Diversity and composition of fungal endophytes in semiarid Northwest Venezuela

Journal of Arid Environments 85 (2012) 46e55

Contents lists available at SciVerse ScienceDirect

Journal of Arid Environments journal homepage: www.elsevier.com/locate/jaridenv

Diversity and composition of fungal endophytes in semiarid Northwest Venezuela M. Loro a, C.A. Valero-Jiménez b, S. Nozawa c, L.M. Márquez a, d, * a

Depto. de Biología de Organismos, Universidad Simón Bolívar, Apdo. 89000, Caracas 1080, Venezuela Departmento de Biología, Facultad Experimental de Ciencias, Universidad del Zulia, Maracaibo, Venezuela c Fundación Instituto Botánico de Venezuela Dr. Tobías Lasser, Herbario Nacional de Venezuela, Universidad Central de Venezuela, Apartado 2156, Caracas, Venezuela d Centro de Biotecnología, Fundación Instituto de Estudios Avanzados, IDEA, Sartenejas, Baruta. Edo. Miranda, Caracas 1015-A, Venezuela b

a r t i c l e i n f o

a b s t r a c t

Article history: Received 3 September 2011 Received in revised form 10 April 2012 Accepted 16 April 2012 Available online 23 May 2012

Fungal endophytes grow asymptomatically within the tissues of all vascular plants and some are known to provide their host plants with tolerance to different types of environmental stress. The diversity and incidence of fungal endophytes has been negatively correlated with latitude. However, fungal endophyte communities from arid and semiarid environments do not follow this pattern, arguably due to their extreme conditions. In this study, fungal endophytes were cultured from dominant grasses and sedges growing at three different environments in the neotropical semiarid region of Northwest Venezuela. Operational Taxonomic Units were clearly differentiated using phylogenetic analysis of the ITSrDNA region. The results indicated that the incidence and diversity of fungal endophytes in these samples were comparable with those in other tropical plant communities and those in semiarid temperate grasslands. The most common OTUs within the grasses and sedges were related to Cochliobolus sp. and Phoma sp. (Order Pleosporales). This supports the notion that dark septate fungal endophytes dominate semiarid grasslands worldwide. Ó 2012 Elsevier Ltd. All rights reserved.

Keywords: Biodiversity Dark septate endophytes Endophytic fungi Internal transcribed spacer Poaceae

1. Introduction Most fungal endophytes are ascomycetes, but they are actually defined as a functional group based on their ability to grow asymptomatically within both the aerial and root tissues of all families of vascular plants and bryophytes (Schulz and Boyle, 2006). Many fungal endophytes establish mutualistic associations with their host plants (Saikkonen et al., 2010; Vesterlund et al., 2011), providing benefits that range from protection against herbivores (Albrectsen et al., 2010; Clay, 1988) to stress tolerance (Rodriguez and Redman, 2008; Rodriguez et al., 2008, 2004), which seems to play an important role in shaping plant communities (Rudgers and Clay, 2007). Fungal endophyte communities are extremely diverse; a single tropical forest tree and even a single leaf may harbor a diverse array of fungal species (Arnold et al., 2000). Although the study of patterns of fungal endophyte diversity has been a hot topic of

* Corresponding author. Present address: Center for Infectious Disease Dynamics, Department of Plant Pathology, Pennsylvania State University, Millennium Science Complex, University Park, PA 16802, USA. Tel.: þ1 814 8631741. E-mail addresses: [email protected] (M. Loro), claudiovalero@ gmail.com (C.A. Valero-Jiménez), [email protected] (S. Nozawa), luismarquez_ [email protected] (L.M. Márquez). 0140-1963/$ e see front matter Ó 2012 Elsevier Ltd. All rights reserved. doi:10.1016/j.jaridenv.2012.04.009

debate for a decade, it is not clear yet whether fungal endophyte diversity and incidence follow a general latitudinal pattern of biodiversity. Arnold and Lutzoni (2007) showed that both the diversity and incidence of foliar fungal endophytes from a diverse array of plant communities, ranging from the North American tundra to a lowland tropical forest, gradually increase from high latitudes to low latitudes then peak in the tropics. However, the opposite pattern was observed in the diversity of the fungal endophyte communities associated with the roots of a single host plant, the grass Bouteloua gracilis (Kunth) Lag. ex Griffiths (Herrera et al., 2010). In B. gracilis the largest species richness and diversity of fungal endophytes were estimated in South Dakota, USA and Saskatchewan, Canada, in northerly temperate sites. According to Herrera et al. (2010), this difference may be due to the influence of fundamentally different conditions between above-ground and below-ground environments. In the latitudinal study of Arnold and Lutzoni (2007), annual rainfall was a poor predictor of fungal endophyte incidence and diversity, despite the common association of fungal growth with high humidity. Nevertheless, comparative studies suggest that within a narrow latitude range, the diversity of fungal endophytes can be correlated with environmental humidity. For instance, the fungal endophytes from cupressaceous trees are more diverse in mesic semi-deciduous forests than in xeric environment from 32 to

M. Loro et al. / Journal of Arid Environments 85 (2012) 46e55

36  N (Hoffman and Arnold, 2008). Also, fungal endophyte communities within tropical dry forests seem to be less diverse than their counterparts in tropical humid forests (Suryanarayanan et al., 2003). Because biodiversity in deserts and semiarid regions may not follow latitudinal patterns, these environments are particularly interesting from the standpoint of plant-fungal endophyte interactions. It has been proposed that the benefits provided by fungal endophyte symbioses are driven by the dominant stress factor in the natural environment where the host plant lives (Rodriguez et al., 2008). A few studies of fungal endophyte communities from the roots of grasses in semiarid temperate grasslands indicate that they are dominated by dark septate fungal endophytes (DSE) (order Pleosporales) (Barrow, 2003; Green et al., 2008; Herrera et al., 2010; Khidir et al., 2009; Medina-Roldán et al., 2008; Porras-Alfaro et al., 2008). Although experimental evidence is available for only one species of DSE (Curvularia protuberata) (Rodriguez et al., 2008, 2004), it has been proposed that many of these fungi may provide drought tolerance to host plants (Khidir et al., 2009). Therefore, if a strong selective pressure is in place in these systems, it could be possible that the fungal endophyte communities of all semiarid grasslands are dominated by DSE, independent of latitude. In this study, we cultured and identified fungal endophytes from dominant grasses and sedges growing in three different environments in the neotropical semiarid region of Northwest Venezuela. This is a unique, relatively small and isolated semiarid neotropical pocket rich in endemics, separated from the semiarid regions of Central America by the Darien jungle, and from the Brazilian Caatinga by tropical dry and humid forests (Shmida, 1985). Our aims were to: 1) compare the incidence and diversity of fungal endophytes with those in other tropical plant communities and semiarid temperate grasslands; and 2) identify which fungal endophytes dominate tropical semiarid environments. 2. Materials and methods 2.1. Study sites Sampling was done near the city of Coro in Northwest Venezuela, which is one of the few arid regions in the mainland neotropics. This region has 250e500 mm of rain per year, evapotranspiration of 1600e2300 mm, wind velocity 4e8 m/s and radiation of 5500 kvat/day (Diaz, 2001). Plants were sampled from 3 distinct habitats 15e30 km apart, including: a patch of sand dunes at the isthmus of the Paraguaná Peninsula (113301900 N, 69 420 2200 W), a sandy beach at La Vela de Coro (11270 2100 N, 69 340 3500 W) and a hot spring nearby El Isiro water dam (11190 3100 N, 69 330 4800 W). Localities were chosen to compare distinct habitats within the region where similar plant communities grow. 2.2. Plant sampling and processing Three specimens were collected from each of 13 dominant grasses per locality, plus the addition of one of Paspalum ligulare Nees and at the hot spring three individuals from the sedges Cyperus laevigatus L. and Eleocharis atropurpurea (Retz.) Kunth (Table 1). Whole plants were dug up, bagged individually and transported to the laboratory in an iced cooler. Processing of plants took place within 96 h of collection. Whole plants were washed thoroughly with running tap water, then twice more with double distilled water to remove debris. Afterward, plants were surface-sterilized using sequential immersion in 95% ethanol (10 s), 10% chlorine bleach (0.525% NaOCl, 2 min), and 70% ethanol (2 min) and allowed to surface dry under sterile conditions in a laminar hood. Apparently healthy leaves and photosynthetic stems or roots were cut into small fragments (w1 cm) and plated on potato dextrose agar. Plates were

47

sealed with parafilm, incubated at room temperature, and scored for fungal growth for up to two weeks. Emergent hyphae were isolated into pure culture according to morphotypes, based on colony and hyphae aspect and coloration sensu Lacap et al. (2003). Fungal cultures were photographed, and deposited as living vouchers in the microbial collection at Universidad Simón Bolívar. Plant vouchers were deposited at the Herbario Nacional de Venezuela (VEN). 2.3. Molecular identification of endophytic fungi Species identification was based on sequence analysis of approximately 600 base-pairs from the nuclear ribosomal internal transcribed spacer region (ITSrDNA), which is frequently used in fungi systematics (Arnold and Lutzoni, 2007). For DNA extraction, a small amount of mycelia was scraped from each fungal colony with an applicator stick. Mycelia were suspended in 1 ml lysis buffer (150 mM EDTA, 50 mM Tris 8.0, 2% sarkosyl), ground with a plastic pestle, and frozen solid at 80  C for half an hour. Frozen samples were incubated at 55 c for 5 min and centrifuged at 10,000 g for 15 min to pellet the cellular debris. Supernatant from each sample (700 ml) were transferred to a new tube, then DNA was pelleted by adding 490 mL of PEG/NaCl (20% PEG mw 8000/2.5 M NaCl), incubating at room temperature for 1 hr, and centrifuging at 10,000 g for 15 min. DNA pellets were resuspended in 0.4 ml of 10 mM Tris pH 8.0. Approximately 10 ng of fungal DNA were used as template for a 25 ml PCR reaction that included Promega Taq Polymerase, buffers and dNTPs plus 1 mM each of primers ITS1F (50 TTGGTCATTTAGA GGAAGTAA30 ) and ITS4 (50 TCCTCCGCTTATTGATATGC30 ). Thermal cycling reactions used the following conditions: slope setting of 0.5  C/s, 1 cycle of 94  C, 5 min; 40 cycles of 94  C, 30 s, 60  C, 30 s, and 72  C during 45 s; 1 cycle of 72  C, 10 min. Amplified products were directly sequenced using an ABI 3130xl Genetic Analyzer at the Center for Sequencing and Analysis of Nucleic Acids at the Venezuelan Institute for Scientific Research. Operational Taxonomic Units (OTUs) were defined based upon the criterion of at least 5% divergence in the ITS1-5.8S-ITS2 region as suggested by Arnold and Lutzoni (2007). Sequences obtained in this study were compared with GenBank data using BLAST, and close matching sequences (similarity >97%) were included our phylogenetic analysis to infer species. Maximum Parsimony was used as the phylogenetic inference method in Mega 4 (Tamura et al., 2007) with complete deletion for gaps. The robustness of the topology was tested with 1000 bootstrap iterations. 2.4. Data analyses The composition of fungal endophyte communities was compared among sites using two similarity indices: Morisita-Horn, which takes into account the frequency of occurrence of different species; and Jaccard, which only considers presence-absence data. Similarity indices were calculated using EstimateS (Colwell, 2009). Species diversity was estimated by Fisher-alpha, which should be robust for comparing samples of different sizes, and is commonly used for fungal endophytes (e.g. Arnold and Lutzoni, 2007), as well as Shannon’s diversity index for comparative purposes. 3. Results 3.1. Fungal isolate identification Out of 48 plants screened in this study, a total of 198 fungal isolates were purified into individual axenic cultures. All plants contained fungal endophytes (incidence ¼ 100%), yielding between 2 and 8 morphologically distinct isolates per plant (Fig. 1).

48

M. Loro et al. / Journal of Arid Environments 85 (2012) 46e55

Table 1 List of plants and fungal endophyte OTUs per plant, collected in semiarid Northwest Venezuela. GenBank sequence accession numbers are indicated. Maximum identities with GenBank sequences are indicated between brackets. Environment

Plant

BLASTn closest match (Max Ident %)

No of isolates

Accession number

Sand dunes

Sporobolus pyramidatus (Lam.) Hitchc.

Cochliobolus sp. (97%) Phoma glomerata (99%) Phoma sp. (99%) Acremonium strictum (99%) Dothideomycete sp. (99%) Fusarium equiseti (97%) Cochliobolus sp. (97%) Phoma glomerata (99%) Nigrospora sphaerica (99%) Penicillium sp. (99%) Unknown 5 (94%) Cochliobolus sp. (99%) Phoma sp. (98%) Nigrospora sp. (99%) Cochliobolus hawaiiensis (98%) Cochliobolus sp. (98%) Fusarium equiseti (99%) Neurospora crassa (99%) Unknown 6 (92%) Cochliobolus sp. (97%) Exserohilum rostratum (99%) Unknown 7 (96%) Unknown 8 (96%) Colletotrichum gloeosporioides (99%) Pleosporaceae sp. (100%) Exserohilum rostratum (100%) Botryosphaeria sp. (100%) Cladosporium sp. (100%) Cladosporium oxysporum (99%) Phoma moricola (99%) Phoma glomerata (99%) Curvularia oryzae (98%) Acremonium alternatum (99%) Alternaria sp. (99%) Fusarium equiseti (100%) Sordaria tomento-alba (100%) Curvularia sichuanensis (99%) Phoma sp. (99%) Cladosporium sp. (100%) Nigrospora oryzae (99%) Fusarium sp. (100%) Cochliobolus hawaiiensis (99%) Cochliobolus lunatus (99%) Cochliobolus sp. (98%) Fusarium sp. (100%) Cladorrhinum bulbillosum (99%) Curvularia sp. (100%) Corynascus kuwaitiensis (99%) Trichoderma sp. (98%) Unknown 1 (93%) Cochliobolus hawaiiensis (99%) Nigrospora sphaerica (99%) E. rostratum (99%) Emericella nidulans (100%) Unknown 2 (96%) Cochliobolus sp. (99%) Cladosporium sp. (99%) Phoma sorghina (97%) Phoma sp. (99%) Bartalinia robillardoides (98%) Bartalinia pondoensis (99%) Dothideomycete sp. (98%) Unknown 3 (95%) Cochliobolus hawaiiensis (99%) Cochliobolus sp. (99%) Fusarium sp. (99%) Nectria sp. (99%) Phoma sp. (99%) Sordaria tomento-alba (100%) Unknown 3 (96%) Unknown 4 (94%) Nigrospora oryzae (97%)

3 1 1 1 3 1 1 1 1 1 1 1 1 1 2 1 1 1 1 1 4 1 1 1 1 1 1 1 1 1 1 4 1 1 1 2 1 4 1 3 2 1 1 1 1 1 1 1 1 1 1 3 1 1 1 3 1 1 4 1 1 1 2 1 1 1 6 1 2 1 1 1

JN207282 JN207285 JN207289 JN207284 JN207287 JN207288 JN207295 JN207293 JN207296 JN207294 JN207292 JN207297 JN207299 JN207298 JN207304 JN207301 JN207300 JN207303 JN207302 JN207309 JN207305 JN207306 JN207307 JN207312 JN207313 JN207314 JN207315 JN207316 JN207317 JN207318 JN207343 JN207336 JN207340 JN207341 JN207342 JN207344 JN207346 JN207351 JN207350 JN207354 JN207347 JN207243 JN207244 JN207246 JN207239 JN207240 JN207242 JN207245 JN207238 JN207241 JN207251 JN207247 JN207252 JN207253 JN207250 JN207262 JN207254 JN207259 JN207265 JN207256 JN207255 JN207264 JN207263 JN207274 JN207278 JN207272 JN207269 JN207277 JN207268 JN207275 JN207280 JN207335

Pappophorum krapovickasii Roseng.

Aristida cf. venesuelae Henrard

Leptothrium rigidum Kunth

Eragostris ciliaris (L.) R.Br.

Fimbristylis cymosa R.Br.

Paspalum ligulare Nees

Cyperus laevigatus L.

Cenchrus ciliaris L. Bothriochloa pertusa (L.) A.Camus

Beach

Cenchrus echinatus L.

Sporobolus virginicus (L.) Kunth

Chloris inflata Link (¼ C. barbata Sw.)

Cenchrus cf. spinifex Cav. (¼ C. incertus M.A.Curtis)

Spartina spartinae (Trin.) Merr. ex Hitchc.

M. Loro et al. / Journal of Arid Environments 85 (2012) 46e55

49

Table 1 (continued ) Environment

Plant

BLASTn closest match (Max Ident %)

No of isolates

Accession number

Hot-spring

Cyperus laevigatus L.

Cochliobolus australiensis (98%) Phoma leveillei (100%) Phoma sp. (99%) Didymella sp. (97%) Exserohilum rostratum (99%) Lasiodiplodia pseudotheobromae(99%) Curvularia sp. (99%) Fusarium equiseti (100%) Fusarium sp. (100%) Unknown 9 (92%) Unknown 10 (95%) 4.5  1.8

2 1 1 1 1 1 3 1 2 1 1

JN207324 JN207326 JN207321 JN207320 JN207322 JN207323 JN207327 JN207334 JN207331 JN207328 JN207329

Eleocharis atropurpurea (Retz.) Kunth

Average OTUs/Plant

Due to our inability to amplify DNA from all isolates, we sequenced the ITS1-5.8S-ITS2 region of 120 isolates, taking care to sequence at least one representative of each morphotype from each plant species. Sequences were deposited in NCBI’s GenBank under accession numbers JN207238eJN207357. Comparisons of these sequences against the NCBI database using BLASTN indicated that 108 were highly similar (>97%) to sequences deposited in GenBank. These isolates comprised 44 fungal species, according to the rule of >95% similarity in ITS1-5.8S-ITS2 sequence (Table 1). For only 12 isolates the closest match in GenBank had a similarity <97%. The phylogenetic analysis resulted in a tree with highly supported clades and each one of them included representative sequences from GenBank for only one particular fungal genus (Fig. 2). Using the 5% divergence criterion to define species, together with comparisons to GenBank, we could unequivocally assign each isolate to a particular OTU.

3.2. Fungal community diversity and composition The maximum numbers of OTUs and morphotypes per whole plant, including all organs (roots and photosynthetic steams or leaves), were both eight. We estimated an average of 4.5  1.8 OTUs per plant species (Table 1). Rarefaction curves for all three localities did not show saturation (Fig. 3) indicating that fungal endophyte diversity is underestimated in this study. The Fisher-alpha diversity estimate for the whole fungal endophyte sample was 25.06. Estimates for the three localities indicate that the diversity was largest at the sand dunes, moderate at the sandy beach, and lowest at the hot spring (Table 2). Rarefaction curves support this trend. The dominant genera of fungal endophytes in the whole sample, Phoma and Cochliobolus, were dark septate endophytes (DSE) that belonged to the order Pleosporales (Fig. 4). Nevertheless, 19% of the

Fig. 1. Number of isolates of fungal endophytes per plant in grasses and sedges from semiarid Nortwest Venezuela.

50

M. Loro et al. / Journal of Arid Environments 85 (2012) 46e55

sequences corresponded with genera with a single representative in our sample (singletons) and 8% did not match a particular species (<97% similarity with sequences in GenBank), for a total of 27% rare species (singletons þ unidentified). Phoma and Cochliobolus were present in all 3 distinct habitats within the region, but proportions varied by site (Fig. 5). Some fungal endophytes were isolated exclusively from plants growing in a particular environment: Acremonium species from sand dunes, Nectria and Bartalinia at the beach, Lasiodiplodia and Didymella from the hot spring (Table 1). Also, the largest proportion of rare and unidentified species were isolated from two sedges growing at the hot spring (19 and 12% respectively). The similarity indices indicated that the sand dunes and the beach shared many fungal species. Conversely, the beach and the hot spring shared comparatively few (Table 3). Within the hot spring area, the sedge C. laevigatus was sampled at the edge of the hot water pond where the plants were partially submerged. The composition and relative abundance of fungal endophytes was unique in these plants, as it was completely different from those in plants from the same species growing 50 m away from the pond where the soil was dry and cool. The community of fungal endophytes in plants of C. laevigatus from the hotspring was more similar to that of E. atropurpurea, a sedge that grows w1 m away in a band where the soil is wet and warm (Table 4). We did not find the same species of grass growing at more than one study site. However, we used the similarity indices to compare

Fig. 2. Phylogenetic relationships among 120 isolates of fungal endophytes obtained in culture from asymptomatic dominant grasses and sedges from semiarid Northwest Venezuela and representative species with closest similarity matches obtained by BLAST in GenBank. Tree represents the most parsimonious tree inferred from ca. 600 bp of the ITSrDNA. Bootstrap values of a 1000 iteration process are shown above branches.

Fig. 2. (Continued)

M. Loro et al. / Journal of Arid Environments 85 (2012) 46e55

51

40 35

Sand Dunes

30 25 20 15 10 5 0

Accumulated No of OTUs

0

20

40

60

80

100

40 35

Beach

30 25 20 15

Fig. 4. Relative abundance and composition of the whole fungal endophyte community from grasses and sedges in semiarid Northwest Venezuela.

10 5 0 0

20

40

60

80

100

40

Hotspring

35 30

No of observed OTUs 95% confidence estimate Bootstrap estimate

25 20 15 10 5 0 0

20

40

60

80

100

Number of Isolates Fig. 3. Accumulation curves of Operational Taxonomic Units (OTUs) of fungal endophytes and bootstrap estimates for 100 randomized samples of fungal endophytes, for communities at three environments in semiarid Northwest Venezuela.

the composition and relative abundance of fungal endophytes from grasses of the genus Cenchrus that grew in the different environments. Cenchrus ciliaris grew over sand dunes at the isthmus of Paraguaná, whereas both Cenchrus echinatus and C. cf. spinifex grew at the beach. The similarity index was larger between the communities of fungal endophytes from the two congeneric plants growing at the beach (Table 5). 4. Discussion Overall, fungal endophytes in the semiarid grasslands of Northwest Venezuela are quite diverse, as indicated by a FisherAlpha estimate of 25 for the whole sample (all sites and plants Table 2 Diversity estimates for the fungal endophyte communities from grasses and sedges at three different environments in semiarid Northwest Venezuela. Environment

Shannon

Fisher-alpha

Sand dunes Beach Hot-spring

3.06 2.77 2.27

20.43 15.75 15.54

pooled). This level of fungal endophyte diversity was smaller than that for a tropical humid forest (Fisher-Alpha ¼ 30.9, Arnold and Lutzoni, 2007) but more than twice those for tropical dry forests (Fisher-Alpha 10.38 and 9.89, Suryanarayanan et al., 2003). Nevertheless, these comparisons need to be interpreted cautiously because saturation curves in all these studies indicated the diversities of fungal communities were underestimated. Traditionally, the diversity of fungal endophytes in grasses has been estimated using the Shannon-Weiner Index. Estimates for fungal endophyte diversities associated with the roots of B. gracilis, a dominant grass species at the semiarid grassland of Sevilleta National Wildlife Refuge in New Mexico (SNWR), ranged from H ¼ 3.1 to H ¼ 2.2 (Khidir et al., 2009; Porras-Alfaro et al., 2008). Fungal endophyte diversities in two other plants from these grasslands, Sporobolus cryptandrus (Torr.) A. Gray and Yucca glauca Nutt., were H ¼ 2.1 and H ¼ 2.9 respectively. Estimates of fungal endophyte diversity isolated from a native versus an introduced grass in Australia ranged from H ¼ 3.08 to H ¼ 3.40 (White and Backhouse, 2007). These estimates are relatively similar to those obtained here for semiarid Northwest Venezuela. Moreover, our lowest diversity estimate (H ¼ 2.27), obtained from 2 plant species at the hot spring, is similar to the lowest diversity estimate (H ¼ 2.34) from the latitudinal study of the fungal endophytes for B. gracilis by Herrera et al. (2010). Very similar diversity estimates were also obtained for fungal endophyte communities isolated from two temperate grasses growing in humid grasslands along the Atlantic coast in Spain (H ¼ 2.33 and H ¼ 1.96 for Ammophila arenaria and Elymus farctus respectively) (Sánchez-Márquez et al., 2008). These grasses grew on beach foredunes and had their roots flooded by salt water at high tide, thus water potential in this environment was limited by osmotic pressure, not drought. On the other hand, our Shannon-Weiner diversity estimates were smaller than H ¼ 4.27 estimated for the perennial grass Dactylis glomerata, in Spain (Sánchez-Márquez et al., 2007). It is worth noticing that the sample size of this single Spanish grass was more than twice the size of our whole plant collection, including a wide range of environments (i.e., humid Atlantic to Mediterranean), ecosystems (i.e., arid grasslands, river banks and sulfurous water springs), as well as a much larger geographic area. Indeed, in that study the trend to asymptotic species accumulation curve was observed in the fungi occurring in more than one plant (plurals), indicating that the community was exhaustively screened at least for those common fungi.

52

M. Loro et al. / Journal of Arid Environments 85 (2012) 46e55

Fig. 5. Relative abundance and composition of the fungal endophyte communities at three different environments in semiarid Northwest Venezuela.

We can also view fungal diversity in terms of richness estimates (number of species or OTUs) per plant. Our estimate of 4.5  1.8 OTUs per plant species is much lower than those for all types of tropical forests: 38.3  3.8 to 47.5  4.9 morphotaxa per cocoa tree (Theobroma cacao L.) in a tropical humid forest in Panama (Arnold et al., 2003), 15.58  4.06 morphotypes per tree at a tropical dry forest in India (Suryanarayanan et al., 2003) and 13.82  5.95 morphotypes per tree at a humid tropical forest in Guyana (Cannon and Simmons, 2002). Our estimate was even smaller than those for temperate loblolly pine (Pinus taeda L.) (12.00  0.87 morphotypes per tree) (Arnold et al., 2007) and invasive spotted knapweed (Centaurea stoebe L.) (8.1 isolates per plant) (Shipunov et al., 2008). Remarkably, our estimate was very close to that for B. gracilis at SNWR of 4.8  1.9 OTUs per plant (Khidir et al., 2009). Although it has to be taken into account that only the roots of B. gracilis were sampled, it seems that the harsh environmental conditions typical of semiarid grasslands really drive down the number of OTUs per plant. In the study of Australian native and introduced grasses, the numbers of fungal endophyte species per plant were also relatively small (5.48  0.36 to

Table 3 Similarities among fungal endophyte communities from semiarid Northwest Venezuela. Jaccard Index above the diagonal, Morisita-Horn Index below the diagonal. Sand dunes Sand dunes Beach Hot-spring

0.55 0.59

Beach

Hot-spring

0.23

0.18 0.18

0.36

7.36  0.43) (White and Backhouse, 2007). Also, despite the high Shannon-Wiener estimate, in D. glomerata the number of fungal endophyte OTUs per plant at different environments in Spain was smaller than the one obtained here (2.7  1.8, recalculated from Sánchez-Márquez et al., 2007), perhaps driven by the extremity of the Mediterranean summers. Even though we stressed above that the comparison with other studies is valid, it has to be kept in mind that there are significant differences among all these studies. For instance, in the North American grass studies (Herrera et al., 2010; Porras-Alfaro et al., 2008) the fungi were identified without culturing by direct analysis of DNA sequences (environmental PCR), whereas in all the other studies fungal endophytes where first isolated in culture and then identified. Nevertheless, in the study by Khidir et al. (2009), both culturing and environmental PCR were used and although the authors did not state it explicitly, the results did not seem to differ significantly between methods. Studies comparing both methods have concluded that culturing alone tends to underestimate fungal Table 4 Similarities among fungal endophyte communities from sedges growing around (within 1 m from the water edge) and away from a hot-spring in semiarid Northwest Venezuela. Jaccard Index above the diagonal, Morisita-Horn Index below the diagonal.

Around C. laevigatus E. atropurpurea Away C. laevigatus

Around hot-spring

Away from hot-spring

Cyperus laevigatus

Eleocharis atropurpurea

Cyperus laevigatus

0

0.11 0.29

0 0.17

0.75

M. Loro et al. / Journal of Arid Environments 85 (2012) 46e55 Table 5 Similarities among fungal endophyte communities from grass species of the genus Cenchrus in semiarid Northwest Venezuela. Jaccard Index above the diagonal, Morisita-Horn Index below the diagonal. C. echinatus C. echinatus C. cf. spinifex C. ciliaris

0.258 0.1

C. cf. spinifex

C. ciliaris

0.167

0.125 0.125

0.24

endophyte diversity (Arnold et al., 2007; Higgins et al., 2011). Nevertheless, cloning is not a “silver bullet” for estimating fungal endophyte diversity, because some commonly cultured clades (i.e., Sordariomycetes) cannot be detected this way (Arnold et al., 2007). On the other hand, the media used to grow the fungal endophytes differed among studies, as Arnold and Lutzoni (2007) used Malt Extract Agar medium, which is a poor medium that maximizes recovery of slow growing fungi; whereas Suryanarayanan et al. (2002, 2003), Sánchez-Marquez et al. (2007, 2008), White and Backhouse (2007) as well as this study, used Potato Dextrose Agar, a rich medium formulated to maximize overall fungal growth, which may cause under-sampling of slow growing fungi. Herrera et al. (2010) used both types of media, but did not report any difference between them. In our study we may have underestimated fungal endophyte diversity in the grasses of semiarid northwest Venezuela by culturing alone, by using PDA as a medium, and by insufficient sampling of the plant community. Considering these factors, the diversity of fungal endophytes is very high in this region, despite the harshness of the environment. Overall, we conclude that the diversity of fungal endophyte communities associated with grasses and sedges in the semiarid region of Northwest Venezuela is slightly lower than tropical humid forests, significantly higher than tropical dry forests, and very similar to subtropical semiarid and temperate grasses. Even so, the diversity of these microbial communities is remarkably high in semiarid grasslands, considering the harshness of these environments. According to Porras-Alfaro et al. (2008) and references therein, this high diversity may be associated with microenvironmental heterogeneity that is characteristic of arid environments. Given this, plants may require associations with a diverse array of fungal endophytes that possess an equally diverse battery of enzymes to increase both the efficiency of nutrient acquisition and stress tolerance. As with our results on fungal diversity, we were surprised by the high rate of fungal endophyte colonization in our samples (all plants and their organs were colonized). This corresponds with the negative correlation between fungal endophyte incidence and latitude (Arnold and Lutzoni, 2007), indicating that tropical plants tend to be colonized by fungal endophytes more often than temperate ones, independently of the environment. We did not expect this because Arnold and Lutzoni (2007) estimated that the rate of infection in the Sonoran Desert was significantly below expected values given the latitude of the sampling site (6 vs. 25% in Cupressaceous trees). It seems that the rate of infection by fungal endophytes tends to be very variable in temperate arid and semiarid environments (e.g. Quercus emoryi in Arizona 10e100%, Faeth and Hammon, 1997). In the latitudinal study of the fungal endophyte community associated with B. gracilis, a clear pattern in the rate of infection could not be discerned either in relation to latitude or rainfall (J. Herrera personal communication). Indeed, the highest infection rates (87.5e95%) of fungal endophytes in this plant were estimated at semiarid and mid-latitude SNWR (Khidir et al., 2009; J. Herrera personal communication). With the limited data available so far it is impossible to determine which environmental factors may control the rate of fungal endophyte infection and thus experimental work is strongly recommended.

53

In the semiarid region of Northwest Venezuela, both congeneric species of grasses and distantly related ones shared a similar composition of fungal endophyte communities, dominated by the genera Phoma and Cochliobolus, which are both DSE of the order Pleosporales. On the other hand, the number of singleton/rare species was relatively low (27%) compared to other plant communities (w50%) (Arnold and Lutzoni, 2007; Arnold personal communication). This result supports the idea that DSE are prevalent in arid and semiarid environments at all latitudes (Barrow et al., 2007; Herrera et al., 2010; Khidir et al., 2009; Lucero et al., 2006; Porras-Alfaro et al., 2008). To explain their high prevalence, it has been suggested that DSE may be involved in drought and heat tolerance (Khidir et al., 2009; Mandyam and Jumpponen, 2005). The observation of a continuous fungal network linking the vascular sieve elements to the rhizosphere suggests that they may be involved in water uptake (Barrow, 2003; Barrow et al., 2008; Mandyam and Jumpponen, 2005). Also, it has been hypothesized that the fungi may alter hormone levels controlling stomatal behavior and osmotic adjustment, leading to better turgor maintenance (Malinowski and Belesky, 2000; Mandyam and Jumpponen, 2005). It has been demonstrated experimentally that a species in the genus Curvularia, another Pleosporales that was relatively abundant in our sample (8%), confers significant drought tolerance to rice, wheat, tomato and watermelon plants (Redman et al., 2001; Rodriguez et al., 2004, 2008). This same species of fungal endophyte (C. protuberata) grown out of cotton panic grass (Dichanthelium lanuginosum (Elliot) Gould) from geothermal soils of Yellowstone National Park, confers tolerance to extremely high temperatures of up to 65  C at the roots for both its natural host plant and the tomato (Redman et al., 2002). Moreover, C. protuberata only confers heat tolerance when it is infected with a virus (Márquez et al., 2007), indicating that in some instances complex symbiosis networks are required for stress tolerance. Expression profile analyses of some candidate genes suggest possible involvement of osmoprotectants, the pigment melanin (responsible for the dark coloration of DSE) and heat shock proteins in the thermotolerance of C. protuberata in culture (Morsy et al., 2010). We did not isolate species of the genus Curvularia from the sedge C. laevigatus growing immediately around the hot-spring, but from the other sedge E. atropurpurea growing in a band around the former where the soil was still warm but not scalding hot. We also isolated species of Curvularia from the grass C. echinatus and the sedge C. laevigatus growing on sandy soil by the road. It is likely that these species of Curvularia are involved in heat and/or drought tolerance at our sampling sites, but some other species or species combination is responsible for the extreme tolerance of C. laevigatus at the hot spring. We were puzzled by the absence in our sample of any DSE related to the genus Paraphaeosphaeria, which have been shown to mitigate heat stress within Arabidopsis (Arabidopsis thaliana) by producing a heat shock (HSP90) inhibitor (McLellan et al., 2007). Our limited sampling did not allow quantitative comparisons among plant species across the three different environments. However, the comparisons of the fungal endophyte communities among conspecific grasses in the genus Cenchrus suggest that the environment, rather than the identity of the host plant, determines the composition and relative abundance of the fungal endophytes. Sánchez-Márquez et al. (2008) reached a similar conclusion when confronted with the fact that the similarity of the endophyte communities in the two grasses that they studied in the northwest coast of Spain was negatively correlated with the distance among the sampling sites. The comparisons among the sedges also supports this conclusion, as the communities in the conspecific from different environments where less similar than those from different species growing in the same environment, away from the hot spring. In the study of fungal endophytes from grasses in Australia, White and Backhouse (2007) found that the identity of

54

M. Loro et al. / Journal of Arid Environments 85 (2012) 46e55

the host affected the relative abundance of certain endophytes, as well as the presence of two particular ones, but the composition of the endophyte communities was relatively similar between the native and introduced grass species. Interestingly, we isolated the mango pathogen Lasiodiplodia pseudotheobromae (Morales-Rondón and Rodríguez-González, 2006) from the healthy looking sedge C. laevigatus growing at the hot spring. We also isolated Aspergillus (¼ Emericella) nidulans, Exserohilum rostratum and Corynascus kuwaitiensis that are known as thermophilic and opportunistic pathogens in humans (Adler et al., 2006; Khan Z. unpublished). Similarly, Lucero et al. (2006) and Khidir et al. (2009) also reported isolating an unknown species of the genus Moniliophthora from healthy looking B. gracilis. This genus contains the fungal pathogens M. perniciosa and M. roreri that are the causative agents of witches’ broom and frosty pod rot in cocoa (T. cacao). Small genetic differences between the commensal, if not mutualistic, isolates and their pathogenic relatives may be responsible for the lack of disease symptoms, as conversion from pathogenic to mutualistic lifestyle in fungi can be achieved by a single point mutation (Freeman and Rodriguez, 1993). Alternatively, the physiological conditions of these plants growing in extreme environments may push the outcome of the symbiosis toward mutualism. Experimental infection with wellknown pathogenic plant viruses has delayed the appearance of drought symptoms in various plant species stressed by withholding water (Xu et al., 2008). Also, the particular physiological conditions of different hosts may favor mutualism too, as pathogenic Colletotrichum species expressed either mutualistic or commensal lifestyles in plants not known to be hosts (Redman et al., 2001). Many plant diseases may be caused by the accidental transfer of a microbial symbiont to a new host species, with whom the microbe has not co-evolved (Roossinck personal communication). The prevalence of DSE, low numbers of OTUs per plant, and low number of rare/singleton species suggest that extreme conditions and spatial heterogeneity in semiarid grasslands may limit plantfungal interactions to only those that provide maximum benefit to both partners. Further experiments on plant-fungal interactions may provide key insights into how fungal endophytes could be used for improving stress tolerance in crop plants in the face of global climate change. Acknowledgments Our most sincere words of appreciation go to Prof. Robert Wingfield, who took us on an extensive field trip to obtain the appropriate plant samples representative of the Northwest Venezuelan semiarid grasslands. We are also in debt with Ing. Gustavo Romay, who helped us during the field activities. Also, we would like to thank Jose Herrera, Tracy Feldman and Jason B. Mackenzie for proof reading the manuscript and providing very useful comments. We really appreciate the comments and suggestions of the two anonymous reviewers, which significantly improved the quality of our discussion. This project received financial support by the Fundación Instituto de Estudios Avanzados, IDEA, by an OFICA, C.A. LOCTI project and through the grant C/4407-1 awarded to LM by the International Foundation for Science, Sweden. This project counted with the approval of the Venezuelan Ministry for the Environment for access to genetic resources. References Adler, A., Yaniv, I., Samra, Z., Yacobovich, J., Fisher, S., Avrahami, G., Levy, I., 2006. Exserohilum: an emerging human pathogen. European Journal of Clinical Microbiology and Infectious Diseases 25, 247e253. Albrectsen, B.R., Bjorken, L., Varad, A., Hagner, A., Wedin, M., Karlsson, J., Jansson, S., 2010. Endophytic fungi in European aspen (Populus tremula) leaves-diversity, detection, and a suggested correlation with herbivory resistance. Fungal Diversity 41, 17e28.

Arnold, A.E., Lutzoni, F., 2007. Diversity and host range of foliar fungal endophytes: are tropical leaves biodiversity hotspots? Ecology 88, 541e549. Arnold, A.E., Maynard, Z., Gilbert, G.S., Coley, P.D., Kursar, T.A., 2000. Are tropical fungal endophytes hyperdiverse? Ecology Letters 3, 267e274. Arnold, A.E., Mejía, L.C., Kyllo, D., Rojas, E.I., Maynard, Z., Robins, N., Herre, E.A., 2003. Fungal endophytes limit pathogen damage in a tropical tree. Proceedings of the National Academy of Sciences of the United States of America 100, 15649e15654. Arnold, A.E., Henk, D.A., Eells, R.L., Lutzoni, F., Vilgalys, R., 2007. Diversity and phylogenetic affinities of foliar fungal endophytes in loblolly pine inferred by culturing and environmental PCR. Mycology 99, 185e206. Barrow, J.R., Lucero, M.E., Reyes-Vera, I., Havstad, K.M., 2007. Endosymbiotic fungi structurally integrated with leaves reveals a lichenous condition of C4 grasses. In Vitro Cellular and Developmental Biology e Plant 43, 65e70. Barrow, J.R., Lucero, M.E., Reyes-Vera, I., Havstad, K.M., 2008. Do symbiotic microbes have a role in plant evolution, performance and response to stress? Communicative and Integrative Biology 1, 69e73. Barrow, J.R., 2003. Atypical morphology of dark septate fungal root endophytes of Bouteloua in arid southwestern USA rangelands. Mycorrhiza 13, 239e247. Cannon, P.F., Simmons, C.M., 2002. Diversity and host preference of leaf endophytic fungi in the Iwokrama Forest Reserve, Guyana. Mycologia 94, 210e220. Clay, K., 1988. Fungal endophytes of grasses: a defensive mutualism between plants and fungi. Ecology 69, 10e16. Colwell, R.K., 2009. EstimateS: Statistical Estimation of Species Richness and Shared Species from Samples. Version 8.2. User’s Guide and Application. http://viceroy. eeb.uconn.edu/EstimateS. Diaz, M., 2001. Ecología experimental y ecofisiología: Bases para el uso sostenible de los recursos naturales de las zonas áridas neo-tropicales. Interciencia 26, 472e478. Faeth, S.H., Hammon, K.E., 1997. Fungal endophytes in oak trees: long-term patterns of abundance and associations with leafminers. Ecology 78, 810e819. Freeman, S., Rodriguez, R.J., 1993. Genetic conversion of a fungal plant pathogen to a nonpathogenic, endophytic mutualist. Science 260, 75e78. Green, L.E., Porras-Alfaro, A., Sinsabaugh, R.L., 2008. Translocation of nitrogen and carbon integrates biotic crust and grass production in desert grassland. Journal of Ecology 96, 1076e1085. Herrera, J., Khidir, H.H., Eudy, D.M., Porras-Alfaro, A., Natvig, D.O., Sinsabaugh, R.L., 2010. Shifting fungal endophyte communities colonize Bouteloua gracilis: effect of host tissue and geographical distribution. Mycologia 102, 1012e1026. Higgins, K.L., Coley, P.D., Kursar, T.A., Arnold, A.E., 2011. Culturing and direct PCR suggest prevalent host generalism among diverse fungal endophytes of tropical forest grasses. Mycologia 103, 247e260. Hoffman, M., Arnold, A.E., 2008. Geographic locality and host identity shape fungal endophyte communities in cupressaceous trees. Mycological Research 112, 331e344. Khidir, H.H., Eudy, D.M., Porras-Alfaro, A., Herrera, J., Natvig, D.O., Sinsabaugh, R.L., 2009. A general suite of fungal endophytes dominate the roots of two dominant grasses in a semiarid grassland. Journal of Arid Environments 74, 35e42. Lacap, D.C., Hyde, K.D., Liew, E.C.Y., 2003. An evaluation of the fungal ‘morphotype’ concept based on ribosomal DNA sequences. Fungal Diversity 12, 53e66. Lucero, M.E., Barrow, J.R., Osuna, P., Reyes, I., 2006. Plantefungal interactions in arid and semi-arid ecosystems: large-scale impacts from microscale processes. Journal of Arid Environments 65, 276e284. Malinowski, D.P., Belesky, D.P., 2000. Adaptations of endophyte-infected coolseason grasses to environmental stresses: mechanisms of drought and mineral stress tolerance. Crop Science 40, 923e940. Mandyam, K., Jumpponen, A., 2005. Seeking the elusive function of the rootcolonising dark septate endophytic fungi. Studies in Mycology 53, 173e189. Márquez, L.M., Redman, R.S., Rodriguez, R.J., Roossinck, M.J., 2007. A virus in a fungus in a plant: three-way symbiosis required for thermal tolerance. Science 315, 513e515. McLellan, C.A., Turbyville, T.J., Wijeratne, E.M.K., Kerschen, A., Vierling, E., Queitsch, C., Whitesell, L., Gunatilaka, A.A.L., 2007. A rhizo-sphere fungus enhances Arabidopsis thermotolerance through production of an HSP90 inhibitor. Plant Physiology 145, 174e182. Medina-Roldán, E., Arredondo, J.T., Huber-Sannwald, E., Chapa-Vargas, L., OlaldePortugal, V., 2008. Grazing effects on fungal root symbionts and carbon and nitrogen storage in a shortgrass steppe in central Mexico. Journal of Arid Environments 72, 546e556. Morales-Rondón, V., Rodríguez-González, M., 2006. Hongos endofitos en plantaciones de mango ‘Haden’ de la planicie de Maracaibo, Venezuela. Revista de la Facultad de Agronomía de La Universidad del Zulia 23, 273e283. Morsy, M.R., Oswald, J., He, J., Tang, Y., Roossinck, M.J., 2010. Teasing apart a threeway symbiosis: transcriptome analyses of Curvularia protuberata in response to viral infection and heat stress. Biochemical and Biophysical Research Communications 401, 225e230. Porras-Alfaro, A., Herrera, J., Sinsabaugh, R.L., Odenbach, K., Lowrey, T., Natvig, D.O., 2008. Novel root fungal consortium associated with a dominant dessert grass. Applied and Environmental Microbiology 74, 2805e2813. Redman, R.S., Dunigan, D.D., Rodriguez, R.J., 2001. Fungal symbiosis: from mutualism to parasitism, who controls the outcome, host or invader? New Phytologist 151, 705e716. Redman, R.S., Sheehan, K.B., Stout, R.G., Rodriguez, R.J., Henson, J.M., 2002. Thermotolerance generated by plant/fungal symbiosis. Science 298, 1581. Rodriguez, R., Redman, R., 2008. More than 400 million years of evolution and some plants still can’t make it on their own: plant stress tolerance via fungal symbiosis. Journal of Experimental Botany 59, 1109e1114.

M. Loro et al. / Journal of Arid Environments 85 (2012) 46e55 Rodriguez, R.J., Redman, R.S., Henson, J.M., 2004. The role of fungal symbioses in the adaptation of plants to high stress environments. Mitigation and Adaptation Strategies for Global Change 9, 261e272. Rodriguez, R.J., Henson, J., Van Volkenburgh, E., Hoy, M., Wright, L., Beckwith, F., Kim, Y.-O., Redman, R.S., 2008. Stress tolerance in plants via habitat-adapted symbiosis. The ISME Journal 2, 404e416. Rudgers, J.A., Clay, K., 2007. Endophyte symbiosis with tall fescue: how strong are the impacts on communities and ecosystems? Fungal Biology Reviews 21, 107e124. Saikkonen, K., Saari, S., Helander, M., 2010. Defensive mutualism between plants and endophytic fungi? Fungal Diversity 41, 101e113. Sánchez-Márquez, S., Bills, G.F., Zabalgogeazcoa, I., 2007. The endophytic mycobiota of the grass Dactylis glomerata. Fungal Diversity 27, 171e195. Sánchez-Márquez, S., Bills, G.F., Zabalgogeazcoa, I., 2008. Diversity and structure of the fungal endophytic assemblages from two sympatric coastal grasses. Fungal Diversity 33, 87e100. Schulz, B., Boyle, C., 2006. What are endophytes? In: Schulz, B.J.E., Boyle, C.J.C., Sieber, T.N. (Eds.), Microbial Root Endophytes. Springer Verlag, Berlin, Heidelberg, pp. 1e13. Shipunov, A., Newcombe, G., Raghavendra, A.K.H., Anderson, C.L., 2008. Hidden diversity of endophytic fungi in an invasive plant. American Journal of Botany 95, 1096e1108.

55

Shmida, S., 1985. Biogeography of the desert floras of the world. In: Evenari, A.M., Noy-Meir, I., Goodall, D.W. (Eds.), Ecosystems of the World. Hot Deserts and Arid Shrublands, vol. 12a. Elsevier, Amsterdam, pp. 23e77. Suryanarayanan, T.S., Venkatesan, G., Murali, T.S., 2002. Occurrence and distribution of fungal endophytes in tropical forests across a rainfall gradient. Canadian Journal of Botany 80, 818e826. Suryanarayanan, T.S., Venkatesan, G., Murali, T.S., 2003. Endophytic fungal communities in leaves of tropical forest trees: diversity and distribution patterns. Current Science 85, 489e493. Tamura, K., Dudley, J., Nei, M., Kumar, S., 2007. MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0. Molecular Biology and Evolution 24, 1596e1599. Vesterlund, S.R., Helander, M., Faeth, S.H., Hyvonen, T., Saikkonen, K., 2011. Environmental conditions and host plant origin override endophyte effects on invertebrate communities. Fungal Diversity 47, 109e118. White, I.R., Backhouse, D., 2007. Comparison of fungal endophyte communities in the invasive panicoid grass Hyparrhenia hirta and the native grass Bothriochloa macra. Australian Journal Botany 55, 178e185. Xu, P., Chen, F., Mannas, J.P., Feldman, T., Sumner, L.W., Roossinck, M.J., 2008. Virus infection improves drought tolerance. New Phytologist 180, 911e921.