- Email: [email protected]
Distribution of Helicobacter pylori virulence markers in patients with gastroduodenal diseases in a region at high risk of gastric cancer
Microbial Pathogenesis 59-60 (2013) 13e18
Contents lists available at SciVerse ScienceDirect
Microbial Pathogenesis journal homepage: www.elsevier.com/locate/micpath
Distribution of Helicobacter pylori virulence markers in patients with gastroduodenal diseases in a region at high risk of gastric cancer Ming-yi Wang a, b, Cheng Chen a, Xiao-zhong Gao c, Jie Li c, Jing Yue c, Feng Ling a, Xiao-chun Wang a, Shi-he Shao a, * a b c
School of Medical Science and Laboratory Medicine, Jiangsu University, Zhenjiang, Jiangsu 212013, PR China Department of Clinical Lab, Weihai Municipal Hospital Affiliated to Dalian Medical University, Weihai, Shandong 264200, PR China Department of Gastroenterology, Weihai Municipal Hospital Affiliated to Dalian Medical University, Weihai, Shandong 264200, PR China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 30 December 2012 Received in revised form 24 March 2013 Accepted 1 April 2013 Available online 9 April 2013
Abstract background: Helicobacter pylori (H. pylori) is a major human pathogen that is responsible for various gastroduodenal diseases. We investigated the prevalence of H. pylori virulence markers in a region at high risk of gastric cancer. Methods: One hundred and sixteen H. pylori strains were isolated from patients with gastroduodenal diseases. cagA, the cagA 30 variable region, cagPAI genes, vacA, and dupA genotypes were determined by PCR, and some amplicons of the cagA 30 variable region, cagPAI genes and dupA were sequenced. Results: cagA was detected in all strains. The cagA 30 variable region of 85 strains (73.3%) was amplified, and the sequences of 24 strains were obtained including 22 strains possessing the East Asian-type. The partial cagPAI presented at a higher frequency in chronic gastritis (44.4%) than that of the severe clinical outcomes (9.7%, p < 0.001). The most prevalent vacA genotypes were s1a/m2 (48.3%) and s1c/m2 (13.8%). Thirty-six strains (31.0%) possessed dupA and sequencing of dupA revealed an ORF of 2449-bp. The prevalence of dupA was significantly higher in strains from patients with the severe clinical outcomes (40.3%) than that from chronic gastritis (20.4%, p ¼ 0.02). Conclusion: The high rate of East Asian-type cagA, intact cagPAI, virulent vacA genotypes, and the intact long-type dupA may underlie the high risk of gastric cancer in the region. Ó 2013 Elsevier Ltd. All rights reserved.
Keywords: Helicobacter pylori Virulence markers cagPAI vacA dupA
1. Introduction Helicobacter pylori (H. pylori) colonizes the surface area of the gastric mucosa in the human stomach, and is associated with an increased risk for diseases ranging from gastritis to peptic ulcer and gastric cancer. Although the mechanisms resulting in the disease development are poorly understood, a number of virulence factors in H. pylori have been identified and suggested to be involved in the pathogenesis of the diseases, including the cag pathogenicity island (cagPAI), the vacuolating cytotoxin (vacA), and the duodenal ulcer promoting gene A (dupA) [1,2]. The H. pylori cagPAI encodes components of a type IV secretion system (T4SS), which is used for the translocation of CagA protein into the gastric epithelium cells, and is clearly associated with an enhanced risk of developing gastritis, peptic ulcer and gastric cancer [3]. Notably the presence of intact cagPAI strains was found
* Corresponding author. Tel.: þ86 13951404805. E-mail address: [email protected] (S.-h. Shao). 0882-4010/$ e see front matter Ó 2013 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.micpath.2013.04.001
more frequently in patients with severe gastroduodenal disease, and partial deletions of the cagPAI appear to be sufficient to render the organism less pathogenic [4,5]. According to the sequence located in the 30 region, cagA could be mainly classified into 2 types (East Asian-type and Western-type). It is interesting to note that both in vitro and in vivo (animal and human) data clearly show that East Asian-type CagA protein is more carcinogenic than Westerntype CagA protein [6e8]. Virtually all H. pylori strains have a copy of vacA, which has been found to be associated with distinct gastrointestinal disorders [9]. The vacA gene contains at least two variable parts: the signal (s) region that is present as type s1 (subtype a, b and c) or type s2, and the middle (m) region occurs as the m1 or m2 allelic type. In general, type s1/m1 and s1/m2 strains produce high and moderate levels of toxin, respectively, whereas s2/m2 strains produce little or no toxin [10]. dupA located in the plasticity region of H. pylori, is typical of other virulence factor, such as cagA [11,12]. It has been supposed that dupA is a component of a new cluster of vir homolog genes that might form a type IV secretion system with other genes to induce the gastric epithelial cells to secrete IL-8, similarly to cagPAI [13,14].
14
M.-y. Wang et al. / Microbial Pathogenesis 59-60 (2013) 13e18
Although the high risk of gastric cancer was reported in a littoral region of Northeast China [15], there is currently no report explaining the mechanisms resulting in the phenomenon. In this study, we selected H. pylori strains to analyze the virulence markers status, and examine the association between virulence markers and severe clinical outcomes in the region. Furthermore, the cagPAI has a variable genetic structure [16], and dupA is commonly polymorphic [11,17]. We analyzed the sequence of cagPAI genes (cagI, cagL, cagM, cagT, cagX) and dupA in some H. pylori strains to consider whether their genetic structures are conserved in the region. 2. Materials and methods 2.1. Patients and sampling Three hundred and eighty-six patients had abdominal symptoms and were clinically examined at the Department of Gastroenterology and further underwent upper gastrointestinal endoscopy in Weihai Municipal Hospital affiliated to Dalian Medical University from June 2010 to June 2013. None of the patients had recently been prescribed antibiotics and received nonsteroidal antiinflammatory drugs. A total of six biopsies were obtained from each patient during the endoscopic procedure: two biopsies from the greater curvature of the gastric antrum, two from the greater curvature of the gastric fundic mucosa, and two from the margin of the lesion. One specimen each from the antral, fundic mucosae and the margin of the lesion was subjected to histological analysis. The other specimens were subjected to culture for H. pylori. Gastritis was defined as histological gastritis without peptic ulcer diseases or gastric malignancy, or erosive esophagitis. Peptic ulcers were identified endoscopically and histologically, and Gastric cancers were confirmed histologically. Written and informed consent was obtained from all patients, and the study was conducted upon approval by the Ethical Committee of Weihai Municipal Hospital affiliated to Dalian Medical University. 2.2. Histological analysis Biopsy specimens were stained with hematoxylin-eosin for histopathology. After the specimens were evaluated by an experienced histopathologist, the histological slides were then examined by an independent expert, who had no information on the patients, for confirmation of the diagnosis. 2.3. H. pylori cultivation and identification After biopsies were taken, samples were collected in brain heart infusion broth (Oxoid, United Kingdom), and dispersed using a sterile tissue homogenizer within 2 h of collection. Every homogenate was inoculated onto Campylobacter agar (Oxoid, United Kingdom) with 8% sheep blood and H. pylori selective supplement (Oxoid, United Kingdom) in microaerophilic condition (5% O2, 10% CO2 and 85% N2) at 37 C for 72 h. Small dew drop colonies were selected for the identification of H. pylori with the phenotypic characteristics and PCR based on 16SrRNA gene sequence as described previously [18]. Isolates with curved gram-negative rods, positive in all the three enzymes activity tests and 16SrRNA gene sequences having more 98% homology with H. pylori were identified as H. pylori. After bacteria were harvested, genomic DNA was isolated by using bacterial genomic DNA extraction kit (DV810A, Takara), and stored at 20 C until PCR analysis and nucleotide sequencing.
2.4. Analysis of cagA status and 30 variable region of cagA PCR analyses were carried out to determine the presence or absence of cagA and to detect cagA 30 variable region of H. pylori strains as described previously [19,20]. Primer sequences used in this study were listed in Table 1. After PCR, the amplified PCR products were electrophoresed in 2% agarose gels and examined under UV illumination. Some amplicons of cagA 30 variable region were sequenced by Life Technologies Corporation using BigDyeÒ Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems). 2.5. cagPAI genes PCR analysis and sequencing of cagPAI genes (cagI, cagL, cagM, cagT, cagX) PCR analyses were carried out to amplify six different loci spread over the cagⅠregion (cagE, cagI, cagL, cagM) and cagⅡ region (cagT, cagX) to estimate whether the cagPAI was intact and likely to be functional in vivo using eight oligonucleotide pairs shown in Table 1 [21,22]. PCR tests were performed thrice, while H. pylori NCTC 11637 was served as positive control and sterile distilled water was used as negative control. Where more than one primer pair was utilized, isolates positive for one primer pair were considered to be positive for that gene. In the present study, the cagPAI was classified as intact, partially or completely deleted according to the presence of the cagA, cagE, cagI, cagL, cagM, cagT and cagX. Some amplicons of cagI, cagL, cagM, cagT and cagX were sequenced by Life Technologies Corporation using BigDyeÒ Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems). The fulllength amino acid sequences of each gene were constructed and translated from the nucleotide sequences using Primer 5.0 (Premier Biosoft International). 2.6. Detection of vacA genetype diversity Genotyping of the vacA was performed by PCR amplification in the s-region and the m-region using the primers (Table 1) [23,24]. The amplified products were electrophoresed in 2% agarose gels and examined under UV illumination. 2.7. dupA status analysis and sequencing Two sets of primers were employed for partial amplification of jph0917 and jhp0918 to screen for the presence of dupA as previously described [25]. Another set of primers (Table 1) was utilized to amplify the entire dupA for sequencing. Some amplicons of the entire dupA were sequenced and compared with deposited sequences in NCBI. 2.8. Statistical analysis The statistical calculation was performed using SPSS version 13.0 (SPSS, Chicago, IL, USA). Chi-square test was used to check for presence of partial cagPAI and dupA between different clinical outcome groups. p value less than 0.05 was considered significant. 3. Results H. pylori strains were isolated from 116 patients (30.1%, 116/386) with gastroduodenal diseases in this study. Diseases (n ¼ 116) were diagnosed by pathological manifestations, including chronic gastritis (CG, n ¼ 54), gastric ulcer (GU, n ¼ 25), duodenal ulcer (DU, n ¼ 26), and gastric cancer (GC, n ¼ 11). A summary of the prevalence of individual virulence factors was presented in Table 2, including cagPAI, vacA and dupA.
M.-y. Wang et al. / Microbial Pathogenesis 59-60 (2013) 13e18
15
Table 1 Polymerase chain reaction (PCR) primer pairs used for genotyping Helicobacter pylori isolates. Region
Primer
Sequence
Amplicon size (bp)
References
cagA conservative region
f: r: cag2 cagA26 picBF picBR f: r: f: r: f: r: f: r: f: r: f: r: f: r: f: r:
GATAGGGATAACAGGCAAGC GGGGGTTGTATGATATTTTC GGAACCCTAGTCGGTAATG GCTTTAGCTTCTGATACC TGTTTGGTTTCCCTG ACGCATTCCTTAACG TTGAAAACTTCAAGGATAGGATAGAGC GCCTAGCGTAATATCACCATTACCC ACAGAAGTAGTAATAACGCTTGAAC TTTGACAATAACTTTAGAGCTAG AAGCGTCTGTGAAGCAGTGA GACCAACCAACAAGTGCTCA GAAGATATAACAAGCGGTTT TTTAACAATGATCTTACTTGA GAGCAGTTTGGTTCATTT CTATTCAAAGGGATTATTC CCATGTTTATACGCCTGTGT CATCACCACACCCTTTTGAT ATGAAAGTGAGAGCAAGTGT TCACTTACCACTGAGCAAAC ATGGGGCAGGCATTTTTTA TTATTTATCTCTGACAAGAGGGAG
297
[19]
Uncertain
[20]
1335
[21]
508
[21]
1086
This study
433
[21]
654
This study
1149
This study
301
[22]
843
This study
1569
This study
SS1-F VA1-R SS3-F VA1-R f: r: SS2-F VA1-R VA3-F VA3-R VA4-F VA4-R f: r: f: r: f: r:
GTCAGCATCACACCGCAAC CTGCTTGAATGCGCCAAAC AGCGCCATACCGCAAGAG CTGCTTGAATGCGCCAAAC CTYGCTTTAGTRGGGYTA CTGCTTGAATGCGCCAAA C GCTAACACGCCAAATGATCC CTGCTTGAATGCGCCAAAC GGTCAAAATGCGGTCATGG CCATTGGTACCTGTAGAAAC GGAGCCCCAGGAAACATTG CATAACTAGCGCCTTGCAC GGTTTCTACTGACAGAGCGC AACACGCTGACAGGACAATCTCCC CCTATATCGCTAACGCGCGCTC AAGCTGAAGCGTTTGTAACG ATGTTTCTTGGTTTAGAGGG GCCCACCAGTTGCAAAAACAAATGAAC
190
[23]
187
[23]
213
[24]
199
[23]
290
[23]
352
[23]
307
[25]
276
[25]
Uncertain
This study [11]
cagA 30 variable region cagE cagE cagI cagL cagL cagM cagT cagT cagX vacA alleles s1a s1b s1ca s2 m1 m2 jph0917 jph0918 dupA a
Y is C or T; R is A or G.
3.1. Detection of cagA status and sequencing of the cagA 30 variable region The expected 297bp PCR product of the conserved cagA fragment was obtained from all clinical isolates of H. pylori, as well as from the positive control strain, NCTC 11637. cagA 30 variable region of 85 strains (73.3%, 85/116) was amplified, and the sequence of 24 strains were obtained. After nucleotide Table 2 Summary of the prevalence of cagPAI, vacA genotypes and dupA in 116 clinical H. pylori isolates (%). Genes
cagA cagE cagI cagL cagM cagT cagX vacAs1a vacAs1b vacAs1c vacAs2 vacAm1 vacAm2 dupA
CG
GU
DU
GC
n ¼ 54
n ¼ 25
n ¼ 26
n ¼ 11
Total n ¼ 116
54(100) 42(77.8) 40(74.1) 54(100) 54(100) 54(100) 54(100) 28(51.9) 3(5.6) 23(42.6) 0(0) 0(0) 32(59.3) 11(20.4.)
25(100) 25(100) 22(88.0) 25(100) 25(100) 25(100) 25(100) 22(88.0) 0(0) 3(12.0) 0(0) 0(0) 14(56.0) 10(40.0)
26(100) 26(100) 23(88.5) 26(100) 26(100) 26(100) 26(100) 21(80.8) 0(0) 5(19.2) 0(0) 0(0) 17(65.4) 11(42.3)
11(100) 11(100) 11(100) 11(100) 11(100) 11(100) 11(100) 9(81.8) 0(0) 2(18.2) 0(0) 0(0) 9(81.8) 4(36.4)
116(100) 104(89.7) 96(82.8) 116(100) 116(100) 116(100) 116(100) 80(69.0) 3(2.6) 33(28.4) 0(0) 0(0) 72(62.1) 36(31.0)
analysis, we found that cagA 30 variable region fell into two types: East Asian-type (22 strains, 91.7%) classified as EPIYA-B-D types and Western-type (2 strains, 8.3%) classified as EPIYA-BeC types [26]. The two strains with Western-type were isolated from CG, while other 22 strains with East Asian-type were isolated from the different gastroduodenal diseases (11 strains from CG, 4 strains from GU, 6 strains from DU and 1 strain from GC). The longer East Asian-type (521bp) possessed three EPIYA motifs, and the shorter Western-type (502bp) possessed two EPIYA motifs and one EPIYT. Meanwhile, the East Asian-type had a region characterized by the KIASAGKGVGGFSGA pattern following between the second and third EPIYA motifs, whereas the Westerntype strains were characterized by the FPLKRHDKVDDLSKV. As previously reported [26], all strains with East Asian-type were characterized by two repeats of 15-bp sequences (R1) and by a 42bp region (R2) located between the two R1 repeats, which were classified as type-A. Downstream of the R1-R2-R1 sequence, a 147bp segment (R3) was found, followed by another R1 sequence. 3.2. Prevalence of an intact cagPAI and characteristics of the cagPAI gene sequences After PCR amplification of the cagPAI genes, the results showed that 100% (116/116) of the isolates were positive for cagA, cagL, cagM, cagT and cagX, whereas 89.7% (104/116) and 82.8% (96/116) strains had cagE and cagI, respectively (Table 2). Two strains
16
M.-y. Wang et al. / Microbial Pathogenesis 59-60 (2013) 13e18
Fig. 1. Schematic structure of the jhp0917 gene,jhp0918 gene and jhp0919 gene in strain J99 and that of the dupA gene in the clinical isolates. All 8 clinical isolates examined contained an additional 50 region before jhp0917 gene, and ended at 5bp after the putative start codon of jph0919 gene.
isolated from CG had double deletions of cagI and cagE, while no strain had double deletions in other groups. None of the isolates completely lacked the cagPAI. Isolates with partial cagPAI were found in 25.9% strains (30/116), which present at a higher frequency in CG (44.4%, 24/54) than that of GU (12.0%, 3/25), DU (11.5%, 3/26) and GC (0%, 0/11) (p < 0.001). Seventeen strains were selected for cagI sequence analysis, and the results revealed a 1146-bp open reading frame (ORF), encoding proteins of 381 amino acids. Sequencing of cagL in 20 strains revealed a 714-bp ORF encoding proteins of 237 amino acids. Interestingly, the sequence of cagL in 2 strains possessed a 708-bp ORF, which encoded 235 amino acids because of a deletion of 6-bp after the position 169-bp of cagL gene. The cagM sequence of 24 strains was analyzed, and it showed that cagM with a 1131-bp ORF encoding proteins of 376 amino acids. Sequencing of cagT (18 strains) revealed an 843-bp ORF encoding proteins of 280 amino acids. cagX gene of all 11 isolates produced a fragment of size 1539bp ORF encoding proteins of 512 amino acids. These cagI, cagM, cagT, and cagX were well conserved among all strains, which encoded the same length protein as the previously published strains 26695, J99, and NCTC 11637. It showed that the distribution of the isolates was almost the same among each protein of cagPAI genes with high homology (more than 98%), except cagL. 3.3. Characterization of vacA genotype of H. pylori The most common vacA s genotype was s1a (69.0%) and s1c (28.4%), whereas low prevalence of s1b (2.6%) was found in the region. The vacA genotype m2 was most common (62.1%) in the patients with gastroduodenal diseases, which ranged from 59.3% in CG, 56.0% in GU, 65.4% in DU, to 81.8% in GC, whereas no vacm1 was found in the strains. It showed that s1a/m2 (48.3%) and s1c/m2 (13.8%) strains were the most prevalent strains in this region. 3.4. dupA status analysis and sequencing With the two primer pairs, both jhp0917 and jhp0918 genes were found in 36 strains (31.0%, 36/116), of which 11 strains (20.4%, 11/ 54) were isolated from patients with CG, 10 strains (40.0%, 10/25) from GU, 11 strains (42.3%, 11/26) from DU, and 4 strains (36.4%, 4/ 11) from GC. There was no strain possessing the jhp0917-positive/ jhp0918-negative or jhp0917-negative/jhp0918-positive genotype. All the 36 strains were amplified by the primer pairs for the entire dupA, and the amplicons of 8 strains were sequenced. The prevalence of dupA was significantly higher in strains from patients with GU, DU and GC (40.3%) than that from gastritis (20.4%,
p ¼ 0.02). Sequencing of dupA revealed an ORF of 2449-bp, longer than previously described due to an additional 615-nucleotide region before the 50 region of the jhp0917 gene and ending at 5-bp after the putative start codon of jhp0919 gene (Fig. 1). Meanwhile, all 8 isolates were also observed to possess a ‘C’ insertion after the position 1385-bp of the jhp0917 gene, and there was an ‘A’ insertion after position 311-bp relative to jhp0918 gene. DNA sequences of dupA were highly conserved, and the homology between some isolates and HPSHI_04615 gene of Shi470 strain (GenBank sequence: CP001072) was very high, at over 99%. 3.5. Nucleotide sequence accession numbers Nucleotide sequences of the cagA 30 variable region, cagPAI genes and dupA were assembled to deposit in the GenBank nucleotide sequence database (Accession nos. KC690282eKC690305, KC707809eKC707908). 4. Discussion H. pylori is believed to exhibit a large degree of genomic and allelic diversity, and there are indications of significant geographic differences among H. pylori strains [27]. In this study, H. pylori was isolated from a region at high risk of gastric cancer, and virulence markers genotypes were analyzed to examine the association between virulence markers and clinical outcomes in the region. It is already well established that the regions with high rates of severe disease have high rates of cagA-positive strains, whereas those with mild diseases have lower rates of cagA-positive strains. It was previously reported that East Asian H. pylori strains have the high prevalence of cagA positivity approaching 100% [19,28]. In the study, the result confirmed that all strains were cagA-positive in the region. When determining the variation of the cagA 30 region, 2 of our 24 strains isolated were categorized as Western-type with EPIYA-B-C types, and other strains were categorized as East Asian-type with EPIYA-B-D types. The structural differences are substantially associated with functional differences between East Asian and Western CagA protein. The endemic East Asian-type in East Asian countries conferred stronger SHP-2 binding and morphologically transforming activities to Western CagA protein [29]. This finding indicates that H. pylori strains isolated in the region are characterized with East Asian-type cagA 30 region to be more active biologically. The cagPAI island is not intact in many strains across the world, and an intact cagPAI is indicative of a more severe outcome [4,30]. In our study, most H. pylori strains (74.1%) had the intact cagPAI, and the prevalence of intact cagPAI was significantly higher in patients
M.-y. Wang et al. / Microbial Pathogenesis 59-60 (2013) 13e18
with peptic ulcer and GC than in patients with CG. These results indicate that the severity of H. pylori-related disease is correlated with the presence of the intact cagPAI. Interestingly, strains with partially deleted cagPAI were found, which lack only cagE or cagI. cagE is one of the marker genes in cagⅠ of the cagPAI, which is believed to be a more accurate marker of an intact cagPAI than the cagA gene [31]. Meanwhile, CagI protein might be an accessory component of the CagA protein secretion and involve in CagA protein secretion [32]. Therefore, we believe that it is practical to detect the cagE and cagI to evaluate whether the cagPAI is functional and intact in this region with high cagA-positivity. Sequence analysis indicated that CagL protein is a protein highly conserved among pathogenic H. pylori strains [33]. Intriguingly, here we found that two strains (9.1%, 2/22) were mutants in cagL due to a deletion of 6-bp after the position 169-bp of cagL gene. H. pylori CagL protein is a specialized adhesin that is targeted to the pilus surface. Although the mutant still possesses the arginin-glycine-aspartate (RGD) which is the best known binding domain on integrin ligands [33], the function of mutant should be analyzed in the future. A strain’s vacA structure determines its in-vitro cytotoxin activity, with s1/m1 and s1/m2 being more active [10]. As shown by our results, vacA of s1a/m2 genotype (48.3%) and s1c/m2 genotype (13.8%) predominated in H. pylori from patients with gastroduodenal diseases. Recently a novel H. pylori virulence factor was identified and named duodenal ulcer promoting gene (dupA), which was located in the plasticity region of the H. pylori genome [1]. dupA has been previously described as a risk marker for duodenal ulcer (DU) development and a protective factor against gastric cancer (GC) in many regions, including China [12,25,34]. However, several controversial results have been reported that dupA is unlikely to be a virulence factor of H. pylori and not associated with gastroduodenal diseases [35,36]. The presence of dupA was 31.0% in this study, and the prevalence of dupA was significantly higher in strains from patients with the severe clinical outcomes than that from chronic gastritis. In the study, we found that dupA in the region reveals an ORF of 2449-bp, which is a kind of conserved, intact and long-type dupA as recently reported [37]. These results indicate that the intact long-type dupA is a real virulence marker for severe outcomes in this region. In conclusion, we hypothesize that the more active East Asiantype cagA, intact cagPAI, virulent vacA genotypes, and the intact long-type dupA are likely to explain the high risk of gastric cancer in the region. Disclosure of interest The authors declare that they have no conflicts of interest concerning this article. Acknowledgments This work was supported by the 2012 Program Sponsored for Scientific Innovation Research of College Graduate in Jiangsu Province (No. CXLX12_0674), the 2012 Program Sponsored for Scientific Innovation Research and Achievement Transformation (Science and Technology of Life Health) in Jiangsu Province (No. BL2012047) and the National Natural Science Foundation of China (Grant No. 81271795). References [1] Lu H, Yamaoka Y, Graham DY. Helicobacter pylori virulence factors: facts and fantasies. Curr Opin Gastroenterol 2005;21(6):653e9. [2] Yamaoka Y. Pathogenesis of Helicobacter pylori-Related gastroduodenal diseases from molecular epidemiological studies. Gastroenterol Res Pract 2012;2012:371503.
17
[3] Backert S, Schwarz T, Miehlke S, Kirsch C, Sommer C, Kwok T, et al. Functional analysis of the cag pathogenicity island in Helicobacter pylori isolates from patients with gastritis, peptic ulcer, and gastric cancer. Infect Immun 2004;72(2): 1043e56. [4] Nilsson C, Sillén A, Eriksson L, Strand ML, Enroth H, Normark S, et al. Correlation between cag pathogenicity island composition and Helicobacter pyloriassociated gastroduodenal disease. Infect Immun 2003;71(11):6573e81. [5] Ali M, Khan AA, Tiwari SK, Ahmed N, Rao LV, Habibullah CM, et al. Association between cag-pathogenicity island in Helicobacter pylori isolates from peptic ulcer, gastric carcinoma, and non-ulcer dyspepsia subjects with histological changes. World J Gastroenterol 2005;11(43):6815e22. [6] Hatakeyama M. Oncogenic mechanisms of the Helicobacter pylori CagA protein. Nat Rev Cancer 2004;4(9):688e94. [7] Miura M, Ohnishi N, Tanaka S, Yanagiya K, Hatakeyama M. Differential oncogenic potential of geographically distinct Helicobacter pylori CagA isoforms in mice. Int J Cancer 2009;125(11):2497e504. [8] Vilaichone RK, Mahachai V, Tumwasorn S, Wu JY, Graham DY, Yamaoka Y. Molecular epidemiology and outcome of Helicobacter pylori infection in Thailand: a cultural cross roads. Helicobacter 2004;9(5):453e9. [9] Yamazaki S, Yamakawa A, Okuda T, Ohtani M, Suto H, Ito Y, et al. Distinct diversity of vacA, cagA, and cagE genes of Helicobacter pylori associated with peptic ulcer in Japan. J Clin Microbiol 2005;43(8):3906e16. [10] Fischer W. Assembly and molecular mode of action of the Helicobacter pylori Cag type IV secretion apparatus. FEBS J 2011;278(8):1203e12. [11] Hussein NR, Argent RH, Marx CK, Patel SR, Robinson K, Atherton JC. Helicobacter pylori dupA is polymorphic, and its active form induces proinflammatory cytokine secretion by mononuclear cells. J Infect Dis 2010;202(2):261e9. [12] Hussein NR. The association of dupA and Helicobacter pylori-related gastroduodenal diseases. Eur J Clin Microbiol Infect Dis 2010;29(7):817e21. [13] Yamaoka Y. Roles of the plasticity regions of Helicobacter pylori in gastroduodenal pathogenesis. J Med Microbiol 2008;57(Pt 5):545e53. [14] Fischer W, Windhager L, Rohrer S, Zeiller M, Karnholz A, Hoffmann R, et al. Strain-specific genes of Helicobacter pylori: genome evolution driven by a novel type IV secretion system and genomic island transfer. Nucleic Acids Res 2010;38(18):6089e101. [15] Gao XZ, Chu YL, Qiao XL, Wang XF, Liu F, Liu J. Narrow band imaging endoscopy for diagnosis of malignant and premalignant gastric lesions. Chin J Digestion 2009;29(5):289e92. [16] Azuma T, Yamakawa A, Yamazaki S, Ohtani M, Ito Y, Muramatsu A, et al. Distinct diversity of the cag pathogenicity island among Helicobacter pylori strains in Japan. J Clin Microbiol 2004;42(6):2508e17. [17] Queiroz DM, Moura SB, Rocha AM. The genotype of the Brazilian dupA-positive Helicobacter pylori strains is dupA1. J Infect Dis 2011;203(7):1033e4. [18] Wang MY, Lin J, Sun SB, Yuan XY. Identification of Granulicatella elegans from a case of infective endocarditis, based on the phenotypic characteristics and 16SrRNA gene sequence. J Cardiovasc Med (Hagerstown) 2012. [Epub ahead of print]. [19] Zhou J, Zhang J, Xu C, He L. cagA genotype and variants in Chinese Helicobacter pylori strains and relationship to gastroduodenal diseases. J Med Microbiol 2004;53(Pt 3):231e5. [20] Zhang Y, Argent RH, Letley DP, Thomas RJ, Atherton JC. Tyrosine phosphorylation of CagA from Chinese Helicobacter pylori isolates in AGS gastric epithelial cells. J Clin Microbiol 2005;43(2):786e90. [21] Schmidt HM, Andres S, Nilsson C, Kovach Z, Kaakoush NO, Engstrand L, et al. The cagPAI is intact and functional but HP0521 varies significantly in Helicobacter pylori isolates from Malaysia and Singapore. Eur J Clin Microbiol Infect Dis 2010;29(4):439e51. [22] Kauser F, Hussain MA, Ahmed I, Ahmad N, Habeeb A, Khan AA, et al. Comparing genomes of Helicobacter pylori strains from the high-altitude desert of Ladakh, India. J Clin Microbiol 2005;43(4):1538e45. [23] Yakoob J, Abid S, Abbas Z, Jafri W, Ahmad Z, Ahmed R, et al. Distribution of Helicobacter pylori virulence markers in patients with gastroduodenal diseases in Pakistan. BMC Gastroenterol 2009;9:87. [24] Tan HJ, Rizal AM, Rosmadi MY, Goh KL. Distribution of Helicobacter pylori cagA, cagE and vacA in different ethnic groups in Kuala Lumpur Malaysia. J Gastroenterol Hepatol 2005;20(4):589e94. [25] Lu H, Hsu PI, Graham DY, Yamaoka Y. Duodenal ulcer promoting gene of Helicobacter pylori. Gastroenterology 2005;128(4):833e48. [26] Yamaoka Y, Kodama T, Kashima K, Graham DY, Sepulveda AR. Variants of the 3’ region of the cagA gene in Helicobacter pylori isolates from patients with different H. pylori-associated diseases. J Clin Microbiol 1998;36(8):2258e63. [27] Falush D, Wirth T, Linz B, Pritchard JK, Stephens M, Kidd M, et al. Traces of human migrations in Helicobacter pylori populations. Science 2003;299(5612):1582e5. [28] Chen XJ, Yan J, Shen YF. Dominant cagA/vacA genotypes and coinfection frequency of H. pylori in peptic ulcer or chronic gastritis patients in Zhejiang Province and correlations among different genotypes, coinfection and severity of the diseases. Chin Med J (Engl) 2005;118(6):460e7. [29] Higashi H, Tsutsumi R, Fujita A, Yamazaki S, Asaka M, Azuma T, et al. Biological activity of the Helicobacter pylori virulence factor CagA is determined by variation in the tyrosine phosphorylation sites. Proc Natl Acad Sci U S A 2002;99(22):14428e33. [30] Kauser F, Khan AA, Hussain MA, Carroll IM, Ahmad N, Tiwari S, et al. The cag pathogenicity island of Helicobacter pylori is disrupted in the majority of patient isolates from different human populations. J Clin Microbiol 2004;42(11): 5302e8.
18
M.-y. Wang et al. / Microbial Pathogenesis 59-60 (2013) 13e18
[31] Ikenoue T, Maeda S, Ogura K, Akanuma M, Mitsuno Y, Imai Y, et al. Determination of Helicobacter pylori virulence by simple gene analysis of the cag pathogenicity island. Clin Diagn Lab Immunol 2001;8(1):181e6. [32] Wang H, Han J, Chen D, Duan X, Gao X, Wang X, et al. Characterization of CagI in the cag pathogenicity island of Helicobacter pylori. Curr Microbiol 2012;64(2):191e6. [33] Kwok T, Zabler D, Urman S, Rohde M, Hartig R, Wessler S, et al. Helicobacter exploits integrin for type IV secretion and kinase activation. Nature 2007;449(7164):862e6. [34] Zhang Z, Zheng Q, Chen X, Xiao S, Liu W, Lu H. The Helicobacter pylori duodenal ulcer promoting gene, dupA in China. BMC Gastroenterol 2008;8:49.
[35] Nguyen LT, Uchida T, Tsukamoto Y, Kuroda A, Okimoto T, Kodama M, et al. Helicobacter pylori dupA gene is not associated with clinical outcomes in the Japanese population. Clin Microbiol Infect 2010;16(8): 1264e9. [36] Gomes LI, Rocha GA, Rocha AM, Soares TF, Oliveira CA, Bittencourt PF, et al. Lack of association between Helicobacter pylori infection with dupApositive strains and gastroduodenal diseases in Brazilian patients. Int J Med Microbiol 2008;298(3e4):223e30. [37] Takahashi A, Shiota S, Matsunari O, Watada M, Suzuki R, Nakachi S, et al. Intact long-type dupA as a marker for gastroduodenal diseases in Okinawan subpopulation, Japan. Helicobacter 2013;18(1):66e72.
Contents lists available at SciVerse ScienceDirect
Microbial Pathogenesis journal homepage: www.elsevier.com/locate/micpath
Distribution of Helicobacter pylori virulence markers in patients with gastroduodenal diseases in a region at high risk of gastric cancer Ming-yi Wang a, b, Cheng Chen a, Xiao-zhong Gao c, Jie Li c, Jing Yue c, Feng Ling a, Xiao-chun Wang a, Shi-he Shao a, * a b c
School of Medical Science and Laboratory Medicine, Jiangsu University, Zhenjiang, Jiangsu 212013, PR China Department of Clinical Lab, Weihai Municipal Hospital Affiliated to Dalian Medical University, Weihai, Shandong 264200, PR China Department of Gastroenterology, Weihai Municipal Hospital Affiliated to Dalian Medical University, Weihai, Shandong 264200, PR China
a r t i c l e i n f o
a b s t r a c t
Article history: Received 30 December 2012 Received in revised form 24 March 2013 Accepted 1 April 2013 Available online 9 April 2013
Abstract background: Helicobacter pylori (H. pylori) is a major human pathogen that is responsible for various gastroduodenal diseases. We investigated the prevalence of H. pylori virulence markers in a region at high risk of gastric cancer. Methods: One hundred and sixteen H. pylori strains were isolated from patients with gastroduodenal diseases. cagA, the cagA 30 variable region, cagPAI genes, vacA, and dupA genotypes were determined by PCR, and some amplicons of the cagA 30 variable region, cagPAI genes and dupA were sequenced. Results: cagA was detected in all strains. The cagA 30 variable region of 85 strains (73.3%) was amplified, and the sequences of 24 strains were obtained including 22 strains possessing the East Asian-type. The partial cagPAI presented at a higher frequency in chronic gastritis (44.4%) than that of the severe clinical outcomes (9.7%, p < 0.001). The most prevalent vacA genotypes were s1a/m2 (48.3%) and s1c/m2 (13.8%). Thirty-six strains (31.0%) possessed dupA and sequencing of dupA revealed an ORF of 2449-bp. The prevalence of dupA was significantly higher in strains from patients with the severe clinical outcomes (40.3%) than that from chronic gastritis (20.4%, p ¼ 0.02). Conclusion: The high rate of East Asian-type cagA, intact cagPAI, virulent vacA genotypes, and the intact long-type dupA may underlie the high risk of gastric cancer in the region. Ó 2013 Elsevier Ltd. All rights reserved.
Keywords: Helicobacter pylori Virulence markers cagPAI vacA dupA
1. Introduction Helicobacter pylori (H. pylori) colonizes the surface area of the gastric mucosa in the human stomach, and is associated with an increased risk for diseases ranging from gastritis to peptic ulcer and gastric cancer. Although the mechanisms resulting in the disease development are poorly understood, a number of virulence factors in H. pylori have been identified and suggested to be involved in the pathogenesis of the diseases, including the cag pathogenicity island (cagPAI), the vacuolating cytotoxin (vacA), and the duodenal ulcer promoting gene A (dupA) [1,2]. The H. pylori cagPAI encodes components of a type IV secretion system (T4SS), which is used for the translocation of CagA protein into the gastric epithelium cells, and is clearly associated with an enhanced risk of developing gastritis, peptic ulcer and gastric cancer [3]. Notably the presence of intact cagPAI strains was found
* Corresponding author. Tel.: þ86 13951404805. E-mail address: [email protected] (S.-h. Shao). 0882-4010/$ e see front matter Ó 2013 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.micpath.2013.04.001
more frequently in patients with severe gastroduodenal disease, and partial deletions of the cagPAI appear to be sufficient to render the organism less pathogenic [4,5]. According to the sequence located in the 30 region, cagA could be mainly classified into 2 types (East Asian-type and Western-type). It is interesting to note that both in vitro and in vivo (animal and human) data clearly show that East Asian-type CagA protein is more carcinogenic than Westerntype CagA protein [6e8]. Virtually all H. pylori strains have a copy of vacA, which has been found to be associated with distinct gastrointestinal disorders [9]. The vacA gene contains at least two variable parts: the signal (s) region that is present as type s1 (subtype a, b and c) or type s2, and the middle (m) region occurs as the m1 or m2 allelic type. In general, type s1/m1 and s1/m2 strains produce high and moderate levels of toxin, respectively, whereas s2/m2 strains produce little or no toxin [10]. dupA located in the plasticity region of H. pylori, is typical of other virulence factor, such as cagA [11,12]. It has been supposed that dupA is a component of a new cluster of vir homolog genes that might form a type IV secretion system with other genes to induce the gastric epithelial cells to secrete IL-8, similarly to cagPAI [13,14].
14
M.-y. Wang et al. / Microbial Pathogenesis 59-60 (2013) 13e18
Although the high risk of gastric cancer was reported in a littoral region of Northeast China [15], there is currently no report explaining the mechanisms resulting in the phenomenon. In this study, we selected H. pylori strains to analyze the virulence markers status, and examine the association between virulence markers and severe clinical outcomes in the region. Furthermore, the cagPAI has a variable genetic structure [16], and dupA is commonly polymorphic [11,17]. We analyzed the sequence of cagPAI genes (cagI, cagL, cagM, cagT, cagX) and dupA in some H. pylori strains to consider whether their genetic structures are conserved in the region. 2. Materials and methods 2.1. Patients and sampling Three hundred and eighty-six patients had abdominal symptoms and were clinically examined at the Department of Gastroenterology and further underwent upper gastrointestinal endoscopy in Weihai Municipal Hospital affiliated to Dalian Medical University from June 2010 to June 2013. None of the patients had recently been prescribed antibiotics and received nonsteroidal antiinflammatory drugs. A total of six biopsies were obtained from each patient during the endoscopic procedure: two biopsies from the greater curvature of the gastric antrum, two from the greater curvature of the gastric fundic mucosa, and two from the margin of the lesion. One specimen each from the antral, fundic mucosae and the margin of the lesion was subjected to histological analysis. The other specimens were subjected to culture for H. pylori. Gastritis was defined as histological gastritis without peptic ulcer diseases or gastric malignancy, or erosive esophagitis. Peptic ulcers were identified endoscopically and histologically, and Gastric cancers were confirmed histologically. Written and informed consent was obtained from all patients, and the study was conducted upon approval by the Ethical Committee of Weihai Municipal Hospital affiliated to Dalian Medical University. 2.2. Histological analysis Biopsy specimens were stained with hematoxylin-eosin for histopathology. After the specimens were evaluated by an experienced histopathologist, the histological slides were then examined by an independent expert, who had no information on the patients, for confirmation of the diagnosis. 2.3. H. pylori cultivation and identification After biopsies were taken, samples were collected in brain heart infusion broth (Oxoid, United Kingdom), and dispersed using a sterile tissue homogenizer within 2 h of collection. Every homogenate was inoculated onto Campylobacter agar (Oxoid, United Kingdom) with 8% sheep blood and H. pylori selective supplement (Oxoid, United Kingdom) in microaerophilic condition (5% O2, 10% CO2 and 85% N2) at 37 C for 72 h. Small dew drop colonies were selected for the identification of H. pylori with the phenotypic characteristics and PCR based on 16SrRNA gene sequence as described previously [18]. Isolates with curved gram-negative rods, positive in all the three enzymes activity tests and 16SrRNA gene sequences having more 98% homology with H. pylori were identified as H. pylori. After bacteria were harvested, genomic DNA was isolated by using bacterial genomic DNA extraction kit (DV810A, Takara), and stored at 20 C until PCR analysis and nucleotide sequencing.
2.4. Analysis of cagA status and 30 variable region of cagA PCR analyses were carried out to determine the presence or absence of cagA and to detect cagA 30 variable region of H. pylori strains as described previously [19,20]. Primer sequences used in this study were listed in Table 1. After PCR, the amplified PCR products were electrophoresed in 2% agarose gels and examined under UV illumination. Some amplicons of cagA 30 variable region were sequenced by Life Technologies Corporation using BigDyeÒ Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems). 2.5. cagPAI genes PCR analysis and sequencing of cagPAI genes (cagI, cagL, cagM, cagT, cagX) PCR analyses were carried out to amplify six different loci spread over the cagⅠregion (cagE, cagI, cagL, cagM) and cagⅡ region (cagT, cagX) to estimate whether the cagPAI was intact and likely to be functional in vivo using eight oligonucleotide pairs shown in Table 1 [21,22]. PCR tests were performed thrice, while H. pylori NCTC 11637 was served as positive control and sterile distilled water was used as negative control. Where more than one primer pair was utilized, isolates positive for one primer pair were considered to be positive for that gene. In the present study, the cagPAI was classified as intact, partially or completely deleted according to the presence of the cagA, cagE, cagI, cagL, cagM, cagT and cagX. Some amplicons of cagI, cagL, cagM, cagT and cagX were sequenced by Life Technologies Corporation using BigDyeÒ Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems). The fulllength amino acid sequences of each gene were constructed and translated from the nucleotide sequences using Primer 5.0 (Premier Biosoft International). 2.6. Detection of vacA genetype diversity Genotyping of the vacA was performed by PCR amplification in the s-region and the m-region using the primers (Table 1) [23,24]. The amplified products were electrophoresed in 2% agarose gels and examined under UV illumination. 2.7. dupA status analysis and sequencing Two sets of primers were employed for partial amplification of jph0917 and jhp0918 to screen for the presence of dupA as previously described [25]. Another set of primers (Table 1) was utilized to amplify the entire dupA for sequencing. Some amplicons of the entire dupA were sequenced and compared with deposited sequences in NCBI. 2.8. Statistical analysis The statistical calculation was performed using SPSS version 13.0 (SPSS, Chicago, IL, USA). Chi-square test was used to check for presence of partial cagPAI and dupA between different clinical outcome groups. p value less than 0.05 was considered significant. 3. Results H. pylori strains were isolated from 116 patients (30.1%, 116/386) with gastroduodenal diseases in this study. Diseases (n ¼ 116) were diagnosed by pathological manifestations, including chronic gastritis (CG, n ¼ 54), gastric ulcer (GU, n ¼ 25), duodenal ulcer (DU, n ¼ 26), and gastric cancer (GC, n ¼ 11). A summary of the prevalence of individual virulence factors was presented in Table 2, including cagPAI, vacA and dupA.
M.-y. Wang et al. / Microbial Pathogenesis 59-60 (2013) 13e18
15
Table 1 Polymerase chain reaction (PCR) primer pairs used for genotyping Helicobacter pylori isolates. Region
Primer
Sequence
Amplicon size (bp)
References
cagA conservative region
f: r: cag2 cagA26 picBF picBR f: r: f: r: f: r: f: r: f: r: f: r: f: r: f: r:
GATAGGGATAACAGGCAAGC GGGGGTTGTATGATATTTTC GGAACCCTAGTCGGTAATG GCTTTAGCTTCTGATACC TGTTTGGTTTCCCTG ACGCATTCCTTAACG TTGAAAACTTCAAGGATAGGATAGAGC GCCTAGCGTAATATCACCATTACCC ACAGAAGTAGTAATAACGCTTGAAC TTTGACAATAACTTTAGAGCTAG AAGCGTCTGTGAAGCAGTGA GACCAACCAACAAGTGCTCA GAAGATATAACAAGCGGTTT TTTAACAATGATCTTACTTGA GAGCAGTTTGGTTCATTT CTATTCAAAGGGATTATTC CCATGTTTATACGCCTGTGT CATCACCACACCCTTTTGAT ATGAAAGTGAGAGCAAGTGT TCACTTACCACTGAGCAAAC ATGGGGCAGGCATTTTTTA TTATTTATCTCTGACAAGAGGGAG
297
[19]
Uncertain
[20]
1335
[21]
508
[21]
1086
This study
433
[21]
654
This study
1149
This study
301
[22]
843
This study
1569
This study
SS1-F VA1-R SS3-F VA1-R f: r: SS2-F VA1-R VA3-F VA3-R VA4-F VA4-R f: r: f: r: f: r:
GTCAGCATCACACCGCAAC CTGCTTGAATGCGCCAAAC AGCGCCATACCGCAAGAG CTGCTTGAATGCGCCAAAC CTYGCTTTAGTRGGGYTA CTGCTTGAATGCGCCAAA C GCTAACACGCCAAATGATCC CTGCTTGAATGCGCCAAAC GGTCAAAATGCGGTCATGG CCATTGGTACCTGTAGAAAC GGAGCCCCAGGAAACATTG CATAACTAGCGCCTTGCAC GGTTTCTACTGACAGAGCGC AACACGCTGACAGGACAATCTCCC CCTATATCGCTAACGCGCGCTC AAGCTGAAGCGTTTGTAACG ATGTTTCTTGGTTTAGAGGG GCCCACCAGTTGCAAAAACAAATGAAC
190
[23]
187
[23]
213
[24]
199
[23]
290
[23]
352
[23]
307
[25]
276
[25]
Uncertain
This study [11]
cagA 30 variable region cagE cagE cagI cagL cagL cagM cagT cagT cagX vacA alleles s1a s1b s1ca s2 m1 m2 jph0917 jph0918 dupA a
Y is C or T; R is A or G.
3.1. Detection of cagA status and sequencing of the cagA 30 variable region The expected 297bp PCR product of the conserved cagA fragment was obtained from all clinical isolates of H. pylori, as well as from the positive control strain, NCTC 11637. cagA 30 variable region of 85 strains (73.3%, 85/116) was amplified, and the sequence of 24 strains were obtained. After nucleotide Table 2 Summary of the prevalence of cagPAI, vacA genotypes and dupA in 116 clinical H. pylori isolates (%). Genes
cagA cagE cagI cagL cagM cagT cagX vacAs1a vacAs1b vacAs1c vacAs2 vacAm1 vacAm2 dupA
CG
GU
DU
GC
n ¼ 54
n ¼ 25
n ¼ 26
n ¼ 11
Total n ¼ 116
54(100) 42(77.8) 40(74.1) 54(100) 54(100) 54(100) 54(100) 28(51.9) 3(5.6) 23(42.6) 0(0) 0(0) 32(59.3) 11(20.4.)
25(100) 25(100) 22(88.0) 25(100) 25(100) 25(100) 25(100) 22(88.0) 0(0) 3(12.0) 0(0) 0(0) 14(56.0) 10(40.0)
26(100) 26(100) 23(88.5) 26(100) 26(100) 26(100) 26(100) 21(80.8) 0(0) 5(19.2) 0(0) 0(0) 17(65.4) 11(42.3)
11(100) 11(100) 11(100) 11(100) 11(100) 11(100) 11(100) 9(81.8) 0(0) 2(18.2) 0(0) 0(0) 9(81.8) 4(36.4)
116(100) 104(89.7) 96(82.8) 116(100) 116(100) 116(100) 116(100) 80(69.0) 3(2.6) 33(28.4) 0(0) 0(0) 72(62.1) 36(31.0)
analysis, we found that cagA 30 variable region fell into two types: East Asian-type (22 strains, 91.7%) classified as EPIYA-B-D types and Western-type (2 strains, 8.3%) classified as EPIYA-BeC types [26]. The two strains with Western-type were isolated from CG, while other 22 strains with East Asian-type were isolated from the different gastroduodenal diseases (11 strains from CG, 4 strains from GU, 6 strains from DU and 1 strain from GC). The longer East Asian-type (521bp) possessed three EPIYA motifs, and the shorter Western-type (502bp) possessed two EPIYA motifs and one EPIYT. Meanwhile, the East Asian-type had a region characterized by the KIASAGKGVGGFSGA pattern following between the second and third EPIYA motifs, whereas the Westerntype strains were characterized by the FPLKRHDKVDDLSKV. As previously reported [26], all strains with East Asian-type were characterized by two repeats of 15-bp sequences (R1) and by a 42bp region (R2) located between the two R1 repeats, which were classified as type-A. Downstream of the R1-R2-R1 sequence, a 147bp segment (R3) was found, followed by another R1 sequence. 3.2. Prevalence of an intact cagPAI and characteristics of the cagPAI gene sequences After PCR amplification of the cagPAI genes, the results showed that 100% (116/116) of the isolates were positive for cagA, cagL, cagM, cagT and cagX, whereas 89.7% (104/116) and 82.8% (96/116) strains had cagE and cagI, respectively (Table 2). Two strains
16
M.-y. Wang et al. / Microbial Pathogenesis 59-60 (2013) 13e18
Fig. 1. Schematic structure of the jhp0917 gene,jhp0918 gene and jhp0919 gene in strain J99 and that of the dupA gene in the clinical isolates. All 8 clinical isolates examined contained an additional 50 region before jhp0917 gene, and ended at 5bp after the putative start codon of jph0919 gene.
isolated from CG had double deletions of cagI and cagE, while no strain had double deletions in other groups. None of the isolates completely lacked the cagPAI. Isolates with partial cagPAI were found in 25.9% strains (30/116), which present at a higher frequency in CG (44.4%, 24/54) than that of GU (12.0%, 3/25), DU (11.5%, 3/26) and GC (0%, 0/11) (p < 0.001). Seventeen strains were selected for cagI sequence analysis, and the results revealed a 1146-bp open reading frame (ORF), encoding proteins of 381 amino acids. Sequencing of cagL in 20 strains revealed a 714-bp ORF encoding proteins of 237 amino acids. Interestingly, the sequence of cagL in 2 strains possessed a 708-bp ORF, which encoded 235 amino acids because of a deletion of 6-bp after the position 169-bp of cagL gene. The cagM sequence of 24 strains was analyzed, and it showed that cagM with a 1131-bp ORF encoding proteins of 376 amino acids. Sequencing of cagT (18 strains) revealed an 843-bp ORF encoding proteins of 280 amino acids. cagX gene of all 11 isolates produced a fragment of size 1539bp ORF encoding proteins of 512 amino acids. These cagI, cagM, cagT, and cagX were well conserved among all strains, which encoded the same length protein as the previously published strains 26695, J99, and NCTC 11637. It showed that the distribution of the isolates was almost the same among each protein of cagPAI genes with high homology (more than 98%), except cagL. 3.3. Characterization of vacA genotype of H. pylori The most common vacA s genotype was s1a (69.0%) and s1c (28.4%), whereas low prevalence of s1b (2.6%) was found in the region. The vacA genotype m2 was most common (62.1%) in the patients with gastroduodenal diseases, which ranged from 59.3% in CG, 56.0% in GU, 65.4% in DU, to 81.8% in GC, whereas no vacm1 was found in the strains. It showed that s1a/m2 (48.3%) and s1c/m2 (13.8%) strains were the most prevalent strains in this region. 3.4. dupA status analysis and sequencing With the two primer pairs, both jhp0917 and jhp0918 genes were found in 36 strains (31.0%, 36/116), of which 11 strains (20.4%, 11/ 54) were isolated from patients with CG, 10 strains (40.0%, 10/25) from GU, 11 strains (42.3%, 11/26) from DU, and 4 strains (36.4%, 4/ 11) from GC. There was no strain possessing the jhp0917-positive/ jhp0918-negative or jhp0917-negative/jhp0918-positive genotype. All the 36 strains were amplified by the primer pairs for the entire dupA, and the amplicons of 8 strains were sequenced. The prevalence of dupA was significantly higher in strains from patients with GU, DU and GC (40.3%) than that from gastritis (20.4%,
p ¼ 0.02). Sequencing of dupA revealed an ORF of 2449-bp, longer than previously described due to an additional 615-nucleotide region before the 50 region of the jhp0917 gene and ending at 5-bp after the putative start codon of jhp0919 gene (Fig. 1). Meanwhile, all 8 isolates were also observed to possess a ‘C’ insertion after the position 1385-bp of the jhp0917 gene, and there was an ‘A’ insertion after position 311-bp relative to jhp0918 gene. DNA sequences of dupA were highly conserved, and the homology between some isolates and HPSHI_04615 gene of Shi470 strain (GenBank sequence: CP001072) was very high, at over 99%. 3.5. Nucleotide sequence accession numbers Nucleotide sequences of the cagA 30 variable region, cagPAI genes and dupA were assembled to deposit in the GenBank nucleotide sequence database (Accession nos. KC690282eKC690305, KC707809eKC707908). 4. Discussion H. pylori is believed to exhibit a large degree of genomic and allelic diversity, and there are indications of significant geographic differences among H. pylori strains [27]. In this study, H. pylori was isolated from a region at high risk of gastric cancer, and virulence markers genotypes were analyzed to examine the association between virulence markers and clinical outcomes in the region. It is already well established that the regions with high rates of severe disease have high rates of cagA-positive strains, whereas those with mild diseases have lower rates of cagA-positive strains. It was previously reported that East Asian H. pylori strains have the high prevalence of cagA positivity approaching 100% [19,28]. In the study, the result confirmed that all strains were cagA-positive in the region. When determining the variation of the cagA 30 region, 2 of our 24 strains isolated were categorized as Western-type with EPIYA-B-C types, and other strains were categorized as East Asian-type with EPIYA-B-D types. The structural differences are substantially associated with functional differences between East Asian and Western CagA protein. The endemic East Asian-type in East Asian countries conferred stronger SHP-2 binding and morphologically transforming activities to Western CagA protein [29]. This finding indicates that H. pylori strains isolated in the region are characterized with East Asian-type cagA 30 region to be more active biologically. The cagPAI island is not intact in many strains across the world, and an intact cagPAI is indicative of a more severe outcome [4,30]. In our study, most H. pylori strains (74.1%) had the intact cagPAI, and the prevalence of intact cagPAI was significantly higher in patients
M.-y. Wang et al. / Microbial Pathogenesis 59-60 (2013) 13e18
with peptic ulcer and GC than in patients with CG. These results indicate that the severity of H. pylori-related disease is correlated with the presence of the intact cagPAI. Interestingly, strains with partially deleted cagPAI were found, which lack only cagE or cagI. cagE is one of the marker genes in cagⅠ of the cagPAI, which is believed to be a more accurate marker of an intact cagPAI than the cagA gene [31]. Meanwhile, CagI protein might be an accessory component of the CagA protein secretion and involve in CagA protein secretion [32]. Therefore, we believe that it is practical to detect the cagE and cagI to evaluate whether the cagPAI is functional and intact in this region with high cagA-positivity. Sequence analysis indicated that CagL protein is a protein highly conserved among pathogenic H. pylori strains [33]. Intriguingly, here we found that two strains (9.1%, 2/22) were mutants in cagL due to a deletion of 6-bp after the position 169-bp of cagL gene. H. pylori CagL protein is a specialized adhesin that is targeted to the pilus surface. Although the mutant still possesses the arginin-glycine-aspartate (RGD) which is the best known binding domain on integrin ligands [33], the function of mutant should be analyzed in the future. A strain’s vacA structure determines its in-vitro cytotoxin activity, with s1/m1 and s1/m2 being more active [10]. As shown by our results, vacA of s1a/m2 genotype (48.3%) and s1c/m2 genotype (13.8%) predominated in H. pylori from patients with gastroduodenal diseases. Recently a novel H. pylori virulence factor was identified and named duodenal ulcer promoting gene (dupA), which was located in the plasticity region of the H. pylori genome [1]. dupA has been previously described as a risk marker for duodenal ulcer (DU) development and a protective factor against gastric cancer (GC) in many regions, including China [12,25,34]. However, several controversial results have been reported that dupA is unlikely to be a virulence factor of H. pylori and not associated with gastroduodenal diseases [35,36]. The presence of dupA was 31.0% in this study, and the prevalence of dupA was significantly higher in strains from patients with the severe clinical outcomes than that from chronic gastritis. In the study, we found that dupA in the region reveals an ORF of 2449-bp, which is a kind of conserved, intact and long-type dupA as recently reported [37]. These results indicate that the intact long-type dupA is a real virulence marker for severe outcomes in this region. In conclusion, we hypothesize that the more active East Asiantype cagA, intact cagPAI, virulent vacA genotypes, and the intact long-type dupA are likely to explain the high risk of gastric cancer in the region. Disclosure of interest The authors declare that they have no conflicts of interest concerning this article. Acknowledgments This work was supported by the 2012 Program Sponsored for Scientific Innovation Research of College Graduate in Jiangsu Province (No. CXLX12_0674), the 2012 Program Sponsored for Scientific Innovation Research and Achievement Transformation (Science and Technology of Life Health) in Jiangsu Province (No. BL2012047) and the National Natural Science Foundation of China (Grant No. 81271795). References [1] Lu H, Yamaoka Y, Graham DY. Helicobacter pylori virulence factors: facts and fantasies. Curr Opin Gastroenterol 2005;21(6):653e9. [2] Yamaoka Y. Pathogenesis of Helicobacter pylori-Related gastroduodenal diseases from molecular epidemiological studies. Gastroenterol Res Pract 2012;2012:371503.
17
[3] Backert S, Schwarz T, Miehlke S, Kirsch C, Sommer C, Kwok T, et al. Functional analysis of the cag pathogenicity island in Helicobacter pylori isolates from patients with gastritis, peptic ulcer, and gastric cancer. Infect Immun 2004;72(2): 1043e56. [4] Nilsson C, Sillén A, Eriksson L, Strand ML, Enroth H, Normark S, et al. Correlation between cag pathogenicity island composition and Helicobacter pyloriassociated gastroduodenal disease. Infect Immun 2003;71(11):6573e81. [5] Ali M, Khan AA, Tiwari SK, Ahmed N, Rao LV, Habibullah CM, et al. Association between cag-pathogenicity island in Helicobacter pylori isolates from peptic ulcer, gastric carcinoma, and non-ulcer dyspepsia subjects with histological changes. World J Gastroenterol 2005;11(43):6815e22. [6] Hatakeyama M. Oncogenic mechanisms of the Helicobacter pylori CagA protein. Nat Rev Cancer 2004;4(9):688e94. [7] Miura M, Ohnishi N, Tanaka S, Yanagiya K, Hatakeyama M. Differential oncogenic potential of geographically distinct Helicobacter pylori CagA isoforms in mice. Int J Cancer 2009;125(11):2497e504. [8] Vilaichone RK, Mahachai V, Tumwasorn S, Wu JY, Graham DY, Yamaoka Y. Molecular epidemiology and outcome of Helicobacter pylori infection in Thailand: a cultural cross roads. Helicobacter 2004;9(5):453e9. [9] Yamazaki S, Yamakawa A, Okuda T, Ohtani M, Suto H, Ito Y, et al. Distinct diversity of vacA, cagA, and cagE genes of Helicobacter pylori associated with peptic ulcer in Japan. J Clin Microbiol 2005;43(8):3906e16. [10] Fischer W. Assembly and molecular mode of action of the Helicobacter pylori Cag type IV secretion apparatus. FEBS J 2011;278(8):1203e12. [11] Hussein NR, Argent RH, Marx CK, Patel SR, Robinson K, Atherton JC. Helicobacter pylori dupA is polymorphic, and its active form induces proinflammatory cytokine secretion by mononuclear cells. J Infect Dis 2010;202(2):261e9. [12] Hussein NR. The association of dupA and Helicobacter pylori-related gastroduodenal diseases. Eur J Clin Microbiol Infect Dis 2010;29(7):817e21. [13] Yamaoka Y. Roles of the plasticity regions of Helicobacter pylori in gastroduodenal pathogenesis. J Med Microbiol 2008;57(Pt 5):545e53. [14] Fischer W, Windhager L, Rohrer S, Zeiller M, Karnholz A, Hoffmann R, et al. Strain-specific genes of Helicobacter pylori: genome evolution driven by a novel type IV secretion system and genomic island transfer. Nucleic Acids Res 2010;38(18):6089e101. [15] Gao XZ, Chu YL, Qiao XL, Wang XF, Liu F, Liu J. Narrow band imaging endoscopy for diagnosis of malignant and premalignant gastric lesions. Chin J Digestion 2009;29(5):289e92. [16] Azuma T, Yamakawa A, Yamazaki S, Ohtani M, Ito Y, Muramatsu A, et al. Distinct diversity of the cag pathogenicity island among Helicobacter pylori strains in Japan. J Clin Microbiol 2004;42(6):2508e17. [17] Queiroz DM, Moura SB, Rocha AM. The genotype of the Brazilian dupA-positive Helicobacter pylori strains is dupA1. J Infect Dis 2011;203(7):1033e4. [18] Wang MY, Lin J, Sun SB, Yuan XY. Identification of Granulicatella elegans from a case of infective endocarditis, based on the phenotypic characteristics and 16SrRNA gene sequence. J Cardiovasc Med (Hagerstown) 2012. [Epub ahead of print]. [19] Zhou J, Zhang J, Xu C, He L. cagA genotype and variants in Chinese Helicobacter pylori strains and relationship to gastroduodenal diseases. J Med Microbiol 2004;53(Pt 3):231e5. [20] Zhang Y, Argent RH, Letley DP, Thomas RJ, Atherton JC. Tyrosine phosphorylation of CagA from Chinese Helicobacter pylori isolates in AGS gastric epithelial cells. J Clin Microbiol 2005;43(2):786e90. [21] Schmidt HM, Andres S, Nilsson C, Kovach Z, Kaakoush NO, Engstrand L, et al. The cagPAI is intact and functional but HP0521 varies significantly in Helicobacter pylori isolates from Malaysia and Singapore. Eur J Clin Microbiol Infect Dis 2010;29(4):439e51. [22] Kauser F, Hussain MA, Ahmed I, Ahmad N, Habeeb A, Khan AA, et al. Comparing genomes of Helicobacter pylori strains from the high-altitude desert of Ladakh, India. J Clin Microbiol 2005;43(4):1538e45. [23] Yakoob J, Abid S, Abbas Z, Jafri W, Ahmad Z, Ahmed R, et al. Distribution of Helicobacter pylori virulence markers in patients with gastroduodenal diseases in Pakistan. BMC Gastroenterol 2009;9:87. [24] Tan HJ, Rizal AM, Rosmadi MY, Goh KL. Distribution of Helicobacter pylori cagA, cagE and vacA in different ethnic groups in Kuala Lumpur Malaysia. J Gastroenterol Hepatol 2005;20(4):589e94. [25] Lu H, Hsu PI, Graham DY, Yamaoka Y. Duodenal ulcer promoting gene of Helicobacter pylori. Gastroenterology 2005;128(4):833e48. [26] Yamaoka Y, Kodama T, Kashima K, Graham DY, Sepulveda AR. Variants of the 3’ region of the cagA gene in Helicobacter pylori isolates from patients with different H. pylori-associated diseases. J Clin Microbiol 1998;36(8):2258e63. [27] Falush D, Wirth T, Linz B, Pritchard JK, Stephens M, Kidd M, et al. Traces of human migrations in Helicobacter pylori populations. Science 2003;299(5612):1582e5. [28] Chen XJ, Yan J, Shen YF. Dominant cagA/vacA genotypes and coinfection frequency of H. pylori in peptic ulcer or chronic gastritis patients in Zhejiang Province and correlations among different genotypes, coinfection and severity of the diseases. Chin Med J (Engl) 2005;118(6):460e7. [29] Higashi H, Tsutsumi R, Fujita A, Yamazaki S, Asaka M, Azuma T, et al. Biological activity of the Helicobacter pylori virulence factor CagA is determined by variation in the tyrosine phosphorylation sites. Proc Natl Acad Sci U S A 2002;99(22):14428e33. [30] Kauser F, Khan AA, Hussain MA, Carroll IM, Ahmad N, Tiwari S, et al. The cag pathogenicity island of Helicobacter pylori is disrupted in the majority of patient isolates from different human populations. J Clin Microbiol 2004;42(11): 5302e8.
18
M.-y. Wang et al. / Microbial Pathogenesis 59-60 (2013) 13e18
[31] Ikenoue T, Maeda S, Ogura K, Akanuma M, Mitsuno Y, Imai Y, et al. Determination of Helicobacter pylori virulence by simple gene analysis of the cag pathogenicity island. Clin Diagn Lab Immunol 2001;8(1):181e6. [32] Wang H, Han J, Chen D, Duan X, Gao X, Wang X, et al. Characterization of CagI in the cag pathogenicity island of Helicobacter pylori. Curr Microbiol 2012;64(2):191e6. [33] Kwok T, Zabler D, Urman S, Rohde M, Hartig R, Wessler S, et al. Helicobacter exploits integrin for type IV secretion and kinase activation. Nature 2007;449(7164):862e6. [34] Zhang Z, Zheng Q, Chen X, Xiao S, Liu W, Lu H. The Helicobacter pylori duodenal ulcer promoting gene, dupA in China. BMC Gastroenterol 2008;8:49.
[35] Nguyen LT, Uchida T, Tsukamoto Y, Kuroda A, Okimoto T, Kodama M, et al. Helicobacter pylori dupA gene is not associated with clinical outcomes in the Japanese population. Clin Microbiol Infect 2010;16(8): 1264e9. [36] Gomes LI, Rocha GA, Rocha AM, Soares TF, Oliveira CA, Bittencourt PF, et al. Lack of association between Helicobacter pylori infection with dupApositive strains and gastroduodenal diseases in Brazilian patients. Int J Med Microbiol 2008;298(3e4):223e30. [37] Takahashi A, Shiota S, Matsunari O, Watada M, Suzuki R, Nakachi S, et al. Intact long-type dupA as a marker for gastroduodenal diseases in Okinawan subpopulation, Japan. Helicobacter 2013;18(1):66e72.