleen (4N, 4O). Negative controls in the thyroid gland (4P), parathyroid gland (4Q), adrenal cortex (4R), thymus (4S), lymph nodes (4T) and spleen (4U) of Luchuan male piglets. The sections were counterstained with hematoxylin. The primary antibody was replaced in the control section with 1% normal horse serum or the preadsorption of the RFRP-3 antiserum with the RFRP-3 antigen (10 g/ml). Scale bar in (4E, 4I, 4M, 4T) = 200 μm, (4C, 4J, 4R, 4U) = 100 μm, (4A, 4F, 4G, 4K, 4N, 4P, 4Q, 4S) = 50 μm, (4B, 4D, 4H, 4L, 4O) = 20 μm.
47
Gene Expression Patterns 28 (2018) 42–53
X. Wang et al.
of pancreas, which showed intense to moderate staining. However, very weak GnIH signals were detected in the liver (Fig. 5R and S). Respiratory system: Moderate GnIH staining was observed in the pseudostratified ciliated columnar epithelium, tracheal gland and smooth muscle of the trachea (Fig. 6A–C), whereas no GnIH immunoreactivity was found in the lungs (Fig. 6D). Cardiovascular system: Weak levels of GnIH immunoreactivity were observed in the heart (Fig. 6E and F), but no staining was found in the large artery (Fig. 6G). Muscle tissue and skin: No GnIH immunoreactivity was found in muscle (Fig. 6H) or skin (Fig. 6I). 2.2. Expression patterns of GnIH mRNA in the tissues of male Luchuan piglets We next examined the expression of GnIH mRNA in various pig tissues. Semi-quantitative RT-PCR showed that GnIH mRNA was expressed in various tissues. High levels of GnIH mRNA were detected in all CNS tissues, including the medulla oblongata, hypothalamus, midbrain, cerebral cortex, pons, spinal cord, olfactory bulb, cerebellum and hippocampus. In the peripheral organs, high GnIH mRNA levels were detected in the testis, epididymis and kidney, while no expression of GnIH was observed in the liver, lungs, heart, trachea, esophagus, thyroid gland, thymus and large artery (See Fig. 7). 3. Discussion Since the isolation of the GnIH peptide from the quail brain in 2000, it has been generally accepted that GnIH is one of the hypothalamic neuropeptides regulating gonadotropin release in mammals and other vertebrates (Clarke et al., 2009; Tsutsui, 2009; Tsutsui and Osugi, 2009; Tsutsui et al., 2017; Ubuka et al., 2018; Zhang et al., 2010). Although the mechanism of action of GnIH at the molecular, cellular, morphological, physiological, and behavioral levels has been investigated over the past fifteen years, there are some themes that should be extensively investigated in future studies. One of these themes is the underlying sites of action and potential functions of GnIH. Therefore, in the present study, the distribution of GnIH was systemically determined, while the expression of GnIH mRNA was also investigated in different CNS and peripheral organs in male Luchuan piglets (Table 2). Our findings provided particular evidence for multiple physiological functions of pig GnIH at molecular and morphological levels. Using in situ hybridization and immunohistochemistry, the morphological locations of GnIH has been investigated in the brains of birds and mammals. GnIH immunohistochemistry showed that clusters of GnIH-ir neuronal cell bodies were located in the PVN and GnIH-ir nerve fibers were widely distributed in multiple brain regions including the septal area, preoptic area, hypothalamus and the dorsal motor nucleus of the vagus in the medulla oblongata in quail (Bentley et al., 2003; Ubuka et al., 2003; Ukena et al., 2003), house and song sparrows (Bentley et al., 2003), white-crowned sparrows (Osugi et al., 2004), zebra finches (Tobari et al., 2010), and European starlings (Ubuka et al., 2008). In mammals, GnIH is mainly located in the DMN and PVN with a similar distribution as that in the avian brain (Clarke et al., 2008; Kriegsfeld et al., 2006). Abundant GnIH-ir fibers were observed in the nucleus of the stria terminalis in the telencephalon, habenular nucleus, paraventricular nucleus of the thalamus, POA, paraventricular nucleus of the hypothalamus, IPe, arcuate nucleus of the hypothalamus, median eminence and dorsal hypothalamic area in the diencephalon, medial region of the superior colliculus, central gray substance of the midbrain, dorsalraphe nucleus in the midbrain, parabrachial nucleus in the pons, nucleustractus solitarius in the medulla oblongata and spinal cord (Gibson et al., 2008; Johnson et al., 2007; Papargiris et al., 2011; Ubuka et al., 2009). Our findings are in agreement with previous studies that suggest GnIH may participate not only in neuroendocrine functions but also in behavioral and autonomic mechanisms. In recent years, the roles
Fig. 5. Distribution of GnIH immunoreactive cells in the digestive tract and digestive gland of Luchuan male piglets. The GnIH immunostaining results in the esophagus (5A), stomach (5E), small intestines (5I), large intestines (5K), submandibular gland (5M), pancreas (5P) and liver (5R). High magnification of GnIH immunoreactive cells in the stratified squamous epithelium (5B, 5C) and esophageal gland (5B, 5D) of the esophagus; mucosa (5F) and tunica muscularis (5G, 5H) of the stomach; mucosa and duodenal glands of the small intestines (5J); mucosa (5K) and lymphoid nodules (5L) of the large intestines; glandular lobule (5O), secretory duct (5O) and interlobular duct (5N) of the submandibular gland; islet of the pancreas (5Q); liver cells (5S). Negative controls in the esophagus (5T), stomach (5U), large intestines (5V), submandibular gland (5W), pancreas (5X) and liver (5Y) of Luchuan male piglets. The sections were counterstained with hematoxylin. The primary antibody was replaced in the control section with 1% normal horse serum or the preadsorption of the RFRP-3 antiserum with the RFRP-3 antigen (10 g/ ml). Scale bar in (5A, 5I, 5R, 5V) = 200 μm, (5B, 5E, 5G, 5J, 5K, 5L, 5M, 5P, 5T, 5V, 5W5Y) = 100 μm, (5C, 5H) = 50 μm, (5D, 5F, 5N, 5O, 5Q, 5S) = 20 μm.
48
Gene Expression Patterns 28 (2018) 42–53
X. Wang et al.
Fig. 6. Distribution of GnIH immunoreactive cells in the respiratory system, cardiovascular system, muscle tissue and skin of Luchuan male piglets. The GnIH immunostaining results in the trachea (6A), lungs (6D), heart (6E), large artery (6G), muscle (6H) and skin (6I). High magnification of GnIH immunoreactive cells in the pseudostratified ciliated columnar epithelium, tracheal gland and smooth muscle of the trachea (6C). Negative controls in the trachea (6J), lungs (6K), heart (6L), large artery (6M), muscle (6N) and skin (6O) of Luchuan male piglets. The sections were counterstained with hematoxylin. The primary antibody was replaced in the control section with 1% normal horse serum or the preadsorption of the RFRP-3 antiserum with the RFRP-3 antigen (10 g/ml). Scale bar in (6D, 6K) = 200 μm, (6A, 6E, 6G, 6H, 6I, 6J, 6L, 6M-6O) = 100 μm, (6B, 6C) = 50 μm, (6F) = 20 μm.
round to early elongated spermatids. Recently, immunolocalization in the testis of male Xiaomeishan pigs revealed that the GnIH immunoreactivity mainly localized to the spermatogenic cells, sustentacular cells and interstitial cells of the testis throughout sexual development (Zheng et al., 2015). Our findings are in agreement with previous studies suggesting that GnIH can regulate reproductive functions in an autocrine and/or paracrine manner at the level of the gonads in several species, including pigs. Furthermore, we demonstrated that GnIH was distributed in the pig epididymis and accessory glands as well as the testis, suggesting that GnIH may regulate germ cell differentiation and maturation. Although previous studies have confirmed that GnIH is a key neurohormone controlling vertebrate reproduction, accumulated data further indicated that GnIH is involved in the stress response, food intake, and aggressive and sexual behaviors, suggesting a broad physiological role for this neuropeptide (Clarke et al., 2012; Tsutsui et al., 2012; Ubuka et al., 2012b, 2018). Moreover, the morphological locations of GnIH mainly focus on the brain and hypothalamic–pituitary–gonadal axis. There is limited information regarding the distribution of GnIH in the peripheral organs in many species, from fish to mammals. To provide more morphological evidence to support its multiple physiological functions, the distribution of GnIH was also investigated in the male pig endocrine system, immune system, urinary system, digestive system,
of GnIH in mediating feeding, social, and reproductive behaviors were confirmed in birds and rodent species (Papargiris et al., 2011; Ubuka et al., 2012b, 2018). These physiological findings and the morphological locations of GnIH in the brain are corroborative. At the same time, the distribution of GnIH in the brain provides morphological evidence of its physiological functions. Interestingly, the distribution of GnIH in the pig central nervous system seemed more extensive than previous data. GnIH-ir neuronal cell bodies were found in many limbic brain regions, such as the cerebral cortex, the hippocampus, the external plexiform layer of the olfactory bulb and the Purkinje cell layer of the cerebellum, which has not been observed in previous studies. GnIH extends widely in the male pig brain, suggesting that it may have even more physiological functions than previously known. Because the effect of GnIH on reproductive functions was first confirmed in many vertebrate species, there are several studies that have reported the distribution of GnIH in the reproductive system. In birds, mice and the lizard Calotes versicolor, GnIH mainly localized in the granulosa cells and theca cells of antral follicles, as well as in the luteal cells of the corpora lutea (Maddineni et al., 2008; Singh et al., 2008, 2011b). Similar results were also obtained in female pigs in our previous study (Li et al., 2012). However, much less is known regarding the distribution of GnIH in the male reproductive system. In Syrian hamsters (Zhao et al., 2010), GnIH is produced in spermatocytes and in
49
Gene Expression Patterns 28 (2018) 42–53
X. Wang et al.
Fig. 7. Expression patterns of GnIH mRNA in the tissues of male Luchuan piglets. (A) Agarose gel electrophoresis pictures of GAPDH and GnIH. (B) Statistical analysis of GnIH mRNA in different tissues of Luchuan male piglets. Relative level of GnIH mRNA was determined by the ratio of intensity values of GnIH bands normalized to the corresponding GAPDH (internal control). 1, large artery; 2, stomach; 3, hypophysis; 4, transverse colon; 5, liver; 6, submandibular gland; 7, thyroid gland; 8, ileum; 9, trachea; 10, adrenal gland; 11, skin; 12, epididymis; 13, fat; 14, thymus; 15, kidney; 16, medulla oblongata; 17, pons; 18, midbrain; 19, esophagus; 20, hypothalamus; 21, duodenum; 22, parotid gland; 23, lung; 24, testis; 25, jejunum; 26, rectum; 27, olfactory bulb; 28, spinal cord; 29, cerebral cortex; 30, cerebellum; 31, hippocampus; 32, spleen; 33, palatine tonsil; 34, muscle; 35, heart.
50
Gene Expression Patterns 28 (2018) 42–53
X. Wang et al.
respiratory system, cardiovascular system, muscle tissue and skin. We were happily surprised to discover that GnIH was widely distributed in the endocrine system, immune system, digestive system, and even the urinary system. We presumed that these results were likely due to GnIH control of the peripheral organs via an autocrine and/or paracrine manner to affect physiological homeostasis, which then impacts an organism's ability to survive and reproduce. Physiological action studies indicated that GnIH is associated with behaviors important for survival and reproduction, such as the stress response, feeding behaviors, and social, environmental, and reproductive behaviors. Our results provide detailed morphological evidence to support this hypothesis. Studies have found that GnIH mRNA expression is mainly concentrated in the brain, especially in the hypothalamus in several vertebrates. Using in situ hybridization, GnIH mRNA was expressed in multiple brain regions including the diencephalon, telencephalon, midbrain, pons and medulla oblongata in birds (Ukena et al., 2003), rodents (Kriegsfeld et al., 2006), sheep (Clarke et al., 2008) and the rhesus macaque (Ubuka et al., 2009). The expression of GnIH mRNA in different peripheral tissues was demonstrated in zebrafish (Zhang et al., 2010), rats and humans (Hinuma et al., 2000). Zhang et al. presented data indicating that GnIH is mostly expressed in the zebrafish brain, eye, testis, and ovary, with some expression in the muscle, spleen, kidney, and other peripheral tissues (Zhang et al., 2010). Similar studies in humans and rats found that GnIH mRNA was highly expressed in the hypothalamus and eye with low expression in the testis (Hinuma et al., 2000). The expression of GnIH mRNA in various female pig tissues was investigated in our previous study (Li et al., 2012). Both our previous and present studies confirmed that high levels of GnIH mRNA were mainly expressed in the brain and reproductive organs. GnIH mRNA was expressed in only a few peripheral organs, which differed from the morphological locations of GnIH. A possible explanation for this discrepancy is that GnIH synthesis and activity occur in different organs.
determined using a photometer. The RNA integrity was assessed by RNA electrophoresis. For each tissue, equal amounts of all RNA samples were reverse transcribed simultaneously using an oligo (deoxythymidine) 15primer and the M-MLV reverse transcriptase according to the manufacturer's instructions (Vazyme Biotech Co., Ltd, China). All RT reactions were performed at 42 °C with nuclease-free water serving as the negative control. 4.2.2. Semi-quantitative RT-PCR analysis The gene-specific primers for GnIH were designed from the clone sequences shown in Table 1, and the pig GAPDH gene was used as an internal control. A pooled sample was made by mixing equal quantities of total RNA from all samples and was used for optimizing the PCR conditions. In addition, different cycle numbers were tested to optimize amplification in the exponential phase of PCR. The amplification reactions were conducted at least threetimes. PCR conditions were established as follows: (1) for GnIH: denaturation at 95 °C for 5 min, followed by 38 cycles of denaturation at 95 °C for 30 s, annealing at 56 °C for 30 s, and extension at 72 °C for 30 s, and finally, an additional extension step at 72 °C for 10 min; and (2) for GAPDH: denaturation at 95 °C for 5 min, followed by 27 cycles of denaturation at 95 °C for 30 s, annealing at 57 °C for 30 s, and extension at 72 °C for 30 s, and finally, an additional extension step at 72 °C for 10 min. An aliquot (10 μl) of each PCR product was analyzed by electrophoresis. The gel was stained and photographed using a digital camera. The band intensities were analyzed with the Kodak ID Electrophoresis Documentation and Analysis System 120 (Kodak Photo Film Co. Ltd., USA). The ratio of the target gene intensity to the GAPDH intensity was used to represent the abundance of mRNA expression. 4.2.3. Immunohistochemistry The tissue samples for immunochemistry were cut into 5 μm sections. One in every ten sections of the brain was processed immunohistochemically for GnIH immunoreactivity. The procedure, the antibody dilution and specificity for immunohistochemistry have been described previously (Li et al., 2012). To test the specificity of the immunoreaction, the primary antiserum was replaced in the control section with (1) 1% normal horse serum; (2) the preadsorption of the RFRP-3 antiserum with the RFRP-3 antigen (10 g/ml). For the preadsorption, the antigens were added to the diluted antisera (in the same dilution as used for localization) and incubated overnight at 4 °C. Immunohistochemical analyses were performed using the avidin–biotin–peroxidase complex (ABC) method (Wuhan Boster Biological Technology Co., Ltd., China). The peroxidase activity was monitored using 0.03% DAB (Wuhan Boster Biological Technology Co., Ltd., China) in 0.05 M Tris, pH 7.6, for 5 min. The sections were counterstained with hematoxylin. The slides were observed under a Nikon ECLipse Ti light microscope and photographed by a Nikon DXM 12000E digital camera (Japan). The degree of stain was designated by semiquantitative analysis (analysis of 10 microscopic fields at 400 × magnification). According to the intensity of brown stain in different cells, the positive stain was graded into mild, moderate and marked immunostain. Data were obtained using a Leica Qwin 500 image analyzer computer system as previously described (Abd El-Meseeh et al., 2016). Area percentage ranging between 1 and 3 means for mild, 4 and 6 means for moderate and 7 and 10 means for marked immuno-reactivity.
4. Experimental procedures 4.1. Materials All of the pigs were fed according to the breeding standards of Chinese Local Pigs and the National Research Council (NRC). All the experiments were performed according to the guidelines of the regional Animal Ethics Committee and the rules for experimental animals of Guangxi University. Three male Luchuan piglets aged 1 month old that weighed 10 ± 2 kg were used in this study. The animals were maintained with constant food, temperature, and humidity conditions for at least 5 d prior to tissue collection. The pigs were terminally anesthetized and decapitated within 15 min of capture, and different tissues were removed: the cerebral cortex, cerebellum, spinal cord, hippocampus, olfactory bulb, hypothalamus, medulla oblongata, pons, midbrain, hypophysis, trachea, lung, heart, large artery, stomach, esophagus, duodenum, jejunum, Ileum, colon, rectum, liver, skin, parotid gland, submandibular gland, testis, epididymis, kidney, adrenal gland, thyroid gland, palatine tonsil, mesenteric lymph node, and thymus. Two kinds of samples were prepared from all of the tissues. One part of each tissue sample was frozen in liquid nitrogen and stored at 80 °C until RNA was isolated for semi-quantitative RT-PCR. The other parts of the tissue samples were fixed in neutral-buffered formalin for immunochemistry.
5. Conclusions 4.2. Methods In summary, this is the first systemic morphological study to show that GnIH synthesis is distributed in many peripheral organs as well as the CNS. Emerging studies have confirmed that GnIH is a multifunctional neuropeptide involved in many physiological actions such as reproduction, feeding, stress and behaviors. This study provided detailed morphological evidence to support this hypothesis. In addition,
4.2.1. RNA purification and reverse transcription The total RNA was extracted using the TRIzol extraction method. The subsequent procedures for RNA isolation and purification were performed as detailed in the manufacturer's instructions (Vazyme Biotech Co., Ltd, China). The RNA quality and concentration were 51
Gene Expression Patterns 28 (2018) 42–53
X. Wang et al.
the wide distribution of GnIH in the CNS and peripheral organs suggests that GnIH may have even more physiological functions than are currently known. Therefore, the multiple sites of action, physiological mechanisms and potential functions of GnIH at the cellular, molecular and morphological levels in different vertebrates require further investigation.
receptor null mouse. Endocrinology 155, 2953–2965. Li, X., Su, J., Fang, R., Zheng, L., Lei, R., Wang, X., Lei, Z., Jin, M., Jiao, Y., Hou, Y., Guo, T., Ma, Z., 2013. The effects of RFRP-3, the mammalian ortholog of GnIH, on the female pig reproductive axis in vitro. Mol. Cell. Endocrinol. 372, 65–72. Li, X., Su, J., Lei, Z., Zhao, Y., Jin, M., Fang, R., Zheng, L., Jiao, Y., 2012. Gonadotropininhibitory hormone (GnIH) and its receptor in the female pig: cDNA cloning, expression in tissues and expression pattern in the reproductive axis during the estrous cycle. Peptides 36, 176–185. Maddineni, S.R., Ocon-Grove, O.M., Krzysik-Walker, S.M., Hendricks 3rd, G.L., Ramachandran, R., 2008. Gonadotropin-inhibitory hormone (GnIH) receptor gene is expressed in the chicken ovary: potential role of GnIH in follicular maturation. Reproduction 135, 267–274. Osugi, T., Ukena, K., Bentley, G.E., O'Brien, S., Moore, I.T., Wingfield, J.C., Tsutsui, K., 2004. Gonadotropin-inhibitory hormone in Gambel's white-crowned sparrow (Zonotrichia leucophrys gambelii): cDNA identification, transcript localization and functional effects in laboratory and field experiments. J. Endocrinol. 182, 33–42. Papargiris, M.M., Rivalland, E.T., Clarke, I.J., Smith, J.T., Pereira, A., Tilbrook, A.J., 2011. Evidence that RF-amide related peptide-3 is not a mediator of the inhibitory effects of psychosocial stress on gonadotrophin secretion in ovariectomised ewes. J. Neuroendocrinol. 23, 208–215. Qi, Y., Oldfield, B.J., Clarke, I.J., 2009. Projections of RFamide-related peptide-3 neurones in the ovine hypothalamus, with special reference to regions regulating energy balance and reproduction. J. Neuroendocrinol. 21, 690–697. Singh, P., Krishna, A., Sridaran, R., Tsutsui, K., 2008. Changes in GnRH I, bradykinin and their receptors and GnIH in the ovary of Calotes versicolor during reproductive cycle. Gen. Comp. Endocrinol. 159, 158–169. Singh, P., Krishna, A., Sridaran, R., Tsutsui, K., 2011a. Immunohistochemical localization of GnRH and RFamide-related peptide-3 in the ovaries of mice during the estrous cycle. J. Mol. Histol. 42, 371–381. Singh, P., Krishna, A., Tsutsui, K., 2011b. Effects of gonadotropin-inhibitory hormone on folliculogenesis and steroidogenesis of cyclic mice. Fertil. Steril. 95, 1397–1404. Smith, J.T., Clarke, I.J., 2010. Gonadotropin inhibitory hormone function in mammals. Trends Endocrinol. Metabol. 21, 255–260. Tobari, Y., Iijima, N., Tsunekawa, K., Osugi, T., Okanoya, K., Tsutsui, K., Ozawa, H., 2010. Identification of gonadotropin-inhibitory hormone in the zebra finch (Taeniopygia guttata): peptide isolation, cDNA cloning and brain distribution. Peptides 31, 816–826. Tsutsui, K., 2009. A new key neurohormone controlling reproduction, gonadotropin-inhibitory hormone (GnIH): biosynthesis, mode of action and functional significance. Prog. Neurobiol. 88, 76–88. Tsutsui, K., 2010. Phylogenetic aspects of gonadotropin-inhibitory hormone and its homologs in vertebrates. Ann. N. Y. Acad. Sci. 1200, 75–84. Tsutsui, K., Bentley, G.E., Kriegsfeld, L.J., Osugi, T., Seong, J.Y., Vaudry, H., 2010. Discovery and evolutionary history of gonadotrophin-inhibitory hormone and kisspeptin: new key neuropeptides controlling reproduction. J. Neuroendocrinol. 22, 716–727. Tsutsui, K., Bentley, G.E., Ubuka, T., Saigoh, E., Yin, H., Osugi, T., Inoue, K., Chowdhury, V.S., Ukena, K., Ciccone, N., Sharp, P.J., Wingfield, J.C., 2007. The general and comparative biology of gonadotropin-inhibitory hormone (GnIH). Gen. Comp. Endocrinol. 153, 365–370. Tsutsui, K., Osugi, T., 2009. Evolutionary origin and divergence of GnIH and its homologous peptides. Gen. Comp. Endocrinol. 161, 30–33. Tsutsui, K., Osugi, T., Son, Y.L., Ubuka, T., 2017. Review: structure, function and evolution of GnIH. Gen. Comp. Endocrinol. http://dx.doi.org/10.1016/j.ygcen.2017.07. 024. PMID: 28754274, (In press). Tsutsui, K., Saigoh, E., Ukena, K., Teranishi, H., Fujisawa, Y., Kikuchi, M., Ishii, S., Sharp, P.J., 2000. A novel avian hypothalamic peptide inhibiting gonadotropin release. Biochem. Biophys. Res. Commun. 275, 661–667. Tsutsui, K., Ubuka, T., Bentley, G.E., Kriegsfeld, L.J., 2012. Gonadotropin-inhibitory hormone (GnIH): discovery, progress and prospect. Gen. Comp. Endocrinol. 177, 305–314. Ubuka, T., Inoue, K., Fukuda, Y., Mizuno, T., Ukena, K., Kriegsfeld, L.J., Tsutsui, K., 2012a. Identification, expression, and physiological functions of Siberian hamster gonadotropin-inhibitory hormone. Endocrinology 153, 373–385. Ubuka, T., Kim, S., Huang, Y.C., Reid, J., Jiang, J., Osugi, T., Chowdhury, V.S., Tsutsui, K., Bentley, G.E., 2008. Gonadotropin-inhibitory hormone neurons interact directly with gonadotropin-releasing hormone-I and -II neurons in European starling brain. Endocrinology 149, 268–278. Ubuka, T., Lai, H., Kitani, M., Suzuuchi, A., Pham, V., Cadigan, P.A., Wang, A., Chowdhury, V.S., Tsutsui, K., Bentley, G.E., 2009. Gonadotropin-inhibitory hormone identification, cDNA cloning, and distribution in rhesus macaque brain. J. Comp. Neurol. 517, 841–855. Ubuka, T., Mukai, M., Wolfe, J., Beverly, R., Clegg, S., Wang, A., Hsia, S., Li, M., Krause, J.S., Mizuno, T., Fukuda, Y., Tsutsui, K., Bentley, G.E., Wingfield, J.C., 2012b. RNA interference of gonadotropin-inhibitory hormone gene induces arousal in songbirds. PLoS One 7, e30202. Ubuka, T., Parhar, I., Kriegsfeld, L.J., Tsutsui, K., 2018. Editorial: the roles of GnIH in reproductive function and behavior. Front. Endocrinol. 9, 19. Ubuka, T., Ueno, M., Ukena, K., Tsutsui, K., 2003. Developmental changes in gonadotropin-inhibitory hormone in the Japanese quail (Coturnix japonica) hypothalamohypophysial system. J. Endocrinol. 178, 311–318. Ubuka, T., Ukena, K., Sharp, P.J., Bentley, G.E., Tsutsui, K., 2006. Gonadotropin-inhibitory hormone inhibits gonadal development and maintenance by decreasing gonadotropin synthesis and release in male quail. Endocrinology 147, 1187–1194. Ukena, K., Ubuka, T., Tsutsui, K., 2003. Distribution of a novel avian gonadotropin-inhibitory hormone in the quail brain. Cell Tissue Res. 312, 73–79.
Conflicts of interest The authors declared that they have no conflicts of interest to this work. We declare that we do not have any commercial or associative interest that represents a conflict of interest in connection with the work submitted. Acknowledgments This work received financial support from the National Natural Science Foundation of China (NSFC) (31402151) and the Natural Science Foundation of Guangxi province (2015GXNSFBA139077; 2017GXNSFAA198086). Appendix A. Supplementary data Supplementary data related to this article can be found at http://dx. doi.org/10.1016/j.gep.2018.02.004. References Abd El-Meseeh, N.A., El-Shaarawy, E.A., AlDomairy, A.F., Sehly, R.A., 2016. Changes in rat testis morphology and androgen receptor expression around the age of puberty. Ann. Anat. 205, 37–44. Bentley, G.E., Perfito, N., Ukena, K., Tsutsui, K., Wingfield, J.C., 2003. Gonadotropininhibitory peptide in song sparrows (Melospiza melodia) in different reproductive conditions, and in house sparrows (Passer domesticus) relative to chicken-gonadotropin-releasing hormone. J. Neuroendocrinol. 15, 794–802. Bentley, G.E., Ubuka, T., McGuire, N.L., Chowdhury, V.S., Morita, Y., Yano, T., Hasunuma, I., Binns, M., Wingfield, J.C., Tsutsui, K., 2008. Gonadotropin-inhibitory hormone and its receptor in the avian reproductive system. Gen. Comp. Endocrinol. 156, 34–43. Clarke, I.J., Qi, Y., Puspita Sari, I., Smith, J.T., 2009. Evidence that RF-amide related peptides are inhibitors of reproduction in mammals. Front. Neuroendocrinol. 30, 371–378. Clarke, I.J., Sari, I.P., Qi, Y., Smith, J.T., Parkington, H.C., Ubuka, T., Iqbal, J., Li, Q., Tilbrook, A., Morgan, K., Pawson, A.J., Tsutsui, K., Millar, R.P., Bentley, G.E., 2008. Potent action of RFamide-related peptide-3 on pituitary gonadotropes indicative of a hypophysiotropic role in the negative regulation of gonadotropin secretion. Endocrinology 149, 5811–5821. Clarke, I.J., Smith, J.T., Henry, B.A., Oldfield, B.J., Stefanidis, A., Millar, R.P., Sari, I.P., Chng, K., Fabre-Nys, C., Caraty, A., Ang, B.T., Chan, L., Fraley, G.S., 2012. Gonadotropin-inhibitory hormone is a hypothalamic peptide that provides a molecular switch between reproduction and feeding. Neuroendocrinology 95, 305–316. Ducret, E., Anderson, G.M., Herbison, A.E., 2009. RFamide-related peptide-3, a mammalian gonadotropin-inhibitory hormone ortholog, regulates gonadotropin-releasing hormone neuron firing in the mouse. Endocrinology 150, 2799–2804. Gibson, E.M., Humber, S.A., Jain, S., Williams 3rd, W.P., Zhao, S., Bentley, G.E., Tsutsui, K., Kriegsfeld, L.J., 2008. Alterations in RFamide-related peptide expression are coordinated with the preovulatory luteinizing hormone surge. Endocrinology 149, 4958–4969. Hinuma, S., Shintani, Y., Fukusumi, S., Iijima, N., Matsumoto, Y., Hosoya, M., Fujii, R., Watanabe, T., Kikuchi, K., Terao, Y., Yano, T., Yamamoto, T., Kawamata, Y., Habata, Y., Asada, M., Kitada, C., Kurokawa, T., Onda, H., Nishimura, O., Tanaka, M., Ibata, Y., Fujino, M., 2000. New neuropeptides containing carboxy-terminal RFamide and their receptor in mammals. Nat. Cell Biol. 2, 703–708. Johnson, M.A., Tsutsui, K., Fraley, G.S., 2007. Rat RFamide-related peptide-3 stimulates GH secretion, inhibits LH secretion, and has variable effects on sex behavior in the adult male rat. Horm. Behav. 51, 171–180. Kriegsfeld, L.J., 2006. Driving reproduction: RFamide peptides behind the wheel. Horm. Behav. 50, 655–666. Kriegsfeld, L.J., Mei, D.F., Bentley, G.E., Ubuka, T., Mason, A.O., Inoue, K., Ukena, K., Tsutsui, K., Silver, R., 2006. Identification and characterization of a gonadotropininhibitory system in the brains of mammals. Proc. Natl. Acad. Sci. U. S. A. 103, 2410–2415. Leon, S., Garcia-Galiano, D., Ruiz-Pino, F., Barroso, A., Manfredi-Lozano, M., RomeroRuiz, A., Roa, J., Vazquez, M.J., Gaytan, F., Blomenrohr, M., van Duin, M., Pinilla, L., Tena-Sempere, M., 2014. Physiological roles of gonadotropin-inhibitory hormone signaling in the control of mammalian reproductive axis: studies in the NPFF1
52
Gene Expression Patterns 28 (2018) 42–53
X. Wang et al.
involvement in early development and the negative control of LH release. Peptides 31, 1034–1043. Zhao, S., Zhu, E., Yang, C., Bentley, G.E., Tsutsui, K., Kriegsfeld, L.J., 2010. RFamiderelated peptide and messenger ribonucleic acid expression in mammalian testis: association with the spermatogenic cycle. Endocrinology 151, 617–627. Zheng, L., Su, J., Fang, R., Jin, M., Lei, Z., Hou, Y., Ma, Z., Guo, T., 2015. Developmental changes in the role of gonadotropin-inhibitory hormone (GnIH) and its receptors in the reproductive axis of male Xiaomeishan pigs. Anim. Reprod. Sci. 154, 113–120.
Ullah, R., Shen, Y., Zhou, Y.D., Huang, K., Fu, J.F., Wahab, F., Shahab, M., 2016. Expression and actions of GnIH and its orthologs in vertebrates: current status and advanced knowledge. Neuropeptides 59, 9–20. Wahab, F., Shahab, M., Behr, R., 2015. The involvement of gonadotropin inhibitory hormone and kisspeptin in the metabolic regulation of reproduction. J. Endocrinol. 225, R49–R66. Zhang, Y., Li, S., Liu, Y., Lu, D., Chen, H., Huang, X., Liu, X., Meng, Z., Lin, H., Cheng, C.H., 2010. Structural diversity of the GnIH/GnIH receptor system in teleost: its
53
Contents lists available at ScienceDirect
Gene Expression Patterns journal homepage: www.elsevier.com/locate/gep
Distribution of gonadotropin-inhibitory hormone (GnIH) in male Luchuan piglets
T
Xiaoye Wang, Xun Li∗, Chuanhuo Hu∗∗ College of Animal Science and Technology, Guangxi University, Nanning, Guangxi, 530004, PR China
A R T I C L E I N F O
A B S T R A C T
Keywords: Gonadotropin inhibitory hormone (GnIH) Male piglets Distribution Immunohistochemistry Central nervous system (CNS) and peripheral organs
Gonadotropin inhibitory hormone (GnIH) has emerged as a novel hypothalamic neuropeptide that actively inhibits gonadotropin release in birds and mammals. Recent evidence indicates that GnIH not only acts as a key neurohormone that controls vertebrate reproduction but is also involved in stress response, food intake, and aggressive and sexual behaviors, suggesting a broad physiological role for this neuropeptide. To elucidate its multiple sites of action and potential functions, studying the detailed distribution of GnIH in different organs, except for the hypothalamus-pituitary-ovary/testis axis, is necessary. Therefore, in the present study, in different central nervous system (CNS) and peripheral organs of male Luchuan piglets, the distribution of GnIH was systemically determined using immunohistochemistry, and the expression of GnIH mRNA was investigated using semi-quantitative reverse transcription polymerase chain reaction (RT-PCR). Our results demonstrate that GnIH immune reactive (GnIH-ir) neurons were widely distributed in the pig CNS, but the number and size of the GnIHir neurons varied and exhibited morphological diversity. In the peripheral organs, GnIH immunoreactive cells were observed in the respiratory tract, alimentary tract, endocrine organs, genitourinary tract and lymphatic organs. GnIH mRNA was highly expressed in the CNS, with the highest expression in the hypothalamus. In the peripheral organs, high GnIH mRNA levels were detected in the testis, while no GnIH expression was observed in the liver, lungs and heart et al. These results demonstrated that GnIH might play an important role in modulating a variety of physiological functions and provided the morphological data for further study of GnIH in pigs.
1. Introduction Gonadotropin-inhibitory hormone (GnIH) is a novel hypothalamic neuropeptide that was originally discovered in 2000 in quail as an inhibitory factor for gonadotropin release (Tsutsui et al., 2000; Ubuka et al., 2012a). After over a decade of research, avian GnIH and its orthologs, which share a common C-terminal LPXRFamide (X = L or Q) motif, have been identified and characterized in various species from fish to mammals (Bentley et al., 2008; Smith and Clarke, 2010; Tsutsui et al., 2017; Ubuka et al., 2018). Importantly, as in birds, mammalian GnIH orthologs [RFamide-related peptides (RFRPs)] also act to inhibit gonadotropin release across mammalian species, including rats, hamsters, and sheep (Tsutsui, 2010; Tsutsui et al., 2010; Ullah et al., 2016). An abundance of original research papers have demonstrated that GnIH appears to act similarly across vertebrate species to regulate reproduction in the hypothalamic–pituitary–gonadal (HPG) axis (Clarke et al., 2009; Tsutsui, 2009; Tsutsui et al., 2017). In the brain, GnIH neuronal cell bodies are found in the hypothalamus, and their fibers mostly extend into the diencephalon and midbrain (Kriegsfeld et al., ∗
2006; Tsutsui et al., 2007; Ukena et al., 2003). GnIH neurons project into the external layer of the median eminence, and GnIH fibers are closely associated with many other neurons, such as GnRH, POMC, NPY, orexin, and kisspeptin neurons (Ducret et al., 2009; Kriegsfeld, 2006; Qi et al., 2009; Ubuka et al., 2008). These findings suggested that GnIH neurons may not only inhibit gonadotropin release and synthesis in the pituitary but also regulate various neurons in the brain. In addition, GnIH and GPR147 are expressed in the gonads and accessory reproductive organs (Li et al., 2012; Singh et al., 2011a; Ubuka et al., 2006), indicating that they are possibly involved in autocrine/paracrine regulation of gonadal steroid production and germ cell differentiation and maturation. Although studies on GnIH in the past decade mainly focused on its reproductive physiology, recent evidence has further indicated that GnIH is also involved in several non-reproductive functions, such as appetite regulation, energy metabolism, and anxiety and stress responses (Clarke et al., 2012; Leon et al., 2014; Tsutsui et al., 2012; Wahab et al., 2015) Multiple physiological functions suggest that GnIH might be widely distributed in many tissues. However, there have been
Corresponding author. College of Animal Science and Technology, Guangxi University, Nanning, Guangxi, 530004, PR China. Corresponding author. E-mail addresses: [email protected] (X. Li), [email protected] (C. Hu).
∗∗
https://doi.org/10.1016/j.gep.2018.02.004 Received 14 December 2017; Received in revised form 22 February 2018; Accepted 22 February 2018 Available online 24 February 2018 1567-133X/ © 2018 Elsevier B.V. All rights reserved.
Gene Expression Patterns 28 (2018) 42–53
X. Wang et al.
cloned partial pig GnIH precursor cDNA and demonstrated its distribution and reproductive functions in the pig hypothalamic–pituitary–gonadal (HPG) axis (Li et al., 2012, 2013), further studies on the multiple sites of action and potential functions of pig GnIH are very important. Therefore, the distribution of GnIH in different central nervous system and peripheral organs of male Luchuan piglets was systemically determined using immunohistochemistry (Table 2), and the expression of GnIH mRNA was investigated. Taken together, the results of this study describe the comprehensive anatomical locations of GnIH in pigs and provide the morphological basis for hypothetical physiological functions of GnIH.
Table 1 Primers and reaction conditions of semi-quantitative RT-PCR. Primers
Sequences (5′–3′)
Length (bp)
GnIH
(+)TAACATCCAACATCTTTTGTACAG (−)CGGGTGATGGAGTAAAGTAAC (+)AGGTCGGAGTGAACGGATTTG (−)CAGTCTTCTGGGTGGCAGTGAT
442
GAPDH
549
Table 2 Localization and relative score intensity of GnIH in the central nervous system and the peripheral organs of male Luchuan piglets. Tissues The central nervous system Telencephalon Cerebral cortex Septal region Hippocampus Olfactory bulb Diencephalon Preoptic area Hypothalamic periventricular regions Suprachiasmatic nucleus Supraoptic nucleus Brainstem Midbrain Pons Medulla oblongata Cerebellum Spinalcord The peripheral organs Male Reproductive system Testis Epididymis Accessory glands Endocrine system Thyroid gland Parathyroid gland Adrenal gland Immune system Thymus Lymph nodes Palatine tonsil Spleen Urinary system Kidneys Urinary bladder Digestive tract Esophagus Stomach Small intestines Large intestines Digestive gland Submandibular gland Pancreas Liver Respiratory system Trachea Lungs Cardiovascular system Heart Large artery Muscle tissue and skin
2. Results
GnIH
2.1. Localization of GnIH in male Luchuan piglet tissues ++ ++ + +
2.1.1. Distribution of GnIH immunoreactive cells in the central nervous system Telencephalon: In the cerebral cortex (Fig. 1A–D), intense and numerous GnIH immunoreactive cells were found in the external granular, external pyramidal and internal pyramidal layers, while dispersed labeled GnIH immunoreactive cells were found in the internal molecular, pyramidal and polymorphic layers. The immunoreactivities of the GnIH proteins were mainly localized to the astrocytes and pyramidal cells in the six layers of the cerebral cortex. In addition, clusters of distinct immunoreactive cells and fibers were observed in the septal region, the nucleus of the stria terminalis and the diagonal band (Fig. 1E and F). In the hippocampus, pyramidal cells of the stratum pyramidale exhibited moderate immunoreactivity. Multiple intense and dispersed immunoreactive cells were identified in the stratum multiformis (Fig. 1G–I). In the olfactory bulb (Fig. 1J–L), a few immunoreactive cells were observed in the external plexiform layer, whereas cells with strong immunoreactivity were found in the mitral cell layer. Diencephalon: Clusters of GnIH immunoreactive cells were maximally located in the preoptic area and the hypothalamic periventricular regions, such as the dorsomedial nucleus (DMN), intermediate periventricular nucleus (IPe), paraventricular nucleus (PVN) and arcuate nucleus (Arc) (Fig. 2A–D and 2F). A few moderately immunoreactive cells were also identified in the suprachiasmatic nucleus (SCN) and supraoptic nucleus (SON) (Fig. 2E). Brainstem: Abundant GnIH immunoreactive cells and fibers were generally restricted to the periventricular region of the brainstem. Clusters of distinct immunoreactive cells were observed in the central gray substance of the midbrain and in the dorsal raphe nucleus in the midbrain (Fig. 2G–I). The parabrachial nucleus in the pons also exhibited GnIH-positive cells (Fig. 2J). However, compared to the midbrain and pons, the quantity and distribution of GnIH immunoreactive cells and fibers were increased in the medulla oblongata. Many intense and dispersed immunoreactive cells and fibers were located in the tegmental area. Clusters of cells with intense to moderate immunoreactivity were observed in the central gray substance of the medulla oblongata (CGMB), dorsal raphe nucleus (DR) and inferior olivary nucleus (Fig. 2K–M). Cerebellum: Purkinje cells in the Purkinje cell layer showed intense to moderate levels of GnIH immunoreactivity (Fig. 2N and O). Spinalcord: The quantity and distribution of GnIH immunoreactive cells were localized to the gray matter, which showed intense to moderate staining (Fig. 2P and Q).
+++ +++ + + + + ++ + +
+++ +++ +++/++ ++ +++/++ ++ ++/+ + ++ +++/++ ± ++ +++ +++ ++ ++ +++ +++ ± +++/++ – ± – –
The intensities of signals indicated above represent a subjective consensus of sections examined from the CNS and peripheral organs collected from male Luchuan piglets (N = 3). The signals were estimated as score intensity of immunoreactivity on a scale of to 3 + as: , absence of immunoreactivity; +, mild; ++, moderate; +++, intense; +/−, there was heterogeneity in the signal, e.g., some of the histological units contained signal, and others did not.
2.1.2. Distribution of GnIH immunoreactive cells in the peripheral organs Male Reproductive system: In the testis (Fig. 3A–C), Leydig cells in the testis interstitium as well as the spermatogenic epithelium displayed moderate to strong GnIH immunoreactivity, while the Sertoli cells were negative. In the testicular lobule (Fig. 3D and E), strong GnIH immunoreactivity in the spermatogonium was prominent. In the
no reports demonstrating the comprehensive anatomical locations of GnIH in fish and mammals. There is also a lack of information on the distribution and biological role of GnIH in pigs. Although we have 43
Gene Expression Patterns 28 (2018) 42–53
X. Wang et al.
Fig. 1. Distribution of GnIH immunoreactive cells in the telencephalon of Luchuan male piglets. The GnIH immunostaining results in the cerebral cortex (1A), septal region (1E), diagonal band (1F), hippocampus (1G) and olfactory bulb (1J). High magnification of GnIH immunoreactive cells in external pyramidal (1D) and internal pyramidal (1C) layers of the cerebral cortex (1B); the stratum multiformis (1H) and stratum pyramidale (1I) of the hippocampus; the mitral cell layer the olfactory bulb (1K, 1L). Negative controls in the cerebral cortex (1M), hippocampus (1N) and olfactory bulb (1O) of Luchuan male piglets. The sections were counterstained with hematoxylin. The primary antibody was replaced in the control section with 1% normal horse serum or the preadsorption of the RFRP-3 antiserum with the RFRP-3 antigen (10 g/ml). Scale bar in (1A, 1J, 1M-1O) = 200 μm, (1B, 1G) = 100 μm, (1E, 1F, 1H, 1I, 1K) = 50 μm, (1C, 1D, 1L) = 20 μm.
lymph nodes, the lymphoid nodule in the palatine tonsil exhibited intense to moderate levels of GnIH immunoreactivity, while dispersed GnIH immunoreactive cells localized to the diffuse lymphoid tissue (Fig. 4K). In addition, the stratified squamous epithelium of the palatine tonsil also showed intense GnIH staining (Fig. 4L). In the spleen (Fig. 4M–O), the white pulp displayed strong GnIH staining, whereas no GnIH immunoreactivity was detected in the red pulp. Urinary system: In the kidneys (Fig. 3L and M), the renal corpuscle and medullary ray showed moderate levels of GnIH immunoreactivity, but GnIH signals were weakly detected in the cortical labyrinth and renal medulla. The muscularis of the urinary bladder displayed moderate GnIH immunoreactivity (Fig. 3N and O). Digestive tract: In the esophagus (Fig. 5A–D), the stratified squamous epithelium, esophageal gland and muscularis showed intense to moderate staining. GnIH immunoreactivity was found in the layers of mucosa and the tunica muscularis in all the digestive tract as well as in the layer of submucosa in the esophagus and dodecadactylon. In the stomach (Fig. 5E–H), an intense level of GnIH immunoreactivity was observed in the mucosa, while moderate immunoreactivity was
epididymis (Fig. 3F and G), the small transportation ducts and epididymal ducts showed intense GnIH staining. The multi-tube gland epithelium of the accessory glands including the prostate gland (Fig. 3H and I) and seminal vesicular gland (Fig. 3J and K) also displayed strong staining. Endocrine system: The follicular epithelial cells and parafollicular cells of the thyroid gland showed intense to moderate levels of GnIH immunoreactivity (Fig. 4A and B). In the parathyroid gland (Fig. 4C and D), moderate GnIH staining was detected in the chief cells, while acidophilic cells were strongly positive. In the adrenal cortex (Fig. 4E and F), GnIH was weakly detected in the reticular and fascicular zones, but it was strongly detected in the glomerulosa. No GnIH immunoreactivity was found in the adrenal medulla. Immune system: In the thymus (Fig. 4G and H), a few GnIH immunoreactive cells were weakly detected in the cortex, but they were strongly detected in the medulla. In the lymph nodes (Fig. 4I and J), many moderately immunoreactive cells were distributed in the lymphoid nodules, while some moderately to weakly immunoreactive cells were dispersed in the paracortical area and the medulla. Similar to the 44
Gene Expression Patterns 28 (2018) 42–53
X. Wang et al.
Fig. 2. Distribution of GnIH immunoreactive cells in the diencephalon, brainstem, cerebellum and spinalcord of Luchuan male piglets. The GnIH immunostaining results in the hypothalamic periventricular regions (2A, 2B); SON (2E) and Arc (2F) in the hypothalamus; midbrain (2G); parabrachial nucleus in the pons (2J); CGMB, DR and inferior olivary nucleus in the medulla oblongata (2K, 2M); cerebellum (2N) and spinalcord (2P). High magnification of GnIH immunoreactive cells in the IPe (2C, 2D) of hypothalamus; central gray substance of the midbrain (2H, 2I); tegmental area of the medulla oblongata (2L); Purkinje cell layer of the cerebellum (2O); gray matter of the spinalcord (2Q). Negative controls in the brainstem (2R), cerebellum (2S) and spinalcord (2T) of Luchuan male piglets. The sections were counterstained with hematoxylin. The primary antibody was replaced in the control section with 1% normal horse serum or the preadsorption of the RFRP-3 antiserum with the RFRP-3 antigen (10 g/ml). Scale bar in (2A, 2B, 2G, 2J, 2K, 2M, 2P, 2R-2T) = 200 μm, (2E, 2F, 2L, 2N, 2Q) = 100 μm, (2C, 2D, 2H, 2I, 2O) = 20 μm. Abbreviations: Arc, a rcuate nucleus; SON, supraoptic nucleus; CGMB, central gray substance of the medulla oblongata; DR, dorsal raphe nucleus; IPe, intermediate periventricular nucleus.
tunicamuscularis layers generally showed intense to moderate staining. Digestive gland: Moderate GnIH immunoreactivity was widely distributed in the glandular lobule, secretory duct and interlobular duct of the submandibular gland (Fig. 5M–O). In the pancreas (Fig. 5P and Q), abundant GnIH immunoreactive cells were concentrated in the islet
observed in the tunica muscularis. The location of GnIH immunoreactivity in the intestine was nearly the same as that of the esophagus. In the small and large intestines (Fig. 5I–L), the duodenal glands and lymphoid nodules conspicuously exhibited strong and maximal GnIH immunoreactivity, while the mucosa and 45
Gene Expression Patterns 28 (2018) 42–53
X. Wang et al.
Fig. 3. Distribution of GnIH immunoreactive cells in the male Reproductive system and urinary system of Luchuan male piglets. The GnIH immunostaining results in the testis (3A), epididymis (3D, 3F), prostate gland (3H), seminal vesicular gland (3J), kidneys (3L), and urinary bladder (3N). High magnification of GnIH immunoreactive cells in the interstitium and spermatogenic epithelium of the testis (3B, 3C); small transportation ducts (3E) and epididymal ducts (3G) of the epididymis; multi-tube gland epithelium of the prostate gland (3I) and seminal vesicular gland (3K); renal corpuscle of the kidneys (3M); muscularis of the urinary bladder (3O). Negative controls in the testis (3P), epididymis (3Q), prostate gland (3R), seminal vesicular gland (3S), kidneys (3T), and urinary bladder (3U) of Luchuan male piglets. The sections were counterstained with hematoxylin. The primary antibody was replaced in the control section with 1% normal horse serum or the preadsorption of the RFRP-3 antiserum with the RFRP-3 antigen (10 g/ml). Scale bar in (3A, 3D, 3F, 3H, 3J, 3L, 3P3T) = 200 μm, (3B, 3E, 3N) = 50 μm, (3C, 3G, 3I, 3K, 3M, 3O, 3U) = 20 μm.
46
Gene Expression Patterns 28 (2018) 42–53
X. Wang et al.
Fig. 4. Distribution of GnIH immunoreactive cells in the endocrine system and immune system of Luchuan male piglets. The GnIH immunostaining results in the thyroid gland (4A), parathyroid gland (4C), adrenal cortex (4E), thymus (4G), lymph nodes (4I), palatine tonsil (4K) and spleen (4M). High magnification of GnIH immunostaining in the follicular epithelial cells and parafollicular cells of the thyroid gland (4B); chief cells and acidophilic cells of the parathyroid gland (4D); glomerulosa of the adrenal cortex (4F); medulla of the thymus (4H); lymphoid nodules and paracortical area of the lymph nodes (4J); lymphoid nodule of the palatine tonsil (4L); white pulp of the spleen (4N, 4O). Negative controls in the thyroid gland (4P), parathyroid gland (4Q), adrenal cortex (4R), thymus (4S), lymph nodes (4T) and spleen (4U) of Luchuan male piglets. The sections were counterstained with hematoxylin. The primary antibody was replaced in the control section with 1% normal horse serum or the preadsorption of the RFRP-3 antiserum with the RFRP-3 antigen (10 g/ml). Scale bar in (4E, 4I, 4M, 4T) = 200 μm, (4C, 4J, 4R, 4U) = 100 μm, (4A, 4F, 4G, 4K, 4N, 4P, 4Q, 4S) = 50 μm, (4B, 4D, 4H, 4L, 4O) = 20 μm.
47
Gene Expression Patterns 28 (2018) 42–53
X. Wang et al.
of pancreas, which showed intense to moderate staining. However, very weak GnIH signals were detected in the liver (Fig. 5R and S). Respiratory system: Moderate GnIH staining was observed in the pseudostratified ciliated columnar epithelium, tracheal gland and smooth muscle of the trachea (Fig. 6A–C), whereas no GnIH immunoreactivity was found in the lungs (Fig. 6D). Cardiovascular system: Weak levels of GnIH immunoreactivity were observed in the heart (Fig. 6E and F), but no staining was found in the large artery (Fig. 6G). Muscle tissue and skin: No GnIH immunoreactivity was found in muscle (Fig. 6H) or skin (Fig. 6I). 2.2. Expression patterns of GnIH mRNA in the tissues of male Luchuan piglets We next examined the expression of GnIH mRNA in various pig tissues. Semi-quantitative RT-PCR showed that GnIH mRNA was expressed in various tissues. High levels of GnIH mRNA were detected in all CNS tissues, including the medulla oblongata, hypothalamus, midbrain, cerebral cortex, pons, spinal cord, olfactory bulb, cerebellum and hippocampus. In the peripheral organs, high GnIH mRNA levels were detected in the testis, epididymis and kidney, while no expression of GnIH was observed in the liver, lungs, heart, trachea, esophagus, thyroid gland, thymus and large artery (See Fig. 7). 3. Discussion Since the isolation of the GnIH peptide from the quail brain in 2000, it has been generally accepted that GnIH is one of the hypothalamic neuropeptides regulating gonadotropin release in mammals and other vertebrates (Clarke et al., 2009; Tsutsui, 2009; Tsutsui and Osugi, 2009; Tsutsui et al., 2017; Ubuka et al., 2018; Zhang et al., 2010). Although the mechanism of action of GnIH at the molecular, cellular, morphological, physiological, and behavioral levels has been investigated over the past fifteen years, there are some themes that should be extensively investigated in future studies. One of these themes is the underlying sites of action and potential functions of GnIH. Therefore, in the present study, the distribution of GnIH was systemically determined, while the expression of GnIH mRNA was also investigated in different CNS and peripheral organs in male Luchuan piglets (Table 2). Our findings provided particular evidence for multiple physiological functions of pig GnIH at molecular and morphological levels. Using in situ hybridization and immunohistochemistry, the morphological locations of GnIH has been investigated in the brains of birds and mammals. GnIH immunohistochemistry showed that clusters of GnIH-ir neuronal cell bodies were located in the PVN and GnIH-ir nerve fibers were widely distributed in multiple brain regions including the septal area, preoptic area, hypothalamus and the dorsal motor nucleus of the vagus in the medulla oblongata in quail (Bentley et al., 2003; Ubuka et al., 2003; Ukena et al., 2003), house and song sparrows (Bentley et al., 2003), white-crowned sparrows (Osugi et al., 2004), zebra finches (Tobari et al., 2010), and European starlings (Ubuka et al., 2008). In mammals, GnIH is mainly located in the DMN and PVN with a similar distribution as that in the avian brain (Clarke et al., 2008; Kriegsfeld et al., 2006). Abundant GnIH-ir fibers were observed in the nucleus of the stria terminalis in the telencephalon, habenular nucleus, paraventricular nucleus of the thalamus, POA, paraventricular nucleus of the hypothalamus, IPe, arcuate nucleus of the hypothalamus, median eminence and dorsal hypothalamic area in the diencephalon, medial region of the superior colliculus, central gray substance of the midbrain, dorsalraphe nucleus in the midbrain, parabrachial nucleus in the pons, nucleustractus solitarius in the medulla oblongata and spinal cord (Gibson et al., 2008; Johnson et al., 2007; Papargiris et al., 2011; Ubuka et al., 2009). Our findings are in agreement with previous studies that suggest GnIH may participate not only in neuroendocrine functions but also in behavioral and autonomic mechanisms. In recent years, the roles
Fig. 5. Distribution of GnIH immunoreactive cells in the digestive tract and digestive gland of Luchuan male piglets. The GnIH immunostaining results in the esophagus (5A), stomach (5E), small intestines (5I), large intestines (5K), submandibular gland (5M), pancreas (5P) and liver (5R). High magnification of GnIH immunoreactive cells in the stratified squamous epithelium (5B, 5C) and esophageal gland (5B, 5D) of the esophagus; mucosa (5F) and tunica muscularis (5G, 5H) of the stomach; mucosa and duodenal glands of the small intestines (5J); mucosa (5K) and lymphoid nodules (5L) of the large intestines; glandular lobule (5O), secretory duct (5O) and interlobular duct (5N) of the submandibular gland; islet of the pancreas (5Q); liver cells (5S). Negative controls in the esophagus (5T), stomach (5U), large intestines (5V), submandibular gland (5W), pancreas (5X) and liver (5Y) of Luchuan male piglets. The sections were counterstained with hematoxylin. The primary antibody was replaced in the control section with 1% normal horse serum or the preadsorption of the RFRP-3 antiserum with the RFRP-3 antigen (10 g/ ml). Scale bar in (5A, 5I, 5R, 5V) = 200 μm, (5B, 5E, 5G, 5J, 5K, 5L, 5M, 5P, 5T, 5V, 5W5Y) = 100 μm, (5C, 5H) = 50 μm, (5D, 5F, 5N, 5O, 5Q, 5S) = 20 μm.
48
Gene Expression Patterns 28 (2018) 42–53
X. Wang et al.
Fig. 6. Distribution of GnIH immunoreactive cells in the respiratory system, cardiovascular system, muscle tissue and skin of Luchuan male piglets. The GnIH immunostaining results in the trachea (6A), lungs (6D), heart (6E), large artery (6G), muscle (6H) and skin (6I). High magnification of GnIH immunoreactive cells in the pseudostratified ciliated columnar epithelium, tracheal gland and smooth muscle of the trachea (6C). Negative controls in the trachea (6J), lungs (6K), heart (6L), large artery (6M), muscle (6N) and skin (6O) of Luchuan male piglets. The sections were counterstained with hematoxylin. The primary antibody was replaced in the control section with 1% normal horse serum or the preadsorption of the RFRP-3 antiserum with the RFRP-3 antigen (10 g/ml). Scale bar in (6D, 6K) = 200 μm, (6A, 6E, 6G, 6H, 6I, 6J, 6L, 6M-6O) = 100 μm, (6B, 6C) = 50 μm, (6F) = 20 μm.
round to early elongated spermatids. Recently, immunolocalization in the testis of male Xiaomeishan pigs revealed that the GnIH immunoreactivity mainly localized to the spermatogenic cells, sustentacular cells and interstitial cells of the testis throughout sexual development (Zheng et al., 2015). Our findings are in agreement with previous studies suggesting that GnIH can regulate reproductive functions in an autocrine and/or paracrine manner at the level of the gonads in several species, including pigs. Furthermore, we demonstrated that GnIH was distributed in the pig epididymis and accessory glands as well as the testis, suggesting that GnIH may regulate germ cell differentiation and maturation. Although previous studies have confirmed that GnIH is a key neurohormone controlling vertebrate reproduction, accumulated data further indicated that GnIH is involved in the stress response, food intake, and aggressive and sexual behaviors, suggesting a broad physiological role for this neuropeptide (Clarke et al., 2012; Tsutsui et al., 2012; Ubuka et al., 2012b, 2018). Moreover, the morphological locations of GnIH mainly focus on the brain and hypothalamic–pituitary–gonadal axis. There is limited information regarding the distribution of GnIH in the peripheral organs in many species, from fish to mammals. To provide more morphological evidence to support its multiple physiological functions, the distribution of GnIH was also investigated in the male pig endocrine system, immune system, urinary system, digestive system,
of GnIH in mediating feeding, social, and reproductive behaviors were confirmed in birds and rodent species (Papargiris et al., 2011; Ubuka et al., 2012b, 2018). These physiological findings and the morphological locations of GnIH in the brain are corroborative. At the same time, the distribution of GnIH in the brain provides morphological evidence of its physiological functions. Interestingly, the distribution of GnIH in the pig central nervous system seemed more extensive than previous data. GnIH-ir neuronal cell bodies were found in many limbic brain regions, such as the cerebral cortex, the hippocampus, the external plexiform layer of the olfactory bulb and the Purkinje cell layer of the cerebellum, which has not been observed in previous studies. GnIH extends widely in the male pig brain, suggesting that it may have even more physiological functions than previously known. Because the effect of GnIH on reproductive functions was first confirmed in many vertebrate species, there are several studies that have reported the distribution of GnIH in the reproductive system. In birds, mice and the lizard Calotes versicolor, GnIH mainly localized in the granulosa cells and theca cells of antral follicles, as well as in the luteal cells of the corpora lutea (Maddineni et al., 2008; Singh et al., 2008, 2011b). Similar results were also obtained in female pigs in our previous study (Li et al., 2012). However, much less is known regarding the distribution of GnIH in the male reproductive system. In Syrian hamsters (Zhao et al., 2010), GnIH is produced in spermatocytes and in
49
Gene Expression Patterns 28 (2018) 42–53
X. Wang et al.
Fig. 7. Expression patterns of GnIH mRNA in the tissues of male Luchuan piglets. (A) Agarose gel electrophoresis pictures of GAPDH and GnIH. (B) Statistical analysis of GnIH mRNA in different tissues of Luchuan male piglets. Relative level of GnIH mRNA was determined by the ratio of intensity values of GnIH bands normalized to the corresponding GAPDH (internal control). 1, large artery; 2, stomach; 3, hypophysis; 4, transverse colon; 5, liver; 6, submandibular gland; 7, thyroid gland; 8, ileum; 9, trachea; 10, adrenal gland; 11, skin; 12, epididymis; 13, fat; 14, thymus; 15, kidney; 16, medulla oblongata; 17, pons; 18, midbrain; 19, esophagus; 20, hypothalamus; 21, duodenum; 22, parotid gland; 23, lung; 24, testis; 25, jejunum; 26, rectum; 27, olfactory bulb; 28, spinal cord; 29, cerebral cortex; 30, cerebellum; 31, hippocampus; 32, spleen; 33, palatine tonsil; 34, muscle; 35, heart.
50
Gene Expression Patterns 28 (2018) 42–53
X. Wang et al.
respiratory system, cardiovascular system, muscle tissue and skin. We were happily surprised to discover that GnIH was widely distributed in the endocrine system, immune system, digestive system, and even the urinary system. We presumed that these results were likely due to GnIH control of the peripheral organs via an autocrine and/or paracrine manner to affect physiological homeostasis, which then impacts an organism's ability to survive and reproduce. Physiological action studies indicated that GnIH is associated with behaviors important for survival and reproduction, such as the stress response, feeding behaviors, and social, environmental, and reproductive behaviors. Our results provide detailed morphological evidence to support this hypothesis. Studies have found that GnIH mRNA expression is mainly concentrated in the brain, especially in the hypothalamus in several vertebrates. Using in situ hybridization, GnIH mRNA was expressed in multiple brain regions including the diencephalon, telencephalon, midbrain, pons and medulla oblongata in birds (Ukena et al., 2003), rodents (Kriegsfeld et al., 2006), sheep (Clarke et al., 2008) and the rhesus macaque (Ubuka et al., 2009). The expression of GnIH mRNA in different peripheral tissues was demonstrated in zebrafish (Zhang et al., 2010), rats and humans (Hinuma et al., 2000). Zhang et al. presented data indicating that GnIH is mostly expressed in the zebrafish brain, eye, testis, and ovary, with some expression in the muscle, spleen, kidney, and other peripheral tissues (Zhang et al., 2010). Similar studies in humans and rats found that GnIH mRNA was highly expressed in the hypothalamus and eye with low expression in the testis (Hinuma et al., 2000). The expression of GnIH mRNA in various female pig tissues was investigated in our previous study (Li et al., 2012). Both our previous and present studies confirmed that high levels of GnIH mRNA were mainly expressed in the brain and reproductive organs. GnIH mRNA was expressed in only a few peripheral organs, which differed from the morphological locations of GnIH. A possible explanation for this discrepancy is that GnIH synthesis and activity occur in different organs.
determined using a photometer. The RNA integrity was assessed by RNA electrophoresis. For each tissue, equal amounts of all RNA samples were reverse transcribed simultaneously using an oligo (deoxythymidine) 15primer and the M-MLV reverse transcriptase according to the manufacturer's instructions (Vazyme Biotech Co., Ltd, China). All RT reactions were performed at 42 °C with nuclease-free water serving as the negative control. 4.2.2. Semi-quantitative RT-PCR analysis The gene-specific primers for GnIH were designed from the clone sequences shown in Table 1, and the pig GAPDH gene was used as an internal control. A pooled sample was made by mixing equal quantities of total RNA from all samples and was used for optimizing the PCR conditions. In addition, different cycle numbers were tested to optimize amplification in the exponential phase of PCR. The amplification reactions were conducted at least threetimes. PCR conditions were established as follows: (1) for GnIH: denaturation at 95 °C for 5 min, followed by 38 cycles of denaturation at 95 °C for 30 s, annealing at 56 °C for 30 s, and extension at 72 °C for 30 s, and finally, an additional extension step at 72 °C for 10 min; and (2) for GAPDH: denaturation at 95 °C for 5 min, followed by 27 cycles of denaturation at 95 °C for 30 s, annealing at 57 °C for 30 s, and extension at 72 °C for 30 s, and finally, an additional extension step at 72 °C for 10 min. An aliquot (10 μl) of each PCR product was analyzed by electrophoresis. The gel was stained and photographed using a digital camera. The band intensities were analyzed with the Kodak ID Electrophoresis Documentation and Analysis System 120 (Kodak Photo Film Co. Ltd., USA). The ratio of the target gene intensity to the GAPDH intensity was used to represent the abundance of mRNA expression. 4.2.3. Immunohistochemistry The tissue samples for immunochemistry were cut into 5 μm sections. One in every ten sections of the brain was processed immunohistochemically for GnIH immunoreactivity. The procedure, the antibody dilution and specificity for immunohistochemistry have been described previously (Li et al., 2012). To test the specificity of the immunoreaction, the primary antiserum was replaced in the control section with (1) 1% normal horse serum; (2) the preadsorption of the RFRP-3 antiserum with the RFRP-3 antigen (10 g/ml). For the preadsorption, the antigens were added to the diluted antisera (in the same dilution as used for localization) and incubated overnight at 4 °C. Immunohistochemical analyses were performed using the avidin–biotin–peroxidase complex (ABC) method (Wuhan Boster Biological Technology Co., Ltd., China). The peroxidase activity was monitored using 0.03% DAB (Wuhan Boster Biological Technology Co., Ltd., China) in 0.05 M Tris, pH 7.6, for 5 min. The sections were counterstained with hematoxylin. The slides were observed under a Nikon ECLipse Ti light microscope and photographed by a Nikon DXM 12000E digital camera (Japan). The degree of stain was designated by semiquantitative analysis (analysis of 10 microscopic fields at 400 × magnification). According to the intensity of brown stain in different cells, the positive stain was graded into mild, moderate and marked immunostain. Data were obtained using a Leica Qwin 500 image analyzer computer system as previously described (Abd El-Meseeh et al., 2016). Area percentage ranging between 1 and 3 means for mild, 4 and 6 means for moderate and 7 and 10 means for marked immuno-reactivity.
4. Experimental procedures 4.1. Materials All of the pigs were fed according to the breeding standards of Chinese Local Pigs and the National Research Council (NRC). All the experiments were performed according to the guidelines of the regional Animal Ethics Committee and the rules for experimental animals of Guangxi University. Three male Luchuan piglets aged 1 month old that weighed 10 ± 2 kg were used in this study. The animals were maintained with constant food, temperature, and humidity conditions for at least 5 d prior to tissue collection. The pigs were terminally anesthetized and decapitated within 15 min of capture, and different tissues were removed: the cerebral cortex, cerebellum, spinal cord, hippocampus, olfactory bulb, hypothalamus, medulla oblongata, pons, midbrain, hypophysis, trachea, lung, heart, large artery, stomach, esophagus, duodenum, jejunum, Ileum, colon, rectum, liver, skin, parotid gland, submandibular gland, testis, epididymis, kidney, adrenal gland, thyroid gland, palatine tonsil, mesenteric lymph node, and thymus. Two kinds of samples were prepared from all of the tissues. One part of each tissue sample was frozen in liquid nitrogen and stored at 80 °C until RNA was isolated for semi-quantitative RT-PCR. The other parts of the tissue samples were fixed in neutral-buffered formalin for immunochemistry.
5. Conclusions 4.2. Methods In summary, this is the first systemic morphological study to show that GnIH synthesis is distributed in many peripheral organs as well as the CNS. Emerging studies have confirmed that GnIH is a multifunctional neuropeptide involved in many physiological actions such as reproduction, feeding, stress and behaviors. This study provided detailed morphological evidence to support this hypothesis. In addition,
4.2.1. RNA purification and reverse transcription The total RNA was extracted using the TRIzol extraction method. The subsequent procedures for RNA isolation and purification were performed as detailed in the manufacturer's instructions (Vazyme Biotech Co., Ltd, China). The RNA quality and concentration were 51
Gene Expression Patterns 28 (2018) 42–53
X. Wang et al.
the wide distribution of GnIH in the CNS and peripheral organs suggests that GnIH may have even more physiological functions than are currently known. Therefore, the multiple sites of action, physiological mechanisms and potential functions of GnIH at the cellular, molecular and morphological levels in different vertebrates require further investigation.
receptor null mouse. Endocrinology 155, 2953–2965. Li, X., Su, J., Fang, R., Zheng, L., Lei, R., Wang, X., Lei, Z., Jin, M., Jiao, Y., Hou, Y., Guo, T., Ma, Z., 2013. The effects of RFRP-3, the mammalian ortholog of GnIH, on the female pig reproductive axis in vitro. Mol. Cell. Endocrinol. 372, 65–72. Li, X., Su, J., Lei, Z., Zhao, Y., Jin, M., Fang, R., Zheng, L., Jiao, Y., 2012. Gonadotropininhibitory hormone (GnIH) and its receptor in the female pig: cDNA cloning, expression in tissues and expression pattern in the reproductive axis during the estrous cycle. Peptides 36, 176–185. Maddineni, S.R., Ocon-Grove, O.M., Krzysik-Walker, S.M., Hendricks 3rd, G.L., Ramachandran, R., 2008. Gonadotropin-inhibitory hormone (GnIH) receptor gene is expressed in the chicken ovary: potential role of GnIH in follicular maturation. Reproduction 135, 267–274. Osugi, T., Ukena, K., Bentley, G.E., O'Brien, S., Moore, I.T., Wingfield, J.C., Tsutsui, K., 2004. Gonadotropin-inhibitory hormone in Gambel's white-crowned sparrow (Zonotrichia leucophrys gambelii): cDNA identification, transcript localization and functional effects in laboratory and field experiments. J. Endocrinol. 182, 33–42. Papargiris, M.M., Rivalland, E.T., Clarke, I.J., Smith, J.T., Pereira, A., Tilbrook, A.J., 2011. Evidence that RF-amide related peptide-3 is not a mediator of the inhibitory effects of psychosocial stress on gonadotrophin secretion in ovariectomised ewes. J. Neuroendocrinol. 23, 208–215. Qi, Y., Oldfield, B.J., Clarke, I.J., 2009. Projections of RFamide-related peptide-3 neurones in the ovine hypothalamus, with special reference to regions regulating energy balance and reproduction. J. Neuroendocrinol. 21, 690–697. Singh, P., Krishna, A., Sridaran, R., Tsutsui, K., 2008. Changes in GnRH I, bradykinin and their receptors and GnIH in the ovary of Calotes versicolor during reproductive cycle. Gen. Comp. Endocrinol. 159, 158–169. Singh, P., Krishna, A., Sridaran, R., Tsutsui, K., 2011a. Immunohistochemical localization of GnRH and RFamide-related peptide-3 in the ovaries of mice during the estrous cycle. J. Mol. Histol. 42, 371–381. Singh, P., Krishna, A., Tsutsui, K., 2011b. Effects of gonadotropin-inhibitory hormone on folliculogenesis and steroidogenesis of cyclic mice. Fertil. Steril. 95, 1397–1404. Smith, J.T., Clarke, I.J., 2010. Gonadotropin inhibitory hormone function in mammals. Trends Endocrinol. Metabol. 21, 255–260. Tobari, Y., Iijima, N., Tsunekawa, K., Osugi, T., Okanoya, K., Tsutsui, K., Ozawa, H., 2010. Identification of gonadotropin-inhibitory hormone in the zebra finch (Taeniopygia guttata): peptide isolation, cDNA cloning and brain distribution. Peptides 31, 816–826. Tsutsui, K., 2009. A new key neurohormone controlling reproduction, gonadotropin-inhibitory hormone (GnIH): biosynthesis, mode of action and functional significance. Prog. Neurobiol. 88, 76–88. Tsutsui, K., 2010. Phylogenetic aspects of gonadotropin-inhibitory hormone and its homologs in vertebrates. Ann. N. Y. Acad. Sci. 1200, 75–84. Tsutsui, K., Bentley, G.E., Kriegsfeld, L.J., Osugi, T., Seong, J.Y., Vaudry, H., 2010. Discovery and evolutionary history of gonadotrophin-inhibitory hormone and kisspeptin: new key neuropeptides controlling reproduction. J. Neuroendocrinol. 22, 716–727. Tsutsui, K., Bentley, G.E., Ubuka, T., Saigoh, E., Yin, H., Osugi, T., Inoue, K., Chowdhury, V.S., Ukena, K., Ciccone, N., Sharp, P.J., Wingfield, J.C., 2007. The general and comparative biology of gonadotropin-inhibitory hormone (GnIH). Gen. Comp. Endocrinol. 153, 365–370. Tsutsui, K., Osugi, T., 2009. Evolutionary origin and divergence of GnIH and its homologous peptides. Gen. Comp. Endocrinol. 161, 30–33. Tsutsui, K., Osugi, T., Son, Y.L., Ubuka, T., 2017. Review: structure, function and evolution of GnIH. Gen. Comp. Endocrinol. http://dx.doi.org/10.1016/j.ygcen.2017.07. 024. PMID: 28754274, (In press). Tsutsui, K., Saigoh, E., Ukena, K., Teranishi, H., Fujisawa, Y., Kikuchi, M., Ishii, S., Sharp, P.J., 2000. A novel avian hypothalamic peptide inhibiting gonadotropin release. Biochem. Biophys. Res. Commun. 275, 661–667. Tsutsui, K., Ubuka, T., Bentley, G.E., Kriegsfeld, L.J., 2012. Gonadotropin-inhibitory hormone (GnIH): discovery, progress and prospect. Gen. Comp. Endocrinol. 177, 305–314. Ubuka, T., Inoue, K., Fukuda, Y., Mizuno, T., Ukena, K., Kriegsfeld, L.J., Tsutsui, K., 2012a. Identification, expression, and physiological functions of Siberian hamster gonadotropin-inhibitory hormone. Endocrinology 153, 373–385. Ubuka, T., Kim, S., Huang, Y.C., Reid, J., Jiang, J., Osugi, T., Chowdhury, V.S., Tsutsui, K., Bentley, G.E., 2008. Gonadotropin-inhibitory hormone neurons interact directly with gonadotropin-releasing hormone-I and -II neurons in European starling brain. Endocrinology 149, 268–278. Ubuka, T., Lai, H., Kitani, M., Suzuuchi, A., Pham, V., Cadigan, P.A., Wang, A., Chowdhury, V.S., Tsutsui, K., Bentley, G.E., 2009. Gonadotropin-inhibitory hormone identification, cDNA cloning, and distribution in rhesus macaque brain. J. Comp. Neurol. 517, 841–855. Ubuka, T., Mukai, M., Wolfe, J., Beverly, R., Clegg, S., Wang, A., Hsia, S., Li, M., Krause, J.S., Mizuno, T., Fukuda, Y., Tsutsui, K., Bentley, G.E., Wingfield, J.C., 2012b. RNA interference of gonadotropin-inhibitory hormone gene induces arousal in songbirds. PLoS One 7, e30202. Ubuka, T., Parhar, I., Kriegsfeld, L.J., Tsutsui, K., 2018. Editorial: the roles of GnIH in reproductive function and behavior. Front. Endocrinol. 9, 19. Ubuka, T., Ueno, M., Ukena, K., Tsutsui, K., 2003. Developmental changes in gonadotropin-inhibitory hormone in the Japanese quail (Coturnix japonica) hypothalamohypophysial system. J. Endocrinol. 178, 311–318. Ubuka, T., Ukena, K., Sharp, P.J., Bentley, G.E., Tsutsui, K., 2006. Gonadotropin-inhibitory hormone inhibits gonadal development and maintenance by decreasing gonadotropin synthesis and release in male quail. Endocrinology 147, 1187–1194. Ukena, K., Ubuka, T., Tsutsui, K., 2003. Distribution of a novel avian gonadotropin-inhibitory hormone in the quail brain. Cell Tissue Res. 312, 73–79.
Conflicts of interest The authors declared that they have no conflicts of interest to this work. We declare that we do not have any commercial or associative interest that represents a conflict of interest in connection with the work submitted. Acknowledgments This work received financial support from the National Natural Science Foundation of China (NSFC) (31402151) and the Natural Science Foundation of Guangxi province (2015GXNSFBA139077; 2017GXNSFAA198086). Appendix A. Supplementary data Supplementary data related to this article can be found at http://dx. doi.org/10.1016/j.gep.2018.02.004. References Abd El-Meseeh, N.A., El-Shaarawy, E.A., AlDomairy, A.F., Sehly, R.A., 2016. Changes in rat testis morphology and androgen receptor expression around the age of puberty. Ann. Anat. 205, 37–44. Bentley, G.E., Perfito, N., Ukena, K., Tsutsui, K., Wingfield, J.C., 2003. Gonadotropininhibitory peptide in song sparrows (Melospiza melodia) in different reproductive conditions, and in house sparrows (Passer domesticus) relative to chicken-gonadotropin-releasing hormone. J. Neuroendocrinol. 15, 794–802. Bentley, G.E., Ubuka, T., McGuire, N.L., Chowdhury, V.S., Morita, Y., Yano, T., Hasunuma, I., Binns, M., Wingfield, J.C., Tsutsui, K., 2008. Gonadotropin-inhibitory hormone and its receptor in the avian reproductive system. Gen. Comp. Endocrinol. 156, 34–43. Clarke, I.J., Qi, Y., Puspita Sari, I., Smith, J.T., 2009. Evidence that RF-amide related peptides are inhibitors of reproduction in mammals. Front. Neuroendocrinol. 30, 371–378. Clarke, I.J., Sari, I.P., Qi, Y., Smith, J.T., Parkington, H.C., Ubuka, T., Iqbal, J., Li, Q., Tilbrook, A., Morgan, K., Pawson, A.J., Tsutsui, K., Millar, R.P., Bentley, G.E., 2008. Potent action of RFamide-related peptide-3 on pituitary gonadotropes indicative of a hypophysiotropic role in the negative regulation of gonadotropin secretion. Endocrinology 149, 5811–5821. Clarke, I.J., Smith, J.T., Henry, B.A., Oldfield, B.J., Stefanidis, A., Millar, R.P., Sari, I.P., Chng, K., Fabre-Nys, C., Caraty, A., Ang, B.T., Chan, L., Fraley, G.S., 2012. Gonadotropin-inhibitory hormone is a hypothalamic peptide that provides a molecular switch between reproduction and feeding. Neuroendocrinology 95, 305–316. Ducret, E., Anderson, G.M., Herbison, A.E., 2009. RFamide-related peptide-3, a mammalian gonadotropin-inhibitory hormone ortholog, regulates gonadotropin-releasing hormone neuron firing in the mouse. Endocrinology 150, 2799–2804. Gibson, E.M., Humber, S.A., Jain, S., Williams 3rd, W.P., Zhao, S., Bentley, G.E., Tsutsui, K., Kriegsfeld, L.J., 2008. Alterations in RFamide-related peptide expression are coordinated with the preovulatory luteinizing hormone surge. Endocrinology 149, 4958–4969. Hinuma, S., Shintani, Y., Fukusumi, S., Iijima, N., Matsumoto, Y., Hosoya, M., Fujii, R., Watanabe, T., Kikuchi, K., Terao, Y., Yano, T., Yamamoto, T., Kawamata, Y., Habata, Y., Asada, M., Kitada, C., Kurokawa, T., Onda, H., Nishimura, O., Tanaka, M., Ibata, Y., Fujino, M., 2000. New neuropeptides containing carboxy-terminal RFamide and their receptor in mammals. Nat. Cell Biol. 2, 703–708. Johnson, M.A., Tsutsui, K., Fraley, G.S., 2007. Rat RFamide-related peptide-3 stimulates GH secretion, inhibits LH secretion, and has variable effects on sex behavior in the adult male rat. Horm. Behav. 51, 171–180. Kriegsfeld, L.J., 2006. Driving reproduction: RFamide peptides behind the wheel. Horm. Behav. 50, 655–666. Kriegsfeld, L.J., Mei, D.F., Bentley, G.E., Ubuka, T., Mason, A.O., Inoue, K., Ukena, K., Tsutsui, K., Silver, R., 2006. Identification and characterization of a gonadotropininhibitory system in the brains of mammals. Proc. Natl. Acad. Sci. U. S. A. 103, 2410–2415. Leon, S., Garcia-Galiano, D., Ruiz-Pino, F., Barroso, A., Manfredi-Lozano, M., RomeroRuiz, A., Roa, J., Vazquez, M.J., Gaytan, F., Blomenrohr, M., van Duin, M., Pinilla, L., Tena-Sempere, M., 2014. Physiological roles of gonadotropin-inhibitory hormone signaling in the control of mammalian reproductive axis: studies in the NPFF1
52
Gene Expression Patterns 28 (2018) 42–53
X. Wang et al.
involvement in early development and the negative control of LH release. Peptides 31, 1034–1043. Zhao, S., Zhu, E., Yang, C., Bentley, G.E., Tsutsui, K., Kriegsfeld, L.J., 2010. RFamiderelated peptide and messenger ribonucleic acid expression in mammalian testis: association with the spermatogenic cycle. Endocrinology 151, 617–627. Zheng, L., Su, J., Fang, R., Jin, M., Lei, Z., Hou, Y., Ma, Z., Guo, T., 2015. Developmental changes in the role of gonadotropin-inhibitory hormone (GnIH) and its receptors in the reproductive axis of male Xiaomeishan pigs. Anim. Reprod. Sci. 154, 113–120.
Ullah, R., Shen, Y., Zhou, Y.D., Huang, K., Fu, J.F., Wahab, F., Shahab, M., 2016. Expression and actions of GnIH and its orthologs in vertebrates: current status and advanced knowledge. Neuropeptides 59, 9–20. Wahab, F., Shahab, M., Behr, R., 2015. The involvement of gonadotropin inhibitory hormone and kisspeptin in the metabolic regulation of reproduction. J. Endocrinol. 225, R49–R66. Zhang, Y., Li, S., Liu, Y., Lu, D., Chen, H., Huang, X., Liu, X., Meng, Z., Lin, H., Cheng, C.H., 2010. Structural diversity of the GnIH/GnIH receptor system in teleost: its
53