Distribution of two transposon-like elements in rice

plan cienc e [ I ~E'vlIR S( II N T l i I¢ Iq I{I 1~1{I R% I R I I \ N D

Plant Science 94 (19933 61-69

Distribution of two transposon-like elements in ricel" Xiao-quan Wang*, Ge-zhi Shen, Fei-qing Zheng, Zong-yang Wang, Jing-liu Zhang, Meng-min Hong Shanghai Institute of Plant Physiology, Academia Sinica, 300 Fenglin Rd, Shanghai 200032. P.R. China

(Received 4 May 1993: revision received 6 July 1993; accepted 7 July 1993)

Abstract

We have previously identified two transposon-like elements, RTL-I and RTL-2, by comparison of the Wx genes of cultivated Asian rice with that of Orvza L.f. spontanea. In this paper we report the distribution and organization of RTL-I and RTL-2 in the genomes and Wx genes of the genus Oryza (AA, BB, BBCC, CC, CCDD, EE). Southern blot analyses indicate that RTL-1 and RTL-2 are interspersed in all AA genomes of wild rice examined. It is noteworthy that hybridization patterns and copy numbers of RTL-2 are different in some rice species. PCR amplifications using primers in exon regions flanking intron 10 or intron 13 indicate that neither RTL-1 nor RTL-2 is present in the corresponding site of the Wx genes of BB, BBCC, CC, CCDD, EE genome-type of rice. RTL-I is only present in the Wx gene of O. nivara, O. rufipogon (Guangdong, crawl), while RTL-2 present in the corresponding site of Wx genes of all AA genome-type. Surprisingly we found and proved by sequence analysis that in O. rt~/~pogon from Sri Lanka there are two bands (161 bp and 300 bp) corresponding to the excision/insertion of RTL-I. Key words: Wx gene; PCR amplification; Southern blotting analysis; Repetitive element; Transposon

1. Introduction

One of the chief distinguishing features o f the genomes o f almost all eucaryotes is the presence of repetitive D N A sequences, which can be organized in long arrays of tandem repeats or interspersed in the genomes [1]. Some repetitive D N A sequences are transposable elements [2,3]. In higher animals and plants, many repetitive D N A sequences have been well characterized with respect to their * Corresponding author. "~This work was supported by the Rockefeller Foundation.

lengths, abundances, c h r o m o s o m a l distributions and their nucleotide sequences [4-6]. Recently in rice, repetitive D N A sequences have been identified from hybridization data [7-16]. Rice Wx gene codes for the starch granulebound starch synthase, which is responsible for the synthesis of amylose in the developing endosperm and pollen [17]. The nucleotide sequences of the Wx gene of O. sativa subsp, indica [18], O. sativa subsp, japonica [19] and O. L.f. spontanea [18] have been analysed. Comparison of the Wx genes of cultivated Asian rice with that of O. L.f. spontanea has revealed the presence o f two transposon-

0168-9452/93/$06.00 © 1993 Elsevier Scientific Publishers Ireland Ltd. All rights reserved. SSDI 0168-9452(93)03704-Y

62

X.-q Wang et al./Plant Sci. 94 (1993) 61-69

like elements named RTL-1 and RTL-2 in intron l0 and intron 13, respectively in the cultivated Asian rice. They are not present in the corresponding region of the Wx gene of O. L.f. spontanea. RTL-1, which is about 125 bp long and is flanked by 14 bp direct repeats, shares sequence homology with valine tRNA molecules to some extent and contains an internal promoter of RNA polymerase IlI. RTL-2 contains almost perfect inverted terminal repeats of 75 bp with an 84 bp unique internal sequence. Furthermore they are interspersed in the genomes of the three species of rice mentioned above, suggesting that RTL-1 resembles the SINEs (short interspersed repeated DNA elements), while RTL-2 may be similar to the FB transposon of Drosophila melanogaster [18].

Here we have examined the distribution of RTL- 1 and RTL-2 in the genomes of different wild rice by Southern blotting analyses and in the Wx genes of various wild rice species by polymerase chain reaction (PCR) amplification analysis. 2. Materials and methods

2.1. Seeds and plant growth All rice entries used in this study are tabulated in Table I. Seeds were germinated in Petri dishes and grown in pots in the greenhouse (25°C, 16 h light, 8 h dark; light intensity 8000 lux maximum at the pot level). DNA was extracted from plants that were about 2 months old.

Table 1 Plant materials used in this study Species

Origin

Genome

O. sativa subsp, indica 232 cultivar

China

AA

Hainan b Guangdong b Malaysia Sri Lanka Indonesia

AA AA AA AA AA

O. L.f. spontanea

Dongxiang b

AA

O. nivara

India Bangladesh Nepal Laos

AA AA AA AA

100898 102463 105703 106151

O. barthii

Gambia Sudan Cameroon Tanzania Nigeria

AA AA AA AA AA

100122 100933 101196 103910 104076

O. punctata

India

BB, BBCC

100125

O. glaberrima O. rufipogon

IRRI a accession No.

AA

100189 105214 105567

O. minuta

Philippines

BBCC

101082

O. officinalis

Thailand

CC

100179

O. alta

India

CCDD

100888

O. australiensis

India

EE

100882

alnternational Rice Research Institute. bOne part of China.

X.-q Wang et al./Plant Sci. 94 (1993) 61-69

2.2. Isolation oJ" rice total DNA Rice total DNA was extracted according to Schwarz-Sommer's methods [20]. Approximately 1 g of leaf tissue was ground in liquid nitrogen using a cold pestle and mortar. Then 2 ml of 1 x extraction buffer was added and homogenized quickly. The mixture was placed in an ice bath for at least 1 h. An equal volume of equilibrated water-saturated phenol: chloroform [1:1 (v/v)] was added, mixed by gentle inversion and centrifuged at 4000 x g for 10 min. The aqueous layer was reextracted with chloroform and the DNA was precipitated by addition of 2 volumes of cold ethanol to the aqueous layer and spooled into a small volume of TE solution [containing 10 mM Tris.C1 (pH 8.0) and 1 mM ethylenediamine tetraacetic acid (EDTA)]. Then the mixture was incubated with 25 /zg/ml RNase A (final concentration) for 30 min at 37°C, followed by 100/~g/ml proteinase K for 30 min at 37°C. The solution was successively extracted with water-saturated phenol and chloroform. Finally DNAs were precipitated by addition of 2 volumes of ethanol, suspended in TE and stored at -20°C.

63

recovered by DEAE paper methods according to Sambrook et al. [22]. 32p-labelled RTL-1 and RTL-2 fragments were prepared according to the specification in the random primed labeling kit (Promega) [23]. Bam HI digested genomic DNAs were fractionated in 0.8% agarose gels and transferred to nitrocellulose membrane, which were then hybridized to 32p-labelled probes at 68°C as described [22].

2.5. DNA sequencing PCR amplified products were cut with Barn HI, precipitated in the presence of 2 M ammonium acetate with 2 volumes of ethanol to remove dNTPs [24], and then cloned into the Barn HI site of the MI3 mpl8 vector. DNA sequence was determined by the dideoxynucleotide chain termination method [25] using Taq DNA polymerase in an automated fluorescent sequencer (ABI 370A model). The sequence of both strands was determined. The nucleotide sequence data was analyzed by a program developed at the Shanghai Institute of Biochemistry, Academia Sinica. 3. Results

2.3. Polymerase chain reaction (PCR) amplification Approximately 0.3-0.5 /~g of total rice DNA was amplified with specific primers (Fig. 1) to study whether RTL-1 and RTL-2 are present in the corresponding site of Wx genes of the genus Oryza, while 0.05/zg of lambda Wx 25 DNA was used to amplify RTL-1 and RTL-2 fragment used as probes for Southern blot analyses. PCR amplification was performed in a 50-/~1 reaction volume containing 0.2 mM of each dNTP, 10/~l 5 x buffer and 1 unit Taq DNA polymerase for 30 cycles [21]. It was carried out under the following conditions: denaturation for 1 min at 93°C, annealing for 1 min at 55°C and extending for 1 min at 72°C. The primers used are shown in Fig. 1. To facilitate cloning of the PCR products, an 'add-on sequence' ( G G G G A T C C or AAGGATCC) was devised at the 5' end of each primer. 2.4. Random primed labelling and genomic blot hybridization RTL-1 and RTL-2 used as probes were

3.1. PCR amplification of RTL-1 and RTL-2 fragments Comparison of three rice Wx genes has shown that there are two transposon-like elements (RTL1 and RTL-2) in the cultivated Asian rice Wx genes [18]. The sequences of RTL-I and RTL-2 are shown in Fig. 1. To see if they are interspersed in other rice species, the RTL-I and RTL-2 fragments were amplified by PCR amplification using primers (PI, P2 and P3, see Fig. 1.) on the two ends of RTL-1 or RTL-2, because there are no appropriate restriction endonuclease sites flanking RTL-1 and RTL-2. As RTL-2 contains a 75 bp almost perfect inverted terminal repeat, only one primer (P3) is needed for PCR amplification. The amplified products (127 bp and 240 bp long, respectively) were then subcloned into M13 vectors for subsequent sequence analysis, which indicated that they are composed only of the RTL1 and RTL 2 fragments. Therefore, the PCR amplified RTL-I and RTL-2 fragments can be used as probes for Southern blotting analyses.

64

(a)RTL-1 314bp

X.-q Wang e! al. / P k m l Sci. 94 [1993) 6 1 - 6 9

P4

~AGCTCATGCAGGAGGACGTCCAGATCGTTCTTCTGGTATAATATAATACACTACAAGAC Pl ACACTTGCACGATATGCCAAAAATTCAGAACAAATTCAGTGGCAAAaaaaaaactcgaat attagggaaggacctaataatatcaaataattagaaggggtgaggctttgaacccagatc P2 gtctagtccaccaccttgtggagttagccggaagacctctgagcatttctcaattcagtg P5 3~13bp gcaaaTGATGTGTATAATTTTGATCCGTGTGTGTTTCAGGGTACTGGAAAGAAGAAGTT

(b)RTL-2 178bp P6 GTCAGGAACTGCATGAACCAGGACCTCTCCTGGAAGGTATAAATTACGAAACAAATTTA

~

P3 ACCCAAACATATActatatactccctccgcttctaaatattcaacgccgttgtctttttt L,

'J

'

aaatatgtttgaccattcgtcttattaaaaaaattaaataattataaattcttttcctat catttgattcattgttaaatatacttatatgtatacatatagttttacatatttcataaa a~ttttt~aacaagacgaacggtcaaacatgtg,ctaaaaagttaacggtgtcgaatattc ~J

agaaacggagggagtataaaCGTCTTGTTCAGAAGTTCAGAGATTCACCTGTCTGATGCT GATGATGATTAATTGTTTGCAACATGGATTTCAGGGGCCTGCGAAGAACTGGGAGAATGT P7 4~54bp GCTCCTGGGCCTGGGCGTCGCCGGCAGCGCGCCGGGGATCGAAGGCGACGAGATCGC Fig. 1. Nucleotide sequences of RTL-1 (a) and RTL-2 (b) (small letters) as well as their flanking regions (capital letters). Positions are defined according to the Wx gene sequence of O. sativa subsp, japonia [19]. The primers used are underlined, while the direct repeats are double underlined. The 75 bp inverted repeated repeats are indicated by horizontal arrows.

3.2. Distribution of RTL-1 and RTL-2 in the genus Oryza The genus Oryza is rather complex and a large number of species grow in many different habitats. From cytogenetic studies and the analysis of the fertility of the offspring of interspecific crosses, Oryza has been classified into seven genome types: AA, BB, BBCC, CC, CCDD, EE and FF [26]. The AA genome is represented by O. sativa (cultivated Asian rice, indica and japonica subtypes), O.

glaberrima and various wild rice (O. rufipogon, O. nivara, O. barthii). The other genomes are all represented by wild species as indicated in Table 1. RTL-1 was labelled by random primer methods and hybridized with Bam HI-digested DNAs from different accessions. A representative blot is shown in Fig. 2a. From these data, we can see that hybridization yielded a smear of fragments with certain prominent bands. This pattern is expected for a sequence that is interspersed with single copy

X.-q Wang et al./Plant Sci. 94 (1993) 61-69

65

w q

!

~rq

E

|

t

i

•

°

ta~

e',,~c'q I

,.oZe e,)

o

i.i

--eq

66

X.-q Wang el al./ Plant Sci. 94 (1993) 61-69

sequences at many sites [5]. All o f the studied A A genome accessions show very similar (though not identical) patterns o f distribution. In BB and CC genomes of rice there are some hybridization bands; however, we d o n ' t know whether they are exactly homologous to R T L - I sequences. These will be studied further. N o hybridization at all was observed with BBCC, C C D D and EE genomes o f rice. RTL-2 sequences were used to probe Southern blots o f digests o f different rice total D N A s (Fig. 2b). Genomic hybridizations indicate that R T L - 2 is present in the A A genome o f rice, but not in the BB, BBCC, CC, C C D D or EE genomes. In the A A genomes of rice examined, we can see different hybridization patterns. In O. barthii three patterns (lane 12, lanes 10, 14, and lanes 11, 13) can be seen, while in O. nivara examined, three other patterns can be observed (lane 6, lane 7 and lanes 8, 9). In O. rufipogon and O. sativa completely different hybridization patterns can be seen (data not shown). 3.3. R T L - 1 in the Wx genes q / o t h e r rice species To see whether RTL-1 is present in the Wx gene o f other rice species, two primers (P4 and P5, see Fig. 1) in the exon regions flanking intron 10 of

i

2

3

4

5

6

7

8

9

Wx gene were prepared to amplify the corresponding region of other rice species by P C R (Fig. 3). If there is insertion of RTL-1 and it can cause 14 bp direct repeats of target sites, the length of PCR amplification products will be 300 bp; if not, 161 bp. In O. punctata (BB, BBCC), O. minula (BBCC), O. officinalis (CC), O. aha ( C C D D ) and O. australiensis (EE), the length o f PCR products (161 bp) was the same as that o f O. L.f. spontanea, which means that there is no RTL-1 insertion in the corresponding site. D N A sequence analyses of the PCR product of O. offi'cinalis indicate that a 14 bp direct repeat was present only once in the corresponding site of the Wx gene of O. officinalis (data not shown). Of all the A A genome rice examined, the length of PCR products (161 bp) was the same as that of O. L.f. spontanea, except in O. nivara (India and Bangladesh), O. rufipogon (Guangdong). In O. nivara and O. rufipogon (Guangdong), the length of PCR products (300 bp) was 139 bp longer than that of O. L. f. spontanea (161 bp). Subsequent sequence analysis proved that there was a 125 bp fragment of insertion in the corresponding site of the Wx gene o f O. nivara and O. rufipogon (Guangdong) and also 14 bp direct repeats at the insertion site (data not shown).

i0 ii 12 13 14 15 16

300bp 161bp

Fig. 3. Agarose gel electrophoresis of PCR products using P4 and P5 as primers to show the distribution of RTL-I in the Wx gone of different rice species. The amplified products were separated in 2.0% agarose gel, stained in 2.0 #g/ml ethidium bromide and photographed at long-wave length (302 rim) light. Rice total DNA used from: O. au.straliensis(lane 1), O. alta (lane 2), O. O[]icinalis (lane 3). O. minuta (lane 4), O.. punctata (lane 5), O. glaherrima (lane 6). O harthii (lane 7), O. nivara from Gambia (lane 8), O+ rt~fipogon from Guangdong (crawl, lane 9 and erect, lane 10), Sri Lanka (lane 11). Indonesia (hme 12), Mahtysia (hme 13), Hainan (lane 14), O. k.f. spontanea (lane 15), O. sativa subsp, indica 232 (hmc 16).

X.-q Wang et al./Plant Sci. 94 (1993) 61-69

Surprisingly two bands corresponding to 161 bp and 300 bp were observed when total DNAs from O. rufipogon (Sri Lanka) were used for PCR amplification (Fig. 3, Lane 11). Two amplified DNA fragments were subcloned into M13 vectors for sequence analysis. The results indicate that the 161 bp fragment was due to the deletion or excision of RTL- 1 from the 300 bp fragment, that is to say that the 300 bp fragment is the result of insertion of RTL-I in the 161 bp fragment (Fig. 4). This phenomenon may be due to impurity of the seeds used.

67

3.4. RTL-2 in the Wx genes of other rice .species Two primers (P6 and P7, see Fig. 1) in the exon regions flanking intron 13 of the Wx gene were also prepared to see if RTL-2 is present in the corresponding site of other species (Fig. 5). If there is insertion of RTL-2, the length of PCR amplification products will be about 480 bp; if not, 240 bp. The length of PCR amplified fragments of all studied AA genome rice (480 bp) were the same as that of cultivated Asian rice (480 bp), indicating that the RTL-2 fragment is present in the corresponding locus, which'is demonstrated by subse-

P4 GAGCTCATGCAGGAGGACGTCCAGATCGTTCTTCTGGTATAATATAATACACTACAA

J Sl

e o e e , e e e e e e e e e e e e o e e e e e e e o l e e l e e e e e e e e o a e t o o e * e e e e e l e * e o *

S2

e o l e a e e o e ~ e e e * e ~ * ~ e e o ~ o e e ~ e ~ e e e ~ e e e e e ~ e e e e ~ e ~ e e * o o

J

GACACACTTGCACGATATGCCAAAAATTCAGAACAAATTCAGTGGCAAAAAAAAAAC I

eeeooooeeoee0eleoeemeoeeee*eeoooeeeeeeleeleeeJlooeeeoeo~e

$2

oeeeeeeeeleeeeoeoeeeeoeeeeeoeeeeeeeeoeeeeeeee*eee

J

TCGAATATTAGGGAAGGACCTAATAATATCAAATAATTAGAAGGGGTGAGGCTTTGA

~i

leooeoeoeeeomotteooeeoeeeeoeeeoeGeoeeeoeeoeeeooeaeeeeeoeo

$2

J SI S2

ACCCAGATCGTCTAGTCCACCACCTTGTGGAGTTAGCCGGAAGACCTCTGAGCATTT

J

CTCAATTCAGTGGCAAATGATGTGTATAATTTTGATCCGTGTGTG 1

eI*e*oo*oeoaeooeeeoeeeeeele*~eeleeeeeoeeeoeeeoeTeeeooeeeo

i ~ o * ~ e l e e e a o a e * l e e e e e o e e o e , J e * e e t e e o e e o o e e e o *

$2

. . . . . . . . . . . . . . . . . . . . . . . . . . . .

. . . . TTTCAGG__GG . . . .

e e l e e ~ o e

TTTT

. . . . . . . .

P5 J S1 $2

TACTGGAAAGAAGAAGTT

Fig. 4. Sequence comparison of PCR amplified products of total DNA of O. ru/~pogon (Sri Lanka) using primer P4 and P5 [SI, the larger fragment (300 bp), $2 the smaller (161 bp)] with that of the corresponding region of japonica Wx gene (J). Sequence homology is indicated with periods, while gaps are denoted with dashes. The primers used are underlined, while the direct repeats are double underlined.

68

~ - q W a ~ et aL / P ~ n t Sci. 94 (1993) 61-69

1

2

3

4

5

6

7

8

9

i0 ii

12 13 14 15 16

480bp 240bp

Fig. 5. Agarose gel electrophoresis of PCR products using P6 and P7 as primers to show the distribution of RTL-2 in the Wx gone of different rice species. The amplified products were separated in 2.0% agarose gel, stained in 2.0 p,g/ml ethidium bromide and photographed at long-wave length (302 rim) light. Rice total DNA used from: O. australiensis (lane 1), O. alta (lane 2), O. ~[]i'cinalis (lane 3), O. minuta (lane 4), O. punctata (lane 5t. O. ,~]aberr#,a (lane 6), O. harthii (lane 7), O, nivara from Gambia (lane 8), O. rufipogon from Guangdong (crawl, lane 9 and erect, lane 10), Sri Lanka (lane 11 ), Indonesia (lane 12J, Malaysia (lane 13), Hainan (lane 14), O. L.f. spontanea (lane 15), O. sativa subsp, indica 232 (lane 16).

quent sequence analysis of PCR products (data not shown). This result seems to be contrary to that of previous sequence analysis of the Wx gone of O. L. f. spontanea [18]. However, the sources of material are different (for D N A sequence, rice total D N A was extracted from calli [18], while for PCR amplification, from seedlings), so we suggest that RTL-2 may be activated and excised during tissue cultivation. The length of the PCR fragments of O. punctata (BBCC), O. minuta (BBCC), O. of[i'cinalis (CC), O. alta (CCDD), O. grandiglumis (CCDD) or O. australiensis (EE) was, however, 240 bp shorter than that of AA genome rice (Fig. 5). Thus they are the same as that obtained from sequence analysis of the Wx gone of O. L. f. spontanea, revealing that no RTL-2 fragment is present in the corresponding site of rice with different genomes. 4. Discussion

Rice is a very complex genus, which can be divided into seven different genome patterns, AA, BB, BBCC, CC, C C D D , EE and FF. In this paper we have studied the distribution of two transposon-like elements RTL- 1 and RTL-2 in rice species. Southern blot analyses indicate that RTL-1 is present in AA, BB (O. punctata) and CC genomes of rice and absent in BBCC, C C D D , EE genomes.

while RTL-2 is only present in the AA genome. This means that RTL-1 is specific to AA, BB and CC genomes and RTL-2 is specific to the AA genome. Four repetitive sequences specific to AA, CC, EE and FF genome types have been isolated and characterized [11]. De Kochko et al. (1991) have identified a tandemly repeated 352-bp sequence which is AA-specific [12]. These genomespecific repetitive sequences may be useful as molecular markers to distinguish different genomes of rice, which may be much simpler and more accurate than other traditional methods such as comparison of morphological features, analyses of fertility after crosses or cytological analyses. In the genomes of almost all eucaryotes there are a number of repetitive DNA sequences, which are highly variable during evolution. Recently efforts have been made to study genome evolution using repetitive D N A sequences [5,6]. Our results indicate that RTL-2 is only present in the AA genome-type of rice and even in AA genomes of rice we can see different types of hybridization patterns. This indicates that at the DNA sequence level there are obvious differences among different species of AA genome-type rice. From the hybridization data, we can also see that RTL-2 has highly variable copies in the AA genomes of rice examined, which means that RTL2 may be actively transposed owing to stresses dur-

X.-q Wang et al./Plant Sci. 94 (1993) 61-69

69

ing evolution. Previous studies have revealed that the tissue culture environment may cause the activation of previously silent transposable elements [27-30]. The supposed activation of RTL-2 during tissue culture would be consistent with this assumption. There may be some other unknown reasons for this phenomenon.

16

5. References

17

1 2

5

4

5

6

7

8

9

l0

11

12

13

14

M. Singer, Highly repeated sequences in mammalian genomes. Int. Rev. Cytol., 76 (1982) 67-112 P.L. Deininger, SINEs: Short interspersed repeated DNA elements in higher eucaryotes, in: D.E. Berg and M.M. Howe (Eds.), Mobile DNA. American Society for Microbiology, Washington D.C., 1989, pp. 619-636 P.M. Bingham and Z. Zachar, Retrotransposons and the FB transposon from Drosophila melanogaster, in: D.E. Berg, and M.M. Howe (Eds.), Mobile DNA. American Society for Microbiology, Washington D.C., 1989, pp. 485-502. J.S. Waye and H.F. Sillard, Chromosome-specific alpha satellite DNA: Nucleotide sequence analysis of the 2.0 kilobase pair repeat from the human X chromosome. Nucleic Acids Res., 13 (1985) 2731-2743. l.J. Evans, A.M. James and S.R. Barnes, Organization and evolution of repeated DNA sequences in closely related plant genomes. J. Mol. Biol., 170 (1982) 803-806. R.B. Flavell, Amplification, deletion and rearrangement: major sources of variation during species divergence, in: G.A. Dover, R.B. Flavell (Eds.), Genome evolution. Academic Press, New York, 1982, pp 301-324. D. Pental and S.R. Barnes, interrelationship of cultivated rices Oryza sativa and O. glaberrima with wild O. perennis complex. Theor. Appl. Genet., 70 (1985) 185-191. T.Y. Wu and R. Wu, A new rice repetitive DNA shows sequence homology to both 5S RNA and tRNA. Nucleic Acids Res., 15 (1987) 5913-5923. S. Kikuchi, F. Takaiwa and K. Oono, Variable copy number DNA sequences homology in rice. Mol. Gen. Genet., 210 (1987) 373-380. M.S. Dhar, M. Dabak, V.S. Gupta and P.K. Ranjekar, Organization and propertics of repeated DNA sequences in rice genome. Plant Sci., 55 (1988) 43-52. X. Zhao, T. Wu, Y. Xie and R. Wu, Genome-specific repetitive sequences in the genus Oryza. Theor. Appl. Genet., 78 (1989) 201-209. A. De Kochko, M.C. Kiefer, F. Cordesse, A.S. Reddy and M. Delseny, Distribution and organization of a tandemly repeated 352 bp sequence in the Oryzae family. Theor. Appl. Genet., 82 (1991) 57-64. X. Zhao and G. Kochert, Characterization and genetic mapping of a short, highly repeated interspersed DNA sequence from rice (Oryza sativa L.). Mol. Gen. Genet., 231 (1992) 353-359. K. Mochizuki, M. Umeda, H. Ohtsubo and E. Ohtsubo,

15

18

19

20

21

22

23

24

25

26 27

28

29

30

Characterization of a plant SINE, p-SINE I in rice genome. Jpn. J. Genet., 57 (1992) 155-166. H. Aswidinnoor, R.J. Nelson, J.F. Dallas, C . L Mclntyre, H. Leung and J.P. Gustafson, Cloning and characterization of a repetitive DNA sequences from genomes of O0'za minuta and Oryza australiensis. Genome, 34 { 1991 t 790-798. H. Hirochika, A. Fukuchi and F. Kikuchi. Retrotransposon families in rice. Mol. Gen. Genet., 233 (1992) 209-216. Y. Sano, M. Katsamata, and K. Okuno, Genetic studies of speciation in cultivated rice 5. Inter- and intraspecific differentiation in the waxy gene expression in rice. Euphytica, 35 (1986) 1-9. Z. Wang, F. Zheng, X. Wang, J. Gao and M. Hong, Characterization of two transposon like elements in rice Wx gene. Science in China Series B, 23 (1993t, no. 3, in press. Z. Wang, Z. Wu, Y. Xing, F. Zheng, X. Guo, W, Zhang and M. Hong, Nucleotide sequence of rice waxy gene. Nucleic Acids Res., 18 (1990) 5898. Z.S. Schwarz-Sommer, N. Shepherd and E. Tache, Influence of transposable elements on the structure and function of the A1 gene of Zea mays. EMBO J.. 6 (1987) 287-294. K.B. Mullis and F.A. Faloona, Specific synthesis of DNA in vitro via a polymerase catalyzed chain reaction. Methods Enzymol., 155 (1987) 335-350. J. Sambrook, E.F. Fritsch and T. Maniatis. Molecular cloning: a laboratory manual. Cold Spring Harbour Laboratory, Cold Spring Harbor, NY, 1989. A.P. Feinberg and B. Vogelstein, A technique for radiolabelling DNA restriction endonuclease fragments to high specific activity. Anal. Biochem., 132 (1983) 6-13. D.A. Treco, Removal of low-molecular-weight oligonucleotides and triphosphates by ethanol precipitation. In: Current protocols in molecular biology, 1988, vol. l, p. 2.1,4, Green Publishing Associates and WileyInterscience, New York F. Sanger, S. Nicklen, A.R. Coulson, DNA sequencing with chain terminating inhibitors. Proc. Natl. Acad. Sci. USA, 74 (19771 5463-5467. H.I. Oka, Experimental studies on the origin of cultivated rice. Genetics, 78 (1974)475-486. P.J. Larkin and W.R. Scowcroft, Somoclonal variation a novel source of variability from cell cultures for plant improvement. Theor. Appl. Genet., 60 (1981) 197-214. B. Burr and F. Burr, Transposable elements and genetic instabilities in crop plants. Stadler Genet. Syrup., 13 (1981) 115-128. V.M. Peschke and R.L. Phillips, Activation of the maize transposable element suppressor-mutator (SPm) in tissue culture. Theor. Appl. Genet., 81 (1991) 90-97. V.M. Peschke, R.L. Phillips and B.G. Gengenbach, Discovery of transposable element activity among progeny of tissue-culture-derived maize plants. Science, 238 (1987) 804-807.