- Email: [email protected]
Hypocretin System in Mice
NSC 19305
No. of Pages 10
1 November 2019
NEUROSCIENCE 1
RESEARCH ARTICLE K. Ventzke et al. / Neuroscience xxx (2018) xxx–xxx
3 2
Diurnal Regulation of the Orexin/Hypocretin System in Mice
4
Kathrin Ventzke, ay Henrik Oster b and Olaf Jo¨hren a,c*
5
a
6
b
Institute of Neurobiology, University of Lu¨beck, Lu¨beck, Germany
7
c
Center of Brain, Behavior and Metabolism, University of Lu¨beck, Lu¨beck, Germany
9 8
Abstract—A prominent feature of the hypothalamic neuropeptides orexins/hypocretins is their role in the regulation of sleep-wake behavior. While there is strong evidence for a diurnal (i.e. 24-h) rhythmicity of the expression of prepro-orexin (PPO) and its cleavage products, orexin A and B, it is not known whether orexin receptors are also subject to diurnal regulation. Here we ask whether besides the regulation of PPO the expression of the orexin receptor subtypes OX1R and OX2R varies over 24 hours in the mouse brain. The mRNA levels of PPO, OX1R, and OX2R as well as of various clock genes were analyzed over 24 hours in the hypothalamus, cortex, and adrenal glands of male mice using qPCR. We found a significant diurnal regulation of the mRNA levels of PPO as well as both orexin receptor subtypes in the brain, while no regulation was observed in adrenal glands. While in the cortex the mRNA levels of both OX1R and OX2R showed a significant diurnal regulation, in the hypothalamus, only the OX2R mRNA expression was subject to a diurnal rhythm. The expression of both orexin receptor subtypes significantly correlated with that of clock genes. Remarkably, the expression pattern of OX2R showed a strong and highly significant correlation with that of the clock gene Bmal1 in the cortex and hypothalamus. These results suggest that the rhythmic expression of orexin receptors is linked to clock gene expression and that OX2R may potentially play a role in the timing of sleep-wake behavior. Ó 2019 IBRO. Published by Elsevier Ltd. All rights reserved.
Institute for Experimental and Clinical Pharmacology and Toxicology, University of Lu¨beck, Lu¨beck, Germany
Key words: orexin receptor subtypes, OX1R, OX2R, diurnal expression, hypothalamus.
10
INTRODUCTION
11
Orexins/hypocretins are released by proteolytic cleavage from the common precursor protein prepro-orexin (PPO)/ prepro-hypocretin, which is selectively expressed in neurons of the lateral hypothalamic area (de Lecea et al., 1998; Sakurai et al., 1998). Orexin-containing neurons project into numerous brain regions such as the cerebral cortex, the thalamus, the hypothalamus, the brainstem, and the spinal cord (Date et al., 1999; Peyron et al., 1998; van den Pol, 1999). In neurons, orexins mediate their actions via two G-protein coupled receptor subtypes (Sakurai et al., 1998), namely orexin type-1 (OX1R) and orexin type-2 (OX2R) receptors. Orexin receptors are highly expressed in the brain and the distribution of OX1R and OX2R mRNA largely corresponds to
12 13 14 15 16 17 18 19 20 21 22 23 24
the projection sites of orexin-positive nerve fibers (Marcus et al., 2001; Trivedi et al., 1998). According to the broad projection of orexin neurons, orexins are involved in the regulation of a variety of physiological and behavioral mechanisms driving energy homeostasis, arousal, endocrine functions and reward processes (Li et al., 2014). After initial findings showed that PPO is up-regulated by fasting and that orexins stimulate food intake (Sakurai et al., 1998), it is now clear that orexins play an important role in the regulation of sleep-wake behavior (Mieda, 2017). Orexins depolarize histaminergic neurons (Eriksson et al., 2001) to increase alertness (Huang et al., 2001) and an increased activity of orexin neurons can cause insomnia (Prober et al., 2006). In turn, mutations in the OX2R gene (HCRTR2) in narcoleptic canines (Lin et al., 1999) or orexin deficiency in mice (Chemelli et al., 1999) cause narcolepsy-like symptoms and, in humans, narcolepsy is most likely caused by a loss of orexin producing neurons (Nishino et al., 2000; Peyron et al., 2000). More recently, several human genome-wide association studies (GWAS) have linked variants of the OX2R gene to chronotypes in addition to clock gene variants (Hu et al., 2016; Jones et al., 2019; Jones et al., 2016; Lane et al., 2016). Thus, the orexin system represents an important regulator of sleep behavior. Besides the homeostatic drive to sleep, sleep behav-
*Correspondence to: O. Jo¨hren, University of Lu¨beck, Center of Brain, Behavior and Metabolism, Ratzeburger Allee 160, 23562 Lu¨beck, Germany. E-mail address: [email protected] (O. Jo¨hren). y Present address: Department of Anesthesiology and Intensive Care, University of Lu¨beck, Lu¨beck, Germany. Abbreviations: DMH, dorsomedial hypothalamus; GWAS, genomewide association studies; OX1R, orexin type-1 receptor; OX2R, orexin type-2 receptor; PPO, prepro-orexin; PVN, paraventricular nucleus; qPCR, quantitative RT-PCR; SCN, suprachiasmatic nucleus; ZT, zeitgeber time. https://doi.org/10.1016/j.neuroscience.2019.10.002 0306-4522/Ó 2019 IBRO. Published by Elsevier Ltd. All rights reserved. 1
Please cite this article in press as: Ventzke K et al. Diurnal Regulation of the Orexin/Hypocretin System in Mice. Neuroscience (2019), https://doi.org/10.1016/j.neuroscience.2019.10.002
25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50
NSC 19305
No. of Pages 10
1 November 2019
2
K. Ventzke et al. / Neuroscience xxx (2019) xxx–xxx Table 1. Sequences of primers used for RT-PCR of mouse RNA (orientation 50 –30 ).
51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97
Primer
Forward
Reverse
GAPDH OX1R OX2R PPO Bmal1 (ARNTL) Per2 NFIL-3 (E4BP4) DBP
ATGTGTCCGTCGTGGATCTGA TTGGTGCGGAACTGGAAAC TTCCCGGAACTTCTTCTGTGG TGTTCCTGCCGTCTCTACGAA TCAAATGTGGAACCCTAGGCC TTCTCCCATTCGATTCCGC TGGTCCCTCAAATCGGAACA TGCCCGAAGAACGTCATGA
TGAAGTCGCAGGAGACAACCT CCATCAGCATCTTAGCCGTCT TCAGCAGCAACAGCGCTAATC TGGTTACCGTTGGCCTGAA TAGTTGCTGGTCACCCCAAAG TGTGCCTCCCAATGATGAAAG TCGGAAACCTTATAGCCACCG CCCCAACATGCTAAGAGCACA
ior is controlled by the circadian system. In mammals, the circadian rhythm is determined and controlled by the suprachiasmatic nucleus (SCN) (Ibuka and Kawamura, 1975; Moore and Eichler, 1972; Ralph et al., 1990). The SCN itself is entrained to light signals from the environment (Moore and Klein, 1974). At the cellular level, clock genes ensure rhythmicity via interconnected feedback loops of transcription and translation (Balsalobre et al., 1998). Members of the core clock loop essential for the function of circadian rhythms in mammals are the period isoforms Per1 and Per2, the cryptochromes Cry1 and Cry2, and the PAS helix-loop-helix transcription factor coding genes Bmal1 and Clock (Takahashi, 2017). Orexin neurons in the lateral hypothalamus receive direct inputs from the SCN (Abrahamson et al., 2001) and SCN neurons, in turn, are innervated by orexin neurons and express orexin receptors (Belle et al., 2014). The activity of the orexin neurons is controlled by a circadian stimulus, is increased during waking phases, and correlates with motor activity in nocturnal rodents (Marston et al., 2008; Martinez et al., 2002). Moreover, orexin neurons are involved in resetting of the SCN clock by dark pulses (Marston et al., 2008). Orexin A immunoreactivity shows time-dependent changes in rat brain areas associated with awakening, sleep and diurnal rhythm (Taheri et al., 2000) while in extracts from whole mouse brains no effect of daily time was observed on orexins A or orexin B levels (Lin et al., 2002). Within the hypothalamus, prepro-orexin mRNA levels decrease during the light and increased during the dark (active) phase in rats and mice (Justinussen et al., 2015; Taheri et al., 2000). In freely moving rodents, extracellular orexin A levels decrease during the light (inactive) phase and increase during the dark (active) phase in the lateral hypothalamus (Fenzl et al., 2009; Yoshida et al., 2001). Also in the cerebrospinal fluid, orexin A levels increase in the active (dark) phase in rats (Fujiki et al., 2001) and light phase in diurnal squirrel monkeys (Zeitzer et al., 2003). Furthermore, the rhythm of orexin A concentrations in cerebrospinal fluid disappears upon lesion of the SCN (Deboer et al., 2004; Zhang et al., 2004). While these data clearly demonstrate a diurnal regulation of the expression and release of orexins, little is known about the diurnal regulation of orexin receptors. Therefore, we analyzed the expression of the orexin receptor subtypes OX1R and OX2R over 24 hours in addition to PPO and comparison to the expression of selected clock genes in the present study.
Fig. 1. Diurnal expression of PPO mRNA in the mouse hypothalamus during the 24-h light–dark phase (A) and average PPO mRNA levels during the first (ZT0-8) and second (ZT12-20) half of the 24-h day (B). Shown are the means ± SEM (n = 5–6 for each group) in A or the minimum, 25th percentile, median, 75th percentile and maximum in B. Data were fitted with a sine wave function after CircWave analysis, values at ZT24 were not considered. * – p < 0.05, ** – p < 0.01 and *** – p < 0.001 compared to the 0 h value in A or to the first half (ZT0-8) of the 24-h day in B.
EXPERIMENTAL PROCEDURES
98
Tissue preparation and RNA extraction
99
12 weeks old, male C57BL/6N mice were obtained from Charles River Laboratories (Sulzfeld, Germany) and housed in groups of six per cage at constant 12-h light/12-h dark (L/D) cycle conditions with lights on at 7:00 AM (zeitgeber time (ZT)0) at 20 °C with ad libitum access to food and drinking water. To compensate for a 1-h time difference in the L/D cycle compared to the breeder’s location, mice were allowed to adapt for 1 week to the new conditions. All mice were sacrificed within one 24-h period by decapitation in a room separate but next the housing room. At various time points of the L/D cycle (ZT0, ZT4, ZT8, ZT12, ZT16, ZT20, ZT24), corresponding mice were brought into this room and sacrificed immediately. The preparation took 15–20 min for each time. During the dark phase, only red light was present. Brains and adrenal glands were quickly removed, frozen in liquid nitrogen, and stored at 80 °C until dissection. Hypothalami and cerebral cortices were dissected as described earlier for rats (Jo¨hren et al., 2003). To prepare the hypothalamus, mouse brains were adapted to 10 °C in a cryostat. Coronal cuts were made manually with a
100
Please cite this article in press as: Ventzke K et al. Diurnal Regulation of the Orexin/Hypocretin System in Mice. Neuroscience (2019), https://doi.org/10.1016/j.neuroscience.2019.10.002
101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121
NSC 19305
No. of Pages 10
1 November 2019
3
K. Ventzke et al. / Neuroscience xxx (2019) xxx–xxx
Fig. 2. Diurnal hypothalamic mRNA expression of the orexin receptor subtypes OX1R, OX2R, and the clock genes Bmal1, Per2, NIFL-3, and DBP in male mice during the 24-h light–dark phase. Shown are the means ± SEM (n = 5–6 for each group). Data were fitted with a sine wave function after CircWave analysis. Values at ZT24 were not considered. * – p < 0.05; ** – p < 0.01; *** – p < 0.001 compared to the 0 h value.
122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137
sterilized blade at 0.14 mm (just anterior to the optic chiasm) and 2.70 mm (just anterior of the mamillary nucleus) relative to Bregma based on the Paxinos mouse brain atlas (Paxinos and Franklin, 2004). After turning it on its posterior surface, the coronal slice was cut dorsally just ventral to the anterior commissure, placed on the dorsal surface, and cut laterally directly before the amygdala. The cortex including the visual and retrosplenial parts was dissected along the cingulate tract from the dorsal part of the slice. Brain parts were processed for RNA extraction immediately after dissection. Tissues were homogenized in lysis buffer, treated with proteinase K and total RNA was extracted from homogenates in 96-well RNA-purification trays using an ABI Prism 6100 Nucleic Acid Prepstation (Applied Biosystems) according to the manufacturer’s protocol.
Quantitative RT-PCR (qPCR)
138
Reverse transcriptase qPCR was performed as described earlier (Brix et al., 2012). 9 ml of total RNA was reverse transcribed with a Cloned AMV first-strand cDNA synthesis kit (Invitrogen) using oligo-(dT)15 primers. qPCR was accomplished with Platinum SYBR Green qPCR SuperMix-UDG (Invitrogen) on an ABI Prism 7000 Sequence Detection System (Applied Biosystems). For detection of specific cDNA, oligonucleotide primers were designed to amplify cDNA of OX1R, OX2R, PPO, the clock genes Bmal1, Per2, NFIL3, DBP, and the housekeeping gene GAPDH. Primers were obtained from Invitrogen (Karlsruhe, Germany) as indicated (Table 1). Product purity was confirmed by dissociation curve analysis. Calculations of mRNA copy numbers were based on the cycle threshold method using serial dilutions of known amounts of specific cDNA fragments to generate standard curves (Jo¨hren et al., 2001). Expression values of OX1R, OX2R, PPO, Bmal1, Per2, NIFL-3, and DBP were corrected to the variations of mRNA levels of the housekeeping gene GAPDH. We did not observe significant changes in the mRNA levels of GAPDH over 24 hours in our brain and adrenal samples.
139
Statistics
173
140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172
Data analysis was carried out with GraphPad Prism software version 7 (GraphPad Software, La Jolla, CA, USA). One-way ANOVA analysis was used to test for significant differences between expression values at various time points. For the comparisons of expression values, means were compared by Dunnett’s multiple comparison posttests. The existence of a diurnal 24-h rhythm was analyzed using the CircWave v1.4 software as described earlier (Oster et al., 2006). For CircWave analysis, we included the ZT0, ZT4, ZT8, ZT12, ZT16, and ZT20 but not the ZT24 values as we sometimes observed differences between ZT0 and ZT24 values.
174
RESULTS
189
Diurnal rhythms of PPO and orexin receptor subtypes as well as selected clock genes were assessed by analyzing mRNA levels every 4 hours over 24 hours in cortex, hypothalamus, and adrenal glands of mice using qPCR. A subsequent CircWave analysis was used to examine
190
Please cite this article in press as: Ventzke K et al. Diurnal Regulation of the Orexin/Hypocretin System in Mice. Neuroscience (2019), https://doi.org/10.1016/j.neuroscience.2019.10.002
175 176 177 178 179 180 181 182 183 184 185 186 187 188
191 192 193 194
NSC 19305
No. of Pages 10
1 November 2019
4
K. Ventzke et al. / Neuroscience xxx (2019) xxx–xxx
Fig. 3. Average hypothalamic mRNA levels of OX1R, OX2R, Bmal1, Per2, NIFL-3, and DBP in male mice during the first (ZT0-8) and second (ZT12-20) half of the 24-h day. Shown are the minimum, 25th percentile, median, 75th percentile and maximum. *** – p < 0.001 compared to the first half (ZT0-8) of the 24-h day.
195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223
the extent to which the expression of the respective genes has a significant 24 h-cycle. Within the hypothalamus, PPO mRNA expression was significantly regulated over 24 hours (Fig. 1A). CircWave analysis, however, did not reveal a significant 24 h-cycle of PPO mRNA levels. In average, the PPO mRNA expression was significantly higher during the second half of the 24-h day (ZT12-20) when compared to the first half (Fig. 1B). Of the hypothalamic orexin receptors, mRNA levels of OX1R was not altered over 24 hours, whereas OX2R mRNA levels were significantly down regulated at the end of the light phase (ZT12) and showed a significant 24 h-cycle by CircWave analysis (Fig. 2). In addition, the clock genes Bmal1, NFIL-2, and DBP, but not Per2 were significantly regulated over 24 hours in the hypothalamus with significant 24 h-cycles (Fig. 2). OX2R mRNA expression was in phase with that of Bmal1 and NFIL-2 and nearly anti-phasic to that of DBP. Hypothalamic OX2R and Bmal1 showed lower average mRNA expression levels in the second compared to the first half of the 24-h day while no differences between the first and second half of the 24-h day were observed for hypothalamic OX1R or Per2, NFIL-3, and DBP mRNA levels (Fig. 3). Within the cortex, OX1R and OX2R as well as Bmal1, Per2, NFIL-2, and DBP mRNA levels were significantly regulated over 24 hours (Fig. 4). Cortical OX1R, Bmal1, NFIL-2, and DBP mRNA levels also showed a significant 24 h-cycle by CircWave analysis. As in the
hypothalamus, cortical orexin receptor expression was in phase with Bmal1 expression and anti-phasic to DBP expression. In average, OX1R, OX2R, and Bmal1 expression was lower during the second half of the day while DBP mRNA was slightly increased (Fig. 5). The expression of orexin receptor mRNA was also analyzed over 24 hours in adrenal glands, as orexin receptor expression had previously been described in the adrenal cortex (Jo¨hren et al., 2001; Randeva et al., 2001). In contrast to the brain, no clear regulation of OX1R or OX2R mRNA expression was observed in adrenals (Fig. 6). The mRNA levels of adrenal Bmal1, Per2, NFIL-2, and DBP, however, were significantly regulated over 24 hours. In addition, all displayed a significant 24h rhythm (Fig. 6). Average adrenal Per2 and NFIL-3 expressions were significantly higher during the second half of the 24-h day compared to the first half (Fig. 7). Within the hypothalamus and cortex, the expression of both orexin receptor subtypes was positively correlated with the expression of Bmal1, Per1, and NFIL-3 (Table 2). Particularly the diurnal expression of OX2R closely reassembled that of Bmal1 in its course over 24 hours and showed a very strong and highly significant (p < 10-10) correlation with the expression of Bmal1. In adrenal glands, only a weak negative correlation was observed between OX2R and Bmal1 expression. No correlation was observed between hypothalamic mRNA expression of PPO and that of clock genes.
224
DISCUSSION
252
In this study, we confirm the diurnal expression of hypothalamic PPO and demonstrate a diurnal regulation of OX1 and OX2 receptor subtypes in the mouse cortex and hypothalamus. As expected for orexins, within the hypothalamus of mice we found higher expression of PPO mRNA during the second half of the day confirming the decrease of PPO mRNA levels during the light and its increase during the active phase of the day as shown by others in nocturnal rats and mice (Justinussen et al., 2015; Taheri et al., 2000). The 24-h course of PPO mRNA described in the present study is also comparable to that of orexin A levels in the hypothalamus and in cerebrospinal fluid of rats (Fujiki et al., 2001; Taheri et al., 2000). Zeitzer et al. found low concentrations of orexin A in the cerebrospinal fluid at the beginning of the light (active) phase in diurnal squirrel monkeys that increased to maximum levels at the end of the light phase (Zeitzer et al., 2003). Here, we also detected the highest level of PPO mRNA during the second half of the day within the active phase of the mice. In nocturnal and diurnal rodents, orexin neurons exhibit a diurnal oscillation of c-Fos expression that correlates rather with activity and arousal than with wakefulness per se (Espana et al., 2003; Estabrooke et al., 2001; Martinez et al., 2002; Nixon and Smale, 2004). Under constant light, which suppresses locomotor activity, the diurnal rhythmicity of cFos expression in orexin neurons persists in mice and c-Fos expression is enhanced by dark pulses, which results in phase advances of the subjective day indicating
253
Please cite this article in press as: Ventzke K et al. Diurnal Regulation of the Orexin/Hypocretin System in Mice. Neuroscience (2019), https://doi.org/10.1016/j.neuroscience.2019.10.002
225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251
254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282
NSC 19305
No. of Pages 10
1 November 2019
K. Ventzke et al. / Neuroscience xxx (2019) xxx–xxx
283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300
5
2004). Thus, the circadian orexin expression and activity of orexin neurons is downstream of the SCN and orexins apparently do not affect the SCN. Besides the increase of PPO mRNA levels during the second half of the day, we found a significant regulation of both orexin receptor subtypes in the mouse brain. In the cortex, mRNA levels of OX1R and OX2R were reduced during the second half of the day. Within the hypothalamus, only OX2R mRNA levels were reduced. The higher concentration and the diurnal rhythm of OX2R in the hypothalamus suggests that here the OX2R may play a prominent role in the diurnal regulation of orexin functions. Wang et al. recently addressed the diurnal mRNA expression of both orexin receptor subtypes in the perifornical area of the lateral hypothalamus in mice (Wang et al., 2017). However, Wang et al. could not detect a significant regulation of orexin receptor mRNA levels over 24 h, although they described a weak rhythmicity of OX1R but not of OX2R in ad libitum fed rats. In the SCN, mRNA levels of OX1R but not OX2R mRNA were increased at ZT12 relative to ZT0 in parallel to the increase of Per2 mRNA indicating a diurnal regulation of OX1R in the SCN and suggesting an interaction of the molecular clock with OX1R Fig. 4. Diurnal cortical mRNA expression of the orexin receptor subtypes OX1R, OX2R, and the (Belle et al., 2014). The differences cock genes Bmal1, Per2, NIFL-3, and DBP mRNA in male mice during the 24-h light–dark phase. between our data and the results of Shown are the means ± SEM (n = 5–6 for each group). Data were fitted with a sine wave function others (Belle et al., 2014; Wang after CircWave analysis. Values at 24 h were not considered. * – p < 0.05; ** – p < 0.01; *** – p < 0.001 compared to the 0 h value. et al., 2017) can be explained by the different hypothalamic areas analyzed and different methodological approaches used, e.g. using extracts a circadian control of orexin neurons by the SCN (Marston from the whole hypothalamus vs. hypothalamic punches. et al., 2008). The increased activity of orexin neurons was Our novel finding of a diurnal regulation of OX2R mRNA apparent already at ZT12 before the start of the main within the hypothalamus could be due to the high expresactivity of mice (Marston et al., 2008). Here, we also found sion of OX2R in hypothalamic areas such as the paravenincreased expression of PPO at ZT8 and ZT12. Increastricular nucleus (PVN) (Marcus et al., 2001), an area that ing levels of PPO mRNA and orexins during increased was not included in the analysis of the aforementioned activity are consistent with the stimulatory effect of orexstudies. ins on arousal-related behavior and may counteract the While PPO mRNA levels increased during the active increasing drive for sleep (Hagan et al., 1999; Zeitzer phase, the mRNA levels of orexin receptors in the et al., 2003). The increased activity of orexin neurons mouse brain decreased during the second half of the and the increased PPO expression before the onset of day. A negative receptor autoregulation may explain this activity, however, indicates that orexin upregulation predivergent regulation. However, it is important to note cedes the activity of mice during the dark phase and is that in the present study we measured mRNA levels not due to increased locomotor activity. Ablation of orexin and not the actual receptor protein. Changes of protein neurons affected food-anticipatory increases of activity in levels may not temporally correlate with that of mRNA food-restricted mice but did not alter the Per2 rhythmicity (Vogel and Marcotte, 2012). During the circadian rhythm in the SCN and the phase uncoupling of Per2 expression of the cell cycle, protein expression can be delayed by in extra-SCN brain areas by food restriction (Mieda et al.,
Please cite this article in press as: Ventzke K et al. Diurnal Regulation of the Orexin/Hypocretin System in Mice. Neuroscience (2019), https://doi.org/10.1016/j.neuroscience.2019.10.002
301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361
NSC 19305
No. of Pages 10
1 November 2019
6
K. Ventzke et al. / Neuroscience xxx (2019) xxx–xxx
Fig. 5. Average cortical mRNA levels of OX1R, OX2R, Bmal1, Per2, NIFL-3, and DBP in male mice during the first (ZT0-8) and second (ZT12-20) half of the 24-h day. Shown are the minimum, 25th percentile, median, 75th percentile and maximum. * – p < 0.05; ** – p < 0.01; *** – p < 0.001 compared to the first half (ZT0-8) of the 24h day.
362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387
more than six hours and even may show an anti-phasic appearance compared to rhythmic expression of the corresponding mRNA (Robles et al., 2014). Thus, posttranslational factors and the half-life of OX2R protein must be considered and the current expression data on OX2R mRNA only allow conclusions about OX2R rhythmicity, but not the exact timing of its activity. A prominent finding of our study is the strong and highly significant correlation of the mRNA levels of Bmal1 and OX2R suggesting a similar transcriptional regulation. A promising molecular mechanism in this context is the regulation of both Bmal1 and OX2R by the sirtuin SIRT1 (Asher et al., 2008; Satoh et al., 2013). Interestingly, genetic variations of both OX2R and clock genes such as Bmal1 are linked to chronotypes (Hu et al., 2016; Jones et al., 2019; Jones et al., 2016; Lane et al., 2016). However, the particular cellular and molecular mechanisms that connect clock gene regulation with sleep are largely unknown (Deboer, 2018). As the activity of orexin neurons peaks in the active phase in both nocturnal and diurnal rodents (Kodama et al., 2005; Martinez et al., 2002) it would be interesting to determine whether the correlation between Bmal1 and OX2R expression is also observed in diurnal animals. In the SCN, clock gene expression depends mainly on the L/D cycle while in extra-SCN brain areas such as the
cortex a phase shift of clock gene expression has been described and may be a result of the integration of light cues and non-photic cues such as daily-restricted feeding (Wakamatsu et al., 2001). Food entrained oscillation of c-Fos activity as well as circadian clock gene expression were found within the hypothalamus in a variety of nuclei including the dorsomedial hypothalamus (DMH) and the PVN (Angeles-Castellanos et al., 2004; Verwey et al., 2007). The expression of clock genes in these extra-SCN hypothalamic nuclei is entrained differentially by various food restriction schemes, is not necessarily in phase with the clock in the SCN, and may even autonomously oscillate (De Araujo et al., 2016; Mieda et al., 2006; Minana-Solis et al., 2009). For instance, Bmal1 mRNA expression peaked at ZG16 in the rat SCN, but at ZG4 in the PVN and was lowest in the PVN at ZG12 (Girotti et al., 2009) notably at a time, we observed the lowest hypothalamic OX2R mRNA levels in our present study. Interestingly, Girotti et al. observed an increased expression of Bmal1 in the evening in food-restricted rats (Girotti et al., 2009) and hypothalamic OX2R expression was increased by food restriction in rats at onset of the dark cycle (Karteris et al., 2005). Thus, a similar regulation of Bmal1 and OX2R expression is also apparent from these studies. Besides their expression in the brain, the orexin receptor subtypes OX1R and, to a higher extent, OX2R are also expressed in the adrenal gland of humans and rats, where OX2R is thought to be involved in the steroidogenesis of glucocorticoids (Jo¨hren et al., 2001; Kagerer et al., 2011; Randeva et al., 2001; Wenzel et al., 2009). Here, we confirm the expression of orexin receptors in the adrenal of mice showing also about 10fold higher expression of OX2R. However, unlike in the mouse brain, the expression of orexin receptors was not rhythmically regulated although we found a prominent circadian regulation of clock genes as described earlier (Oster et al., 2006). Thus, interactions between clock genes and orexin receptors appear to be restricted to the brain and may represent a possible connection between the circadian system and sleep-wake behavior. Although we have found clear daily regulation in the expression of brain PPO and orexin receptor subtypes in the present study, our study has also some limitations. Here, we analyzed the diurnal course of RNA expression, which does not necessarily reflect to diurnal expression of the functional peptides/proteins. In fact, it can be expected that protein is significantly later expressed compared to corresponding mRNA (Robles et al., 2014). Thus, a diurnal regulation can be detected by our RNA data but we cannot conclude on the timing of the protein function especially for orexin receptors as discussed above. The use of the complete hypothalamus without further dissection of other hypothalamic nuclei such as the SCN or the lateral hypothalamic area represents another limitation of our study. Thus, desynchronized expression of clock genes in different hypothalamic nuclei would not be detectable in extracts of the complete hypothalamus. The absence of a diurnal regulation of Per2 in hypothalamic extracts in the present study could be explained by a desynchronization of Per2
Please cite this article in press as: Ventzke K et al. Diurnal Regulation of the Orexin/Hypocretin System in Mice. Neuroscience (2019), https://doi.org/10.1016/j.neuroscience.2019.10.002
388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448
NSC 19305
No. of Pages 10
1 November 2019
7
K. Ventzke et al. / Neuroscience xxx (2019) xxx–xxx
449 450 451 452 453 454 455 456 457 458 459 460
461 462 463 464
with the that of clock genes, particularly Bmal1, suggests an important role of orexins and particularly the OX2R for the diurnal control of sleep-wake behavior as orexins are responsible for alertness and suppress sleep during the active phase (John et al., 2000; Kantor et al., 2009; Weinhold et al., 2014; Zeitzer et al., 2003).
465
AUTHOR CONTRIBUTIONS
475
KV, HO and OJ designed research. HO performed CircWave analysis. KV and OJ performed experiments and analyzed data. KV and OJ wrote the paper.
476
ACKNOWLEDGEMENTS
481
We thank Christine Eichholz and Gudrun Viercke for their technical support. This research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors.
482
REFERENCES
488
Abrahamson EE, Leak RK, Moore RY (2001) The suprachiasmatic nucleus projects to posterior hypothalamic arousal systems. Neuroreport 12:435–440. Angeles-Castellanos M, Aguilar-Roblero R, Escobar C (2004) c-Fos expression in hypothalamic nuclei of food-entrained rats. Am J Physiol Regul Integr Comp Fig. 6. Diurnal adrenal mRNA expression of the orexin receptor subtypes OX1R, OX2R, and the Physiol 286:R158–R165. cock genes Bmal1, Per2, NIFL-3, and DBP mRNA in male mice during the 24-h light–dark phase. Asher G, Gatfield D, Stratmann M, Reinke H, Shown are the means ± SEM (n = 5–6 for each group). Data were fitted with a sine wave function Dibner C, Kreppel F, Mostoslavsky R, Alt after CircWave analysis. Values at 24 h were not considered. * – p < 0.05; ** – p < 0.01; *** – FW, et al. (2008) SIRT1 regulates p < 0.001 compared to the 0 h value. circadian clock gene expression through PER2 deacetylation. Cell 134:317–328. Balsalobre A, Damiola F, Schibler U (1998) A serum shock induces circadian gene expression between different hypothalamic nuclei. In expression in mammalian tissue culture cells. Cell 93:929–937. some analyzes, we found a discrepancy between the Belle MD, Hughes AT, Bechtold DA, Cunningham P, Pierucci M, expression at ZT0 and ZT24, which represent the same Burdakov D, Piggins HD (2014) Acute suppressive and long-term time on different days. No apparent variances during the phase modulation actions of orexin on the Mammalian circadian preparation at these two time points were noticed. The clock. J Neurosci 34:3607–3621. fact that this observation has occurred only selectively Brix B, Mesters JR, Pellerin L, Jo¨hren O (2012) Endothelial cellspeaks against a systematic error in our preparation and derived nitric oxide enhances aerobic glycolysis in astrocytes via HIF-1alpha-mediated target gene activation. J Neurosci analysis. Others describe similar observations 32:9727–9735. (Justinussen et al., 2015). The cause for the observed difChemelli RM, Willie JT, Sinton CM, Elmquist JK, Scammell T, Lee C, ferences is unclear. Small differences in timing during Richardson JA, Williams SC, et al. (1999) Narcolepsy in orexin preparation may have a major impact if gene expression knockout mice: molecular genetics of sleep regulation. Cell changes rapidly during this time window. 98:437–451. Date Y, Ueta Y, Yamashita H, Yamaguchi H, Matsukura S, Kangawa K, Sakurai T, Yanagisawa M, et al. (1999) Orexins, orexigenic CONCLUSION hypothalamic peptides, interact with autonomic, neuroendocrine and neuroregulatory systems. Proc Natl Acad Sci USA Besides the expression of orexins, also the expression of 96:748–753. central orexin receptors is subject to diurnal regulation. De Araujo LD, Roa SL, Bueno AC, Coeli-Lacchini FB, Martins CS, The strong correlation of the diurnal expression of OX2R Uchoa ET, Antunes-Rodrigues J, Elias LL, et al. (2016) Restricted
Please cite this article in press as: Ventzke K et al. Diurnal Regulation of the Orexin/Hypocretin System in Mice. Neuroscience (2019), https://doi.org/10.1016/j.neuroscience.2019.10.002
466 467 468 469 470 471 472 473 474
477 478 479 480
483 484 485 486 487
489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525
NSC 19305
No. of Pages 10
1 November 2019
8
K. Ventzke et al. / Neuroscience xxx (2019) xxx–xxx
Fig. 7. Average adrenal mRNA levels of OX1R, OX2R, Bmal1, Per2, NIFL-3, and DBP in male mice during the first (ZT0-8) and second (ZT12-20) half of the 24-h day. Shown are the minimum, 25th percentile, median, 75th percentile and maximum. *** – p < 0.001 compared to the first half (ZT0-8) of the 24-h day.
Table 2. Pearson correlation analysis of clock gene expression and expression of components of the orexin system in mouse brain and adrenal glands. Bmal1
Per2
NFIL-3
DBP
Hypothalamus PPO 0.207 ns OX1R 0.504** OX2R 0.895###
0.090 ns 0.482** 0.638***
0.144 ns 0.265 ns 0.442**
0.113 ns 0.108 ns 0.317 ns
Cortex OX1R OX2R
0.596*** 0.837***
0.616*** 0.713***
0.152 0.164
0.150 ns 0.043 ns
0.087 ns 0.187 ns
0.022 ns 0.224 ns
0.831*** 0.878###
Adrenal glands OX1R 0.090 ns OX2R 0.349*
Shown are Pearson’s correlation coefficients (r). * – p < 0.05; ** – p < 0.01; *** – p < 0.001, ### – p < 1010, ns – not significant.
526 527 528 529 530 531 532 533 534 535
feeding schedules modulate in a different manner the expression of clock genes in rat hypothalamic nuclei. Front Neurosci 10:567. de Lecea L, Kilduff TS, Peyron C, Gao X, Foye PE, Danielson PE, Fukuhara C, Battenberg EL, et al. (1998) The hypocretins: hypothalamus-specific peptides with neuroexcitatory activity. Proc Natl Acad Sci USA 95:322–327. Deboer T (2018) Sleep homeostasis and the circadian clock: Do the circadian pacemaker and the sleep homeostat influence each other’s functioning? Neurobiology of Sleep and Circadian Rhythms 5:68–77.
Deboer T, Overeem S, Visser NA, Duindam H, Frolich M, Lammers GJ, Meijer JH (2004) Convergence of circadian and sleep regulatory mechanisms on hypocretin-1. Neuroscience 129:727–732. Eriksson KS, Sergeeva O, Brown RE, Haas HL (2001) Orexin/ hypocretin excites the histaminergic neurons of the tuberomammillary nucleus. J Neurosci 21:9273–9279. Espana RA, Valentino RJ, Berridge CW (2003) Fos immunoreactivity in hypocretin-synthesizing and hypocretin-1 receptor-expressing neurons: effects of diurnal and nocturnal spontaneous waking, stress and hypocretin-1 administration. Neuroscience 121:201–217. Estabrooke IV, McCarthy MT, Ko E, Chou TC, Chemelli RM, Yanagisawa M, Saper CB, Scammell TE (2001) Fos expression in orexin neurons varies with behavioral state. J Neurosci 21:1656–1662. Fenzl T, Flachskamm C, Rossbauer M, Deussing JM, Kimura M (2009) Circadian rhythms of basal orexin levels in the hypothalamus are not influenced by an impaired corticotropinreleasing hormone receptor type 1 system. Behav Brain Res 203:143–145. Fujiki N, Yoshida Y, Ripley B, Honda K, Mignot E, Nishino S (2001) Changes in CSF hypocretin-1 (orexin A) levels in rats across 24 hours and in response to food deprivation. Neuroreport 12:993–997. Girotti M, Weinberg MS, Spencer RL (2009) Diurnal expression of functional and clock-related genes throughout the rat HPA axis: system-wide shifts in response to a restricted feeding schedule. Am J Physiol Endocrinol Metab 296:E888–E897. Hagan JJ, Leslie RA, Patel S, Evans ML, Wattam TA, Holmes S, Benham CD, Taylor SG, et al. (1999) Orexin A activates locus coeruleus cell firing and increases arousal in the rat. Proc Natl Acad Sci USA 96:10911–10916. Hu Y, Shmygelska A, Tran D, Eriksson N, Tung JY, Hinds DA (2016) GWAS of 89,283 individuals identifies genetic variants associated with self-reporting of being a morning person. Nat Commun 7:10448. Huang ZL, Qu WM, Li WD, Mochizuki T, Eguchi N, Watanabe T, Urade Y, Hayaishi O (2001) Arousal effect of orexin A depends on activation of the histaminergic system. Proc Natl Acad Sci USA 98:9965–9970. Ibuka N, Kawamura H (1975) Loss of circadian rhythm in sleepwakefulness cycle in the rat by suprachiasmatic nucleus lesions. Brain Res 96:76–81. John J, Wu MF, Siegel JM (2000) Systemic administration of hypocretin-1 reduces cataplexy and normalizes sleep and waking durations in narcoleptic dogs. Sleep Res Online 3:23–28. Jo¨hren O, Golsch C, Dendorfer A, Qadri F, Ha¨user W, Dominiak P (2003) Differential expression of AT1 receptors in the pituitary and adrenal gland of SHR and WKY. Hypertension 41:984–990. Jo¨hren O, Neidert SJ, Kummer M, Dendorfer A, Dominiak P (2001) Prepro-orexin and orexin receptor mRNAs are differentially expressed in peripheral tissues of male and female rats. Endocrinology 142:3324–3331. Jones SE, Lane JM, Wood AR, van Hees VT, Tyrrell J, Beaumont RN, Jeffries AR, Dashti HS, et al. (2019) Genome-wide association analyses of chronotype in 697,828 individuals provides insights into circadian rhythms. Nat Commun 10:343. Jones SE, Tyrrell J, Wood AR, Beaumont RN, Ruth KS, Tuke MA, Yaghootkar H, Hu Y, et al. (2016) Genome-Wide Association Analyses in 128,266 Individuals Identifies New Morningness and Sleep Duration Loci. PLoS Genet 12 e1006125. Justinussen JL, Holm A, Kornum BR (2015) An optimized method for measuring hypocretin-1 peptide in the mouse brain reveals differential circadian regulation of hypocretin-1 levels rostral and caudal to the hypothalamus. Neuroscience 310:354–361. Kagerer SM, Eichholz C, Jo¨hren O (2011) Orexins/hypocretins increase the promoter activity of selective steroidogenic enzymes. Peptides 32:839–843.
Please cite this article in press as: Ventzke K et al. Diurnal Regulation of the Orexin/Hypocretin System in Mice. Neuroscience (2019), https://doi.org/10.1016/j.neuroscience.2019.10.002
536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591 592 593 594 595 596 597 598 599 600 601 602 603 604
NSC 19305
No. of Pages 10
1 November 2019
K. Ventzke et al. / Neuroscience xxx (2019) xxx–xxx 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 626 627 628 629 630 631 632 633 634 635 636 637 638 639 640 641 642 643 644 645 646 647 648 649 650 651 652 653 654 655 656 657 658 659 660 661 662 663 664 665 666 667 668 669 670 671 672 673 674
Kantor S, Mochizuki T, Janisiewicz AM, Clark E, Nishino S, Scammell TE (2009) Orexin neurons are necessary for the circadian control of REM sleep. Sleep 32:1127–1134. Karteris E, Machado RJ, Chen J, Zervou S, Hillhouse EW, Randeva HS (2005) Food deprivation differentially modulates orexin receptor expression and signaling in rat hypothalamus and adrenal cortex. Am J Physiol Endocrinol Metab 288: E1089–E1100. Kodama T, Usui S, Honda Y, Kimura M (2005) High Fos expression during the active phase in orexin neurons of a diurnal rodent, Tamias sibiricus barberi. Peptides 26:631–638. Lane JM, Vlasac I, Anderson SG, Kyle SD, Dixon WG, Bechtold DA, Gill S, Little MA, et al. (2016) Genome-wide association analysis identifies novel loci for chronotype in 100,420 individuals from the UK Biobank. Nat Commun 7:10889. Li J, Hu Z, de Lecea L (2014) The hypocretins/orexins: integrators of multiple physiological functions. Br J Pharmacol 171:332–350. Lin L, Faraco J, Li R, Kadotani H, Rogers W, Lin X, Qiu X, de Jong PJ, et al. (1999) The sleep disorder canine narcolepsy is caused by a mutation in the hypocretin (orexin) receptor 2 gene. Cell 98:365–376. Lin L, Wisor J, Shiba T, Taheri S, Yanai K, Wurts S, Lin X, Vitaterna M, et al. (2002) Measurement of hypocretin/orexin content in the mouse brain using an enzyme immunoassay: the effect of circadian time, age and genetic background. Peptides 23:2203–2211. Marcus JN, Aschkenasi CJ, Lee CE, Chemelli RM, Saper CB, Yanagisawa M, Elmquist JK (2001) Differential expression of orexin receptors 1 and 2 in the rat brain. J Comp Neurol 435:6–25. Marston OJ, Williams RH, Canal MM, Samuels RE, Upton N, Piggins HD (2008) Circadian and dark-pulse activation of orexin/ hypocretin neurons. Mol Brain 1:19. Martinez GS, Smale L, Nunez AA (2002) Diurnal and nocturnal rodents show rhythms in orexinergic neurons. Brain Res 955:1–7. Mieda M (2017) The roles of orexins in sleep/wake regulation. Neurosci Res 118:56–65. Mieda M, Williams SC, Richardson JA, Tanaka K, Yanagisawa M (2006) The dorsomedial hypothalamic nucleus as a putative foodentrainable circadian pacemaker. Proc Natl Acad Sci USA 103:12150–12155. Mieda M, Williams SC, Sinton CM, Richardson JA, Sakurai T, Yanagisawa M (2004) Orexin neurons function in an efferent pathway of a food-entrainable circadian oscillator in eliciting foodanticipatory activity and wakefulness. J Neurosci 24:10493–10501. Minana-Solis MC, Angeles-Castellanos M, Feillet C, Pevet P, Challet E, Escobar C (2009) Differential effects of a restricted feeding schedule on clock-gene expression in the hypothalamus of the rat. Chronobiol Int 26:808–820. Moore RY, Eichler VB (1972) Loss of a circadian adrenal corticosterone rhythm following suprachiasmatic lesions in the rat. Brain Res 42:201–206. Moore RY, Klein DC (1974) Visual pathways and the central neural control of a circadian rhythm in pineal serotonin Nacetyltransferase activity. Brain Res 71:17–33. Nishino S, Ripley B, Overeem S, Lammers GJ, Mignot E (2000) Hypocretin (orexin) deficiency in human narcolepsy. Lancet 355:39–40. Nixon JP, Smale L (2004) Individual differences in wheel-running rhythms are related to temporal and spatial patterns of activation of orexin A and B cells in a diurnal rodent (Arvicanthis niloticus). Neuroscience 127:25–34. Oster H, Damerow S, Hut RA, Eichele G (2006a) Transcriptional profiling in the adrenal gland reveals circadian regulation of hormone biosynthesis genes and nucleosome assembly genes. J Biol Rhythms 21:350–361. Oster H, Damerow S, Kiessling S, Jakubcakova V, Abraham D, Tian J, Hoffmann MW, Eichele G (2006b) The circadian rhythm of glucocorticoids is regulated by a gating mechanism residing in the adrenal cortical clock. Cell Metab 4:163–173.
9
Paxinos G, Franklin KBJ (2004) The mouse brain in stereotaxic coordinates. Amsterdam; Boston: Elsevier Academic Press. Peyron C, Faraco J, Rogers W, Ripley B, Overeem S, Charnay Y, Nevsimalova S, Aldrich M, et al. (2000) A mutation in a case of early onset narcolepsy and a generalized absence of hypocretin peptides in human narcoleptic brains. Nat Med 6:991–997. Peyron C, Tighe DK, van den Pol AN, de Lecea L, Heller HC, Sutcliffe JG, Kilduff TS (1998) Neurons containing hypocretin (orexin) project to multiple neuronal systems. J Neurosci 18:9996–10015. Prober DA, Rihel J, Onah AA, Sung RJ, Schier AF (2006) Hypocretin/ orexin overexpression induces an insomnia-like phenotype in zebrafish. J Neurosci 26:13400–13410. Ralph MR, Foster RG, Davis FC, Menaker M (1990) Transplanted suprachiasmatic nucleus determines circadian period. Science 247:975–978. Randeva HS, Karteris E, Grammatopoulos D, Hillhouse EW (2001) Expression of orexin-A and functional orexin type 2 receptors in the human adult adrenals: implications for adrenal function and energy homeostasis. J Clin Endocrinol Metab 86:4808–4813. Robles MS, Cox J, Mann M (2014) In-vivo quantitative proteomics reveals a key contribution of post-transcriptional mechanisms to the circadian regulation of liver metabolism. PLoS Genet 10 e1004047. Sakurai T, Amemiya A, Ishii M, Matsuzaki I, Chemelli RM, Tanaka H, Williams SC, Richardson JA, et al. (1998) Orexins and orexin receptors: a family of hypothalamic neuropeptides and G proteincoupled receptors that regulate feeding behavior. Cell 92:573–585. Satoh A, Brace CS, Rensing N, Cliften P, Wozniak DF, Herzog ED, Yamada KA, Imai S (2013) Sirt1 extends life span and delays aging in mice through the regulation of Nk2 homeobox 1 in the DMH and LH. Cell Metab 18:416–430. Taheri S, Sunter D, Dakin C, Moyes S, Seal L, Gardiner J, Rossi M, Ghatei M, et al. (2000) Diurnal variation in orexin A immunoreactivity and prepro-orexin mRNA in the rat central nervous system. Neurosci Lett 279:109–112. Takahashi JS (2017) Transcriptional architecture of the mammalian circadian clock. Nat Rev Genet 18:164–179. Trivedi P, Yu H, MacNeil DJ, Van der Ploeg LH, Guan XM (1998) Distribution of orexin receptor mRNA in the rat brain. FEBS Lett 438:71–75. van den Pol AN (1999) Hypothalamic hypocretin (orexin): robust innervation of the spinal cord. J Neurosci 19:3171–3182. Verwey M, Khoja Z, Stewart J, Amir S (2007) Differential regulation of the expression of Period2 protein in the limbic forebrain and dorsomedial hypothalamus by daily limited access to highly palatable food in food-deprived and free-fed rats. Neuroscience 147:277–285. Vogel C, Marcotte EM (2012) Insights into the regulation of protein abundance from proteomic and transcriptomic analyses. Nat Rev Genet 13:227–232. Wakamatsu H, Yoshinobu Y, Aida R, Moriya T, Akiyama M, Shibata S (2001) Restricted-feeding-induced anticipatory activity rhythm is associated with a phase-shift of the expression of mPer1 and mPer2 mRNA in the cerebral cortex and hippocampus but not in the suprachiasmatic nucleus of mice. Eur J Neurosci 13:1190–1196. Wang D, Opperhuizen AL, Reznick J, Turner N, Su Y, Cooney GJ, Kalsbeek A (2017) Effects of feeding time on daily rhythms of neuropeptide and clock gene expression in the rat hypothalamus. Brain Res 1671:93–101. Weinhold SL, Seeck-Hirschner M, Nowak A, Hallschmid M, Goder R, Baier PC (2014) The effect of intranasal orexin-A (hypocretin-1) on sleep, wakefulness and attention in narcolepsy with cataplexy. Behav Brain Res 262:8–13. Wenzel J, Grabinski N, Knopp CA, Dendorfer A, Ramanjaneya M, Randeva HS, Ehrhart-Bornstein M, Dominiak P, et al. (2009) Hypocretin/orexin increases the expression of steroidogenic enzymes in human adrenocortical NCI H295R cells. Am J Physiol Regul Integr Comp Physiol 297:R1601–R1609.
Please cite this article in press as: Ventzke K et al. Diurnal Regulation of the Orexin/Hypocretin System in Mice. Neuroscience (2019), https://doi.org/10.1016/j.neuroscience.2019.10.002
675 676 677 678 679 680 681 682 683 684 685 686 687 688 689 690 691 692 693 694 695 696 697 698 699 700 701 702 703 704 705 706 707 708 709 710 711 712 713 714 715 716 717 718 719 720 721 722 723 724 725 726 727 728 729 730 731 732 733 734 735 736 737 738 739 740 741 742 743 744
NSC 19305
No. of Pages 10
1 November 2019
10 745 746 747 748 749 750 756 757 758
K. Ventzke et al. / Neuroscience xxx (2019) xxx–xxx
Yoshida Y, Fujiki N, Nakajima T, Ripley B, Matsumura H, Yoneda H, Mignot E, Nishino S (2001) Fluctuation of extracellular hypocretin1 (orexin A) levels in the rat in relation to the light-dark cycle and sleep-wake activities. Eur J Neurosci 14:1075–1081. Zeitzer JM, Buckmaster CL, Parker KJ, Hauck CM, Lyons DM, Mignot E (2003) Circadian and homeostatic regulation of hypocretin in a
primate model: implications for the consolidation of wakefulness. J Neurosci 23:3555–3560. Zhang S, Zeitzer JM, Yoshida Y, Wisor JP, Nishino S, Edgar DM, Mignot E (2004) Lesions of the suprachiasmatic nucleus eliminate the daily rhythm of hypocretin-1 release. Sleep 27:619–627.
(Received 2 July 2019, Accepted 1 October 2019) (Available online xxxx)
Please cite this article in press as: Ventzke K et al. Diurnal Regulation of the Orexin/Hypocretin System in Mice. Neuroscience (2019), https://doi.org/10.1016/j.neuroscience.2019.10.002
751 752 753 754 755
No. of Pages 10
1 November 2019
NEUROSCIENCE 1
RESEARCH ARTICLE K. Ventzke et al. / Neuroscience xxx (2018) xxx–xxx
3 2
Diurnal Regulation of the Orexin/Hypocretin System in Mice
4
Kathrin Ventzke, ay Henrik Oster b and Olaf Jo¨hren a,c*
5
a
6
b
Institute of Neurobiology, University of Lu¨beck, Lu¨beck, Germany
7
c
Center of Brain, Behavior and Metabolism, University of Lu¨beck, Lu¨beck, Germany
9 8
Abstract—A prominent feature of the hypothalamic neuropeptides orexins/hypocretins is their role in the regulation of sleep-wake behavior. While there is strong evidence for a diurnal (i.e. 24-h) rhythmicity of the expression of prepro-orexin (PPO) and its cleavage products, orexin A and B, it is not known whether orexin receptors are also subject to diurnal regulation. Here we ask whether besides the regulation of PPO the expression of the orexin receptor subtypes OX1R and OX2R varies over 24 hours in the mouse brain. The mRNA levels of PPO, OX1R, and OX2R as well as of various clock genes were analyzed over 24 hours in the hypothalamus, cortex, and adrenal glands of male mice using qPCR. We found a significant diurnal regulation of the mRNA levels of PPO as well as both orexin receptor subtypes in the brain, while no regulation was observed in adrenal glands. While in the cortex the mRNA levels of both OX1R and OX2R showed a significant diurnal regulation, in the hypothalamus, only the OX2R mRNA expression was subject to a diurnal rhythm. The expression of both orexin receptor subtypes significantly correlated with that of clock genes. Remarkably, the expression pattern of OX2R showed a strong and highly significant correlation with that of the clock gene Bmal1 in the cortex and hypothalamus. These results suggest that the rhythmic expression of orexin receptors is linked to clock gene expression and that OX2R may potentially play a role in the timing of sleep-wake behavior. Ó 2019 IBRO. Published by Elsevier Ltd. All rights reserved.
Institute for Experimental and Clinical Pharmacology and Toxicology, University of Lu¨beck, Lu¨beck, Germany
Key words: orexin receptor subtypes, OX1R, OX2R, diurnal expression, hypothalamus.
10
INTRODUCTION
11
Orexins/hypocretins are released by proteolytic cleavage from the common precursor protein prepro-orexin (PPO)/ prepro-hypocretin, which is selectively expressed in neurons of the lateral hypothalamic area (de Lecea et al., 1998; Sakurai et al., 1998). Orexin-containing neurons project into numerous brain regions such as the cerebral cortex, the thalamus, the hypothalamus, the brainstem, and the spinal cord (Date et al., 1999; Peyron et al., 1998; van den Pol, 1999). In neurons, orexins mediate their actions via two G-protein coupled receptor subtypes (Sakurai et al., 1998), namely orexin type-1 (OX1R) and orexin type-2 (OX2R) receptors. Orexin receptors are highly expressed in the brain and the distribution of OX1R and OX2R mRNA largely corresponds to
12 13 14 15 16 17 18 19 20 21 22 23 24
the projection sites of orexin-positive nerve fibers (Marcus et al., 2001; Trivedi et al., 1998). According to the broad projection of orexin neurons, orexins are involved in the regulation of a variety of physiological and behavioral mechanisms driving energy homeostasis, arousal, endocrine functions and reward processes (Li et al., 2014). After initial findings showed that PPO is up-regulated by fasting and that orexins stimulate food intake (Sakurai et al., 1998), it is now clear that orexins play an important role in the regulation of sleep-wake behavior (Mieda, 2017). Orexins depolarize histaminergic neurons (Eriksson et al., 2001) to increase alertness (Huang et al., 2001) and an increased activity of orexin neurons can cause insomnia (Prober et al., 2006). In turn, mutations in the OX2R gene (HCRTR2) in narcoleptic canines (Lin et al., 1999) or orexin deficiency in mice (Chemelli et al., 1999) cause narcolepsy-like symptoms and, in humans, narcolepsy is most likely caused by a loss of orexin producing neurons (Nishino et al., 2000; Peyron et al., 2000). More recently, several human genome-wide association studies (GWAS) have linked variants of the OX2R gene to chronotypes in addition to clock gene variants (Hu et al., 2016; Jones et al., 2019; Jones et al., 2016; Lane et al., 2016). Thus, the orexin system represents an important regulator of sleep behavior. Besides the homeostatic drive to sleep, sleep behav-
*Correspondence to: O. Jo¨hren, University of Lu¨beck, Center of Brain, Behavior and Metabolism, Ratzeburger Allee 160, 23562 Lu¨beck, Germany. E-mail address: [email protected] (O. Jo¨hren). y Present address: Department of Anesthesiology and Intensive Care, University of Lu¨beck, Lu¨beck, Germany. Abbreviations: DMH, dorsomedial hypothalamus; GWAS, genomewide association studies; OX1R, orexin type-1 receptor; OX2R, orexin type-2 receptor; PPO, prepro-orexin; PVN, paraventricular nucleus; qPCR, quantitative RT-PCR; SCN, suprachiasmatic nucleus; ZT, zeitgeber time. https://doi.org/10.1016/j.neuroscience.2019.10.002 0306-4522/Ó 2019 IBRO. Published by Elsevier Ltd. All rights reserved. 1
Please cite this article in press as: Ventzke K et al. Diurnal Regulation of the Orexin/Hypocretin System in Mice. Neuroscience (2019), https://doi.org/10.1016/j.neuroscience.2019.10.002
25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50
NSC 19305
No. of Pages 10
1 November 2019
2
K. Ventzke et al. / Neuroscience xxx (2019) xxx–xxx Table 1. Sequences of primers used for RT-PCR of mouse RNA (orientation 50 –30 ).
51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97
Primer
Forward
Reverse
GAPDH OX1R OX2R PPO Bmal1 (ARNTL) Per2 NFIL-3 (E4BP4) DBP
ATGTGTCCGTCGTGGATCTGA TTGGTGCGGAACTGGAAAC TTCCCGGAACTTCTTCTGTGG TGTTCCTGCCGTCTCTACGAA TCAAATGTGGAACCCTAGGCC TTCTCCCATTCGATTCCGC TGGTCCCTCAAATCGGAACA TGCCCGAAGAACGTCATGA
TGAAGTCGCAGGAGACAACCT CCATCAGCATCTTAGCCGTCT TCAGCAGCAACAGCGCTAATC TGGTTACCGTTGGCCTGAA TAGTTGCTGGTCACCCCAAAG TGTGCCTCCCAATGATGAAAG TCGGAAACCTTATAGCCACCG CCCCAACATGCTAAGAGCACA
ior is controlled by the circadian system. In mammals, the circadian rhythm is determined and controlled by the suprachiasmatic nucleus (SCN) (Ibuka and Kawamura, 1975; Moore and Eichler, 1972; Ralph et al., 1990). The SCN itself is entrained to light signals from the environment (Moore and Klein, 1974). At the cellular level, clock genes ensure rhythmicity via interconnected feedback loops of transcription and translation (Balsalobre et al., 1998). Members of the core clock loop essential for the function of circadian rhythms in mammals are the period isoforms Per1 and Per2, the cryptochromes Cry1 and Cry2, and the PAS helix-loop-helix transcription factor coding genes Bmal1 and Clock (Takahashi, 2017). Orexin neurons in the lateral hypothalamus receive direct inputs from the SCN (Abrahamson et al., 2001) and SCN neurons, in turn, are innervated by orexin neurons and express orexin receptors (Belle et al., 2014). The activity of the orexin neurons is controlled by a circadian stimulus, is increased during waking phases, and correlates with motor activity in nocturnal rodents (Marston et al., 2008; Martinez et al., 2002). Moreover, orexin neurons are involved in resetting of the SCN clock by dark pulses (Marston et al., 2008). Orexin A immunoreactivity shows time-dependent changes in rat brain areas associated with awakening, sleep and diurnal rhythm (Taheri et al., 2000) while in extracts from whole mouse brains no effect of daily time was observed on orexins A or orexin B levels (Lin et al., 2002). Within the hypothalamus, prepro-orexin mRNA levels decrease during the light and increased during the dark (active) phase in rats and mice (Justinussen et al., 2015; Taheri et al., 2000). In freely moving rodents, extracellular orexin A levels decrease during the light (inactive) phase and increase during the dark (active) phase in the lateral hypothalamus (Fenzl et al., 2009; Yoshida et al., 2001). Also in the cerebrospinal fluid, orexin A levels increase in the active (dark) phase in rats (Fujiki et al., 2001) and light phase in diurnal squirrel monkeys (Zeitzer et al., 2003). Furthermore, the rhythm of orexin A concentrations in cerebrospinal fluid disappears upon lesion of the SCN (Deboer et al., 2004; Zhang et al., 2004). While these data clearly demonstrate a diurnal regulation of the expression and release of orexins, little is known about the diurnal regulation of orexin receptors. Therefore, we analyzed the expression of the orexin receptor subtypes OX1R and OX2R over 24 hours in addition to PPO and comparison to the expression of selected clock genes in the present study.
Fig. 1. Diurnal expression of PPO mRNA in the mouse hypothalamus during the 24-h light–dark phase (A) and average PPO mRNA levels during the first (ZT0-8) and second (ZT12-20) half of the 24-h day (B). Shown are the means ± SEM (n = 5–6 for each group) in A or the minimum, 25th percentile, median, 75th percentile and maximum in B. Data were fitted with a sine wave function after CircWave analysis, values at ZT24 were not considered. * – p < 0.05, ** – p < 0.01 and *** – p < 0.001 compared to the 0 h value in A or to the first half (ZT0-8) of the 24-h day in B.
EXPERIMENTAL PROCEDURES
98
Tissue preparation and RNA extraction
99
12 weeks old, male C57BL/6N mice were obtained from Charles River Laboratories (Sulzfeld, Germany) and housed in groups of six per cage at constant 12-h light/12-h dark (L/D) cycle conditions with lights on at 7:00 AM (zeitgeber time (ZT)0) at 20 °C with ad libitum access to food and drinking water. To compensate for a 1-h time difference in the L/D cycle compared to the breeder’s location, mice were allowed to adapt for 1 week to the new conditions. All mice were sacrificed within one 24-h period by decapitation in a room separate but next the housing room. At various time points of the L/D cycle (ZT0, ZT4, ZT8, ZT12, ZT16, ZT20, ZT24), corresponding mice were brought into this room and sacrificed immediately. The preparation took 15–20 min for each time. During the dark phase, only red light was present. Brains and adrenal glands were quickly removed, frozen in liquid nitrogen, and stored at 80 °C until dissection. Hypothalami and cerebral cortices were dissected as described earlier for rats (Jo¨hren et al., 2003). To prepare the hypothalamus, mouse brains were adapted to 10 °C in a cryostat. Coronal cuts were made manually with a
100
Please cite this article in press as: Ventzke K et al. Diurnal Regulation of the Orexin/Hypocretin System in Mice. Neuroscience (2019), https://doi.org/10.1016/j.neuroscience.2019.10.002
101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121
NSC 19305
No. of Pages 10
1 November 2019
3
K. Ventzke et al. / Neuroscience xxx (2019) xxx–xxx
Fig. 2. Diurnal hypothalamic mRNA expression of the orexin receptor subtypes OX1R, OX2R, and the clock genes Bmal1, Per2, NIFL-3, and DBP in male mice during the 24-h light–dark phase. Shown are the means ± SEM (n = 5–6 for each group). Data were fitted with a sine wave function after CircWave analysis. Values at ZT24 were not considered. * – p < 0.05; ** – p < 0.01; *** – p < 0.001 compared to the 0 h value.
122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137
sterilized blade at 0.14 mm (just anterior to the optic chiasm) and 2.70 mm (just anterior of the mamillary nucleus) relative to Bregma based on the Paxinos mouse brain atlas (Paxinos and Franklin, 2004). After turning it on its posterior surface, the coronal slice was cut dorsally just ventral to the anterior commissure, placed on the dorsal surface, and cut laterally directly before the amygdala. The cortex including the visual and retrosplenial parts was dissected along the cingulate tract from the dorsal part of the slice. Brain parts were processed for RNA extraction immediately after dissection. Tissues were homogenized in lysis buffer, treated with proteinase K and total RNA was extracted from homogenates in 96-well RNA-purification trays using an ABI Prism 6100 Nucleic Acid Prepstation (Applied Biosystems) according to the manufacturer’s protocol.
Quantitative RT-PCR (qPCR)
138
Reverse transcriptase qPCR was performed as described earlier (Brix et al., 2012). 9 ml of total RNA was reverse transcribed with a Cloned AMV first-strand cDNA synthesis kit (Invitrogen) using oligo-(dT)15 primers. qPCR was accomplished with Platinum SYBR Green qPCR SuperMix-UDG (Invitrogen) on an ABI Prism 7000 Sequence Detection System (Applied Biosystems). For detection of specific cDNA, oligonucleotide primers were designed to amplify cDNA of OX1R, OX2R, PPO, the clock genes Bmal1, Per2, NFIL3, DBP, and the housekeeping gene GAPDH. Primers were obtained from Invitrogen (Karlsruhe, Germany) as indicated (Table 1). Product purity was confirmed by dissociation curve analysis. Calculations of mRNA copy numbers were based on the cycle threshold method using serial dilutions of known amounts of specific cDNA fragments to generate standard curves (Jo¨hren et al., 2001). Expression values of OX1R, OX2R, PPO, Bmal1, Per2, NIFL-3, and DBP were corrected to the variations of mRNA levels of the housekeeping gene GAPDH. We did not observe significant changes in the mRNA levels of GAPDH over 24 hours in our brain and adrenal samples.
139
Statistics
173
140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172
Data analysis was carried out with GraphPad Prism software version 7 (GraphPad Software, La Jolla, CA, USA). One-way ANOVA analysis was used to test for significant differences between expression values at various time points. For the comparisons of expression values, means were compared by Dunnett’s multiple comparison posttests. The existence of a diurnal 24-h rhythm was analyzed using the CircWave v1.4 software as described earlier (Oster et al., 2006). For CircWave analysis, we included the ZT0, ZT4, ZT8, ZT12, ZT16, and ZT20 but not the ZT24 values as we sometimes observed differences between ZT0 and ZT24 values.
174
RESULTS
189
Diurnal rhythms of PPO and orexin receptor subtypes as well as selected clock genes were assessed by analyzing mRNA levels every 4 hours over 24 hours in cortex, hypothalamus, and adrenal glands of mice using qPCR. A subsequent CircWave analysis was used to examine
190
Please cite this article in press as: Ventzke K et al. Diurnal Regulation of the Orexin/Hypocretin System in Mice. Neuroscience (2019), https://doi.org/10.1016/j.neuroscience.2019.10.002
175 176 177 178 179 180 181 182 183 184 185 186 187 188
191 192 193 194
NSC 19305
No. of Pages 10
1 November 2019
4
K. Ventzke et al. / Neuroscience xxx (2019) xxx–xxx
Fig. 3. Average hypothalamic mRNA levels of OX1R, OX2R, Bmal1, Per2, NIFL-3, and DBP in male mice during the first (ZT0-8) and second (ZT12-20) half of the 24-h day. Shown are the minimum, 25th percentile, median, 75th percentile and maximum. *** – p < 0.001 compared to the first half (ZT0-8) of the 24-h day.
195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223
the extent to which the expression of the respective genes has a significant 24 h-cycle. Within the hypothalamus, PPO mRNA expression was significantly regulated over 24 hours (Fig. 1A). CircWave analysis, however, did not reveal a significant 24 h-cycle of PPO mRNA levels. In average, the PPO mRNA expression was significantly higher during the second half of the 24-h day (ZT12-20) when compared to the first half (Fig. 1B). Of the hypothalamic orexin receptors, mRNA levels of OX1R was not altered over 24 hours, whereas OX2R mRNA levels were significantly down regulated at the end of the light phase (ZT12) and showed a significant 24 h-cycle by CircWave analysis (Fig. 2). In addition, the clock genes Bmal1, NFIL-2, and DBP, but not Per2 were significantly regulated over 24 hours in the hypothalamus with significant 24 h-cycles (Fig. 2). OX2R mRNA expression was in phase with that of Bmal1 and NFIL-2 and nearly anti-phasic to that of DBP. Hypothalamic OX2R and Bmal1 showed lower average mRNA expression levels in the second compared to the first half of the 24-h day while no differences between the first and second half of the 24-h day were observed for hypothalamic OX1R or Per2, NFIL-3, and DBP mRNA levels (Fig. 3). Within the cortex, OX1R and OX2R as well as Bmal1, Per2, NFIL-2, and DBP mRNA levels were significantly regulated over 24 hours (Fig. 4). Cortical OX1R, Bmal1, NFIL-2, and DBP mRNA levels also showed a significant 24 h-cycle by CircWave analysis. As in the
hypothalamus, cortical orexin receptor expression was in phase with Bmal1 expression and anti-phasic to DBP expression. In average, OX1R, OX2R, and Bmal1 expression was lower during the second half of the day while DBP mRNA was slightly increased (Fig. 5). The expression of orexin receptor mRNA was also analyzed over 24 hours in adrenal glands, as orexin receptor expression had previously been described in the adrenal cortex (Jo¨hren et al., 2001; Randeva et al., 2001). In contrast to the brain, no clear regulation of OX1R or OX2R mRNA expression was observed in adrenals (Fig. 6). The mRNA levels of adrenal Bmal1, Per2, NFIL-2, and DBP, however, were significantly regulated over 24 hours. In addition, all displayed a significant 24h rhythm (Fig. 6). Average adrenal Per2 and NFIL-3 expressions were significantly higher during the second half of the 24-h day compared to the first half (Fig. 7). Within the hypothalamus and cortex, the expression of both orexin receptor subtypes was positively correlated with the expression of Bmal1, Per1, and NFIL-3 (Table 2). Particularly the diurnal expression of OX2R closely reassembled that of Bmal1 in its course over 24 hours and showed a very strong and highly significant (p < 10-10) correlation with the expression of Bmal1. In adrenal glands, only a weak negative correlation was observed between OX2R and Bmal1 expression. No correlation was observed between hypothalamic mRNA expression of PPO and that of clock genes.
224
DISCUSSION
252
In this study, we confirm the diurnal expression of hypothalamic PPO and demonstrate a diurnal regulation of OX1 and OX2 receptor subtypes in the mouse cortex and hypothalamus. As expected for orexins, within the hypothalamus of mice we found higher expression of PPO mRNA during the second half of the day confirming the decrease of PPO mRNA levels during the light and its increase during the active phase of the day as shown by others in nocturnal rats and mice (Justinussen et al., 2015; Taheri et al., 2000). The 24-h course of PPO mRNA described in the present study is also comparable to that of orexin A levels in the hypothalamus and in cerebrospinal fluid of rats (Fujiki et al., 2001; Taheri et al., 2000). Zeitzer et al. found low concentrations of orexin A in the cerebrospinal fluid at the beginning of the light (active) phase in diurnal squirrel monkeys that increased to maximum levels at the end of the light phase (Zeitzer et al., 2003). Here, we also detected the highest level of PPO mRNA during the second half of the day within the active phase of the mice. In nocturnal and diurnal rodents, orexin neurons exhibit a diurnal oscillation of c-Fos expression that correlates rather with activity and arousal than with wakefulness per se (Espana et al., 2003; Estabrooke et al., 2001; Martinez et al., 2002; Nixon and Smale, 2004). Under constant light, which suppresses locomotor activity, the diurnal rhythmicity of cFos expression in orexin neurons persists in mice and c-Fos expression is enhanced by dark pulses, which results in phase advances of the subjective day indicating
253
Please cite this article in press as: Ventzke K et al. Diurnal Regulation of the Orexin/Hypocretin System in Mice. Neuroscience (2019), https://doi.org/10.1016/j.neuroscience.2019.10.002
225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251
254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282
NSC 19305
No. of Pages 10
1 November 2019
K. Ventzke et al. / Neuroscience xxx (2019) xxx–xxx
283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300
5
2004). Thus, the circadian orexin expression and activity of orexin neurons is downstream of the SCN and orexins apparently do not affect the SCN. Besides the increase of PPO mRNA levels during the second half of the day, we found a significant regulation of both orexin receptor subtypes in the mouse brain. In the cortex, mRNA levels of OX1R and OX2R were reduced during the second half of the day. Within the hypothalamus, only OX2R mRNA levels were reduced. The higher concentration and the diurnal rhythm of OX2R in the hypothalamus suggests that here the OX2R may play a prominent role in the diurnal regulation of orexin functions. Wang et al. recently addressed the diurnal mRNA expression of both orexin receptor subtypes in the perifornical area of the lateral hypothalamus in mice (Wang et al., 2017). However, Wang et al. could not detect a significant regulation of orexin receptor mRNA levels over 24 h, although they described a weak rhythmicity of OX1R but not of OX2R in ad libitum fed rats. In the SCN, mRNA levels of OX1R but not OX2R mRNA were increased at ZT12 relative to ZT0 in parallel to the increase of Per2 mRNA indicating a diurnal regulation of OX1R in the SCN and suggesting an interaction of the molecular clock with OX1R Fig. 4. Diurnal cortical mRNA expression of the orexin receptor subtypes OX1R, OX2R, and the (Belle et al., 2014). The differences cock genes Bmal1, Per2, NIFL-3, and DBP mRNA in male mice during the 24-h light–dark phase. between our data and the results of Shown are the means ± SEM (n = 5–6 for each group). Data were fitted with a sine wave function others (Belle et al., 2014; Wang after CircWave analysis. Values at 24 h were not considered. * – p < 0.05; ** – p < 0.01; *** – p < 0.001 compared to the 0 h value. et al., 2017) can be explained by the different hypothalamic areas analyzed and different methodological approaches used, e.g. using extracts a circadian control of orexin neurons by the SCN (Marston from the whole hypothalamus vs. hypothalamic punches. et al., 2008). The increased activity of orexin neurons was Our novel finding of a diurnal regulation of OX2R mRNA apparent already at ZT12 before the start of the main within the hypothalamus could be due to the high expresactivity of mice (Marston et al., 2008). Here, we also found sion of OX2R in hypothalamic areas such as the paravenincreased expression of PPO at ZT8 and ZT12. Increastricular nucleus (PVN) (Marcus et al., 2001), an area that ing levels of PPO mRNA and orexins during increased was not included in the analysis of the aforementioned activity are consistent with the stimulatory effect of orexstudies. ins on arousal-related behavior and may counteract the While PPO mRNA levels increased during the active increasing drive for sleep (Hagan et al., 1999; Zeitzer phase, the mRNA levels of orexin receptors in the et al., 2003). The increased activity of orexin neurons mouse brain decreased during the second half of the and the increased PPO expression before the onset of day. A negative receptor autoregulation may explain this activity, however, indicates that orexin upregulation predivergent regulation. However, it is important to note cedes the activity of mice during the dark phase and is that in the present study we measured mRNA levels not due to increased locomotor activity. Ablation of orexin and not the actual receptor protein. Changes of protein neurons affected food-anticipatory increases of activity in levels may not temporally correlate with that of mRNA food-restricted mice but did not alter the Per2 rhythmicity (Vogel and Marcotte, 2012). During the circadian rhythm in the SCN and the phase uncoupling of Per2 expression of the cell cycle, protein expression can be delayed by in extra-SCN brain areas by food restriction (Mieda et al.,
Please cite this article in press as: Ventzke K et al. Diurnal Regulation of the Orexin/Hypocretin System in Mice. Neuroscience (2019), https://doi.org/10.1016/j.neuroscience.2019.10.002
301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361
NSC 19305
No. of Pages 10
1 November 2019
6
K. Ventzke et al. / Neuroscience xxx (2019) xxx–xxx
Fig. 5. Average cortical mRNA levels of OX1R, OX2R, Bmal1, Per2, NIFL-3, and DBP in male mice during the first (ZT0-8) and second (ZT12-20) half of the 24-h day. Shown are the minimum, 25th percentile, median, 75th percentile and maximum. * – p < 0.05; ** – p < 0.01; *** – p < 0.001 compared to the first half (ZT0-8) of the 24h day.
362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387
more than six hours and even may show an anti-phasic appearance compared to rhythmic expression of the corresponding mRNA (Robles et al., 2014). Thus, posttranslational factors and the half-life of OX2R protein must be considered and the current expression data on OX2R mRNA only allow conclusions about OX2R rhythmicity, but not the exact timing of its activity. A prominent finding of our study is the strong and highly significant correlation of the mRNA levels of Bmal1 and OX2R suggesting a similar transcriptional regulation. A promising molecular mechanism in this context is the regulation of both Bmal1 and OX2R by the sirtuin SIRT1 (Asher et al., 2008; Satoh et al., 2013). Interestingly, genetic variations of both OX2R and clock genes such as Bmal1 are linked to chronotypes (Hu et al., 2016; Jones et al., 2019; Jones et al., 2016; Lane et al., 2016). However, the particular cellular and molecular mechanisms that connect clock gene regulation with sleep are largely unknown (Deboer, 2018). As the activity of orexin neurons peaks in the active phase in both nocturnal and diurnal rodents (Kodama et al., 2005; Martinez et al., 2002) it would be interesting to determine whether the correlation between Bmal1 and OX2R expression is also observed in diurnal animals. In the SCN, clock gene expression depends mainly on the L/D cycle while in extra-SCN brain areas such as the
cortex a phase shift of clock gene expression has been described and may be a result of the integration of light cues and non-photic cues such as daily-restricted feeding (Wakamatsu et al., 2001). Food entrained oscillation of c-Fos activity as well as circadian clock gene expression were found within the hypothalamus in a variety of nuclei including the dorsomedial hypothalamus (DMH) and the PVN (Angeles-Castellanos et al., 2004; Verwey et al., 2007). The expression of clock genes in these extra-SCN hypothalamic nuclei is entrained differentially by various food restriction schemes, is not necessarily in phase with the clock in the SCN, and may even autonomously oscillate (De Araujo et al., 2016; Mieda et al., 2006; Minana-Solis et al., 2009). For instance, Bmal1 mRNA expression peaked at ZG16 in the rat SCN, but at ZG4 in the PVN and was lowest in the PVN at ZG12 (Girotti et al., 2009) notably at a time, we observed the lowest hypothalamic OX2R mRNA levels in our present study. Interestingly, Girotti et al. observed an increased expression of Bmal1 in the evening in food-restricted rats (Girotti et al., 2009) and hypothalamic OX2R expression was increased by food restriction in rats at onset of the dark cycle (Karteris et al., 2005). Thus, a similar regulation of Bmal1 and OX2R expression is also apparent from these studies. Besides their expression in the brain, the orexin receptor subtypes OX1R and, to a higher extent, OX2R are also expressed in the adrenal gland of humans and rats, where OX2R is thought to be involved in the steroidogenesis of glucocorticoids (Jo¨hren et al., 2001; Kagerer et al., 2011; Randeva et al., 2001; Wenzel et al., 2009). Here, we confirm the expression of orexin receptors in the adrenal of mice showing also about 10fold higher expression of OX2R. However, unlike in the mouse brain, the expression of orexin receptors was not rhythmically regulated although we found a prominent circadian regulation of clock genes as described earlier (Oster et al., 2006). Thus, interactions between clock genes and orexin receptors appear to be restricted to the brain and may represent a possible connection between the circadian system and sleep-wake behavior. Although we have found clear daily regulation in the expression of brain PPO and orexin receptor subtypes in the present study, our study has also some limitations. Here, we analyzed the diurnal course of RNA expression, which does not necessarily reflect to diurnal expression of the functional peptides/proteins. In fact, it can be expected that protein is significantly later expressed compared to corresponding mRNA (Robles et al., 2014). Thus, a diurnal regulation can be detected by our RNA data but we cannot conclude on the timing of the protein function especially for orexin receptors as discussed above. The use of the complete hypothalamus without further dissection of other hypothalamic nuclei such as the SCN or the lateral hypothalamic area represents another limitation of our study. Thus, desynchronized expression of clock genes in different hypothalamic nuclei would not be detectable in extracts of the complete hypothalamus. The absence of a diurnal regulation of Per2 in hypothalamic extracts in the present study could be explained by a desynchronization of Per2
Please cite this article in press as: Ventzke K et al. Diurnal Regulation of the Orexin/Hypocretin System in Mice. Neuroscience (2019), https://doi.org/10.1016/j.neuroscience.2019.10.002
388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448
NSC 19305
No. of Pages 10
1 November 2019
7
K. Ventzke et al. / Neuroscience xxx (2019) xxx–xxx
449 450 451 452 453 454 455 456 457 458 459 460
461 462 463 464
with the that of clock genes, particularly Bmal1, suggests an important role of orexins and particularly the OX2R for the diurnal control of sleep-wake behavior as orexins are responsible for alertness and suppress sleep during the active phase (John et al., 2000; Kantor et al., 2009; Weinhold et al., 2014; Zeitzer et al., 2003).
465
AUTHOR CONTRIBUTIONS
475
KV, HO and OJ designed research. HO performed CircWave analysis. KV and OJ performed experiments and analyzed data. KV and OJ wrote the paper.
476
ACKNOWLEDGEMENTS
481
We thank Christine Eichholz and Gudrun Viercke for their technical support. This research did not receive any specific grant from funding agencies in the public, commercial, or not-for-profit sectors.
482
REFERENCES
488
Abrahamson EE, Leak RK, Moore RY (2001) The suprachiasmatic nucleus projects to posterior hypothalamic arousal systems. Neuroreport 12:435–440. Angeles-Castellanos M, Aguilar-Roblero R, Escobar C (2004) c-Fos expression in hypothalamic nuclei of food-entrained rats. Am J Physiol Regul Integr Comp Fig. 6. Diurnal adrenal mRNA expression of the orexin receptor subtypes OX1R, OX2R, and the Physiol 286:R158–R165. cock genes Bmal1, Per2, NIFL-3, and DBP mRNA in male mice during the 24-h light–dark phase. Asher G, Gatfield D, Stratmann M, Reinke H, Shown are the means ± SEM (n = 5–6 for each group). Data were fitted with a sine wave function Dibner C, Kreppel F, Mostoslavsky R, Alt after CircWave analysis. Values at 24 h were not considered. * – p < 0.05; ** – p < 0.01; *** – FW, et al. (2008) SIRT1 regulates p < 0.001 compared to the 0 h value. circadian clock gene expression through PER2 deacetylation. Cell 134:317–328. Balsalobre A, Damiola F, Schibler U (1998) A serum shock induces circadian gene expression between different hypothalamic nuclei. In expression in mammalian tissue culture cells. Cell 93:929–937. some analyzes, we found a discrepancy between the Belle MD, Hughes AT, Bechtold DA, Cunningham P, Pierucci M, expression at ZT0 and ZT24, which represent the same Burdakov D, Piggins HD (2014) Acute suppressive and long-term time on different days. No apparent variances during the phase modulation actions of orexin on the Mammalian circadian preparation at these two time points were noticed. The clock. J Neurosci 34:3607–3621. fact that this observation has occurred only selectively Brix B, Mesters JR, Pellerin L, Jo¨hren O (2012) Endothelial cellspeaks against a systematic error in our preparation and derived nitric oxide enhances aerobic glycolysis in astrocytes via HIF-1alpha-mediated target gene activation. J Neurosci analysis. Others describe similar observations 32:9727–9735. (Justinussen et al., 2015). The cause for the observed difChemelli RM, Willie JT, Sinton CM, Elmquist JK, Scammell T, Lee C, ferences is unclear. Small differences in timing during Richardson JA, Williams SC, et al. (1999) Narcolepsy in orexin preparation may have a major impact if gene expression knockout mice: molecular genetics of sleep regulation. Cell changes rapidly during this time window. 98:437–451. Date Y, Ueta Y, Yamashita H, Yamaguchi H, Matsukura S, Kangawa K, Sakurai T, Yanagisawa M, et al. (1999) Orexins, orexigenic CONCLUSION hypothalamic peptides, interact with autonomic, neuroendocrine and neuroregulatory systems. Proc Natl Acad Sci USA Besides the expression of orexins, also the expression of 96:748–753. central orexin receptors is subject to diurnal regulation. De Araujo LD, Roa SL, Bueno AC, Coeli-Lacchini FB, Martins CS, The strong correlation of the diurnal expression of OX2R Uchoa ET, Antunes-Rodrigues J, Elias LL, et al. (2016) Restricted
Please cite this article in press as: Ventzke K et al. Diurnal Regulation of the Orexin/Hypocretin System in Mice. Neuroscience (2019), https://doi.org/10.1016/j.neuroscience.2019.10.002
466 467 468 469 470 471 472 473 474
477 478 479 480
483 484 485 486 487
489 490 491 492 493 494 495 496 497 498 499 500 501 502 503 504 505 506 507 508 509 510 511 512 513 514 515 516 517 518 519 520 521 522 523 524 525
NSC 19305
No. of Pages 10
1 November 2019
8
K. Ventzke et al. / Neuroscience xxx (2019) xxx–xxx
Fig. 7. Average adrenal mRNA levels of OX1R, OX2R, Bmal1, Per2, NIFL-3, and DBP in male mice during the first (ZT0-8) and second (ZT12-20) half of the 24-h day. Shown are the minimum, 25th percentile, median, 75th percentile and maximum. *** – p < 0.001 compared to the first half (ZT0-8) of the 24-h day.
Table 2. Pearson correlation analysis of clock gene expression and expression of components of the orexin system in mouse brain and adrenal glands. Bmal1
Per2
NFIL-3
DBP
Hypothalamus PPO 0.207 ns OX1R 0.504** OX2R 0.895###
0.090 ns 0.482** 0.638***
0.144 ns 0.265 ns 0.442**
0.113 ns 0.108 ns 0.317 ns
Cortex OX1R OX2R
0.596*** 0.837***
0.616*** 0.713***
0.152 0.164
0.150 ns 0.043 ns
0.087 ns 0.187 ns
0.022 ns 0.224 ns
0.831*** 0.878###
Adrenal glands OX1R 0.090 ns OX2R 0.349*
Shown are Pearson’s correlation coefficients (r). * – p < 0.05; ** – p < 0.01; *** – p < 0.001, ### – p < 1010, ns – not significant.
526 527 528 529 530 531 532 533 534 535
feeding schedules modulate in a different manner the expression of clock genes in rat hypothalamic nuclei. Front Neurosci 10:567. de Lecea L, Kilduff TS, Peyron C, Gao X, Foye PE, Danielson PE, Fukuhara C, Battenberg EL, et al. (1998) The hypocretins: hypothalamus-specific peptides with neuroexcitatory activity. Proc Natl Acad Sci USA 95:322–327. Deboer T (2018) Sleep homeostasis and the circadian clock: Do the circadian pacemaker and the sleep homeostat influence each other’s functioning? Neurobiology of Sleep and Circadian Rhythms 5:68–77.
Deboer T, Overeem S, Visser NA, Duindam H, Frolich M, Lammers GJ, Meijer JH (2004) Convergence of circadian and sleep regulatory mechanisms on hypocretin-1. Neuroscience 129:727–732. Eriksson KS, Sergeeva O, Brown RE, Haas HL (2001) Orexin/ hypocretin excites the histaminergic neurons of the tuberomammillary nucleus. J Neurosci 21:9273–9279. Espana RA, Valentino RJ, Berridge CW (2003) Fos immunoreactivity in hypocretin-synthesizing and hypocretin-1 receptor-expressing neurons: effects of diurnal and nocturnal spontaneous waking, stress and hypocretin-1 administration. Neuroscience 121:201–217. Estabrooke IV, McCarthy MT, Ko E, Chou TC, Chemelli RM, Yanagisawa M, Saper CB, Scammell TE (2001) Fos expression in orexin neurons varies with behavioral state. J Neurosci 21:1656–1662. Fenzl T, Flachskamm C, Rossbauer M, Deussing JM, Kimura M (2009) Circadian rhythms of basal orexin levels in the hypothalamus are not influenced by an impaired corticotropinreleasing hormone receptor type 1 system. Behav Brain Res 203:143–145. Fujiki N, Yoshida Y, Ripley B, Honda K, Mignot E, Nishino S (2001) Changes in CSF hypocretin-1 (orexin A) levels in rats across 24 hours and in response to food deprivation. Neuroreport 12:993–997. Girotti M, Weinberg MS, Spencer RL (2009) Diurnal expression of functional and clock-related genes throughout the rat HPA axis: system-wide shifts in response to a restricted feeding schedule. Am J Physiol Endocrinol Metab 296:E888–E897. Hagan JJ, Leslie RA, Patel S, Evans ML, Wattam TA, Holmes S, Benham CD, Taylor SG, et al. (1999) Orexin A activates locus coeruleus cell firing and increases arousal in the rat. Proc Natl Acad Sci USA 96:10911–10916. Hu Y, Shmygelska A, Tran D, Eriksson N, Tung JY, Hinds DA (2016) GWAS of 89,283 individuals identifies genetic variants associated with self-reporting of being a morning person. Nat Commun 7:10448. Huang ZL, Qu WM, Li WD, Mochizuki T, Eguchi N, Watanabe T, Urade Y, Hayaishi O (2001) Arousal effect of orexin A depends on activation of the histaminergic system. Proc Natl Acad Sci USA 98:9965–9970. Ibuka N, Kawamura H (1975) Loss of circadian rhythm in sleepwakefulness cycle in the rat by suprachiasmatic nucleus lesions. Brain Res 96:76–81. John J, Wu MF, Siegel JM (2000) Systemic administration of hypocretin-1 reduces cataplexy and normalizes sleep and waking durations in narcoleptic dogs. Sleep Res Online 3:23–28. Jo¨hren O, Golsch C, Dendorfer A, Qadri F, Ha¨user W, Dominiak P (2003) Differential expression of AT1 receptors in the pituitary and adrenal gland of SHR and WKY. Hypertension 41:984–990. Jo¨hren O, Neidert SJ, Kummer M, Dendorfer A, Dominiak P (2001) Prepro-orexin and orexin receptor mRNAs are differentially expressed in peripheral tissues of male and female rats. Endocrinology 142:3324–3331. Jones SE, Lane JM, Wood AR, van Hees VT, Tyrrell J, Beaumont RN, Jeffries AR, Dashti HS, et al. (2019) Genome-wide association analyses of chronotype in 697,828 individuals provides insights into circadian rhythms. Nat Commun 10:343. Jones SE, Tyrrell J, Wood AR, Beaumont RN, Ruth KS, Tuke MA, Yaghootkar H, Hu Y, et al. (2016) Genome-Wide Association Analyses in 128,266 Individuals Identifies New Morningness and Sleep Duration Loci. PLoS Genet 12 e1006125. Justinussen JL, Holm A, Kornum BR (2015) An optimized method for measuring hypocretin-1 peptide in the mouse brain reveals differential circadian regulation of hypocretin-1 levels rostral and caudal to the hypothalamus. Neuroscience 310:354–361. Kagerer SM, Eichholz C, Jo¨hren O (2011) Orexins/hypocretins increase the promoter activity of selective steroidogenic enzymes. Peptides 32:839–843.
Please cite this article in press as: Ventzke K et al. Diurnal Regulation of the Orexin/Hypocretin System in Mice. Neuroscience (2019), https://doi.org/10.1016/j.neuroscience.2019.10.002
536 537 538 539 540 541 542 543 544 545 546 547 548 549 550 551 552 553 554 555 556 557 558 559 560 561 562 563 564 565 566 567 568 569 570 571 572 573 574 575 576 577 578 579 580 581 582 583 584 585 586 587 588 589 590 591 592 593 594 595 596 597 598 599 600 601 602 603 604
NSC 19305
No. of Pages 10
1 November 2019
K. Ventzke et al. / Neuroscience xxx (2019) xxx–xxx 605 606 607 608 609 610 611 612 613 614 615 616 617 618 619 620 621 622 623 624 625 626 627 628 629 630 631 632 633 634 635 636 637 638 639 640 641 642 643 644 645 646 647 648 649 650 651 652 653 654 655 656 657 658 659 660 661 662 663 664 665 666 667 668 669 670 671 672 673 674
Kantor S, Mochizuki T, Janisiewicz AM, Clark E, Nishino S, Scammell TE (2009) Orexin neurons are necessary for the circadian control of REM sleep. Sleep 32:1127–1134. Karteris E, Machado RJ, Chen J, Zervou S, Hillhouse EW, Randeva HS (2005) Food deprivation differentially modulates orexin receptor expression and signaling in rat hypothalamus and adrenal cortex. Am J Physiol Endocrinol Metab 288: E1089–E1100. Kodama T, Usui S, Honda Y, Kimura M (2005) High Fos expression during the active phase in orexin neurons of a diurnal rodent, Tamias sibiricus barberi. Peptides 26:631–638. Lane JM, Vlasac I, Anderson SG, Kyle SD, Dixon WG, Bechtold DA, Gill S, Little MA, et al. (2016) Genome-wide association analysis identifies novel loci for chronotype in 100,420 individuals from the UK Biobank. Nat Commun 7:10889. Li J, Hu Z, de Lecea L (2014) The hypocretins/orexins: integrators of multiple physiological functions. Br J Pharmacol 171:332–350. Lin L, Faraco J, Li R, Kadotani H, Rogers W, Lin X, Qiu X, de Jong PJ, et al. (1999) The sleep disorder canine narcolepsy is caused by a mutation in the hypocretin (orexin) receptor 2 gene. Cell 98:365–376. Lin L, Wisor J, Shiba T, Taheri S, Yanai K, Wurts S, Lin X, Vitaterna M, et al. (2002) Measurement of hypocretin/orexin content in the mouse brain using an enzyme immunoassay: the effect of circadian time, age and genetic background. Peptides 23:2203–2211. Marcus JN, Aschkenasi CJ, Lee CE, Chemelli RM, Saper CB, Yanagisawa M, Elmquist JK (2001) Differential expression of orexin receptors 1 and 2 in the rat brain. J Comp Neurol 435:6–25. Marston OJ, Williams RH, Canal MM, Samuels RE, Upton N, Piggins HD (2008) Circadian and dark-pulse activation of orexin/ hypocretin neurons. Mol Brain 1:19. Martinez GS, Smale L, Nunez AA (2002) Diurnal and nocturnal rodents show rhythms in orexinergic neurons. Brain Res 955:1–7. Mieda M (2017) The roles of orexins in sleep/wake regulation. Neurosci Res 118:56–65. Mieda M, Williams SC, Richardson JA, Tanaka K, Yanagisawa M (2006) The dorsomedial hypothalamic nucleus as a putative foodentrainable circadian pacemaker. Proc Natl Acad Sci USA 103:12150–12155. Mieda M, Williams SC, Sinton CM, Richardson JA, Sakurai T, Yanagisawa M (2004) Orexin neurons function in an efferent pathway of a food-entrainable circadian oscillator in eliciting foodanticipatory activity and wakefulness. J Neurosci 24:10493–10501. Minana-Solis MC, Angeles-Castellanos M, Feillet C, Pevet P, Challet E, Escobar C (2009) Differential effects of a restricted feeding schedule on clock-gene expression in the hypothalamus of the rat. Chronobiol Int 26:808–820. Moore RY, Eichler VB (1972) Loss of a circadian adrenal corticosterone rhythm following suprachiasmatic lesions in the rat. Brain Res 42:201–206. Moore RY, Klein DC (1974) Visual pathways and the central neural control of a circadian rhythm in pineal serotonin Nacetyltransferase activity. Brain Res 71:17–33. Nishino S, Ripley B, Overeem S, Lammers GJ, Mignot E (2000) Hypocretin (orexin) deficiency in human narcolepsy. Lancet 355:39–40. Nixon JP, Smale L (2004) Individual differences in wheel-running rhythms are related to temporal and spatial patterns of activation of orexin A and B cells in a diurnal rodent (Arvicanthis niloticus). Neuroscience 127:25–34. Oster H, Damerow S, Hut RA, Eichele G (2006a) Transcriptional profiling in the adrenal gland reveals circadian regulation of hormone biosynthesis genes and nucleosome assembly genes. J Biol Rhythms 21:350–361. Oster H, Damerow S, Kiessling S, Jakubcakova V, Abraham D, Tian J, Hoffmann MW, Eichele G (2006b) The circadian rhythm of glucocorticoids is regulated by a gating mechanism residing in the adrenal cortical clock. Cell Metab 4:163–173.
9
Paxinos G, Franklin KBJ (2004) The mouse brain in stereotaxic coordinates. Amsterdam; Boston: Elsevier Academic Press. Peyron C, Faraco J, Rogers W, Ripley B, Overeem S, Charnay Y, Nevsimalova S, Aldrich M, et al. (2000) A mutation in a case of early onset narcolepsy and a generalized absence of hypocretin peptides in human narcoleptic brains. Nat Med 6:991–997. Peyron C, Tighe DK, van den Pol AN, de Lecea L, Heller HC, Sutcliffe JG, Kilduff TS (1998) Neurons containing hypocretin (orexin) project to multiple neuronal systems. J Neurosci 18:9996–10015. Prober DA, Rihel J, Onah AA, Sung RJ, Schier AF (2006) Hypocretin/ orexin overexpression induces an insomnia-like phenotype in zebrafish. J Neurosci 26:13400–13410. Ralph MR, Foster RG, Davis FC, Menaker M (1990) Transplanted suprachiasmatic nucleus determines circadian period. Science 247:975–978. Randeva HS, Karteris E, Grammatopoulos D, Hillhouse EW (2001) Expression of orexin-A and functional orexin type 2 receptors in the human adult adrenals: implications for adrenal function and energy homeostasis. J Clin Endocrinol Metab 86:4808–4813. Robles MS, Cox J, Mann M (2014) In-vivo quantitative proteomics reveals a key contribution of post-transcriptional mechanisms to the circadian regulation of liver metabolism. PLoS Genet 10 e1004047. Sakurai T, Amemiya A, Ishii M, Matsuzaki I, Chemelli RM, Tanaka H, Williams SC, Richardson JA, et al. (1998) Orexins and orexin receptors: a family of hypothalamic neuropeptides and G proteincoupled receptors that regulate feeding behavior. Cell 92:573–585. Satoh A, Brace CS, Rensing N, Cliften P, Wozniak DF, Herzog ED, Yamada KA, Imai S (2013) Sirt1 extends life span and delays aging in mice through the regulation of Nk2 homeobox 1 in the DMH and LH. Cell Metab 18:416–430. Taheri S, Sunter D, Dakin C, Moyes S, Seal L, Gardiner J, Rossi M, Ghatei M, et al. (2000) Diurnal variation in orexin A immunoreactivity and prepro-orexin mRNA in the rat central nervous system. Neurosci Lett 279:109–112. Takahashi JS (2017) Transcriptional architecture of the mammalian circadian clock. Nat Rev Genet 18:164–179. Trivedi P, Yu H, MacNeil DJ, Van der Ploeg LH, Guan XM (1998) Distribution of orexin receptor mRNA in the rat brain. FEBS Lett 438:71–75. van den Pol AN (1999) Hypothalamic hypocretin (orexin): robust innervation of the spinal cord. J Neurosci 19:3171–3182. Verwey M, Khoja Z, Stewart J, Amir S (2007) Differential regulation of the expression of Period2 protein in the limbic forebrain and dorsomedial hypothalamus by daily limited access to highly palatable food in food-deprived and free-fed rats. Neuroscience 147:277–285. Vogel C, Marcotte EM (2012) Insights into the regulation of protein abundance from proteomic and transcriptomic analyses. Nat Rev Genet 13:227–232. Wakamatsu H, Yoshinobu Y, Aida R, Moriya T, Akiyama M, Shibata S (2001) Restricted-feeding-induced anticipatory activity rhythm is associated with a phase-shift of the expression of mPer1 and mPer2 mRNA in the cerebral cortex and hippocampus but not in the suprachiasmatic nucleus of mice. Eur J Neurosci 13:1190–1196. Wang D, Opperhuizen AL, Reznick J, Turner N, Su Y, Cooney GJ, Kalsbeek A (2017) Effects of feeding time on daily rhythms of neuropeptide and clock gene expression in the rat hypothalamus. Brain Res 1671:93–101. Weinhold SL, Seeck-Hirschner M, Nowak A, Hallschmid M, Goder R, Baier PC (2014) The effect of intranasal orexin-A (hypocretin-1) on sleep, wakefulness and attention in narcolepsy with cataplexy. Behav Brain Res 262:8–13. Wenzel J, Grabinski N, Knopp CA, Dendorfer A, Ramanjaneya M, Randeva HS, Ehrhart-Bornstein M, Dominiak P, et al. (2009) Hypocretin/orexin increases the expression of steroidogenic enzymes in human adrenocortical NCI H295R cells. Am J Physiol Regul Integr Comp Physiol 297:R1601–R1609.
Please cite this article in press as: Ventzke K et al. Diurnal Regulation of the Orexin/Hypocretin System in Mice. Neuroscience (2019), https://doi.org/10.1016/j.neuroscience.2019.10.002
675 676 677 678 679 680 681 682 683 684 685 686 687 688 689 690 691 692 693 694 695 696 697 698 699 700 701 702 703 704 705 706 707 708 709 710 711 712 713 714 715 716 717 718 719 720 721 722 723 724 725 726 727 728 729 730 731 732 733 734 735 736 737 738 739 740 741 742 743 744
NSC 19305
No. of Pages 10
1 November 2019
10 745 746 747 748 749 750 756 757 758
K. Ventzke et al. / Neuroscience xxx (2019) xxx–xxx
Yoshida Y, Fujiki N, Nakajima T, Ripley B, Matsumura H, Yoneda H, Mignot E, Nishino S (2001) Fluctuation of extracellular hypocretin1 (orexin A) levels in the rat in relation to the light-dark cycle and sleep-wake activities. Eur J Neurosci 14:1075–1081. Zeitzer JM, Buckmaster CL, Parker KJ, Hauck CM, Lyons DM, Mignot E (2003) Circadian and homeostatic regulation of hypocretin in a
primate model: implications for the consolidation of wakefulness. J Neurosci 23:3555–3560. Zhang S, Zeitzer JM, Yoshida Y, Wisor JP, Nishino S, Edgar DM, Mignot E (2004) Lesions of the suprachiasmatic nucleus eliminate the daily rhythm of hypocretin-1 release. Sleep 27:619–627.
(Received 2 July 2019, Accepted 1 October 2019) (Available online xxxx)
Please cite this article in press as: Ventzke K et al. Diurnal Regulation of the Orexin/Hypocretin System in Mice. Neuroscience (2019), https://doi.org/10.1016/j.neuroscience.2019.10.002
751 752 753 754 755