Diurnal and circadian regulation of a melatonin receptor, MT1, in the golden rabbitfish, Siganus guttatus

General and Comparative Endocrinology 150 (2007) 253–262 www.elsevier.com/locate/ygcen

Diurnal and circadian regulation of a melatonin receptor, MT1, in the golden rabbitfish, Siganus guttatus Yong-Ju Park a, Ji-Gweon Park a,c, Nanae Hiyakawa a, Young-Don Lee b, Se-Jae Kim c, Akihiro Takemura a,* b

a Sesoko Station, Tropical Biosphere Research Center, University of the Ryukyus, 3422 Sesoko, Motobu, Okinawa 905-0227, Japan Marine and Environmental Research Institute, Cheju National University, 3288 Hamdeok, Jocheon, Jeju-do 695-814, Republic of Korea c Department of Life Science, Cheju National University, 66 Jejudaehakno, Jeju-do 690-756, Republic of Korea

Received 2 May 2006; revised 1 August 2006; accepted 29 August 2006 Available online 16 October 2006

Abstract The golden rabbitfish Siganus guttatus is a reef fish with a restricted lunar-synchronized spawning rhythmicity and releases gametes simultaneously around the first quarter moon period during the spawning season. In order to understand the molecular aspects of the ‘‘circa’’ rhythms in this species, the full-length melatonin receptor (MT1) cDNA was cloned, and its diurnal/circadian regulation was examined. The full-length MT1 cDNA (1257 bp) contained an open reading frame that encodes a protein of 350 amino acids; this protein is highly homologous to MT1 of nonmammalian species. A high expression of MT1 mRNA with a day-night difference was observed in the whole brain, retina, liver, and kidney. When diurnal variations in MT1 mRNA expression in the retina and whole brain were examined using real-time quantitative RT-PCR, an increase in the mRNA expression was observed during nighttime in both tissues under conditions of light/dark, constant darkness, and constant light. This suggests that MT1 mRNA expression is under circadian regulation. The expression of MT1 mRNA in the cultured pineal gland also showed diurnal variations with high expression levels during nighttime; this suggests that the increased expression level observed in the whole brain is partially of pineal origin. Alternation of light conditions in the pineal gland cultures resulted in the changes in melatonin release into the culture medium as well as MT1 mRNA expression in the pineal gland. The present results suggest that melatonin and its receptors play an important role in the exertion of daily and circadian variations in the neural tissues.  2006 Elsevier Inc. All rights reserved. Keywords: Circadian rhythm; Diurnal variation; Golden rabbitfish; MT1; Melatonin; Melatonin receptor; Pineal gland; Teleost

1. Introduction It is well established that melatonin receptors belong to the G-protein-coupled receptor family and play an important role in the mediation of melatonin action in various neural and peripheral tissues (Reppert et al., 1996; Vanecˇek, 1998). Radioreceptor assay techniques using 2-[125I]iodomelatonin ([125I]Mel) as the radioligand have demonstrated two types of plasma membrane-associated melatonin binding sites, namely, ML1 and ML2 (Dubocovich, 1988, 1995). ML1 has a high affinity to [125I]Mel and *

Corresponding author. Fax: +81 980 47 4919. E-mail address: [email protected] (A. Takemura).

0016-6480/$ - see front matter  2006 Elsevier Inc. All rights reserved. doi:10.1016/j.ygcen.2006.08.011

belongs to the G-protein-coupled receptor family, while ML2 with a low affinity to [125I]Mel has been identified as quinone reductase 2 (QR2). Recent molecular techniques have revealed the existence of three different subtypes of melatonin receptors, namely, MT1, MT2, and Mel1c (Dubocovich et al., 2000; Ebisawa et al., 1994; Reppert et al., 1996). MT1 and MT2 have been widely identified in vertebrates (Reppert et al., 1994, 1995b; Roca et al., 1996). On the other hand, Mel1c has been cloned only in nonmammalian species such as zebrafish, Xenopus, and chicken (Ebisawa et al., 1994; Reppert et al., 1995a). Several studies on the actions of melatonin and melatonin receptors have been carried out in the neural tissues of mammals (Gauer et al., 1993a; Guerrero et al., 2000;

254

Y.-J. Park et al. / General and Comparative Endocrinology 150 (2007) 253–262

Schuster et al., 2001). A high mRNA expression of the principal melatonin receptor MT1 has been detected in the suprachiasmatic nuclei (SCN) (Dubocovich et al., 2003; Scher et al., 2002; Von Gall et al., 2002), the location of the master circadian clock system in mammals (Gauer et al., 1993b, 1994; Masson-Pe´vet et al., 1996). In teleost fish, on the other hand, the pineal gland appears to be a possible candidate as the master circadian clock (Cahill, 1996) because this photoreceptive gland functions as an endocrine organ as well as a circadian oscillator (Collin et al., 1989; Gern and Greenhouse, 1988; Falco´n et al., 1992; Takahashi et al., 1989). In contrast to the extensive studies in mammals, only a few studies have reported the role of melatonin receptors in the circadian system of fish. Diurnal variations in the melatonin binding sites in the retina and whole brain were reported in several species (Bayarri et al., 2004a,b; Gauer et al., 1993b; Iigo et al., 1994; Yuan et al., 1990). On the other hand, molecular approaches on diurnal variations in melatonin receptors have been reported only in the chum salmon (Oncorhynchus keta) for MT1 and MT2 (Shi et al., 2004) and in the golden rabbitfish (Siganus guttatus) for MT2 (Park et al., 2006). Rabbitfish (Siganidae) is commonly found in coral reefs and shows a restricted lunar-related rhythmicity with 1month intervals in behavior and reproduction (Takemura et al., 2004b). The spiny rabbitfish S. spinus (Harahap et al., 2001) and the seagrass rabbitfish S. canaliculatus (Hoque et al., 1999) spawn around the new moon period, while the golden rabbitfish (Hara et al., 1986; Rahman et al., 2000) repeats simultaneous spawnings around the first quarter moon period. Takemura et al. (2004a) found that in the golden rabbitfish, the melatonin level in the blood circulation exhibits both diurnal (with an increase during nighttime) and monthly (with an increase during the new moon period) variations. Such duality may imply that through melatonin actions, the melatonin receptors are also involved in the regulation of daily and monthly activities in this fish species. In order to have a better understanding of the molecular aspects of ‘‘circa’’ systems in the golden rabbitfish, in the present study, we cloned and characterized the cDNA of the MT1 melatonin receptor. Diurnal and circadian variations in MT1 mRNA expression in the retina and whole brain were examined by realtime quantitative reverse transcription-polymerase chain reaction (RT-PCR). In addition, we evaluated the effect of alternation of light conditions on MT1 mRNA expression in the pineal gland cultured in vitro. 2. Materials and methods 2.1. Experimental animals Juvenile golden rabbitfish were caught in the mangrove creek of Manna river, Okinawa, Japan, by using a small mesh size net during the daytime low tide around the new moon period in July 2004. They were reared in indoor tanks (6 metric tons) with running seawater and aeration under natural photoperiod at Sesoko Station, Tropical Biosphere Research Center, University

of the Ryukyus, Japan. They were fed commercial pellets (EP1 and EP2, Marubeni Nisshin, Tokyo, Japan) daily at 10:00 h. When the experiments were carried out in 2005, their body mass ranged from 37.6 to 60.4 g. The fish were taken from the stock tanks at random and transferred to 200-L tanks, which were maintained at 25.0 ± 1.0 C under natural photoperiod (sunrise around 06:30 h and sunset around 18:30 h) for 2 weeks. They were fed EP2 daily at 10:00 h. After anesthetizing with 2-phenoxyethanol (Kanto Chemicals, Tokyo, Japan), the fish (n = 8) were sacrificed by decapitation at 12:00 h and 24:00 h. Tissues (retina, whole brain, liver, spleen, heart, intestine, and kidney) were immediately removed from the fish, frozen in liquid nitrogen, and stored at 80 C. The tissues were dissected at 24:00 h under dim red light. To examine daily variations in MT1 mRNA expression, the fish were transferred into indoor tanks (500 L capacity) and acclimatized for 6 days under a 12-h light/12-h dark (LD, light switched on at 06:30 h) cycle. During the light phase, the light intensity provided by a white fluorescent bulb (40 W) was approximately 800 lx near the water surface. The fish were fed EP2 daily at 10:00 h. On Day 7, the fish were placed under LD, constant dark (DD), or constant light (LL) conditions. After 3 days without feeding, the fish were anesthetized and sacrificed at 3-h intervals. The retina and whole brain were immediately removed from the fish, frozen in liquid nitrogen, and stored at 80 C. During the dark period, the tissues were dissected under dim red light. The same experimental regime was conducted to examine MT1 mRNA expression in the pineal gland, which was dissected from the brain. All the experiments complied with both the guidelines of the Animal Care and Use Committee of the University of the Ryukyus and the regulations for the care and use of laboratory animals in Japan.

2.2. Isolation of cDNA fragments Total RNA was isolated from the whole brain by using the TRI reagent (Molecular Research Center, Cincinnati, OH) according to the manufacturer’s instructions. The isolated total RNA was then reverse transcribed into first-strand cDNA by using the ImPromII Reverse Transcription System kit (Promega, Madison WI). The cDNA was amplified by PCR in a final volume of 75 ll using oligonucleotide degenerate primers for MT1. The oligonucleotide degenerate primer sets for MT1 were designed based on the highly conserved regions of MT1 sequences from humans (GenBank Accession No. NM_005958), rainbow trouts (AF156262), and zebrafish (NM_131393) (Table 1). The predicted size of the PCR product was 525 bp. The PCR reaction conditions were as follows: 1 cycle of 95 C for 2 min, 35 cycles of 95 C for 45 s, 60 C for 45 s, and 72 C for 1 min, followed by 1 cycle of 72 C for 5 min. The PCR products were ligated, cloned into the pGEM-T easy vector (Promega), and sequenced with the ALF Express II DNA Sequencer System version 2.1 (GE Healthcare Bio-Sciences, Uppsala, Sweden) using the Thermo Sequence Fluorescent Labeled Primer Cycle Sequence kit with 7-deaza-dGTP (GE Healthcare Bio-Sciences) according to the manufacturer’s instructions.

2.3. Rapid amplification of cDNA 5 0 and 3 0 ends To determine the full-length MT1 cDNA, rapid amplification of cDNA 5 0 and 3 0 ends (5 0 - and 3 0 -RACE) were carried out using the BD Smart RACE cDNA Amplification kit (BD Biosciences, San Jose, CA) according to the manufacturer’s protocol. First-strand cDNA was synthesized using 1 lg of total brain RNA and the primers provided in the kit. The first PCR for 5 0 - and 3 0 -RACE was performed with Universal Primer A Mix (UPM) and each gene-specific primer (Table 1) by using a 3-step program for touchdown PCR. The PCR reaction conditions were as follows: (1) 5 cycles of 94 C for 30 s and 72 C for 3 min; (2) 5 cycles of 94 C for 30 s, 70 C for 30 s, and 72 C for 3 min; and (3) 25 cycles of 94 C for 30 s, 68 C for 30 s, and 72 C for 3 min. Using the 50-fold diluted first PCR products as a template, nested PCR was performed with the Nested Universal Primer A (NUP) and each gene-specific nested primer (Table 1) under the following conditions: 20 cycles of 94 C for 30 s, 68 C for 30 s, and 72 C for 3 min. The final PCR products were ligated and cloned into the pGEM-T easy vector and sequenced.

Y.-J. Park et al. / General and Comparative Endocrinology 150 (2007) 253–262

255

Table 1 Nucleotide sequences of MT1 primers used for cloning and real-time PCR Primer

Sequence (from 5 0 to 3 0 )

Remark

MT1-F MT1-R MT1-5R MT1-N5R MT1-3R MT1-N3R MT1-realF MT1-realR Actin-realF Actin-realR

ATCACTG(C/G)CATCGCCAT(C/T)AAC GGC(A/G)TTAAGGCA(A/G)CTGTTGAA CAGGAGTAAACCCGAGGGTCGTACTG GGCCATGAAGTAGCTGGAGACGAAC GTACAGCGACAAGAACTCGGTGTGC ATACTGGTCATCCAGGTGAGGAGGC TCTACCGGAACAAGAAGCTGC AGGTTCCAGCCATTGTGGAAG TACCACCATGTACCCTGGCATC TACGCTCAGGTGGAGCAATGA

Forward degenerated primer for MT1 cDNA fragment Reverse degenerated primer for MT1 cDNA fragment Gene-Specific primer for 5 0 -RACE of MT1 Nested primer for 5 0 -RACE of MT1 Gene-specific primer for MT1 3 0 -RACE Nested primer for 3 0 -RACE of MT1 Forward primer for real-Time PCR of MT1 Reverse primer for real-Time PCR of MT1 Forward primer for internal standardization of real-time PCR Reverse primer for internal standardization of real-time PCR

2.4. Sequence analysis The identity of nucleotide and deduced amino acid sequences was analyzed and verified by searching the NCBI database using the BLAST program. For phylogenetic analysis, multiple alignments of the full-length melatonin receptor sequences isolated from several vertebrates were used in the ClustalW program (http//www.ebi.ac.uk/clustalw) under the Phylip package settings. Phylogenetic analysis was performed by the neighborjoining method using the Consense program. One thousand bootstrap trials were run and used to construct a strict consensus tree. The rat mu (l) opioid receptor sequence was used as an outgroup to root the phylogenetic tree.

2.5. Real-time quantitative RT-PCR Total RNA samples were treated with RQ1 RNase-Free DNase (Promega) to avoid genomic DNA contamination. The samples with a 260/ 280-nm absorbance ratio (A260/A280) of 1.7–2.0 were used for cDNA synthesis. RT was carried out in a total volume of 10 ll containing 500 ng total RNA, 500 lM each dNTP mixture, and 25 lM oligo(dT) primer using components from the ExScript RT Reagent kit (Takara, Ostu, Japan). Real-time quantitative PCR was performed using the ABI Prism 7000 Sequence Detection System (Applied Biosystems, Foster City, CA) and the SYBR Green premix PCR kit (Takara) to quantify MT1 mRNA expression. The PCR reaction was carried out with 10 ll SYBR premix Ex Taq, 0.2 lM forward primer, 0.2 lM reverse primer, and 4 ll 5-fold diluted cDNA or standard plasmid DNA as a template in a final volume of 20 ll. b-Actin was also amplified as an internal control. Ten-fold serial dilutions of plasmid DNA (3 · 101–3 · 107 copies/4 ll) encoding MT1 and b-actin mRNAs were used to establish the standard curve. Copy numbers for each plasmid DNA were calculated as plasmid (DNA concentration, ll/lg) · 106 pg/1 lg · 1 pmol/(660 pg · plasmid size) · Avogadro number · 1012 (Applied Biosystems). All primer sequences used for this assay were designed using the PrimerExpress version 2.0 software (Table 1, Applied Biosystems). The conditions for each PCR reaction were as follows: initial denaturation at 95 C for 10 s, 40 amplification cycles including denaturation at 95 C for 5 s, annealing, and elongation at 60 C for 1 min. The detection of the fluorescent product was carried out at the end of each cycle. To confirm the specificity of PCR, a melting curve analysis was performed after the end of 40 cycles by slowly increasing the temperature Tm of the sample from 60 C to 95 C. The expression levels of MT1 and b-actin mRNAs were measured in triplicate and reported as threshold cycle (Ct) values based on their respective standard curve. The data of MT1 mRNA were normalized by the amount of b-actin mRNA.

2.6. In vitro culture of the pineal gland After anesthetizing the fish, the pineal gland was dissected from the fish and placed in an ice-cold medium, which was composed of 150 mM NaCl, 10 mM Hepes, 7 mM NaHCO3, 2.8 mM glucose, 2.5 mM KCl, 1 mM

MgCl2, 1 mM CaCl2, 0.7 mM NaH2PO4, and 0.88 g/l Eagle’s MEM (Nissui Seiyaku, Tokyo, Japan) containing antibiotics (0.1 g/l streptomycin and 0.01 g/l polymyxin B sulfate; Sigma, St. Louis, MO). The pineal gland was transferred into a 24-well microplate (Iwaki glass, Funabashi, Japan) with 1 ml of the medium and incubated at 24 ± 0.5 C in an incubator (MIR-153; Sanyo, Tokyo, Japan) under LD conditions (LD12:12, light switched on at 7:00 h). The light intensity at the surface of the microplate was approximately 1000 l· during the light phase. The pineal gland was sampled at 3-h intervals (n = 5–6) from ZT3 to ZT24, immediately frozen in liquid nitrogen, and stored at 80 C until RNA extraction. To examine the effects of light on melatonin production and MT1 expression, the pineal gland was placed in the microplate under LD conditions (LD12:12) for 2 days. The microplate with the pineal gland was exposed to light (1000 l·) at ZT18 or covered with a black sheet at ZT6, and then incubated for 2 h. The pineal gland was sampled at ZT20 and ZT8 and treated as mentioned above. At each step, the medium was also collected and frozen at 30 C. The MT1 mRNA expression in the pineal gland was determined by real-time quantitative RT-PCR. The melatonin content in the medium was measured by time-resolved immunofluoroassay according to the method of Takemura et al. (2004a).

2.7. Statistical analysis All the data of real-time quantitative PCR were expressed as mean (±SEM). Student’s t test was used for comparing the MT1 mRNA expression levels during noon and midnight in several tissues. One-way ANOVA followed by Tukey’s post hoc test was performed to compare diurnal and circadian variations in the MT1 mRNA levels under LD, DD, and LL conditions. A probability of P < 0.05 was considered statistically significant.

3. Results 3.1. Cloning, characterization, and comparison of MT1 sequence MT1 fragments (525 bp) were obtained by PCR amplification of cDNA from the brain by using the degenerate oligonucleotide primers. These putative cDNA fragments showed 95% identity with the zebrafish MT1 at the amino acid sequence level. We designed gene-specific primers from these partial sequences in order to determine the corresponding full-length cDNA of MT1 by 5 0 - and 3 0 -RACE. The full-length MT1 cDNA (1257 bp) comprised a 99-bp 5 0 -untranslated region (UTR), a 105-bp 3 0 -UTR including a poly (A) tail, and a 1053-bp open reading frame (ORF), which encoded a protein of 350 amino acids (Fig. 1).

256

Y.-J. Park et al. / General and Comparative Endocrinology 150 (2007) 253–262

Fig. 1. The nucleotide and deduced amino acid sequences of the MT1 melatonin receptor in the golden rabbitfish. The nucleotides (upper row) and amino acids (lower row) are numbered on the right-hand side of the sequences. The seven presumed transmembrane domains (I–VII, underlined) as well as consensus sites for N-linked glycosylation (dotted frame) and protein kinase C phosphorylation (solid frame) are indicated. The asterisk indicates the stop codon, and the probable polyadenylation signal (AATAAA) is underlined. This nucleotide and deduced amino acid sequences were registered in GenBank with Accession No. DQ768087.

The putative golden rabbitfish MT1 had structural features of the prototypic G-protein-coupled receptor family that comprises seven transmembrane domains of 19–27 amino acids. The melatonin receptors included an NRY motif immediately downstream of the third transmembrane domain, a C(C/Y)ICH motif immediately downstream of NRY, and a NAXXY motif in the seventh transmembrane domain. Several consensus sites corresponding to the Nlinked glycosylation sites (N–X–S/T) in the amino terminus and to the protein kinase C phosphorylation (S/T–X–R/K) sites located in the intracellular loop immediately before the fourth transmembrane domain and in the carboxyl tail were also identified in the MT1 of the golden rabbitfish (Fig. 1). The deduced amino acid sequence of the golden rabbitfish MT1 was compared with those of other vertebrates. We observed homologies in the conserved region of MT1 from the golden rabbitfish and those from other vertebrates (Fig. 2). The golden rabbitfish MT1 showed high homology to the MT1 of zebrafish (92%), chicken (82%), and human (73%) but low homology to the MT2 and Mel1c of vertebrates (54–69%). The consensus tree showed that the golden rabbitfish MT1 is located as a completely distinct subgroup in the melatonin receptor family and is closely related to the teleost MT1 (Fig. 3).

3.2. Expression pattern of MT1 in several tissues The daytime and nighttime MT1 mRNA expression in the retina, whole brain, liver, spleen, intestine, heart, and kidney was compared. This melatonin receptor gene was expressed in all the tissues tested in the present study. A relatively higher expression of MT1 mRNA was observed in the retina, whole brain, liver, and kidney. The difference in MT1 mRNA expression at 12:00 and 24:00 h was evident in these tissues. The MT1 mRNA expression in the retina and whole brain was significantly higher at 24:00 h than at 12:00 h, whereas that in the liver and kidney was higher at 12:00 h than at 24:00 h (Fig. 4). 3.3. Diurnal and circadian variations in MT1 mRNA expression Diurnal variations in MT1 mRNA expression in the retina and whole brain were examined under three different conditions. Under LD conditions, MT1 mRNA expression in the retina and whole brain showed variations with significantly higher expressions from mid to late night (Fig. 5a and b). Similar variations in MT1 mRNA expression were observed in both tissues under DD (Fig. 5c and d) and LL conditions (Fig. 5e and f). The increase in MT1 mRNA

Y.-J. Park et al. / General and Comparative Endocrinology 150 (2007) 253–262

257

Fig. 2. Comparison of the deduced amino acid sequences of the MT1 melatonin receptor from various vertebrates by using the ClustalW program. The coding regions of the rabbitfish, zebrafish, chicken, and human receptors are shown. To maximize homology, gaps (represented by dots) have been introduced in the sequences. The seven presumed transmembrane domains (I–VII) are overlined. GenBank accession numbers of the analyzed sequences are as follows: zebrafish MT1 (NM_131393), chicken MT1 (U31820), and human MT1 (NM_005958).

expression during nighttime (ZT18 and ZT21) was significant under both conditions. Fig. 6 shows the diurnal variation in MT1 mRNA expression in the pineal gland. The MT1 mRNA expression showed a diurnal variation with a significant increase in the expression during nighttime. A diurnal variation in MT1 mRNA expression was also observed in the cultured pineal gland, and the expression increased during nighttime. A peak expression level was observed at ZT18 and at ZT21 during in vivo and in vitro experiments, respectively. 3.4. Effect of light conditions on melatonin production and MT1 mRNA expression Light conditions in the pineal gland cultures were altered to evaluate the effect of light on melatonin release into the medium and on MT1 mRNA expression in the pineal gland (Fig. 7). When the pineal gland, which was placed under dark conditions, was exposed to light, melatonin release into the medium significantly decreased (Fig. 7a). Similarly, the expression of MT1 mRNA significantly reduced after light exposure (Fig. 7c). On the other hand, the transfer of the pineal gland from light to dark

conditions during the light phase resulted in a significant increase in melatonin release into the medium (Fig. 7b). An increase in MT1 mRNA expression was also observed after this transfer. However, the expression of MT1 mRNA was low and not significantly different from that prior to the transfer (Fig. 7d). 4. Discussion The golden rabbitfish full-length MT1 melatonin receptor cDNA was 1257 bp in length with a single open reading frame that encodes a protein of 350 amino acids. It contained the seven presumed transmembrane domains that are characteristic of the G-protein-coupled receptor family (Dubocovich, 1988; Reppert et al., 1996). Based on phylogenetic analysis, the golden rabbitfish melatonin receptor cDNA was classified into the MT1 group. Further, the alignment of the deduced amino acid sequence showed higher identity to nonmammalian MT1 (82–92%) than to MT2 and Mel1c (63–69%). The present study clearly shows that the cloned cDNA belongs to the G-protein-coupled receptor family and is categorized as MT1 among the three melatonin receptor subtypes.

258

Y.-J. Park et al. / General and Comparative Endocrinology 150 (2007) 253–262

Fig. 3. Phylogenetic analysis of the relationship among the known full-length melatonin receptor sequences from four vertebrate classes. The rat l-opioid receptor (GenBank Accession No. NM_011013) was used as an outgroup to root the tree. Analysis was performed with multiple alignments from the amino acid sequences by using the ClustalW program. A consensus tree corresponding to 1000 bootstrap values was obtained by the neighbor-joining method. The numbers on the branches indicate the results of bootstrap analysis. GenBank accession numbers of the analyzed sequences are as follows: human MT1 (NM_005958), mouse MT1 (NM_008639), sheep MT1 (AF045219), chicken MT1 (U31820), rainbow trout MT1 (AF156262), zebrafish MT1 (NM_131393), human MT2 (NM_005959), mouse MT2 (NM_145712), rat MT2 (XM_345899), chicken MT2 (U30609), zebrafish MT2 (XM_679915), pike P2.6 (AF188871), chicken Mel1c (U31821), Xenopus Mel1c (XLU09561), and zebrafish Mel1c (XM_684351).

Relative MT1 mRNA level

0.4

*

*

*

* Daytime Nighttime

0.3

0.2

0.1

0 Retina

Brain

Liver

Spleen Intestine Heart

Kidney

Tissues Fig. 4. Expression of MT1 mRNA in the neural and peripheral tissues of the golden rabbitfish during daytime and nighttime. White and black columns indicate MT1 mRNA expression during daytime and nighttime, respectively. Each value represents mean ± SEM of 6–8 individuals. The data were normalized against b-actin values and then averaged. Asterisks indicate statistical significance at P < 0.05 in the comparison of MT1 mRNA expression during daytime and nighttime.

The mRNA expression of this gene was significantly higher in the retina, brain, liver, and kidney. Among these tissues, the MT1 mRNA expression during daytime and nighttime showed obvious differences; this suggests that MT1 plays a role in mediating melatonin actions with diurnal variations. Interestingly, the retina/brain (neural tis-

sues) exhibited an opposite expression pattern from the liver/kidney (peripheral tissues). In mammals and birds, high expression of melatonin receptors has been reported in the peripheral tissues (Drew et al., 1998; Poon et al., 2001; Song et al., 1993; Wan and Pang, 1995). Diurnal variations in the expression of melatonin receptors were found in the kidney of ducks and chickens (Song et al., 1993) and the liver of quails (Wan and Pang, 1995). Therefore, it is considered that melatonin receptors play a role in diurnal changes in ordinal activities in the tissues. On the other hand, it is unlikely that melatonin and melatonin receptors positively play a role in the regulation of vitellogenesis, during which the yolk precursor protein (vitellogenin) is synthesized in the liver under the influence of estrogens followed by its active incorporation into the developing oocytes (Wallace and Selman, 1981). This is because melatonin treatments and pinealectomy failed to induce gene expressions of estrogen receptors and vitellogenin in rainbow trout Oncorhynchus mykiss (Mazurais et al., 2000). Using radioreceptor assay techniques, daily variations in the melatonin binding sites have been demonstrated in the retina of goldfish Carassius auratus (Iigo et al., 1995; Ribelayga et al., 2003), catfish Silurus asotus (Iigo et al., 1997), and European sea bass Dicentrarchus labrax (Bayarri et al., 2004b), and in the whole brain of goldfish (Iigo et al., 1995; Martinoli et al., 1991), gilthead seabream Sparus aurata (Falco´n et al., 1996), pike Esox lucius (Gaildrat et al., 1998), and Atlantic salmon Salmo salar (Ekstro¨m and

Y.-J. Park et al. / General and Comparative Endocrinology 150 (2007) 253–262

a 0.5

b

b 0.3 b

bcd d

0.4

a

a

ab

a

ab

a a

bcd

abc abc

0.2 0.3

0.2

259

a

a 0.1

0.1

0 0.5

0

d 0.2 ab

0.4

ab

ab ab

ab

b

ab

0.3

a

0.2

0.1

e

0 0.6

c bc

0.5

bc

Relative mRNA level in the brain

Relative mRNA level in the retina

c

ab 0.1

a

a

b

a

0

f 0.2

a a

0.3

b ab

ab ab

ab

0.4

b

ab

ab

b

b

b

b

b

0.1 a

0.2 0.1 0

0 3

6

9

12

15

18

21

24

Zeitgeber/Circadian time

3

6

9

12

15

18

21

24

Zeitgeber/Circadian time

Fig. 5. Diurnal and circadian variations in MT1 mRNA expression in the retina (a, c, and e) and whole brain (b, d, and f) of the golden rabbitfish. The fish were maintained under conditions of light/dark (LD, a and b), constant darkness (DD, c and d), and constant light (LL, e and f). Each value represents mean ± SEM of 6–8 individuals. The relative values of MT1 mRNA expression were normalized against b-actin values and then averaged. Solid and open bars along the x-axis represent the dark and light phases, respectively. Means represented by different letters are significant (P < 0.05).

Relative MT1 mRNA level

1.6 b

In vitro In vivo

b

1.2 ab

0.8

ab

ab

ab a

0.4

a

ab

ab ab

ab a

a a

a

0.0

3

6

9

12

15

18

21

24

Zeitgeber time Fig. 6. Diurnal variations in MT1 mRNA expression in the pineal gland in vivo and in vitro under 12-h L/12-h D (LD) conditions. Each value represents mean ± SEM of 5–6 individuals. The relative values of MT1 mRNA expression were normalized against b-actin values and then averaged. Solid and open bars along the x-axis represent the dark and light phases, respectively. Means represented by different letters are significant (P < 0.05).

Vanecˇek, 1992). In contrast, using a real-time PCR assay, daily variations in melatonin receptor gene expression have been demonstrated only for MT1 and MT2 in the chum salmon (Shi et al., 2004) and for MT2 in the golden rabbitfish (Park et al., 2006). In the present study, we showed a day–night variation in MT1 mRNA expression in the retina (ZT18) and whole brain (ZT21) of the golden rabbitfish, with higher levels of expression during nighttime. Since both tissues showed similar variations in MT1 mRNA expression under DD and LL conditions, it is likely that MT1 mRNA expression in both tissues is under circadian regulation. The peak of MT1 mRNA expression was also observed in the pineal gland in vivo and in vitro experiments under LD conditions at ZT18 and ZT21, respectively. It is possible that diurnal variations in MT1 mRNA expression in the whole brain are partially due to the pineal gland, similar to that demonstrated in the MT2 of the golden rabbitfish (Park et al., 2006). However, it cannot be ruled out that the other regions of the brain may contribute to daily variations in MT1 mRNA expression. In European sea bass, the density of melatonin binding sites in the dis-

260

a

Y.-J. Park et al. / General and Comparative Endocrinology 150 (2007) 253–262 220

b *

160 120 80 40

120 80

0

Control

Light

3.2

d Relative MT1 mRNA level

*

Relative MT1 mRNA level

160

40

0

c

*

200

Melatonin (pg/ml)

Melatonin (pg/ml)

200

220

2.4

1.6

0.8

0

Control

Dark

Control

Dark

0.4

0.3

0.2

0.1

0

Control

Light

Fig. 7. Effect of light conditions on the melatonin content in the medium (a and b) and on the expression level of MT1 mRNA in the cultured pineal gland (c and d). The pineal gland (n = 5–6) was exposed to light (1000 l·) (a and c) and dark conditions (b and d) at ZT18 and ZT6, respectively, and placed under each condition for 2 h. Open and solid columns indicate the control and experimental groups, respectively. Asterisks indicate statistical significance at P < 0.05.

crete brain were highest in the mesencephalic optic tectum– tegmentum and hypothalamus, intermediate in the telencephalon, cerebellum–vestibulolateral lobe and medulla oblongata-spinal cord, and lowest in the olfactory bulbs (Bayarri et al., 2004a). Moreover, day–night differences were also observed in the binding of the optic tectum–thalamus membranes of the European sea bass (Bayarri et al., 2004a). Thus, it would be interesting to examine the region of the brain that is responsible for diurnal variations in the expression of melatonin receptor genes. In the chum salmon, MT1 mRNA expression in the brain, but not in the retina, showed two peaks at noon (ZT6) and midnight (ZT18) (Shi et al., 2004). Although the available data are limited, the expression pattern of MT1 mRNA may be different among the teleost species. In this regard, it may be stated that the melatonin production in the pineal gland of salmonids is regulated by light– dark cycles but not in a circadian manner (Coon et al., 1998; Gern and Greenhouse, 1988; Max and Meneker, 1992). This is in contrast to the golden rabbitfish, in which melatonin synthesis in the cultured pineal gland shows clear diurnal variations with a peak at midnight and appears to be regulated in a circadian manner (Takemura et al., 2006). Therefore, it appears that the difference in

the gene expression of melatonin receptors between the chum salmon and golden rabbitfish is attributed to the variations in the functions of their pineal gland. In vitro, the exposure of the pineal gland to alternation in light conditions during the dark period resulted in a remarkable decrease in MT1 mRNA expression. When the conditions were reversed, MT1 mRNA expression appeared to increase, although its level was low. Concomitant with these changes in MT1 mRNA expression, the melatonin content in the medium also showed positive changes. These results may imply that the expression of melatonin receptors, at least that of MT1, in the pineal gland is related to melatonin actions by photoperiod in natural habitats as well as by endogenous clocks. In goldfish, it has been demonstrated that the rhythm of melatonin binding sites in the brain diminished after pinealectomy or exposure to constant light conditions (Iigo et al., 1995). A similar experimental evidence is necessary to confirm the direct effect of melatonin on the regulation of its receptors in the pineal gland. In conclusion, it appears that the expression of MT1 mRNA in the pineal gland of the golden rabbitfish is regulated in a diurnal manner. In the present study, we did not evaluate the role of melatonin receptors in lunar-related activities in the golden rabbitfish. Takemura et al. (2004a) found that the exposure of the golden rabbitfish to the ‘‘brightness’’ of midnight during the full and new moon periods resulted in a rapid decrease in the melatonin concentration in the blood circulation. Similarly, the exposure of the cultured pineal gland of the golden rabbitfish to the full moon or new moon periods suppressed melatonin synthesis (Takemura et al., 2006). It is possible that the perception of changes in moonlight-related cues in the fish species is mediated through melatonin receptors by melatonin production and release in the pineal gland. Further studies are required to clarify the interaction between melatonin and its receptors during their role in daily and monthly activities in fish. Acknowledgments The authors express their deepest gratitude to Prof. M. Nakamura, Sesoko Station, Tropical Biosphere Research Center (TBRC), University of the Ryukyus for his useful advice and encouragement, and to Dr. Felix Ayson, a foreign visiting researcher of TBRC, for his critical reading of and useful comments to the manuscript. This study was supported in part by a Grant-in-Aid for Scientific Research, and a Joint Research Project under the Japan–Korea Basic Scientific Cooperation Program from Japan Society for the Promotion of Science to A.T. and in part by the 21st Century COE program of the University of the Ryukyus from the Ministry of Education, Culture, Sports, Science and Technology, Japan. This was contribution from the Sesoko Station, Tropical Biosphere Research Center, University of the Ryukyus, Okinawa, Japan.

Y.-J. Park et al. / General and Comparative Endocrinology 150 (2007) 253–262

References Bayarri, M.J., Garcia-Allegue, R., Mun˜oz-Cueto, J.A., Madrid, J.A., Sa´nchez-Va´zquez, F.J., Iigo, M., 2004a. Melatonin binding sites in the brain of European sea bass (Dicentrarchus labrax). Zool. Sci. 21, 427– 434. Bayarri, M.J., Iigo, M., Mun˜oz-Cueto, J.A., Isorna, E., Delgado, M.J., Madrid, J.A., Sa´nchez-Va´zquez, F.J., Alonso-Go´mez, A.L., 2004b. Binding characteristics and daily rhythms of melatonin receptors are distinct in the retina and the brain areas of the European sea bass retina (Dicentrarchus labrax). Brain Res. 1029, 241–250. Cahill, G.M., 1996. Circadian regulation of melatonin production in cultured zebrafish pineal and retina. Brain Res. 708, 177–181. Collin, J.P., Voisin, P., Falco´n, J., Faure, J.P., Brisson, P., Defaye, J.R., 1989. Pineal transducers in the course of evolution: molecular organization, rhythmic metabolic activity and role. Arch. Histol. Cytol. 52, 441–449. Coon, S.L., Be´gay, V., Falco´n, J., Klein, D.C., 1998. Expression of melatonin synthesis genes in controlled by a circadian clock in the pike pineal organ but not in the trout. Biol. Cell 90, 399–405. Drew, J.E., Williams, L.M., Hannah, L.T., Barrett, P., Abramovich, D.R., 1998. Melatonin receptor in the human fetal kidney: 2-[125I]iodomelatonin binding sites correlated with expression of Mel1a and Mel1b receptor genes. J. Endocrinol. 156, 261–267. Dubocovich, M.L., 1988. Pharmacology and function of melatonin receptors. FASEB J. 2, 2765–2773. Dubocovich, M.L., 1995. Melatonin receptor: are there multiple subtypes? Trends Pharmacol. Sci. 16, 50–56. Dubocovich, M.L., Rivera-Bermudez, M.A., Gerdin, M.J., Masana, M.I., 2003. Molecular pharmacology, regulation and function of mammalian melatonin receptors. Front. Biosci. 8, d1093–d1108. Dubocovich, M.L., Cardinali, D.P., Delagrange, P.R.M., Krause, D.N., Strosberg, D., Sugden, D., Yocca, F.D., 2000. Melatonin receptors. In: Girdlestone, D., Iuphar (Eds.), The IUPHAR Compendium of Receptor Characterization and Classification, second ed. IUPHAR Media, London, pp. 270–277. Ebisawa, T., Karne, S., Lerner, M.R., Reppert, S.M., 1994. Expression cloning of a high-affinity melatonin receptor from Xenopus dermal melanophores. Proc. Natl. Acad. Sci. USA 91, 6133–6137. Ekstro¨m, P., Vanecˇek, J., 1992. Localization of 2-[125I]iodomelatonin binding sites in the brain of the Atlantic salmon, Salmo salar L.. Neuroendocrinology 55, 529–537. Falco´n, J., Molina-Borja, M., Collin, J.P., Oakin, S., 1996. Age-related changes in 2-[125I]iodomelatonin binding sites in the brain of sea breams (Sparus aurata, L). Fish Physiol. Biochem. 15, 401–411. Falco´n, J., Thibault, C., Be´gay, V., Zachmann, A., Collin, J.P., 1992. Regulation of the rhythmic melatonin secretion by fish pineal photoreceptor cells. In: Ali, M.A. (Ed.), Rhythms in fishes, NATOASI Ser. A. Plenum Press, New York, pp. 167–198. Gaildrat, P., Ron, B., Falco´n, J., 1998. Daily and circadian variations in 2[125I]iodomelatonin binding sites in the pike brain (Esox lucius). J. Neuroendocrinol. 10, 511–517. Gauer, F., Masson-Pe´vet, M., Pe´vet, P., 1993a. Melatonin receptor density is regulated in pars tuberalis and suprachiasmatic nuclei by melatonin itself. Brain Res. 602, 153–156. Gauer, F., Masson-Pe´vet, M., Stehle, J., Pe´vet, P., 1994. Daily variations in melatonin receptor density of rat pars tuberalis and suprachiasmatic nuclei are distinctly regulated. Brain Res. 641, 92–98. Gauer, F., Masson-Pe´vet, M., Skene, D.J., Vivien-Roels, B., Pe´vet, P., 1993b. Daily rhythms of melatonin binding sites in the rat pars tuberalis and suprachiasmatic nuclei: evidence for a regulation of melatonin receptors by melatonin itself. Neuroendocrinology 57, 120– 126. Gern, W.A., Greenhouse, S.S., 1988. Examination of in vitro melatonin secretion from superfused trout (Salmo gairdneri) pineal organs maintained under diel illumination or continuous darkness. Gen. Comp. Endocrinol. 71, 163–174.

261

Guerrero, H.Y., Gauer, F., Schuster, C., Pe´vet, P., Masson-Pe´vet, M., 2000. Melatonin regulates the mRNA expression of the mt1 melatonin receptor in the rat pars tuberalis. Neuroendocrinology 71, 163–169. Hara, S., Duray, M.N., Parazo, M., Taki, Y., 1986. Year-round spawning and seed production of the rabbitfish, Siganus guttatus. Aquaculture 59, 259–272. Harahap, A.P., Takemura, A., Nakamura, S., Rahman, M.S., Takano, K., 2001. Histological evidence of lunar-syncronized ovarian development and spawning in the spiny rabbitfish, Siganus spinus (Linnaeus), around the Ryukyus. Fish. Sci. 67, 888–893. Hoque, M.M., Takemura, A., Matsuyama, M., Matsuura, S., Takano, K., 1999. Lunar spawning in Siganus canaliculatus. J. Fish Biol. 55, 1213– 1222. Iigo, M., Kobayashi, M., Ohtani-Kaneko, R., Hara, M., Hattory, A., Suzuki, T., Aida, K., 1994. Characteristics, day–night changes, subcellular distribution and localization of melatonin binding sites in the goldfish brain. Brain Res. 644, 213–220. Iigo, M., Furukawa, K., Hattori, A., Hara, M., Ohtani-Kaneko, R., Suzuki, T., Tabata, M., Aida, K., 1995. Effects of pinealectomy and constant light exposure on day–night changes of melatonin binding sites in the goldfish brain. Neurosci. Lett. 197, 61–64. Iigo, M., Sa´nchez-Va´zquez, F.J., Hara, M., Ohtani-Kaneko, R., Hirata, K., Shinohara, H., Tabata, M., Aida, K., 1997. Characterization, guanosine 5 0 -O-(3-thiotriphosphate) modulation, daily variation, and localization of melatonin-binding sites in the catfish (Silurus asotus) brain. Gen. Comp. Endocrinol. 108, 45–55. Martinoli, M.G., Williams, L.M., Kah, O., Titchener, L.T., Pelletier, G., 1991. Distribution of central melatonin binding sites in the goldfish (Carassius auratus). Mol. Cell. Neurosci. 2, 78–85. Masson-Pe´vet, M., Bianchi, L., Pe´vet, P., 1996. Circadian photic regulation of melatonin receptor density in rat suprachiasmatic nuclei: comparison with light induction of fos-related protein. J. Neurosci. Res. 43, 632–637. Max, M., Meneker, M., 1992. Regulation of melatonin production by light, darkness, and temperature in the trout pineal. J. Comp. Physiol. A 170, 479–489. Mazurais, D., Porter, M., Lethimonier, C., Le Drean, G., Le Goff, P., Randall, C., Pakdel, F., Bromage, N., Kah, O., 2000. Effects of melatonin on liver estrogen receptor and vitellogenin expression rainbow trout: an in vitro and in vivo study. Gen. Comp. Endocrinol. 118, 344–353. Park, Y.J., Park, J.G., Kim, S.J., Lee, Y.D., Rahman, M.S., Takemura, A., 2006. Melatonin receptor of a reef fish with lunar-related rhythmicity: cloning and daily variations. J. Pineal Res. 41, 166–174. Poon, A.M.S., Choy, E.H.Y., Pang, S.F., 2001. Modulation of blood glucose by melatonin: a direct action on melatonin receptors in mouse hepatocytes. Biol. Signal. Recept. 10, 367–379. Rahman, M.S., Takemura, A., Takano, K., 2000. Lunar synchronization of testicular development and plasma steroid hormone profiles in the golden rabbitfish. J. Fish Biol. 57, 1065–1074. Reppert, S.M., Weaver, D.R., Ebisawa, T., 1994. Cloning and characterization of a mammalian melatonin receptor that mediates reproductive and circadian responses. Neuron 13, 1177–1185. Reppert, S.M., Weaver, D.R., Godson, C., 1996. Melatonin receptor step into light: cloning and classification of subtypes. Trends Pharmacol. Sci. 17, 100–102. Reppert, S.M., Weaver, D.R., Cassone, V.M., Godson, C., Kolakowski Jr., L.F., 1995a. Melatonin receptors are for the birds: molecular analysis of two receptor subtypes differentially expressed in chick brain. Neuron 15, 1003–1015. Reppert, S.M., Godson, C., Mahle, C.D., Weaver, D.R., Slaugenhaupt, S.A., Gusella, J.F., 1995b. Molecular characterization of a second melatonin receptor expressed in human retina and brain: the Mel1b melatonin receptor. Proc. Natl. Acad. Sci. USA 92, 8734–8738. Ribelayga, C., Wang, Y., Mangel, S.C., 2003. A circadian clock in the fish retina regulates dopamine release via activation of melatonin receptors. J. Physiol. 554, 467–482.

262

Y.-J. Park et al. / General and Comparative Endocrinology 150 (2007) 253–262

Roca, A.L., Godson, C., Weaver, D.R., Reppert, S.M., 1996. Structure, characterization, and expression of the gene encoding the mouse Mel1a melatonin receptor. Endocrinology 137, 3469– 3477. Scher, J., Wankiewicz, E., Brown, G.M., Fujieda, H., 2002. MT1 melatonin recepotor in the human retina: expression and localization. Invest. Ophthalmol. Vis. Sci. 43, 889–897. Schuster, C., Gauer, F., Malan, A., Recio, J., Pe´vet, P., Masson- Pe´vet, M., 2001. The circadian clock, light/dark cycle and melatonin are differentially involved in the expression of daily and photoperiodic variations in mt(1) melatonin receptors in the Siberian and Syrian hamsters. Neuroendocrinology 74, 55–68. Shi, Q., Ando, H., Coon, S.L., Sato, S., Ban, M., Urano, A., 2004. Embryonic and post-embryonic expression of arylalkylamine Nacetyltransferase and melatonin receptor genes in the eye and brain of chum salmon (Oncorhynchus keta). Gen. Comp. Endocrinol. 136, 311–321. Song, Y., Ayre, E.A., Pang, S.F., 1993. [125I]Iodomelatonin-binding sites in mammalian and avian kidneys. Biol. Signals 2, 207–220. Takahashi, J.S., Murakami, N., Nikaido, S.S., Pratt, B.L., Robertson, L.M., 1989. The avian pineal, a vertebrate model system of the circadian oscillator: cellular regulation of circadian rhythms by light, second messengers, and macromolecular synthesis. Recent Prog. Horm. Res. 45, 279–352.

Takemura, A., Susilo, E.S., Rahman, M.D., Morita, M., 2004a. Perception and possible utilization of moonlight intensity for reproductive activities in a lunar-synchronized spawner, the golden rabbitfish. J. Exp. Zool. A 301, 844–851. Takemura, A., Ueda, S., Hiyakawa, N., Nikaido, Y., 2006. A direct influence of moonlight intensity on changes in melatonin production by cultured pineal glands of the golden rabbitfish, Siganus guttatus. J. Pineal Res. 40, 236–241. Takemura, A., Rahman, M.S., Nakamura, S., Park, Y.J., Takano, K., 2004b. Lunar cycles and reproductive activity in reef fishes with particular attention to rabbitfishes. Fish Fisheries 5, 317–328. Vanecˇek, J., 1998. Cellular mechanisms of melatonin action. Physiol. Rev. 78, 687–721. Von Gall, C., Stehle, J.H., Weaver, D.H., 2002. Mammalian melatonin receptors: molecular biology and signal transduction. Cell. Tissue Res. 309, 151–162. Wallace, R.A., Selman, K., 1981. Cellular and dynamic aspects of oocyte growth in teleosts. Am. Zool. 21, 325–343. Wan, Q., Pang, S.F., 1995. 2-[125I]iodomelatonin binding sites in the quail liver: characterization and the effect of guanosine 5 0 -O-(3-thiotriphosphate). Biol. Signals 4, 24–31. Yuan, H., Tang, F., Pang, S.F., 1990. Binding characteristics, regional distribution and diurnal variation of [125I]-Iodomelatonin binding sites in the chicken brain. J. Pineal Res. 9, 179–191.