Distribution of small native plasmids in Streptococcus pyogenes in India

ARTICLE IN PRESS

G Model IJMM-50786; No. of Pages 9

International Journal of Medical Microbiology xxx (2014) xxx–xxx

Contents lists available at ScienceDirect

International Journal of Medical Microbiology journal homepage: www.elsevier.com/locate/ijmm

Distribution of small native plasmids in Streptococcus pyogenes in India René Bergmann, Andreas Nerlich, Gursharan S. Chhatwal, D. Patric Nitsche-Schmitz ∗ Department of Medical Microbiology, Helmholtz Centre for Infection Research, D-38124 Braunschweig, Germany

a r t i c l e

i n f o

Article history: Received 14 May 2013 Received in revised form 22 October 2013 Accepted 8 December 2013 Available online xxx Keywords: Streptococcus pyogenes Natural plasmids Bacteriocin

a b s t r a c t Complete characterization of a Streptococcus pyogenes population from a defined geographic region comprises information on the plasmids that circulate in these bacteria. Therefore, we determined the distribution of small plasmids (<5 kb) in a collection of 279 S. pyogenes isolates from India, where diversity of strains and incidence rates of S. pyogenes infections are high. The collection comprised 77 emm-types. For plasmid detection and discrimination, we developed PCRs for different plasmid replication initiation protein genes, the putative repressor gene copG and bacteriocin genes dysA and scnM57. Plasmid distribution was limited to 13 emm-types. Co-detection analysis using aforementioned PCRs revealed four distinct plasmid sub-types, two of which were previously unknown. Representative plasmids pA852 and pA996 of the two uncharacterized plasmid sub-types were sequenced. These two plasmids could be assigned to the pMV158 and the pC194/pUB110 family of rolling-circle plasmids, respectively. The majority of small plasmids found in India belonged to the two newly characterized sub-types, with pA852- and pA996-like plasmids amounting to 42% and 22% of all detected plasmids, respectively. None of the detected plasmids coded for a known antibiotic resistance gene. Instead, all of the four plasmid sub-types carried known or potential bacteriocin genes. These genes may have influence on the evolutionary success of certain S. pyogenes genotypes. Notably, pA852-like plasmids were found in all isolates of the most prevalent emmtype 11.0. Together, a priori fitness of this genotype and increased fitness due to the acquired plasmids may have rendered type emm11.0 successful and caused the prevalence of pA852-like plasmids in India. © 2013 Elsevier GmbH. All rights reserved.

Introduction The wide variety of infectious diseases that are caused by Streptococcus pyogenes ranges from uncomplicated superficial infections to severe invasive infections. Incidence rates of these infections and the mortality of invasive cases remain very high (Ralph and Carapetis, 2013). Moreover, S. pyogenes is a cause of severe immune sequelae (Chhatwal and Graham, 2008; Nitsche-Schmitz and Chhatwal, 2013). High rates of lateral gene transfer occur in S. pyogenes. This is thought to be caused by the abundance of prophages and integrated conjugative elements in this species (Banks et al., 2002; Beres and Musser, 2007). The intraspecies horizontal exchange of these genetic elements is involved in the spread of virulence factors and antibiotic resistance, influencing the fitness of a strain. Interspecies horizontal gene transfer between S. pyogenes and related streptococcal species, such as Streptococcus agalactiae and both subspecies of Streptococcus dysgalactiae has also been reported (Beres and Musser, 2007; Davies et al., 2007a, 2007b, 2009; Franken et al.,

∗ Corresponding author at: Helmholtz Centre for Infection Research, Inhoffenstraße 7, D-38124 Braunschweig, Germany. Tel.: +49 531 6181 4504; fax: +49 531 6181 4499. E-mail address: [email protected] (D.P. Nitsche-Schmitz).

2001; Rato et al., 2011; Stalhammar-Carlemalm et al., 1999). Plasmids are a further vector for the transmission of bacterial fitness factors such as antibiotic resistance genes and bacteriocins between streptococci. During the 1970s and 1980s several S. pyogenes plasmids were discovered that conferred erythromycin resistance to the bacteria (Table 1). To date, four natural plasmids of S. pyogenes have been completely sequenced and described (Table 1). Among them is the large, well characterized plasmid pSM19035 (GenBank: AY357120.1). This 28.9 kb plasmid encodes the ermA and ermB-genes that confer resistance to erythromycin to its host strain. The other three plasmids, pRW35 (Woodbury et al., 2008), pDN571 (Heng et al., 2004) and pDN281 (GenBank: AY995189.1) are less than 5 kb in size. Of these three small plasmids, pRW35 encodes the erythromycin resistance gene ermT. Plasmids pDN571 and pDN281 carry the bacteriocin genes scnM57 or dysA, respectively. The scnM57-gene encodes streptococcin A-M57; a bacteriocin that has no bactericidal activity against S. pyogenes strains but against other Gram-positive bacteria (Heng et al., 2004). This suggests that scnM57 has a role in streptococcal competition against other bacterial species. Dysgalacticin, which is encoded by dysA, kills S. pyogenes itself in a ‘non-lytic’ manner (Heng et al., 2006), suggesting that mode of action and function differ principally from streptococcin A-M57. Plasmid-encoded fitness factors may contribute in shaping the population structure of bacteria in endemic regions. They may

1438-4221/$ – see front matter © 2013 Elsevier GmbH. All rights reserved. http://dx.doi.org/10.1016/j.ijmm.2013.12.001

Please cite this article in press as: Bergmann, R., et al., Distribution of small native plasmids in Streptococcus pyogenes in India. Int. J. Med. Microbiol. (2014), http://dx.doi.org/10.1016/j.ijmm.2013.12.001

Plasmid sub-type

Plasmid family

Factor

rep gene

Nucleotide sequence

Size kbp

pA15

pA15

–

pA15-like (pA768) pSM19035

pSM19035

–

ermA, ermB

repS

Partially

∼19

ermA, ermB

repS

No

∼16

ermA, ermB

repS

Yes

28.98

emm type

Reference

19 different emm types –

Liu et al. (2007)

18

–

GenBank: AY357120 (Ceglowski and Alonso, 1994) Malke (1974)

Mol wt (×106 ) – –

No

–

18

–

– –

erm erm

– –

No No

– –

19 17

– emm22

pSM15346 pSM10419

pSM15346 pSM10419

– –

erm erm

– –

No No

– –

19 15

– –

pRW35

pRW35

–

ermT

rep2

Yes

4.96

ermT

rep2

Yes

4.96

dysA

repB

Yes

3.04

dysA

repB

No

pGA2000

pDN281

pDN281

pMV158

pDN281-like

Malke (1974) Clewell and Franke (1974) Malke (1974) Malke et al. (1981)

–

emm92 emm3 emm9 emm28 –

GenBank: EU192194 (Woodbury et al., 2008) GenBank: JF308631.1 (DiPersio et al., 2011)

–

–

–

emm60 emm82 emm111 st11014

GenBank: AY995189 This study

pA852

pA852 pA852-like

pMV158

pA852 ORF3 pA852 ORF3

repB repB

Yes No

2.64

– –

emm11 emm11 emm63 emm53 emm68

This study This study

pDN571

pDN571

pC194/pUB110

scnM57

repA

Yes

3.35

–

emm57

scnM57

repA

No

–

emm69 emm85

GenBank: AY648561.1 (Heng et al., 2004) This study

pA996 ORF5 pA996 ORF5

repA repA

Yes No

– –

emm44 emm22 emm44 emm63 emm92

pDN571-like pA996

pA996 pA996-like

pC194/pUB110

3.62

This study This study

ARTICLE IN PRESS

–

ERL1 pAC1

pSM22095

Liu et al. (2007)

R. Bergmann et al. / International Journal of Medical Microbiology xxx (2014) xxx–xxx

ermA, ermB

ERL1 pAC1 (pDC10535)

G Model

Prototype plasmid

IJMM-50786; No. of Pages 9

2

Please cite this article in press as: Bergmann, R., et al., Distribution of small native plasmids in Streptococcus pyogenes in India. Int. J. Med. Microbiol. (2014), http://dx.doi.org/10.1016/j.ijmm.2013.12.001

Table 1 Overview of known and newly identified S. pyogenes plasmids.

G Model IJMM-50786; No. of Pages 9

ARTICLE IN PRESS R. Bergmann et al. / International Journal of Medical Microbiology xxx (2014) xxx–xxx

influence emergence and decline of strains with particular clinical relevance. We therefore sought to determine the distribution of S. pyogenes plasmids in India, where incidence rates of S. pyogenes infections are high and where other emm-types are prevalent as compared to Europe and North America (Steer et al., 2009). The presented study is focused on small S. pyogenes plasmids (<5 kb). We determined prevalent small plasmids in India and their association with certain emm-types. The results could lead to a better understanding of the plasmids’ influences on streptococcal ecology and their role in human infections. Materials and methods Bacterial strains S. pyogenes isolates were obtained from school surveys (n = 235) and from clinical cases of human infections (n = 44) from the Postgraduate Institute of Medical Education and Research, Chandigarh (Northern India) and the Christian Medical College, Vellore (Southern India) (Haggar et al., 2012; Sagar et al., 2012). S. pyogenes were grown in Todd Hewitt medium supplemented with 0.5% yeast extract (THY) at 37 ◦ C without shaking. Genomic DNA extraction Total DNA was isolated with the Qiagen DNeasy Kit (Qiagen, Hilden, Germany) after mechanical disruption with zirconia beads. In detail, the bacterial pellet from 10 ml overnight culture was re-suspended in 180 ␮l TE buffer and 20 ␮l DNase-free RNase (10 ␮g/ml; AppliChem). The suspension was transferred to 250 ␮l suspension of zirconia beads in a screw cap tube. Bacteria were disrupted with a FastPrep (MPI) device at a speed of 4 m/s for 40 s. The clear lysate was separated from the sedimented beads, transferred to a new 1.5 ml tube and mixed with 200 ␮l Buffer AL. The following steps for extraction of total DNA were carried out according to the manufactures recommendations. emm typing of S. pyogenes isolates The highly variable 5 -terminal nucleotide sequence of the emm gene allows genotyping of S. pyogenes strains. Certain associations between distinct emm-types and diseases (Bisno, 1991; Colman et al., 1993; Cunningham, 2000; Li et al., 2003) as well as an emmtype dependent distribution of virulence factors (McMillan et al., 2007) have been reported. The emm-gene codes for the M protein, which is a major adhesin, invasin, inducer of inflammation and antiphagocytic factor of S. pyogenes (for references see: Bisno et al., 2003; Fischetti, 1989; Nitsche-Schmitz et al., 2007; Oehmcke et al., 2010; Smeesters et al., 2010b). The emm-type was determined as described on the webpage of the Centers for Disease Control and Prevention (CDC). PCR products were purified with the QIAquick PCR Purification Kit (Qiagen, Hilden, Germany) and sequencing was done with an ABI3730xl DNA Analyzer (Life Technologies, Carlsbad, CA). The emm-type was assigned by BLAST comparison with the emmgenes of the CDC database (http://www.cdc.gov/ncidod/biotech/ strep/M-ProteinGene typing.htm).

3

(Sigma, Germany). After incubation for 10 min at 37 ◦ C the manufactures protocol was followed. In some cases, gel purification of the plasmid was necessary due to high amounts of high molecular chromosomal DNA. Purification was carried out with the QIAquick Gel Extraction Kit (Qiagen, Hilden, Germany). Analysis of plasmids by restriction enzyme digestion or computational restriction analysis Restriction enzymes HindIII, XbaI, XhoI and EcoRV from New England Biolabs were used. Restriction digestion was performed according to the manufactures recommendations. Digests were analyzed by agarose gel electrophoresis and visualized using a Kodak Image Station 2000 (Carestream Health, Hannover, Germany). Computational restriction analysis was conducted using NEB cutter (Vincze et al., 2003). Development of specific PCRs for plasmid detection and discrimination For further differentiation and characterization of the detected plasmids, we developed PCR tests that were specific for rep-genes of previously described streptococcal plasmids (Table 2). Primer pairs rep01 and pRW35 rep were designed based on the repA-gene of S. pyogenes plasmid pDN571 (Heng et al., 2004) and the rep2-gene of S. pyogenes plasmid pRW35 (Woodbury et al., 2008), respectively. Primer pair rep02 was designed based on the repB-genes of S. pyogenes plasmid pDN281 (GenBank: AY995189.1), Streptococcus dysgalactiae subsp. equisimils plasmids pW2580 (Heng et al., 2006) and pSdyT132 (GenBank: DQ173493.1). Plasmids with restriction pattern 1 were negative for the above mentioned rep-genes of the human pathogenic species S. pyogenes and S. dysgalactiae subsp. equisimilis but positive in PCR with primer pair rep03, which were designed based on the rep-genes of Streptococcus thermophilus plasmids pSMQ172 (Turgeon and Moineau, 2001), pER13 (GenBank: AY033392.1) and plasmid pSSU1 from Streptococcus suis (Takamatsu et al., 2000). Using these primers, two products with sizes of 300 bp and 500 bp were amplified. Sequencing the PCR products of A852 identified the 300 bp fragment as a part of a rep-gene homologue with similarity to repB of plasmid pDN281. The 500 bp fragment was of chromosomal origin and therefore not considered any further. Instead of primer pair rep03, the optimized primer pA852 fwd and pA852 rev were chosen to specifically amplify the tandem of characteristic plasmid elements copG and repB homologue of plasmid pA852. PCR screening for plasmids PCR screening was performed using 0.2 ␮M of suitable primers (Table 2), 0.2 mM of each dNTP, 1× CoralLoad PCR Buffer, 1.5 mM MgCl2 , and 0.04 units of Taq DNA polymerase (QIAGEN, Hilden, Germany) in a reaction volume of 25 ␮l. The amplification conditions were: denaturation at 94 ◦ C for 4 min, 25 cycles of denaturation at 94 ◦ C for 1 min, annealing at gene-specific temperatures (see Table 2) for 30 s, and an extension phase at 72 ◦ C for 1 min per kb of gene length. The cycle reaction was followed by a further extension phase at 72 ◦ C for 5 min. PCR products were analyzed by agarose gel electrophoresis as described above.

Isolation of streptococcal plasmids

Amplification of plasmids

For isolation of streptococcal plasmids the Qiagen Plasmid Kit (Qiagen, Hilden, Germany) was used with one modification of the manufactures protocol. Bacterial pellet from 10 ml overnight culture was re-suspended in 250 ␮l P1 buffer supplemented with 20 mg/ml lysozyme (Sigma, Germany) and 100 units mutanolysin

Plasmids were amplified using the long PCR enzyme mix (Fermentas). All reactions contained 0.2 ␮M of suitable primers (Table 2), 0.2 mM of each dNTP, 1× Long PCR Buffer with 1.5 mM MgCl2 , additional 2.5 mM MgCl2 , and 1.5 units of the long PCR DNA polymerase mix in a reaction volume of 50 ␮l. The amplification

Please cite this article in press as: Bergmann, R., et al., Distribution of small native plasmids in Streptococcus pyogenes in India. Int. J. Med. Microbiol. (2014), http://dx.doi.org/10.1016/j.ijmm.2013.12.001

G Model IJMM-50786; No. of Pages 9

ARTICLE IN PRESS R. Bergmann et al. / International Journal of Medical Microbiology xxx (2014) xxx–xxx

4 Table 2 Oligonucleotides used in this study. Primer pairs

Sequence 5 –3

Description/specificity

Annealing temperature (◦ C)

Expected amplicon size (bp)

rep01 fwd rep01 rev

TGATTGAACGTGTTCAATCATGTG GTGTTACTTCAACAGAACGAAGATA

repA of S. pyogenes pDN571

55

344

rep02 fwd rep02 rev

TCCAGAATCAATCCCGAACGATT CTTACCAGCAATCACCTCGTTC

repB of S. pyogenes pDN281

55

517

pRW35 rep fwd pRW35 rep rev

ATGGCAAAAGAAAAATCGAGAAATTTT TCAAATATTTCCATTTTTCTCTTCCC

rep2 of S. pyogenes pRW35

52

666

rep03 fwd rep03 rev

ATGGCAAAAGAAAAAGCAAGATACTT CCCATACTTTCGCTCTTGATAAAC

rep gene of Streptococcus thermophilus pSMQ172/Streptococcus suis pSSU1

55

615/618

dysA fwd dysA rev

ATTCCAGCGATTCTACCTGCTG CTCTCTTGTTACTTCATTACTAGTA

Dysgalacticin of S. pyogenes pDN281

52

580

scnM57 fwd scnM57 rev

CATCTTTTATTACAGCCAAAGTAGT TGACCGGCAATTAATGCAGCATT

Streptococcin SA-M57 of S. pyogenes pDN571

52

420

pRW35 ermT fwd pRW35 ermT rev

ATGAACAAAAAAAATATAAAAGATAGTC TTATCTATTAAATAATTTATAGCTATTGA

ermT of S. pyogenes pRW35

55

735

pA852 ORF3 fwd pA852 ORF3 rev

TAGCAACCTCTTTAATTGCTATATC TCACCAACCACAACTTGCTAAAG

Screening of plasmids; specific for pA852 ORF3

52

280

pA996 ORF5 fwd pA996 ORF5 rev

GGGGGATCCAACGAAGTTTTGCAACCAGAAACA GGGGTCGACTTAAATTAGCCATGAAGCTACAGTTA

Screening of plasmids; specific for pA996 ORF5

55

437

rep01B fwd rep01 rev

TATATTACTCAAAAAGAGTGGGGT GTGTTACTTCAACAGAACGAAGATA

Amplification of plasmid pA996

55

3539

pA852 fwd pA852 rev

AGAGCCTCAAGCGTTTGAGGG TGATAAGCTTTATATCAGCCTTATC

Screening of plasmids, specific for copG-repB of S. pyogenes pA852

55

719

pA852 amplify fwd pA852 amplify rev

ATCCAGAATCAATTCCGAATGATTG AGTATCTTGCTTTTTCTTTTGCCATA

Amplification of plasmid pA852

55

2628

conditions were: denaturation at 94 ◦ C for 4 min, 23 cycles of denaturation at 94 ◦ C for 1 min, annealing at gene-specific temperatures (see Table 2) for 30 s, and extension at 68 ◦ C for 5 min. The cycle reaction was followed by a further extension at 68 ◦ C for 10 min. The PCR products were separated in agarose gels and visualized as described above. Sequencing of plasmids Cycle sequencing was performed using ABI PRISM BigDye Terminator v 3.1. Ready Reaction Cycle Sequencing Kit (Applied Biosystems) and analyzed in a ABI 3730XL capillary sequencers. Data were assembled and edited using the GAP4 program (Staden, 1996). Nucleotide sequence accession numbers The nucleotide sequence data reported here have been deposited in GenBank nucleotide sequence database under the accession numbers KC895877 (plasmid pA996) and KC895878 (plasmid pA852). Results Detection and restriction analysis of extra-chromosomal DNA from S. pyogenes To investigate the presence, character and distribution of extrachromosomal DNA in S. pyogenes isolates from India, total DNA of the stains (n = 279) was isolated and analyzed by agarose gel electrophoresis. Preparations of isolates of types emm11.0, emm44.0, emm53.0, emm22.8, emm82.1 and emm85.0 showed in addition to high molecular mass genomic DNA, distinct bands with sizes that ranged from 1900 to 2600 bp. These bands were indicative

for extra-chromosomal DNA, which then was isolated from seven S. pyogenes strains by a plasmid purification method. By restriction analysis using endonucleases HindIII, XbaI, XhoI and EcoRV the seven purified nucleic acids could be separated into four groups with distinct restriction pattern (Table 3). Co-detection of plasmid-specific sequences and computational restriction analysis of plasmids To investigate the nature of the above described extrachromosomal DNA, we developed PCR tests that were specific for rep-genes and additional markers of previously characterized streptococcal plasmids (Table 2). The plasmid associated resistance gene ermT and the plasmidencoded bacteriocins dysgalacticin (dysA) and streptococcin A-M57 (scnM57) occur in the following combinations with rep-genes on already known S. pyogenes plasmids: repA/scnM57 on plasmid pDN571 (Heng et al., 2004), repB/dysA on plasmid pDN281 (GenBank: AY995189) and rep2/ermT on plasmid pRW35 (Woodbury et al., 2008) (Table 1). A co-detection analysis of these plasmidencoded genes by PCR was carried out for further characterization of the plasmids that were found in India (Table 3). Co-detections repA/scnM57 and repB/dysA, respectively classified the plasmid of isolate A1089 as pDN571-like and the plasmid of isolate A1034 as pDN281-like. Plasmids with restriction pattern 1, namely, pA852, pA1022 and pA1065, were positive only for a newly discovered repB-homologue that is described below. Plasmids that produced restriction pattern 2 comprised the repA positive plasmids pA996 and pA1029. None of the genes scnM57, dysA or ermT that are present in the known S. pyogenes plasmids was detected, neither in plasmids with restriction pattern 1 nor with pattern 2. This indicated that the plasmids with restriction pattern 1 or 2 were not yet characterized. Therefore, plasmids pA852 and pA996 were chosen for DNA sequencing as representatives of their groups.

Please cite this article in press as: Bergmann, R., et al., Distribution of small native plasmids in Streptococcus pyogenes in India. Int. J. Med. Microbiol. (2014), http://dx.doi.org/10.1016/j.ijmm.2013.12.001

ARTICLE IN PRESS

G Model IJMM-50786; No. of Pages 9

R. Bergmann et al. / International Journal of Medical Microbiology xxx (2014) xxx–xxx

5

Table 3 Restriction and co-detection analysis of extra chromosomal DNA from S. pyogenes. Isolate

emm type

Restriction pattern

HindIIIa

XbaIa

XhoIa

EcoRVa

Co-detection

Plasmid sub-type

A852 A1065 A1022 A996 A1029 A1034 A1089

11.0 11.0 53.0 44.0 22.8 82.1 85.0

Pattern 1 Pattern 1 Pattern 1 Pattern 2 Pattern 2 Pattern 3 Pattern 4

350/500/1900 300/450/1900 300/500/1900 350/850/2500 800/2500 3000 3000

2600 2700 2600 – – 3000 3200

– – – – – 3200 3200

2600 2600 2600 1100/2600 1000/2600 – –

repBb /pA852 ORF3

pA852-like

repA/pA996 ORF5

pA996-like

repBb /dysA repA/scnM57

pDN281-like pDN571-like

“–”, no recognition site for the endonuclease. a Values indicate the length of the fragments in bp observed after endonuclease treatment and agarose gel electrophoresis. b Homologue genes. Table 4 Comparison of known and newly sequenced plasmids by computational restriction analysis and co-detections of genes. Plasmid

Size of extra chromosomal DNA (linear)

Calculated restriction pattern

HindIIIa

XbaIa

XhoIa

EcoRVa

Co-detection

pA852 pA996 pDN571 pDN281 pRW35 pGA2000

2644 bp 3620 bp 3351 bp 3041 bp 4962 bp 4967 bp

Pattern 1 Pattern 2 Pattern 5 Pattern 6 Pattern 7 Pattern 7

428/288/1928 20/329/824/2447b 20/451/2900 3041 – –

2644 – 3351 3041 4962 4967

– – 3351 – – –

2644 1046/2574 – – – –

repBc /pA852 ORF3 repA/pA996 ORF5 repA/scnM57 repBc /dysA rep2/ermT rep2/ermT

“–”, no recognition site for the endonuclease. a Values indicate the length of the fragments in bp obtained by computational restriction analysis with the given endonucleases. b The difference in the number of restriction fragments obtained by experimental restriction analysis and computational restriction analysis is due to a predicted 20 bp fragment that was not visible in agarose gel electrophoresis analysis. c Homologue genes.

In the co-detection analysis, plasmids from India with restriction pattern 3 or 4 showed characteristics of plasmids pDN571 and pDN281, respectively. However, the determined restriction patterns of the Indian isolates differed from the computational restriction patterns of the prototype plasmids (Table 4). Hence, plasmids of restriction patterns 3 and 4 that circulate in India will be considered as newly discovered pDN571- and pDN281-like variants of the known prototype plasmids, respectively. Nucleotide sequence analysis of plasmid pA852 Plasmid pA852 (GenBank KC895878), which was isolated from the type emm11.0 strain A852, had a size of 2644 bp with a GC content of 43.5%. Three open reading frames were predicted to encode for polypeptides of more than 40 amino acids length (Fig. 1). Homology searches identified four genetic elements, associated with plasmid replication. (I) Open reading frame (ORF) pA852 ORF1 (nucleotides 2448–2585) encodes a putative 5 kDa transcriptional repressor protein (45 amino acids). Its homologue CopG encoded by plasmid pMV158 from S. agalactiae (91% amino acid sequence identity) was shown to control the copy number of the plasmid during bacterial proliferation (del Solar et al., 1990). (II) The predicted coding sequence pA852 ORF2 (nucleotides 1–633) encodes a homologue of replication initiation protein B (210 amino acids) with 92% amino acid sequence identity to the RepB protein of the aforementioned plasmid pMV158 from S. agalactiae (van der Lelie et al., 1989). (III) The newly sequenced plasmid pA852 was further predicted to carry a double-strand origin of replication (dso, nucleotides 2213–2310) with a nick sequence (5 -TACTACG/A-3 ) that is conserved in all plasmids of the pMV158 family except of pKMK1 (del Solar et al., 1993). Such nic regions form stem-loop structures on supercoiled DNA, as shown for pLS1, a derivative from pMV158 (del Solar et al., 1987). Likewise, using the program Mfold (Zuker, 2003), the conserved nick sequence in the dso of pA852 is predicted to remain unpaired, forming a

loop on top of a hairpin structure. A bind region is located 83 nucleotides downstream from the nic region of pA852. It contains three directly repeated iterons: two identical copies of the sequence 5 -TCGGCGACTTT-3 and one copy of the highly similar sequence 5 -TTAGCGACTTT-3 (differing nucleotides are underlined). The first two iterons are identical to the three directly repeated iterons in plasmid pLS1, in which they serve as the binding site of the Rep protein (de la Campa et al., 1990). (IV) The putative single-strand origin of replication (sso; nucleotides 1716–1889) of pA852 contains a highly conserved 14 bp sequence, termed recombination site B (RSB 5 -TTTATGCCGTGAAA-3 ), characterizing it as ssoA-type

Fig. 1. Circular map of plasmid pA852. The 5 -end of repB (replication initiation protein gene) was chosen as position 1 of the plasmid sequence. The three predicted ORFs and their transcriptional orientations are shown as black arrows. This includes the copy control protein gene copG: The double-strand origin of replication (DSO) and the single-strand origin of replication (SSO) are depicted as gray boxes. Examined restriction endonuclease sites are indicated.

Please cite this article in press as: Bergmann, R., et al., Distribution of small native plasmids in Streptococcus pyogenes in India. Int. J. Med. Microbiol. (2014), http://dx.doi.org/10.1016/j.ijmm.2013.12.001

G Model IJMM-50786; No. of Pages 9 6

ARTICLE IN PRESS R. Bergmann et al. / International Journal of Medical Microbiology xxx (2014) xxx–xxx

Fig. 2. Circular map of plasmid pA996. The 5 -end of repA (replication initiation protein gene) was chosen as position 1 of the plasmid sequence. The five ORFs and their transcriptional orientations are shown as black arrows. The double-strand origin of replication (DSO) and the single-strand origin of replication (SSO) are depicted as gray boxes. Examined restriction endonuclease sites are indicated.

origin of replication. It was shown that streptococcal RNA polymerase interacts with the ssoA of pMV158 to initiate lagging-strand synthesis (Khan, 2005; Kramer et al., 1998). In summary, all identified components of the replication machinery of pA852 were homologous to those of the prototype plasmid pMV158, classifying pA852 as a member of the pMV158 rolling-circle plasmid family. Plasmid pA852 bore the uncharacterized ORF pA852 ORF3 (complementary strand, nucleotides 1208–900). This ORF is predicted to encode a protein with signal peptide sequence (amino acids 1–30) (Bendtsen et al., 2004), indicating the export by a Sec-dependent transport system to yield a 7.4 kDa mature extracellular protein after processing by signal peptidase. The sequence of the hypothetical protein did not show sufficient homology to other known proteins, which would allow functional predictions. Computational analysis of the amino acid sequence of the mature protein calculated 56% alpha helical structure (Geourjon and Deleage, 1995), a total net charge of +3 and a hydrophobic ratio of 41% (Wang et al., 2009; Wang and Wang, 2004), which is predictive for interaction between the protein and lipid membranes. Furthermore, the hypothetical peptide contains two cysteine residues, which are predicted to form an intrachain disulfide-bond (Ceroni et al., 2006). Such disulphides are considered as important for biological activity of a variety of antimicrobial proteins from Grampositive bacteria, e.g. class II bacteriocins (Ennahar et al., 2000). Nucleotide sequence analysis of plasmid pA996 The complete nucleotide sequence of plasmid pA996 (GenBank KC895877), which was isolated from the type emm44.0 strain A996, was determined and consisted of 3620 bp with a GC content of 31.9%. Four ORFs encoding polypeptides of more than 60 amino acids length were predicted (Fig. 2). The ORF pA996 ORF3 (nucleotides 1–942) encodes a putative protein of 313 amino acids with high similarity (80–83% identity of the amino acid sequence) to the replication initiation protein RepA of plasmid pDN571 from S. pyogenes (Heng et al., 2004) and of plasmids pER341 (Somkuti et al., 1998), LMD-9 (Makarova et al., 2006) and pCI65st (O’Sullivan et al., 1999) from Streptococcus thermophilus, all of which belong to the pC194/pUB110 family of rolling-circle plasmids. Comparing the sso

(nucleotides 2523–2620) of pA996 with the sso of the three Streptococcus thermophilus plasmids LMD-9 (Makarova et al., 2006), pER35 and pER16 (Solow and Somkuti, 2000) revealed 89% identity of the nucleotide sequence. The putative dso (nucleotides 3402–3435) bore a characteristic heptameric potential nick site 5 -CTTGATA3 . This sequence is conserved among most of the pC194/pUB110 group of plasmids (Seery et al., 1993). Translated sequences of pA996 ORF1 (nucleotides 2742–2990) and pA996 ORF2 (nucleotides 2990–3307) showed a high degree of identity (97% and 100%, respectively) to hypothetical proteins of plasmid pSdyT132 from S. dysgalactiae subsp. equisimilis (GenBank DQ173493.1). These homologies suggest that pA996 ORF1 encodes an antitoxin component of the Phd YefM superfamily proteins (Anantharaman and Aravind, 2003), while pA996 ORF2 encodes a toxin, responsible for plasmid maintenance (Roberts and Helinski, 1992). The predictions suggest that pA996 ORF1 and pA996 ORF2 encode a toxin-antitoxin system. Hypothetical proteins encoded by pA996 ORF4 (nucleotides 1005–1310) and pA996 ORF5 (nucleotides 1611–2117) showed 100% and 99% identity to the amino acid sequences of the uncharacterized hypothetical proteins HMPREF9171 0299 (GenBank EFV98175.1) and HMPREF9171 0300 (GenBank EFV98176.1) of S. agalactiae ATCC 13813 (GenBank AEQQ01000020.1). Notably, the program SignalP (Bendtsen et al., 2004) predicted an N-terminal signal peptide of 29 amino acids in pA996 ORF5 indicating extracellular secretion of a 14.8 kDa protein. The sequence of the hypothetical protein did not show sufficient homology to known proteins, which would allow functional predictions. Homology search in the GenBank database revealed overall 52% identity between pA996 and contig00020 of the draft sequence of S. agalactiae ATCC 13813 (GenBank AEQQ01000020.1). The nature of this DNA segment in S. agalactiae contig00020 remains unclear. However, annotated ORFs of contig00020 were more than 95% identical to the herein described ORFs of pA996 (Fig. 3). A part of them is homologous to genes of the replication machinery of rolling-circle plasmids. Recently, DiPersio et al. (2011) identified plasmids in S. pyogenes and S. agalactiae that contained ermT and that were almost identical to one another. This indicates direct or indirect interspecies horizontal transfer of plasmids between these streptococcal species of the pyogenic group. Distribution of S. pyogenes plasmids To investigate the distribution of the previously described and newly discovered S. pyogenes plasmids in a defined geographic region, the collection of 279 isolates from India was analyzed for the presence of the above mentioned rep-genes and their co-detection with dysA, scnM57, ermT, pA852 ORF3 or pA996 ORF5. A total of 21.1% (n = 59) of the isolates tested positive for the presence of a plasmid that harbored either repA, repB or a repB homologue. In detail, 7.9% (n = 22) of the isolates were positive for repA, 3.9% (n = 11) for repB and 9.3% (n = 26) gave amplification products for copG-repB. None of the 279 Indian isolates was tested positive for the rep2-gene or the antibiotic resistance gene ermT. Based upon the co-detection of the rep-genes with dysA, scnM57, pA852 ORF3 or pA996 ORF5, plasmids could be divided into four different plasmid sub-types (Fig. 4A): (I) pDN281-like and (II) pDN571-like plasmids, showing a co-detection of repB/dysA and repA/scnM57, respectively; (III) pA996-like plasmids, characterized by the co-detection of repA/pA996 ORF5 and (IV) pA852-like plasmids, showing a co-detection of copG-repB/pA852 ORF3 (Table 3, Fig. 4). There were no indications for the presence of more than one kind of plasmid in a single isolate. Plasmids were detected in 13 out of the 77 emm-types in the examined collection (supplementary Fig. S1) and associations of plasmid sub-types with certain emm-types were observed. All 19 isolates of the prevailing

Please cite this article in press as: Bergmann, R., et al., Distribution of small native plasmids in Streptococcus pyogenes in India. Int. J. Med. Microbiol. (2014), http://dx.doi.org/10.1016/j.ijmm.2013.12.001

G Model IJMM-50786; No. of Pages 9

ARTICLE IN PRESS R. Bergmann et al. / International Journal of Medical Microbiology xxx (2014) xxx–xxx

7

Fig. 3. Linear maps of S. pyogenes plasmid pA996 and S. agalactiae ATCC13813 contig00020. Sequence alignment revealed overall 52% nucleotide identity between pA996 and contig00020 of the draft sequence of S. agalactiae ATCC 13813 (GenBank AEQQ01000020.1). The herein described ORFs of S. pyogenes plasmid pA996 had more than 95% identity to the annotated ORFs of the S. agalactiae contig (light gray arrows). Thus, the S. agalactiae contig contains sequences of a rolling-circle plasmid, homologous to pA996 of S. pyogenes. The ORFs HMPREF9171 0304 to HMPREF9171 0307 (black arrows) of the S. agalactiae contig are not present in pA996. They are annotated as follows: HMPREF9171 0304, copG, copy control protein; HMPREF9171 0305, repB, replication initiation protein; HMPREF9171 0306, replication protein and HMPREF9171 0307 putative exported protein.

emm-type 11.0 contained pA852-like plasmids. Plasmids of this sub-type were also found in types emm53.0, emm63.0 and emm68.0 (Fig. 4A). Within the emm-types 82.1, 85.0, 53.0 and st11014.0 not all the isolates harbored a plasmid (Fig. 4A). All isolates of emm-type 63.0 contained a plasmid. Notably, this was the only emm-type in which two different plasmid sub-types, pA852-like and pA996-like plasmids were found. Besides emm63.0 isolates, streptococci of types emm22.8, emm44.0 and emm92.0 possessed pA996-like plasmids. The two newly characterized pA852-like and pA996-like plasmids were the most prevalent sub-types and

Fig. 4. Distribution of four different plasmid sub-types in S. pyogenes. The examined collection of Indian strains consisted of 279 strains of 77 distinct emm-types. The co-detection of different rep-genes with dysA, scnM57, pA852 ORF3 or pA996 ORF5 divided streptococcal plasmids into four different plasmid sub-types. (A) Shows the 13 emm-types in which plasmids were found (x-axis). With respect to the emm-type the diagram indicates the number (left y-axis) and the percentage (right y-axis) of isolates in the collection that were positive for a plasmid of the given sub-type. (B) Depicts the number (left y-axis) and the percentage (right y-axis) of isolates in the collection that were positive for the plasmid sub-type given on the x-axis.

found in 9.3% and 5.0% of all isolates, respectively (Fig. 4B). The pDN281-like plasmids occurred in S. pyogenes isolates of types emm60.6, emm82.1, emm111.1 and st11014.0 while detection of pDN571-like plasmids was limited to types emm69.1 and emm85.0. Supplementary material related to this article can be found, in the online version, at http://dx.doi.org/10.1016/j.ijmm. 2013.12.001. Discussion Evolution of S. pyogenes has produced clones of exceptional virulence. An example for such a clone is the invasive M1T1 clone (Cleary et al., 1992). Moreover strains with antibiotic resistance are evolving in this species. Strains with resistance to macrolides and tetracyclines have already emerged (Smeesters et al., 2010a; Willems et al., 2011). The microevolution of these human pathogens is not yet sufficiently studied to understand or to foresee developments in the population structure of S. pyogenes. Some of these factors are transmitted between S. pyogenes strains via phages, transposons or plasmids. Still, the influence of such mobile genetic elements on the dynamics of the streptococcal population structure remains widely elusive. The herein described investigation of small plasmids (<5 kb) in S. pyogenes from a confined geographic region identified two new plasmid subtypes pA852-like and pA996-like plasmids. Moreover, new variants of pDN281-like and pDN571-like sub-type were found and their association with other than the reported emm-types (Table 1). None of the four detected plasmid sub-types found in India encoded for known antibiotic resistance genes, although resistance against antimicrobials is increasing in this region. Resistance genes may have not been detected due to the limitation of our study to small plasmids. Horizontally acquirable antibiotic resistance genes could have been associated with large plasmids or other mobile genetic elements (Varaldo et al., 2009). Previous studies suggest an association between repS and large S. pyogenes plasmids like pA15 (19 kb) and pSM19035 (29 kb) (Table 1). Due to the limitation of our study to small plasmids repS was not included in our screening. In this context it is notable that large repS-positive plasmids harbor macrolide resistance genes (Table 1). As the prototype plasmids of their sub-type, pDN281-like and pDN571-like plasmids encoded for the bacteriocins dysgalacticin and streptococcin A-M57, respectively. pDN281-like plasmids are known to occur not only in S. pyogenes (GenBank NC 010230) but also in S. dysgalactiae subsp. equisimilis (Heng et al., 2006) (GenBank NC 010907). This indicates interspecies horizontal transfer of this plasmid sub-type. Furthermore, the presented data indicate a horizontal transfer of pA996-like nucleotide sequences between S. pyogenes and S. agalactiae (Fig. 3). Hence, at least two of the plasmid sub-types, pDN281-like and pA996-like plasmids that circulate in India may be suitable vectors for the inter-species exchange of fitness factors and could develop into plasmids that transfer virulence or antibiotic resistance factors within different human pathogenic streptococcal species.

Please cite this article in press as: Bergmann, R., et al., Distribution of small native plasmids in Streptococcus pyogenes in India. Int. J. Med. Microbiol. (2014), http://dx.doi.org/10.1016/j.ijmm.2013.12.001

G Model IJMM-50786; No. of Pages 9

ARTICLE IN PRESS R. Bergmann et al. / International Journal of Medical Microbiology xxx (2014) xxx–xxx

8

The newly characterized pA852-like plasmids were the most frequent plasmids in the Indian S. pyogenes collection and present in all isolates of the prevailing emm-type 11.0. The herein characterized plasmid pA852 encodes a hypothetical protein (pA853 ORF3) with structural and physicochemical similarities to antibacterial proteins. These similarities include two cysteine residues that are conserved in a variety of bacteriocins and important for their function (Ennahar et al., 2000). The potential bacteriocin in pA852-like plasmids may cause a selection advantage in streptococci of type emm11.0 in India. It remains to be studied whether high prevalence of pA852-like plasmids is a cause or a consequence of the fitness of emm11.0. Influences that led to the success of emm11.0 and pA852 may be mutual. Further experiments are needed that deliver insights into possible specificities of the plasmids’ transmission between S. pyogenes strains of different genotypes and across species. Continued investigations on the distribution of mobile genetic elements in streptococci, their horizontal transfer and its influence on the dynamics of the streptococcal population structure will improve our understanding of the evolution and rise of S. pyogenes clones with resistance to antibiotics and/or exceptional virulence. Acknowledgement This work was supported by the European Community’s Sixth Framework Programme (FP6) under contract number 032390. References Anantharaman, V., Aravind, L., 2003. New connections in the prokaryotic toxin–antitoxin network: relationship with the eukaryotic nonsense-mediated RNA decay system. Genome Biology 4, R81. Banks, D.J., Beres, S.B., Musser, J.M., 2002. The fundamental contribution of phages to GAS evolution, genome diversification and strain emergence. Trends in Microbiology 10, 515–521. Bendtsen, J.D., Nielsen, H., von Heijne, G., Brunak, S., 2004. Improved prediction of signal peptides: SignalP 3.0. Journal of Molecular Biology 340, 783–795. Beres, S.B., Musser, J.M., 2007. Contribution of exogenous genetic elements to the group A Streptococcus metagenome. PLoS One 2, e800. Bisno, A.L., 1991. Group A streptococcal infections and acute rheumatic fever. New England Journal of Medicine 325, 783–793. Bisno, A.L., Brito, M.O., Collins, C.M., 2003. Molecular basis of group A streptococcal virulence. Lancet Infectious Diseases 3, 191–200. Ceglowski, P., Alonso, J.C., 1994. Gene organization of the Streptococcus pyogenes plasmid pDB101: sequence analysis of the orf eta-copS region. Gene 145, 33–39. Ceroni, A., Passerini, A., Vullo, A., Frasconi, P., 2006. DISULFIND: a disulfide bonding state and cysteine connectivity prediction server. Nucleic Acids Research 34, W177–W181. Chhatwal, G.S., Graham, R.M., 2008. Streptococcal diseases. In: Encyclopedia of Public Health 2008. Academic Press, San Diego, pp. 231–241. Cleary, P.P., Kaplan, E.L., Handley, J.P., Wlazlo, A., Kim, M.H., Hauser, A.R., Schlievert, P.M., 1992. Clonal basis for resurgence of serious Streptococcus pyogenes disease in the 1980. Lancet 339, 518–521. Clewell, D.B., Franke, A.E., 1974. Characterization of a plasmid determining resistance to erythromycin, lincomycin, and vernamycin Balpha in a strain Streptococcus pyogenes. Antimicrobial Agents and Chemotherapy 5, 534–537. Colman, G., Tanna, A., Efstratiou, A., Gaworzewska, E.T., 1993. The serotypes of Streptococcus pyogenes present in Britain during 1980–1990 and their association with disease. Journal of Medical Microbiology 39, 165–178. Cunningham, M.W., 2000. Pathogenesis of group A streptococcal infections. Clinical Microbiology Reviews 13, 470–511. Davies, M.R., McMillan, D.J., Beiko, R.G., Barroso, V., Geffers, R., Sriprakash, K.S., Chhatwal, G.S., 2007a. Virulence profiling of Streptococcus dysgalactiae subspecies equisimilis isolated from infected humans reveals 2 distinct genetic lineages that do not segregate with their phenotypes or propensity to cause diseases. Clinical Infectious Diseases 44, 1442–1454. Davies, M.R., McMillan, D.J., Van Domselaar, G.H., Jones, M.K., Sriprakash, K.S., 2007b. Phage 3396 from a Streptococcus dysgalactiae subsp. equisimilis pathovar may have its origins in Streptococcus pyogenes. Journal of Bacteriology 189, 2646–2652. Davies, M.R., Shera, J., Van Domselaar, G.H., Sriprakash, K.S., McMillan, D.J., 2009. A novel integrative conjugative element mediates genetic transfer from group G Streptococcus to other ␤-hemolytic Streptococci. Journal of Bacteriology 191, 2257–2265. de la Campa, A.G., del Solar, G.H., Espinosa, M., 1990. Initiation of replication of plasmid pLS1. The initiator protein RepB acts on two distant DNA regions. Journal of Molecular Biology 213, 247–262.

del Solar, G.H., Puyet, A., Espinosa, M., 1987. Initiation signals for the conversion of single stranded to double stranded DNA forms in the streptococcal plasmid pLS1. Nucleic Acids Research 15, 5561–5580. del Solar, G.H., Perez-Martin, J., Espinosa, M., 1990. Plasmid pLS1-encoded RepA protein regulates transcription from repAB promoter by binding to a DNA sequence containing a 13-base pair symmetric element. Journal of Biological Chemistry 265, 12569–12575. del Solar, G., Moscoso, M., Espinosa, M., 1993. Rolling circle-replicating plasmids from Gram-positive and Gram-negative bacteria: a wall falls. Molecular Microbiology 8, 789–796. DiPersio, L.P., DiPersio, J.R., Beach, J.A., Loudon, A.M., Fuchs, A.M., 2011. Identification and characterization of plasmid-borne erm(T) macrolide resistance in group B and group A Streptococcus. Diagnostic Microbiology and Infectious Disease 71, 217–223. Ennahar, S., Sashihara, T., Sonomoto, K., Ishizaki, A., 2000. Class IIa bacteriocins: biosynthesis, structure and activity. FEMS Microbiology Reviews 24, 85–106. Fischetti, V.A., 1989. Streptococcal M protein: molecular design and biological behavior. Clinical Microbiology Reviews 2, 285–314. Franken, C., Haase, G., Brandt, C., Weber-Heynemann, J., Martin, S., Lammler, C., Podbielski, A., Lutticken, R., Spellerberg, B., 2001. Horizontal gene transfer and host specificity of beta-haemolytic streptococci: the role of a putative composite transposon containing scpB and lmb. Molecular Microbiology 41, 925–935. Geourjon, C., Deleage, G., 1995. SOPMA: significant improvements in protein secondary structure prediction by consensus prediction from multiple alignments. Computer Applications in the Biosciences: CABIOS 11, 681–684. Haggar, A., Nerlich, A., Kumar, R., Abraham, V.J., Brahmadathan, K.N., Ray, P., Dhanda, V., Joshua, J.M., Mehra, N., Bergmann, R., Chhatwal, G.S., Norrby-Teglund, A., 2012. Clinical and microbiologic characteristics of invasive Streptococcus pyogenes infections in north and south India. Journal of Clinical Microbiology 50, 1626–1631. Heng, N.C., Burtenshaw, G.A., Jack, R.W., Tagg, J.R., 2004. Sequence analysis of pDN571, a plasmid encoding novel bacteriocin production in M-type 57 Streptococcus pyogenes. Plasmid 52, 225–229. Heng, N.C., Ragland, N.L., Swe, P.M., Baird, H.J., Inglis, M.A., Tagg, J.R., Jack, R.W., 2006. Dysgalacticin: a novel plasmid-encoded antimicrobial protein (bacteriocin) produced by Streptococcus dysgalactiae subsp. equisimilis. Microbiology 152, 1991–2001. Khan, S.A., 2005. Plasmid rolling-circle replication: highlights of two decades of research. Plasmid 53, 126–136. Kramer, M.G., Espinosa, M., Misra, T.K., Khan, S.A., 1998. Lagging strand replication of rolling-circle plasmids: specific recognition of the ssoA-type origins in different Gram-positive bacteria. Proceedings of the National Academy of Sciences of the United States of America 95, 10505–10510. Li, Z., Sakota, V., Jackson, D., Franklin, A.R., Beall, B., 2003. Array of M protein gene subtypes in 1064 recent invasive group A streptococcus isolates recovered from the active bacterial core surveillance. Journal of Infectious Diseases 188, 1587–1592. Liu, Y.F., Wang, C.H., Janapatla, R.P., Fu, H.M., Wu, H.M., Wu, J.J., 2007. Presence of plasmid pA15 correlates with prevalence of constitutive MLS(B) resistance in group A streptococcal isolates at a university hospital in southern Taiwan. Journal of Antimicrobial Chemotherapy 59, 1167–1170. Makarova, K., Slesarev, A., Wolf, Y., Sorokin, A., Mirkin, B., Koonin, E., Pavlov, A., Pavlova, N., Karamychev, V., Polouchine, N., Shakhova, V., Grigoriev, I., Lou, Y., Rohksar, D., Lucas, S., Huang, K., Goodstein, D.M., Hawkins, T., Plengvidhya, V., Welker, D., Hughes, J., Goh, Y., Benson, A., Baldwin, K., Lee, J.H., Diaz-Muniz, I., Dosti, B., Smeianov, V., Wechter, W., Barabote, R., Lorca, G., Altermann, E., Barrangou, R., Ganesan, B., Xie, Y., Rawsthorne, H., Tamir, D., Parker, C., Breidt, F., Broadbent, J., Hutkins, R., O’Sullivan, D., Steele, J., Unlu, G., Saier, M., Klaenhammer, T., Richardson, P., Kozyavkin, S., Weimer, B., Mills, D., 2006. Comparative genomics of the lactic acid bacteria. Proceedings of the National Academy of Sciences of the United States of America 103, 15611–15616. Malke, H., 1974. Genetics of resistance to macrolide antibiotics and lincomycin in natural isolates of Streptococcus pyogenes. Molecular & General Genetics: MGG 135, 349–367. Malke, H., Reichardt, W., Hartmann, M., Walter, F., 1981. Genetic study of plasmid-associated zonal resistance to lincomycin in Streptococcus pyogenes. Antimicrobial Agents and Chemotherapy 19, 91–100. McMillan, D.J., Geffers, R., Buer, J., Vlaminckx, B.J., Sriprakash, K.S., Chhatwal, G.S., 2007. Variations in the distribution of genes encoding virulence and extracellular proteins in group A streptococcus are largely restricted to 11 genomic loci. Microbes and Infection/Institut Pasteur 9, 259–270. Nitsche-Schmitz, D.P., Chhatwal, G.S., 2013. Host–pathogen interactions in streptococcal immune sequelae. Current Topics in Microbiology and Immunology 368, 155–171. Nitsche-Schmitz, D.P., Rohde, M., Chhatwal, G.S., 2007. Invasion mechanisms of Gram-positive pathogenic cocci. Thrombosis and Haemostasis 98, 488–496. Oehmcke, S., Shannon, O., Morgelin, M., Herwald, H., 2010. Streptococcal M proteins and their role as virulence determinants. Clinica Chimica Acta: International Journal of Clinical Chemistry 411, 1172–1180. O’Sullivan, T., van Sinderen, D., Fitzgerald, G., 1999. Structural and functional analysis of pCI65st, a 6.5 kb plasmid from Streptococcus thermophilus NDI-6. Microbiology 145 (Pt 1), 127–134. Ralph, A.P., Carapetis, J.R., 2013. Group a streptococcal diseases and their global burden. Current Topics in Microbiology and Immunology 368, 1–27. Rato, M.G., Nerlich, A., Bergmann, R., Bexiga, R., Nunes, S.F., Vilela, C.L., SantosSanches, I., Chhatwal, G.S., 2011. Virulence gene pool detected in bovine group

Please cite this article in press as: Bergmann, R., et al., Distribution of small native plasmids in Streptococcus pyogenes in India. Int. J. Med. Microbiol. (2014), http://dx.doi.org/10.1016/j.ijmm.2013.12.001

G Model IJMM-50786; No. of Pages 9

ARTICLE IN PRESS R. Bergmann et al. / International Journal of Medical Microbiology xxx (2014) xxx–xxx

C Streptococcus dysgalactiae subsp. dysgalactiae isolates by use of a group A S. pyogenes virulence microarray. Journal of Clinical Microbiology 49, 2470–2479. Roberts, R.C., Helinski, D.R., 1992. Definition of a minimal plasmid stabilization system from the broad-host-range plasmid RK2. Journal of Bacteriology 174, 8119–8132. Sagar, V., Bergmann, R., Nerlich, A., McMillan, D.J., Nitsche-Schmitz, D.P., Chhatwal, G.S., 2012. Variability in the distribution of genes encoding virulence factors and putative extracellular proteins of Streptococcus pyogenes in India – a region with high streptococcal disease burden: implication for the development of a regional multisubunit vaccine. Clinical and Vaccine Immunology 19, 1818–1825. Seery, L.T., Nolan, N.C., Sharp, P.M., Devine, K.M., 1993. Comparative analysis of the pC194 group of rolling circle plasmids. Plasmid 30, 185–196. Smeesters, P.R., Cadar, S., Dreze, P.A., Campos, D., Van Melderen, L., 2010a. Polyclonal dissemination of tetracycline resistance among Streptococcus pyogenes paediatric isolates from Brazil. Journal of Infection in Developing Countries 4, 704–711. Smeesters, P.R., McMillan, D.J., Sriprakash, K.S., 2010b. The streptococcal M protein: a highly versatile molecule. Trends in Microbiology 18, 275–282. Solow, B.T., Somkuti, G.A., 2000. Comparison of low-molecular-weight heat stress proteins encoded on plasmids in different strains of Streptococcus thermophilus. Current Microbiology 41, 177–181. Somkuti, G.A., Solaiman, D.K., Steinberg, D.H., 1998. Structural and functional properties of the hsp16.4-bearing plasmid pER341 in Streptococcus thermophilus. Plasmid 40, 61–72. Staden, R., 1996. The Staden sequence analysis package. Molecular Biotechnology 5, 233–241. Stalhammar-Carlemalm, M., Areschoug, T., Larsson, C., Lindahl, G., 1999. The R28 protein of Streptococcus pyogenes is related to several group B streptococcal surface proteins, confers protective immunity and promotes binding to human epithelial cells. Molecular Microbiology 33, 208–219.

9

Steer, A.C., Law, I., Matatolu, L., Beall, B.W., Carapetis, J.R., 2009. Global emm type distribution of group A streptococci: systematic review and implications for vaccine development. Lancet Infectious Diseases 9, 611–616. Takamatsu, D., Osaki, M., Sekizaki, T., 2000. Sequence analysis of a small cryptic plasmid isolated from Streptococcus suis serotype 2. Current Microbiology 40, 61–66. Turgeon, N., Moineau, S., 2001. Isolation and characterization of a Streptococcus thermophilus plasmid closely related to the pMV158 family. Plasmid 45, 171–183. van der Lelie, D., Bron, S., Venema, G., Oskam, L., 1989. Similarity of minus origins of replication and flanking open reading frames of plasmids pUB110, pTB913 and pMV158. Nucleic Acids Research 17, 7283–7294. Varaldo, P.E., Montanari, M.P., Giovanetti, E., 2009. Genetic elements responsible for erythromycin resistance in streptococci. Antimicrobial Agents and Chemotherapy 53, 343–353. Vincze, T., Posfai, J., Roberts, R.J., 2003. NEBcutter: a program to cleave DNA with restriction enzymes. Nucleic Acids Research 31, 3688–3691. Wang, Z., Wang, G., 2004. APD: the antimicrobial peptide database. Nucleic Acids Research 32, D590–D592. Wang, G., Li, X., Wang, Z., 2009. APD2: the updated antimicrobial peptide database and its application in peptide design. Nucleic Acids Research 37, D933–D937. Willems, R.J., Hanage, W.P., Bessen, D.E., Feil, E.J., 2011. Population biology of Grampositive pathogens: high-risk clones for dissemination of antibiotic resistance. FEMS Microbiology Review 35, 872–900. Woodbury, R.L., Klammer, K.A., Xiong, Y., Bailiff, T., Glennen, A., Bartkus, J.M., Lynfield, R., Van Beneden, C., Beall, B.W., 2008. Plasmid-Borne erm(T) from invasive, macrolide-resistant Streptococcus pyogenes strains. Antimicrobial Agents and Chemotherapy 52, 1140–1143. Zuker, M., 2003. Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Research 31, 3406–3415.

Please cite this article in press as: Bergmann, R., et al., Distribution of small native plasmids in Streptococcus pyogenes in India. Int. J. Med. Microbiol. (2014), http://dx.doi.org/10.1016/j.ijmm.2013.12.001