- Email: [email protected]
DL – methionine can be replaced partially by phyto-additive without affecting growth performance, fat metabolism, and serum biochemistry in broilers
C 2019 Poultry Science Association Inc.
F. L. S. Castro
and W. K. Kim1
Department of Poultry Science, University of Georgia, Athens, GA 30602, USA Primary Audience: Nutritionists, Poultry industry SUMMARY The aim was to evaluate the partial replacement of synthetic DL-Methionine (DL-Met) by Herbal Methionine (H-Met) compared to DL-Met and L-Methionine (L-Met), and the effects on growth performance, fat metabolism, and serum biochemistry in broilers. A total of 600 TM 1-d-old male Cobb500 chicks (Cobb x Cobb) were distributed in a completely randomized design, five dietary treatments, six replicates of 20 birds each. Liquid L-Met was provided through carboys connected to the water line. Two positive control (PC) treatments were used, either connected to the regular water line (PC1) or to carboys (PC2). The treatments were: Negative control (NC—no Met supplementation); PC1 and 2 (100% DL-Met); 60% DL-Met + 40% H-Met through feed (TH-Met); and 50% DL-Met + 50% L-Met through water (TL-Met). At 10, 22, and 42 d body weight gain (BWG), feed intake (FI) and feed conversion ratio (FCR) were determined. At day 21, serum and liver samples were used to evaluate serum biochemistry and the expression of genes related to fat metabolism, respectively. At 42 d, abdominal fat was weighed from 3 birds/replicate. In general, birds fed NC showed lower BWG, FI, higher FCR, and tended to have higher fat pad compared to the other treatments (P < 0.05). No differences were found for gene expression (P > 0.05). For serum biochemistry, Aspartate amino transferase (AST) level was higher in birds fed NC and TH-Met than in PC2 and TL-Met (P < 0.05). In conclusion, DL-Met can be partially replaced by H-Met without negatively affecting growth performance, fat metabolism, and serum biochemistry of broiler chickens. Key words: broiler chickens, DL-Methionine, herbal Methionine, L-Methionine, serum biochemistry 2019 J. Appl. Poult. Res. 0:1–8 http://dx.doi.org/10.3382/japr/pfz062
DESCRIPTION OF PROBLEM Methionine is considered an essential amino acid for poultry because they cannot synthesize it in enough quantity, and they have a high 1
Corresponding author: [email protected]
requirement for it to support adequately their biological functions and rapid growth. Additionally, the plant protein sources used in typical poultry diets have low Met levels, which make the supplementation necessary [1, 2]. The most common forms of dietary Met are synthetic products, such as DL-Met, L-Met, or
Downloaded from https://academic.oup.com/japr/advance-article-abstract/doi/10.3382/japr/pfz062/5519684 by guest on 03 August 2019
DL – methionine can be replaced partially by phyto-additive without affecting growth performance, fat metabolism, and serum biochemistry in broilers
JAPR: Research Report
2
MATERIALS AND METHODS General Procedures The experiment was approved by the Institutional Animal Care and Use Committee (IACUC) of University of Georgia (Athens, Georgia, United States). A total of 600 1-d-old TM male Cobb500 broiler chicks (Cobb x Cobb) were distributed in a completely randomized design with 5 dietary treatments and 6 replicates of 20 birds each. The chicks were allocated to 30 identical pens equipped with 1 nipple drinker and 1 feeder, providing ad libitum access to water and feed from 1 to 42 d of age. Temperature and
lighting program followed the recommendation of Cobb Broiler Management Guide [7]. The corn and soybean meal-based nonorganic diets were formulated to meet the nutrient recommendations [8] for starter (1–10 d), grower (11–22 d), and finisher (23–42 d) phases (Table 1). Birds were supplemented with synthetic DL-Methionine (DL-Met) alone or in combination with L-Methionine (L-Met) or Herbal Methionine (H-Met) [9], which contained extracts from Cicer arientinum, Phaseolus mungo, Triticum sativum, Mucuna pruriens, and Alium cepa, to reach the Met level (100%) recommended by the Cobb500TM guide. The DL-Met and H-Met were provided through feed, whereas L-Met was provided through drinking water, using carboys connected to the nipple lines. Because of the liquid methionine provided through water, 2 positive control (PC) treatments fed DL-Met were used: one connected to the regular water line and the other one to carboys containing only water. The dietary treatments were as follows: negative control (NC—no synthetic Met supplementation); PC (100% of DLMet connected to the regular water line (PC1) or the carboy system (PC2)); 60% DL-Met + 40% H-Met through feed (TH-Met); and 50% DL-Met + 50% L-Met through water (TL-Met). The Met source level of inclusion for each treatment was: PC1 and PC2–0.34, 0.29, 0.23% of DL-Met for starter, grower, and finisher phases, respectively; TH-Met–0.204, 0.174, 0.138% of DL-Met and 0.136, 0.116, 0.092% of H-Met for starter, grower, and finisher phases, respectively; TL-Met–0.170, 0.145, 0.115% of DL-Met and 0.05, 0.1, and 0.2 ml/bird/day of liquid L-Met for starter, grower, and finisher phases, respectively. The water amount provided in the carboys followed an estimated water intake according to Alqhtani [10]. The birds and feed were weighed by pen at 10, 22, and 42 d of the experiment to determine body weight gain (BWG), feed intake (FI), and feed conversion ratio (FCR) (Table 2). Water intake (WI) from PC2 and TL-Met was measured weekly, starting from the second week, by weighing the carboys (Figure 1). Mortality was recorded daily and used to calculate viability (%). At day 21, 1 bird per pen was selected, and serum and liver samples were collected for the evaluation of liver and kidney metabolic markers and the expression of genes related to fat
Downloaded from https://academic.oup.com/japr/advance-article-abstract/doi/10.3382/japr/pfz062/5519684 by guest on 03 August 2019
DL-Methionine-hydroxy analog [1, 2]. However, despite the inexistence of known negative health consequences of supplementing synthetic Met at levels used to meet the bird’s requirement, there is still consumer pressure for banning the use of synthetic substances in organic livestock diets [3]. Since 2012 October 2, the United States Department of Agriculture (USDA)-National Organic Program (NOP) determined that the synthetic Met use in organic production was restricted to 1.0, 1.0, and 1.5 kg/metric ton for laying hens, broilers, and turkeys, respectively [4]. This limitation increases the challenge in formulating diets, since Met rich organic ingredients might not be easily available and cost effective. Thus, alternative organic Met sources have been investigated to replace synthetic Met in organic poultry production. Phyto-additives have been studied for poultry production as a replacement of synthetic Met [1, 2, 5]. Most of the available products have plant extracts containing Met, Cysteine (Cys), betaine, and S-Adenosyl Methionine (SAMe), which can mimic or spare Met in the metabolism, acting as methyl donor groups or sulfur source, and playing major roles in choline, folic acid, and vitamin B12 metabolism [6]. The objective of this study was to investigate the partial replacement of synthetic DL-Methionine (DL-Met) by Herbal Methionine (H-Met) in poultry diets and the effects of feeding H-Met on growth performance, fat metabolism and serum biochemistry in broilers compared to DL-Met and L-Methionine (L-Met).
CASTRO AND KIM: HERBAL METHIONINE FOR BROILERS
3
Table 1. Diets Formulation for All Phases (1–42 d, As-Fed Basis; % Diet). Positive control (PC) Ingredient (% of diet)
ME (kcal/kg) CP (%) Ca (%) Available P (%) Met + Cys (%) Met (%) Lys (%)
Grower (11–22 d)
Finisher (23–42 d)
Starter (1–10 d)
Grower (11–22 d)
Finisher (23–42 d)
63.35 30.00 1.41 0.65 1.75 0.30 0.25 0.08 0.34 0.36 0.12 1.05 0.05 0.29 100
67.34 26.00 1.96 0.63 1.61 0.30 0.25 0.08 0.29 0.33 0.10 0.76 0.05 0.30 100
68.35 25.01 3.00 0.61 1.40 0.30 0.25 0.08 0.23 0.18 0.05 0.05 0.49 100
63.35 30.00 1.41 0.65 1.75 0.30 0.25 0.08 0.36 0.12 1.05 0.05 0.29 100
67.34 26.00 1.96 0.63 1.61 0.30 0.25 0.08 0.33 0.10 0.76 0.05 0.30 100
68.35 25.01 3.0 0.61 1.40 0.30 0.25 0.08 0.18 0.05 0.05 0.72 100
3,035 22.0 0.90 0.45 0.98 0.65 1.32
3,108 20.0 0.84 0.42 0.89 0.58 1.19
3,180 18.48 0.76 0.38 0.82 0.52 1.05
3,023 21.8 0.90 0.45 0.65 0.32 1.32
3,097 19.83 0.84 0.42 0.60 0.30 1.19
3,172 18.34 0.76 0.38 0.59 0.29 1.05
1
Provided per kg of DSM Vitamin premix: Vit. A 2204,586 IU, Vit. D3 200,000 ICU, Vit. E 2000 IU, Vit. B12 2 mg, Biotin 20 mg, Menadione 200 mg, Thiamine 400 mg, Riboflavin 800 mg, d-Pantothenic Acid 2000 mg, Vit. B6 400 mg, Niacin 8000 mg, Folic Acid 100 mg, Choline 34,720 mg. 2 Provided per kg of Mineral premix: Ca 0.72 g, Mn 3.04 g, Zn 2.43 g, Mg 0.61 g, Fe 0.59 g, Cu 22.68 g, I 22.68 g, Se 9.07 g.
metabolism. At 42 d, 3 birds per repetition were selected from a range of ±10% the pen average body weight and euthanized by cervical dislocation. The abdominal fat removed from around the cloaca, bursa of Fabricius, gizzard, and proventriculus was weighed and used to calculate the average fat weight relative to the body weight. Gene Expression Analysis. Liver samples were used to analyze the expression of phosphoenolpyruvate carboxykinase 1 (PEPCK-1) [11], fatty acid binding protein 4 (FABP4) [12], and fatty acid synthase (FAS) [13] genes for nutrient metabolism. For that, the Quantitative ReverseTranscriptase Polymerase Chain Reaction (qRTPCR) was used to determine the mRNA expression of the target genes [14]. Samples were run in duplicate and relative gene expression data were analyzed using the 2−Ct method according to Livak and Schmittgen [15]. The mean Ct of the negative control (no supplementation with Met) was used to calculate the Ct value (Table 3). Serum Analysis. Blood (3 ml/bird) was collected from the brachial vein and centrifuged at
3000 rpm for 12 min using a microcentrifuge [16], and 400 μl of serum was removed and stored at −80◦ C for further analysis. A total of 100 μl of serum was transferred to the specific rotor [17], and serum chemistry was analyzed using a blood analyzer [18]. Aspartate Aminotransferase (AST), Creatine Kinase (CK), Uric Acid (UA), Total Protein (TP), Albumin (ALB), Globulin (GLOB), Sodium (Na+ ), and Potassium (K− ) levels in serum were evaluated (Table 4). Statistical Analysis Data were first tested for homogeneity of variances and normality of studentized residuals. When data were normally distributed, one-way ANOVA was performed, and, in case of significant differences, the treatments were compared by Tukey’s test. Viability was the only variable not normally distributed, therefore, Kruskal– Wallis Test was performed. All statistical procedures were performed using SAS University
Downloaded from https://academic.oup.com/japr/advance-article-abstract/doi/10.3382/japr/pfz062/5519684 by guest on 03 August 2019
Corn Soybean meal (48%) Soybean oil Limestone Defluorinated phosphate Salt Vitamin mix1 Mineral mix2 DL-Methionine L-Lysine Threoninie L- Glutamine Coban 90 Sand
Negative control (NC)
Starter (1–10 d)
JAPR: Research Report
4
Table 2. Means of Body Weight Gain (BWG), Feed Intake (FI), Feed Conversion Ratio (FCR), Viability (Viab), and Abdominal Fat (Fat) According to Dietary Treatments for All Phases. Treatments1 1–10 d
PC2
NC
TH-Met
TL-Met
P value
SE
0.199a 0.254a 1.272b
0.203a 0.253a 1.245b
0.165b 0.226b 1.365a
0.207a 0.260a 1.253b
0.209a 0.260a 1.244b
<0.0001 <0.0001 <0.0001
0.0033 0.0028 0.0101
11–22 d BWG (kg) FI (kg) FCR (kg)
0.653a 0.967a 1.481b
0.686a 1.003a 1.462b
0.512b 0.836b 1.633a
0.698a 1.005a 1.441b
0.665a 0.983a 1.479b
<0.0001 <0.0001 <0.0001
0.0135 0.0142 0.0162
23–42 d BWG (kg) FI (kg) FCR (kg)
1.929a 3.208a,b 1.661b
1.928a 3.160a,b 1.640b
1.613b 3.005b 1.867a
1.994a 3.330a 1.670b
1.928a 3.268a 1.699b
<0.0001 0.0120 <0.0001
0.0310 0.0334 0.0197
1–42 d BWG (kg) FI (kg) FCR (kg) Viab (%) Fat (kg) Fat (%)
2.539a 4.427a 1.743b 89.166 0.040 1.547a,b
2.082b 4.066b 1.955a 93.333 0.043 1.858a
2.649a 4.595a 1.735b 90.833 0.045 1.635a,b
2.549a 4.511a 1.771b 90.000 0.041 1.538a,b
<0.0001 0.0003 <0.0001 0.6579 0.5363 0.0325
0.0425 0.0456 0.0186 1.0968 0.0010 0.0416
2.570a 4.416a 1.718b 88.333 0.042 1.501b
Means followed by different superscript letters, in a row, differ by Tukey’s Studentized Range Test (P < 0.05). PC1 = 100% of DL-Met + regular water line; PC2 = 100% of DL-Met + carboy system; NC = Negative control (no Methionine supplementation); TH-Met = 60% DL-Met + 40% H-Met; TL-Met = 50% DL-Met + 50% L-Met. N = 6.
a,b 1
Edition [19] using P ≤ 0.05 as the significance statement.
RESULTS AND DISCUSSION Growth Performance The results for both PC treatments, either connected to the regular water line (PC1) or connected to the carboy system (PC2), were statistically similar for all analyzed traits and phases. According to Lott et al. [20], feed and water intakes are strongly and positively correlated. Those results indicate that the use of carboys for supplementing liquid L-Met was efficient in providing adequate volume of water to maintain FI and growth performance and did not influence the results. The water intake from the treatments PC2 and TL-Met was only different at week 5, in which birds receiving TL-Met showed higher water intake than birds receiving water only (P = 0.040) (Figure 1). The performance characteristics were affected by treatments at all phases (Table 2). During starter and grower phases (1–10 d and
Figure 1. Weekly water intake from birds receiving water only (PC2–100% DL-Met connected to carboys) or liquid L-Met (TL-Met–50% DL-Met + 50% L-Met) using carboy system. Values are means with their standard errors represented by vertical bars. ∗ Significantly different (P = 0.04).
11–22 d, respectively), BWG and FI were the lowest, and FCR was the highest for birds fed the NC diet (no addition of Met) (P < 0.001). No other differences were found to be significant. For the finisher phase (23–42 d), birds fed the NC diet had the lowest BWG and highest FCR (P < 0.001). The FI was lower when birds were fed the NC diet compared to the treatments TH-Met and TL-Met (P = 0.012). Both PC diets showed intermediate values. Considering the
Downloaded from https://academic.oup.com/japr/advance-article-abstract/doi/10.3382/japr/pfz062/5519684 by guest on 03 August 2019
PC1
BWG (kg) FI (kg) FCR (kg)
CASTRO AND KIM: HERBAL METHIONINE FOR BROILERS
5
Table 3. Means of the Expression of Phosphoenolpyruvate Carboxykinase (PEPCK), Fatty Acid Binding Protein 4 (FABP4), and Fatty Acid Synthase (FAS) at 42 d. Treatments1 PC1
PC2
NC
TH-Met
TL-Met
P value
SE
0.928 1.165 1.064
0.903 0.910 1.245
1.127 1.048 1.421
1.341 1.387 1.539
0.915 0.905 0.441
0.7645 0.6359 0.7190
0.1208 0.1093 0.2574
PC1 = 100% of DL-Met + regular water line; PC2 = 100% of DL-Met + carboy system; NC = Negative control (no Methionine supplementation); TH-Met = 60% DL-Met + 40% H-Met; TL-Met = 50% DL-Met + 50% L-Met. N = 6.
1
Table 4. Means of Aspartate Aminotransferase (AST), Creatine Kinase (CK), Uric Acid (UA), Total Protein (TP), Albumin (ALB), Globulin (GLOB), Sodium (Na+ ), and Potassium (K− ) at 42 d of age. Treatments1 PC1 AST (U/L) CK (U/L) UA (mg/dL) TP (g/dL) ALB (g/dL) GLOB (g/dL) Na+ (mmol/L) K− (mmol/L)
PC2 a,b
178.00 3458 8.360 2.700 2.320 0.420 138.80 7.44
NC b
166.33 3284 9.333 2.567 2.166 0.400 141.33 6.23
a
205.20 4109 7.000 2.600 2.120 0.480 138.00 7.60
TH-Met
TL-Met
P value
SE
a
b
0.0318 0.5994 0.3524 0.3620 0.2422 0.2094 0.7075 0.1529
14.1490 396.941 0.4727 0.0514 0.0396 0.0320 0.8056 0.1866
201.25 5129 5.875 2.525 2.350 0.250 139.75 7.95
167.00 3275 6.300 2.875 2.350 0.500 137.25 7.05
Means followed by different superscript letters, in a row, differ by Tukey’s Studentized Range Test (P < 0.05). PC1 = 100% of DL-Met + regular water line; PC2 = 100% of DL-Met + carboy system; NC = Negative control (no Methionine supplementation); TH-Met = 60% DL-Met + 40% H-Met; TL-Met = 50% DL-Met + 50% L-Met. N = 6.
a,b 1
overall period, from 1 to 42 d, birds fed the negative control diet had the lowest BWG and FI and the highest FCR compared to the other treatments (P < 0.003). No other significant differences were found. Viability was not different between the treatments (P = 0.658). The BWG and FI were reduced, and FCR was increased when birds were fed diets without addition of Met (NC), which is in accordance to the literature [21–23]. Met, which is an essential amino acid for birds, is required for normal development and its deficiency is associated to growth inhibition, induction of metabolic disorders, and reduction of the immune system [24]. Moreover, in the present study, the birds fed TH-Met showed similar performance results than birds fed both PC diets and TL-Met, indicating that DL-Met could be partially replaced (40%) by H-Met. Similarly, Makinde et al. [5] investigated the use of H-Met substituting DL-Met in 0, 25, 50, 75, and 100%, and found no differences between the treatments for growth performance and carcass yield. The authors suggested that DL-Met can be fully replaced by H-Met to
provide 0.50% of Met in the diet. Contrary to our findings, Salome et al. [25] studied graded levels of H-Met supplementation (0, 0.25, 0.5, and 1.0%) compared to 0.25% of DL-Met, and found that increasing levels of H-Met resulted in improved performance results; however, even with the maximum supplementation of 1% of HMet, the performance was still inferior compared to 0.25% of DL-Met. The contradictory results may be attributed to the supplementation levels of H-Met and the degree of Met deficiency in the diet. Our findings suggest that H-Met partially replaces Met requirement in broilers.
Fat Metabolism Fat pad in absolute weight was not affected by the treatments, whereas fat pad as a percentage of body weight was significantly higher when birds were fed the NC diet compared to birds fed the PC2 (P < 0.032) (Table 2). The other treatments resulted in similar and intermediate values. There were no differences between the
Downloaded from https://academic.oup.com/japr/advance-article-abstract/doi/10.3382/japr/pfz062/5519684 by guest on 03 August 2019
FABP4 FAS PEPCK
6
Serum Biochemistry Considering serum analysis, the treatments affected only AST level, which was higher for birds fed the NC and TH-Met diets compared to the PC2 and TL-Met diets (P = 0.031) (Table 4). No other differences were found to be significant. Serum biochemical parameters assessment can be used to monitor health status in broilers. The concentrations of AST, total protein, albumin, and globulin, which are synthesized in the liver, can be indicators of hepatic function [31, 32]; whereas UA, Na, and K concentrations can be indicators of renal function [33]. Although AST is a nonspecific liver damage indicator, it may also be altered in muscle injuries [33–35]. To detect hepatocellular disease, the increase of AST should be followed by an
increase in CK [33]. In our study, birds fed the NC diet and TH-Met showed higher AST levels compared to birds fed PC2 and TL-Met, without significantly increased CK levels. Despite having higher levels for this variable, the values found for those treatments were still within the range considered normal for broilers, that is from 70 to 220 U/L according to Meluzzi et al. [36], suggesting that there was no hepatic damage in the birds. Hadinia et al. [37] and Makinde et al. [5] studying herbal sources of Met did not observe an effect on blood parameters when compared to DL-Met supplementation. Additionally, it has been shown that the consumption of H-Met up to 5000 mg/kg body weight in rats was safe with no adverse effect on growth and biochemical parameters [38]. The results obtained provide clear evidence of the potential of phyto-additives as substitutes of synthetic Met sources in organic production. Our findings showed that herbal methionine can partially replace DL-Met and L-Met in common diets without reducing growth performance, increasing fat accretion and changing serum biochemical characteristics in broiler chickens.
CONCLUSIONS AND APPLICATIONS 1. The partial substitution of DL-Met with HMet, compared to DL-Met and L-Met, was enough to maintain growth performance without increasing fat accretion and changing serum biochemical characteristics in broiler chickens. 2. Based on this study, Phyto-additives showed a great potential as a substitute for synthetic Met sources in organic production. However, additional research needs to be conducted to investigate different inclusion ratios of herbal methionine in the diet.
REFERENCES AND NOTES 1. Kalbande, V. H., K. Ravikanth, S. Maini, and D. S. Rekhe. 2009. Methionine supplementation options in poultry. Int. J. Poult. Sci. 8:588–591. 2. Yuan, J., A. J. Karimi, S. D. Goodgame, C. Lu, F. J. Mussini, and W. P. Waldroup. 2012. Evaluation of herbal methionine source in broiler diets. Int. J. Poult. Sci. 11:247– 250.
Downloaded from https://academic.oup.com/japr/advance-article-abstract/doi/10.3382/japr/pfz062/5519684 by guest on 03 August 2019
treatments for the expression of genes related to lipid metabolism (P < 0.050) (Table 3). Because abdominal fat pad has shown a linear relationship with total body lipid in broilers, it can be used as a predictor for whole body fat [26]. In this study, birds fed the NC diet showed lower body weight and similar abdominal fat weight compared to the other treatments. In consequence, there was a statistically significant increase in fat pad as percentage of body weight for the birds fed NC compared to the ones fed the PC2, and a numerical increase was observed compared to the other treatments. This result is in accordance to Corzo et al. [22], who found an increase in abdominal fat percentage when birds were fed Met deficient diets, and Andi [27] who demonstrated that additional Met decreased abdominal fat relative to body weight of broilers during a starter phase. Met was shown to influence fat metabolism through carnitine synthesis by stimulating β-Oxidation of fatty acids [28] and regulate carnitine palmitoyltrasnferase I gene transcription in the liver [23]. It has also been shown that Met supplementation reduces malic enzyme (ME) and FAS activity and increases hormonesensitive lipase (HSL) activity, hence, reducing lipogenesis and increasing lipolysis in broiler chicks [29, 30]. In the present study, we did not find differences between the treatments for the expression of genes related to lipid metabolism.
JAPR: Research Report
CASTRO AND KIM: HERBAL METHIONINE FOR BROILERS
17. VetScanAvian Reptilian Profile Plus. 18. VetScan VS2 Chemistry Analyzer (Abaxis, Union City, California). 19. SAS Institute. 2017. SAS University Edition, 9.4. SAS Institute, Cary, NC. 20. Lott, B. D., W. A. Dozier, J. D. Simmons, and W. B. Roush. 2003. Water flow rates in commercial broiler houses. Poult. Sci. 82:102 [S56]. 21. Carew, L. B., J. P. McMurtry, and F. A. Alster. 2003. Effects of methionine deficiencies on plasma levels of thyroid hormones, insulin-like growth factors-I and -II, liver and body weights, and feed intake in growing chickens. Poult. Sci. 82:1932–1938. 22. Corzo, A., M. T. Kidd, W. A. Dozier, III, L. A. Shack, and S. C. Burgess. 2006. Protein expression of pecotoralis major muscle in chickens in response to dietary methionine status. Br. J. Nutr. 95:703–708. 23. Kikusato, M., S. Sudo, and M. Toyomizu. 2015. Methionine deficiency leads to hepatic fat accretion via impairment of fatty acid import by carnitine palmitoyltransferase I. Br. Poult. Sci. 56:225–231. 24. Bunchasak, C. 2009. Role of dietary Methionine in poultry production. Jpn. Poult. Sci. 46:169–179. 25. Salome, I., I. I. Dafwang, and G. S. Bawa. 2010. Evaluation of Methiorep as a substitute for methionine in broiler diets. Int. J. Poult. Sci. 9:809–812. 26. Whitehead, C. C., J. Armstrong, and K. M. Herron. 1990. The growth to maturity of lean and fat lines of broiler chickens given diets of different protein content: body composition, plasma lipoprotein concentration and initial egg production. Anim. Prod. 50:183–190. 27. Andi, M. A. 2012. Effects of additional DLmethionine in broiler starter diet on blood lipids and abdominal fat. Afr. J. Biotechnol. 11:7579–7581. 28. Schutte, J. B., J. De Jong, W. Smink, and M. Pack. 1997. Replacement value of betaine for DL-methionine in male broiler chicks. Poult. Sci. 76:321–325. 29. Takahashi, K., and Y. Abiba. 1995. Effect of methionine supplementation on lipogenesis and lipolysis in broiler chicks. Jpn. Poult. Sci. 32:99–106. 30. Fouad, A. M., and H. K. El-Senousey. 2014. Nutritional factors affecting abdominal fat deposition in poultry: a review. Asian Australas. J. Anim. Sci. 27:1057–1068. 31. Gonzalez, F. H. D., and S. C. Silva. 2006. Perfil bioqu´ımico sangu´ıneo. Pages 313–358 in Introduc¸a˜ o a bioqu´ımica cl´ınica veterin´aria. Gonzalez, F. H. D., and S. C. Silva, eds. UFRGS, Porto Alegre, Brazil. 32. Traesel, C. K., P. Wolkmer, C. Schmidt, C. B. Silva, F. C. Paim, A. P. Rosa, S. H. Alves, J. M. Santurio, and S. T. A. Lopes. 2011. Serum biochemical profile and performance of broiler chickens fed diets containing essential oils and pepper. Comp. Clin. Pathol. 20:453–460. 33. Campbell, T. W. (2007) Bioqu´ımica cl´ınica de aves. Pages 448–460 in Hematologia e Bioqu´ımica Cl´ınica Veterin´aria. Thrall, M. A., D. C. Baker, T. W. Campbell, D. Denicola, M. J. Fettman, E. D. Lassen, A. Rebar, and G. Weiser eds. Roca, S˜ao Paulo. 34. Tennant, B. C. 1997. Hepatic function. Pages 327– 352 in Clinical Biochemistry of Domestic Animals. Kaneko, J. J., J. W. Harvey, and M. L. Bruss, eds. Acad. Press, London, England.
Downloaded from https://academic.oup.com/japr/advance-article-abstract/doi/10.3382/japr/pfz062/5519684 by guest on 03 August 2019
3. Burley, H. K., K. E. Anderson, P. H. Patterson, and P. B. Tillman. 2016. Formulation challenges of organic poultry diets with readily available ingredients and limited synthetic methionine. J. Appl. Poult. Res. 25:443–454. 4. USDA, National Organic Program (NOP). 2012. Amendment to the national list of allowed and prohibited substances (Livestock). Fed. Regist. 77:57985– 57990. 5. Makinde, O. J., A. J. Ajibade, S. K. Omotugba, M. S. Tamburawa, E. A. Ibe, E. Opoola, and O. S. Zaccheaus. 2017. R improves growth perforHerbal methionine (Methiorep) mance of broiler chickens without affecting carcass characteristics and blood indices. Trop. Subtrop. Agroecosyst. 20:131–139. 6. Chattopadhyay, K., M. K. Mondal, and B. Roy. 2006. Comparative efficacy of DL-Methionine and herbal methionine on performance of broiler chicken. Int. J. Poult. Sci. 5:1034–1039. 7. COBB Vantress. 2013. Broiler management guide. Accessed Jul. 2018. http://www.cobb-vantress.com/docs/ default-source/management-guides/broiler-managementguide.pdf. 8. COBB Vantress. 2015. Broiler performance and nutrition supplement. Accessed Jul. 2018. http://www. cobb-vantress.com/docs/default-source/cobb-500-guides/ Cobb500 Broiler Performance And Nutrition Supplement. pdf. 9. Methiorep, M/S Ayurvet Limited, Baddi, India. 10. Alqhtani, A. H. 2016. The effect of pen size on water to feed ratio of broiler chickens. Master Thesis, Univ. Georgia, Athens. 11. Primers sequence PEPCK-1: 5’GGGGTGTCTATTGGGAAGGC3’/ 3’CACGGCTCCCCATTATCTGG, product size 100 bp. 12. Primers sequence FABP4: 5’GAGTTTGATGAGACCACAGCAGA3’/ 3’ATAACAGTCTCTTTGCCATCCCA5’, product size 107 bp. 13. Primers sequence FAS: 5’AGAGGCTTTGAA GCTCGGAC3’/ 3’GGTGCCTGAATACTTGGGCT5’, product size 127pb. 14. Total RNA was extracted from the tissue using QIAzolLysis Reagent (Qiagen, Germantown, MD) according to the manufacturer’s instruction. RNA quantity and purity were determined using a Nanodrop 1000 spectrophotometer. The cDNA was synthesized from total RNA (2 mg) using high-capacity cDNA reverse transcription kits (Qiagen, Germantown, MD) and was diluted to 10 ng/μl for qRT- PCR analysis. Glyceraldehyde-3-Phosphate Dehydrogenase (GAPDH) (5’TCAGCAGCAGGCTTCACTAC3’/ 3’GCTAAGGCTGTGGGGAAAGT5’, product size 161pb) was chosen as a reference gene. The qRT-PCR was performed on an Applied Biosystems StepOnePlusTM (Thermo Fisher Scientific,Waltham, MA) with iTaqTM Universal SYBR Green Supermix (BioRad, Hercules, CA) using the following conditions for all genes: 95◦ C for 15 s, 60◦ C for 20 s, and 72◦ C for 15 s. 15. Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2 (-Delta Delta C(T)) Method. Methods 25:402– 408. 16. Eppendorf Centrifuge 5430R, Eppendorf, Hamburg, Germany.
7
8
37. Hadinia, S., M. Shivazad, H. Moravej, M. AlahyariShahrasb, and M. M. Nabi. 2014. Bio-efficacy comparison of herbal-methionine and DL-methionine based on performance and blood parameters of broiler chickens. Vet. Res. Forum. 5:81–87. 38. Rajurker, S., D. S. Rekhe, S. Maini, and K. Ravikanth. 2009. Acute toxicity of polyherbal formulation (Methiorep Premix). Vet. World. 2:58–59.
Downloaded from https://academic.oup.com/japr/advance-article-abstract/doi/10.3382/japr/pfz062/5519684 by guest on 03 August 2019
35. Schmidt, E. M. S., R. Locatelli-Dittrich, E. Santin, and A. C. Paulillo. 2007. Clinical pathology in poultry – a tool to improve poultry health – a review. Arch. Vet. Sci. 12:9–20. 36. Meluzzi, A., G. Pimiceri, R. Giordani, and G. Fabris. 1992. Determination of blood constituents reference values in broilers. Poult. Sci. 71:337– 345.
JAPR: Research Report
F. L. S. Castro
and W. K. Kim1
Department of Poultry Science, University of Georgia, Athens, GA 30602, USA Primary Audience: Nutritionists, Poultry industry SUMMARY The aim was to evaluate the partial replacement of synthetic DL-Methionine (DL-Met) by Herbal Methionine (H-Met) compared to DL-Met and L-Methionine (L-Met), and the effects on growth performance, fat metabolism, and serum biochemistry in broilers. A total of 600 TM 1-d-old male Cobb500 chicks (Cobb x Cobb) were distributed in a completely randomized design, five dietary treatments, six replicates of 20 birds each. Liquid L-Met was provided through carboys connected to the water line. Two positive control (PC) treatments were used, either connected to the regular water line (PC1) or to carboys (PC2). The treatments were: Negative control (NC—no Met supplementation); PC1 and 2 (100% DL-Met); 60% DL-Met + 40% H-Met through feed (TH-Met); and 50% DL-Met + 50% L-Met through water (TL-Met). At 10, 22, and 42 d body weight gain (BWG), feed intake (FI) and feed conversion ratio (FCR) were determined. At day 21, serum and liver samples were used to evaluate serum biochemistry and the expression of genes related to fat metabolism, respectively. At 42 d, abdominal fat was weighed from 3 birds/replicate. In general, birds fed NC showed lower BWG, FI, higher FCR, and tended to have higher fat pad compared to the other treatments (P < 0.05). No differences were found for gene expression (P > 0.05). For serum biochemistry, Aspartate amino transferase (AST) level was higher in birds fed NC and TH-Met than in PC2 and TL-Met (P < 0.05). In conclusion, DL-Met can be partially replaced by H-Met without negatively affecting growth performance, fat metabolism, and serum biochemistry of broiler chickens. Key words: broiler chickens, DL-Methionine, herbal Methionine, L-Methionine, serum biochemistry 2019 J. Appl. Poult. Res. 0:1–8 http://dx.doi.org/10.3382/japr/pfz062
DESCRIPTION OF PROBLEM Methionine is considered an essential amino acid for poultry because they cannot synthesize it in enough quantity, and they have a high 1
Corresponding author: [email protected]
requirement for it to support adequately their biological functions and rapid growth. Additionally, the plant protein sources used in typical poultry diets have low Met levels, which make the supplementation necessary [1, 2]. The most common forms of dietary Met are synthetic products, such as DL-Met, L-Met, or
Downloaded from https://academic.oup.com/japr/advance-article-abstract/doi/10.3382/japr/pfz062/5519684 by guest on 03 August 2019
DL – methionine can be replaced partially by phyto-additive without affecting growth performance, fat metabolism, and serum biochemistry in broilers
JAPR: Research Report
2
MATERIALS AND METHODS General Procedures The experiment was approved by the Institutional Animal Care and Use Committee (IACUC) of University of Georgia (Athens, Georgia, United States). A total of 600 1-d-old TM male Cobb500 broiler chicks (Cobb x Cobb) were distributed in a completely randomized design with 5 dietary treatments and 6 replicates of 20 birds each. The chicks were allocated to 30 identical pens equipped with 1 nipple drinker and 1 feeder, providing ad libitum access to water and feed from 1 to 42 d of age. Temperature and
lighting program followed the recommendation of Cobb Broiler Management Guide [7]. The corn and soybean meal-based nonorganic diets were formulated to meet the nutrient recommendations [8] for starter (1–10 d), grower (11–22 d), and finisher (23–42 d) phases (Table 1). Birds were supplemented with synthetic DL-Methionine (DL-Met) alone or in combination with L-Methionine (L-Met) or Herbal Methionine (H-Met) [9], which contained extracts from Cicer arientinum, Phaseolus mungo, Triticum sativum, Mucuna pruriens, and Alium cepa, to reach the Met level (100%) recommended by the Cobb500TM guide. The DL-Met and H-Met were provided through feed, whereas L-Met was provided through drinking water, using carboys connected to the nipple lines. Because of the liquid methionine provided through water, 2 positive control (PC) treatments fed DL-Met were used: one connected to the regular water line and the other one to carboys containing only water. The dietary treatments were as follows: negative control (NC—no synthetic Met supplementation); PC (100% of DLMet connected to the regular water line (PC1) or the carboy system (PC2)); 60% DL-Met + 40% H-Met through feed (TH-Met); and 50% DL-Met + 50% L-Met through water (TL-Met). The Met source level of inclusion for each treatment was: PC1 and PC2–0.34, 0.29, 0.23% of DL-Met for starter, grower, and finisher phases, respectively; TH-Met–0.204, 0.174, 0.138% of DL-Met and 0.136, 0.116, 0.092% of H-Met for starter, grower, and finisher phases, respectively; TL-Met–0.170, 0.145, 0.115% of DL-Met and 0.05, 0.1, and 0.2 ml/bird/day of liquid L-Met for starter, grower, and finisher phases, respectively. The water amount provided in the carboys followed an estimated water intake according to Alqhtani [10]. The birds and feed were weighed by pen at 10, 22, and 42 d of the experiment to determine body weight gain (BWG), feed intake (FI), and feed conversion ratio (FCR) (Table 2). Water intake (WI) from PC2 and TL-Met was measured weekly, starting from the second week, by weighing the carboys (Figure 1). Mortality was recorded daily and used to calculate viability (%). At day 21, 1 bird per pen was selected, and serum and liver samples were collected for the evaluation of liver and kidney metabolic markers and the expression of genes related to fat
Downloaded from https://academic.oup.com/japr/advance-article-abstract/doi/10.3382/japr/pfz062/5519684 by guest on 03 August 2019
DL-Methionine-hydroxy analog [1, 2]. However, despite the inexistence of known negative health consequences of supplementing synthetic Met at levels used to meet the bird’s requirement, there is still consumer pressure for banning the use of synthetic substances in organic livestock diets [3]. Since 2012 October 2, the United States Department of Agriculture (USDA)-National Organic Program (NOP) determined that the synthetic Met use in organic production was restricted to 1.0, 1.0, and 1.5 kg/metric ton for laying hens, broilers, and turkeys, respectively [4]. This limitation increases the challenge in formulating diets, since Met rich organic ingredients might not be easily available and cost effective. Thus, alternative organic Met sources have been investigated to replace synthetic Met in organic poultry production. Phyto-additives have been studied for poultry production as a replacement of synthetic Met [1, 2, 5]. Most of the available products have plant extracts containing Met, Cysteine (Cys), betaine, and S-Adenosyl Methionine (SAMe), which can mimic or spare Met in the metabolism, acting as methyl donor groups or sulfur source, and playing major roles in choline, folic acid, and vitamin B12 metabolism [6]. The objective of this study was to investigate the partial replacement of synthetic DL-Methionine (DL-Met) by Herbal Methionine (H-Met) in poultry diets and the effects of feeding H-Met on growth performance, fat metabolism and serum biochemistry in broilers compared to DL-Met and L-Methionine (L-Met).
CASTRO AND KIM: HERBAL METHIONINE FOR BROILERS
3
Table 1. Diets Formulation for All Phases (1–42 d, As-Fed Basis; % Diet). Positive control (PC) Ingredient (% of diet)
ME (kcal/kg) CP (%) Ca (%) Available P (%) Met + Cys (%) Met (%) Lys (%)
Grower (11–22 d)
Finisher (23–42 d)
Starter (1–10 d)
Grower (11–22 d)
Finisher (23–42 d)
63.35 30.00 1.41 0.65 1.75 0.30 0.25 0.08 0.34 0.36 0.12 1.05 0.05 0.29 100
67.34 26.00 1.96 0.63 1.61 0.30 0.25 0.08 0.29 0.33 0.10 0.76 0.05 0.30 100
68.35 25.01 3.00 0.61 1.40 0.30 0.25 0.08 0.23 0.18 0.05 0.05 0.49 100
63.35 30.00 1.41 0.65 1.75 0.30 0.25 0.08 0.36 0.12 1.05 0.05 0.29 100
67.34 26.00 1.96 0.63 1.61 0.30 0.25 0.08 0.33 0.10 0.76 0.05 0.30 100
68.35 25.01 3.0 0.61 1.40 0.30 0.25 0.08 0.18 0.05 0.05 0.72 100
3,035 22.0 0.90 0.45 0.98 0.65 1.32
3,108 20.0 0.84 0.42 0.89 0.58 1.19
3,180 18.48 0.76 0.38 0.82 0.52 1.05
3,023 21.8 0.90 0.45 0.65 0.32 1.32
3,097 19.83 0.84 0.42 0.60 0.30 1.19
3,172 18.34 0.76 0.38 0.59 0.29 1.05
1
Provided per kg of DSM Vitamin premix: Vit. A 2204,586 IU, Vit. D3 200,000 ICU, Vit. E 2000 IU, Vit. B12 2 mg, Biotin 20 mg, Menadione 200 mg, Thiamine 400 mg, Riboflavin 800 mg, d-Pantothenic Acid 2000 mg, Vit. B6 400 mg, Niacin 8000 mg, Folic Acid 100 mg, Choline 34,720 mg. 2 Provided per kg of Mineral premix: Ca 0.72 g, Mn 3.04 g, Zn 2.43 g, Mg 0.61 g, Fe 0.59 g, Cu 22.68 g, I 22.68 g, Se 9.07 g.
metabolism. At 42 d, 3 birds per repetition were selected from a range of ±10% the pen average body weight and euthanized by cervical dislocation. The abdominal fat removed from around the cloaca, bursa of Fabricius, gizzard, and proventriculus was weighed and used to calculate the average fat weight relative to the body weight. Gene Expression Analysis. Liver samples were used to analyze the expression of phosphoenolpyruvate carboxykinase 1 (PEPCK-1) [11], fatty acid binding protein 4 (FABP4) [12], and fatty acid synthase (FAS) [13] genes for nutrient metabolism. For that, the Quantitative ReverseTranscriptase Polymerase Chain Reaction (qRTPCR) was used to determine the mRNA expression of the target genes [14]. Samples were run in duplicate and relative gene expression data were analyzed using the 2−Ct method according to Livak and Schmittgen [15]. The mean Ct of the negative control (no supplementation with Met) was used to calculate the Ct value (Table 3). Serum Analysis. Blood (3 ml/bird) was collected from the brachial vein and centrifuged at
3000 rpm for 12 min using a microcentrifuge [16], and 400 μl of serum was removed and stored at −80◦ C for further analysis. A total of 100 μl of serum was transferred to the specific rotor [17], and serum chemistry was analyzed using a blood analyzer [18]. Aspartate Aminotransferase (AST), Creatine Kinase (CK), Uric Acid (UA), Total Protein (TP), Albumin (ALB), Globulin (GLOB), Sodium (Na+ ), and Potassium (K− ) levels in serum were evaluated (Table 4). Statistical Analysis Data were first tested for homogeneity of variances and normality of studentized residuals. When data were normally distributed, one-way ANOVA was performed, and, in case of significant differences, the treatments were compared by Tukey’s test. Viability was the only variable not normally distributed, therefore, Kruskal– Wallis Test was performed. All statistical procedures were performed using SAS University
Downloaded from https://academic.oup.com/japr/advance-article-abstract/doi/10.3382/japr/pfz062/5519684 by guest on 03 August 2019
Corn Soybean meal (48%) Soybean oil Limestone Defluorinated phosphate Salt Vitamin mix1 Mineral mix2 DL-Methionine L-Lysine Threoninie L- Glutamine Coban 90 Sand
Negative control (NC)
Starter (1–10 d)
JAPR: Research Report
4
Table 2. Means of Body Weight Gain (BWG), Feed Intake (FI), Feed Conversion Ratio (FCR), Viability (Viab), and Abdominal Fat (Fat) According to Dietary Treatments for All Phases. Treatments1 1–10 d
PC2
NC
TH-Met
TL-Met
P value
SE
0.199a 0.254a 1.272b
0.203a 0.253a 1.245b
0.165b 0.226b 1.365a
0.207a 0.260a 1.253b
0.209a 0.260a 1.244b
<0.0001 <0.0001 <0.0001
0.0033 0.0028 0.0101
11–22 d BWG (kg) FI (kg) FCR (kg)
0.653a 0.967a 1.481b
0.686a 1.003a 1.462b
0.512b 0.836b 1.633a
0.698a 1.005a 1.441b
0.665a 0.983a 1.479b
<0.0001 <0.0001 <0.0001
0.0135 0.0142 0.0162
23–42 d BWG (kg) FI (kg) FCR (kg)
1.929a 3.208a,b 1.661b
1.928a 3.160a,b 1.640b
1.613b 3.005b 1.867a
1.994a 3.330a 1.670b
1.928a 3.268a 1.699b
<0.0001 0.0120 <0.0001
0.0310 0.0334 0.0197
1–42 d BWG (kg) FI (kg) FCR (kg) Viab (%) Fat (kg) Fat (%)
2.539a 4.427a 1.743b 89.166 0.040 1.547a,b
2.082b 4.066b 1.955a 93.333 0.043 1.858a
2.649a 4.595a 1.735b 90.833 0.045 1.635a,b
2.549a 4.511a 1.771b 90.000 0.041 1.538a,b
<0.0001 0.0003 <0.0001 0.6579 0.5363 0.0325
0.0425 0.0456 0.0186 1.0968 0.0010 0.0416
2.570a 4.416a 1.718b 88.333 0.042 1.501b
Means followed by different superscript letters, in a row, differ by Tukey’s Studentized Range Test (P < 0.05). PC1 = 100% of DL-Met + regular water line; PC2 = 100% of DL-Met + carboy system; NC = Negative control (no Methionine supplementation); TH-Met = 60% DL-Met + 40% H-Met; TL-Met = 50% DL-Met + 50% L-Met. N = 6.
a,b 1
Edition [19] using P ≤ 0.05 as the significance statement.
RESULTS AND DISCUSSION Growth Performance The results for both PC treatments, either connected to the regular water line (PC1) or connected to the carboy system (PC2), were statistically similar for all analyzed traits and phases. According to Lott et al. [20], feed and water intakes are strongly and positively correlated. Those results indicate that the use of carboys for supplementing liquid L-Met was efficient in providing adequate volume of water to maintain FI and growth performance and did not influence the results. The water intake from the treatments PC2 and TL-Met was only different at week 5, in which birds receiving TL-Met showed higher water intake than birds receiving water only (P = 0.040) (Figure 1). The performance characteristics were affected by treatments at all phases (Table 2). During starter and grower phases (1–10 d and
Figure 1. Weekly water intake from birds receiving water only (PC2–100% DL-Met connected to carboys) or liquid L-Met (TL-Met–50% DL-Met + 50% L-Met) using carboy system. Values are means with their standard errors represented by vertical bars. ∗ Significantly different (P = 0.04).
11–22 d, respectively), BWG and FI were the lowest, and FCR was the highest for birds fed the NC diet (no addition of Met) (P < 0.001). No other differences were found to be significant. For the finisher phase (23–42 d), birds fed the NC diet had the lowest BWG and highest FCR (P < 0.001). The FI was lower when birds were fed the NC diet compared to the treatments TH-Met and TL-Met (P = 0.012). Both PC diets showed intermediate values. Considering the
Downloaded from https://academic.oup.com/japr/advance-article-abstract/doi/10.3382/japr/pfz062/5519684 by guest on 03 August 2019
PC1
BWG (kg) FI (kg) FCR (kg)
CASTRO AND KIM: HERBAL METHIONINE FOR BROILERS
5
Table 3. Means of the Expression of Phosphoenolpyruvate Carboxykinase (PEPCK), Fatty Acid Binding Protein 4 (FABP4), and Fatty Acid Synthase (FAS) at 42 d. Treatments1 PC1
PC2
NC
TH-Met
TL-Met
P value
SE
0.928 1.165 1.064
0.903 0.910 1.245
1.127 1.048 1.421
1.341 1.387 1.539
0.915 0.905 0.441
0.7645 0.6359 0.7190
0.1208 0.1093 0.2574
PC1 = 100% of DL-Met + regular water line; PC2 = 100% of DL-Met + carboy system; NC = Negative control (no Methionine supplementation); TH-Met = 60% DL-Met + 40% H-Met; TL-Met = 50% DL-Met + 50% L-Met. N = 6.
1
Table 4. Means of Aspartate Aminotransferase (AST), Creatine Kinase (CK), Uric Acid (UA), Total Protein (TP), Albumin (ALB), Globulin (GLOB), Sodium (Na+ ), and Potassium (K− ) at 42 d of age. Treatments1 PC1 AST (U/L) CK (U/L) UA (mg/dL) TP (g/dL) ALB (g/dL) GLOB (g/dL) Na+ (mmol/L) K− (mmol/L)
PC2 a,b
178.00 3458 8.360 2.700 2.320 0.420 138.80 7.44
NC b
166.33 3284 9.333 2.567 2.166 0.400 141.33 6.23
a
205.20 4109 7.000 2.600 2.120 0.480 138.00 7.60
TH-Met
TL-Met
P value
SE
a
b
0.0318 0.5994 0.3524 0.3620 0.2422 0.2094 0.7075 0.1529
14.1490 396.941 0.4727 0.0514 0.0396 0.0320 0.8056 0.1866
201.25 5129 5.875 2.525 2.350 0.250 139.75 7.95
167.00 3275 6.300 2.875 2.350 0.500 137.25 7.05
Means followed by different superscript letters, in a row, differ by Tukey’s Studentized Range Test (P < 0.05). PC1 = 100% of DL-Met + regular water line; PC2 = 100% of DL-Met + carboy system; NC = Negative control (no Methionine supplementation); TH-Met = 60% DL-Met + 40% H-Met; TL-Met = 50% DL-Met + 50% L-Met. N = 6.
a,b 1
overall period, from 1 to 42 d, birds fed the negative control diet had the lowest BWG and FI and the highest FCR compared to the other treatments (P < 0.003). No other significant differences were found. Viability was not different between the treatments (P = 0.658). The BWG and FI were reduced, and FCR was increased when birds were fed diets without addition of Met (NC), which is in accordance to the literature [21–23]. Met, which is an essential amino acid for birds, is required for normal development and its deficiency is associated to growth inhibition, induction of metabolic disorders, and reduction of the immune system [24]. Moreover, in the present study, the birds fed TH-Met showed similar performance results than birds fed both PC diets and TL-Met, indicating that DL-Met could be partially replaced (40%) by H-Met. Similarly, Makinde et al. [5] investigated the use of H-Met substituting DL-Met in 0, 25, 50, 75, and 100%, and found no differences between the treatments for growth performance and carcass yield. The authors suggested that DL-Met can be fully replaced by H-Met to
provide 0.50% of Met in the diet. Contrary to our findings, Salome et al. [25] studied graded levels of H-Met supplementation (0, 0.25, 0.5, and 1.0%) compared to 0.25% of DL-Met, and found that increasing levels of H-Met resulted in improved performance results; however, even with the maximum supplementation of 1% of HMet, the performance was still inferior compared to 0.25% of DL-Met. The contradictory results may be attributed to the supplementation levels of H-Met and the degree of Met deficiency in the diet. Our findings suggest that H-Met partially replaces Met requirement in broilers.
Fat Metabolism Fat pad in absolute weight was not affected by the treatments, whereas fat pad as a percentage of body weight was significantly higher when birds were fed the NC diet compared to birds fed the PC2 (P < 0.032) (Table 2). The other treatments resulted in similar and intermediate values. There were no differences between the
Downloaded from https://academic.oup.com/japr/advance-article-abstract/doi/10.3382/japr/pfz062/5519684 by guest on 03 August 2019
FABP4 FAS PEPCK
6
Serum Biochemistry Considering serum analysis, the treatments affected only AST level, which was higher for birds fed the NC and TH-Met diets compared to the PC2 and TL-Met diets (P = 0.031) (Table 4). No other differences were found to be significant. Serum biochemical parameters assessment can be used to monitor health status in broilers. The concentrations of AST, total protein, albumin, and globulin, which are synthesized in the liver, can be indicators of hepatic function [31, 32]; whereas UA, Na, and K concentrations can be indicators of renal function [33]. Although AST is a nonspecific liver damage indicator, it may also be altered in muscle injuries [33–35]. To detect hepatocellular disease, the increase of AST should be followed by an
increase in CK [33]. In our study, birds fed the NC diet and TH-Met showed higher AST levels compared to birds fed PC2 and TL-Met, without significantly increased CK levels. Despite having higher levels for this variable, the values found for those treatments were still within the range considered normal for broilers, that is from 70 to 220 U/L according to Meluzzi et al. [36], suggesting that there was no hepatic damage in the birds. Hadinia et al. [37] and Makinde et al. [5] studying herbal sources of Met did not observe an effect on blood parameters when compared to DL-Met supplementation. Additionally, it has been shown that the consumption of H-Met up to 5000 mg/kg body weight in rats was safe with no adverse effect on growth and biochemical parameters [38]. The results obtained provide clear evidence of the potential of phyto-additives as substitutes of synthetic Met sources in organic production. Our findings showed that herbal methionine can partially replace DL-Met and L-Met in common diets without reducing growth performance, increasing fat accretion and changing serum biochemical characteristics in broiler chickens.
CONCLUSIONS AND APPLICATIONS 1. The partial substitution of DL-Met with HMet, compared to DL-Met and L-Met, was enough to maintain growth performance without increasing fat accretion and changing serum biochemical characteristics in broiler chickens. 2. Based on this study, Phyto-additives showed a great potential as a substitute for synthetic Met sources in organic production. However, additional research needs to be conducted to investigate different inclusion ratios of herbal methionine in the diet.
REFERENCES AND NOTES 1. Kalbande, V. H., K. Ravikanth, S. Maini, and D. S. Rekhe. 2009. Methionine supplementation options in poultry. Int. J. Poult. Sci. 8:588–591. 2. Yuan, J., A. J. Karimi, S. D. Goodgame, C. Lu, F. J. Mussini, and W. P. Waldroup. 2012. Evaluation of herbal methionine source in broiler diets. Int. J. Poult. Sci. 11:247– 250.
Downloaded from https://academic.oup.com/japr/advance-article-abstract/doi/10.3382/japr/pfz062/5519684 by guest on 03 August 2019
treatments for the expression of genes related to lipid metabolism (P < 0.050) (Table 3). Because abdominal fat pad has shown a linear relationship with total body lipid in broilers, it can be used as a predictor for whole body fat [26]. In this study, birds fed the NC diet showed lower body weight and similar abdominal fat weight compared to the other treatments. In consequence, there was a statistically significant increase in fat pad as percentage of body weight for the birds fed NC compared to the ones fed the PC2, and a numerical increase was observed compared to the other treatments. This result is in accordance to Corzo et al. [22], who found an increase in abdominal fat percentage when birds were fed Met deficient diets, and Andi [27] who demonstrated that additional Met decreased abdominal fat relative to body weight of broilers during a starter phase. Met was shown to influence fat metabolism through carnitine synthesis by stimulating β-Oxidation of fatty acids [28] and regulate carnitine palmitoyltrasnferase I gene transcription in the liver [23]. It has also been shown that Met supplementation reduces malic enzyme (ME) and FAS activity and increases hormonesensitive lipase (HSL) activity, hence, reducing lipogenesis and increasing lipolysis in broiler chicks [29, 30]. In the present study, we did not find differences between the treatments for the expression of genes related to lipid metabolism.
JAPR: Research Report
CASTRO AND KIM: HERBAL METHIONINE FOR BROILERS
17. VetScanAvian Reptilian Profile Plus. 18. VetScan VS2 Chemistry Analyzer (Abaxis, Union City, California). 19. SAS Institute. 2017. SAS University Edition, 9.4. SAS Institute, Cary, NC. 20. Lott, B. D., W. A. Dozier, J. D. Simmons, and W. B. Roush. 2003. Water flow rates in commercial broiler houses. Poult. Sci. 82:102 [S56]. 21. Carew, L. B., J. P. McMurtry, and F. A. Alster. 2003. Effects of methionine deficiencies on plasma levels of thyroid hormones, insulin-like growth factors-I and -II, liver and body weights, and feed intake in growing chickens. Poult. Sci. 82:1932–1938. 22. Corzo, A., M. T. Kidd, W. A. Dozier, III, L. A. Shack, and S. C. Burgess. 2006. Protein expression of pecotoralis major muscle in chickens in response to dietary methionine status. Br. J. Nutr. 95:703–708. 23. Kikusato, M., S. Sudo, and M. Toyomizu. 2015. Methionine deficiency leads to hepatic fat accretion via impairment of fatty acid import by carnitine palmitoyltransferase I. Br. Poult. Sci. 56:225–231. 24. Bunchasak, C. 2009. Role of dietary Methionine in poultry production. Jpn. Poult. Sci. 46:169–179. 25. Salome, I., I. I. Dafwang, and G. S. Bawa. 2010. Evaluation of Methiorep as a substitute for methionine in broiler diets. Int. J. Poult. Sci. 9:809–812. 26. Whitehead, C. C., J. Armstrong, and K. M. Herron. 1990. The growth to maturity of lean and fat lines of broiler chickens given diets of different protein content: body composition, plasma lipoprotein concentration and initial egg production. Anim. Prod. 50:183–190. 27. Andi, M. A. 2012. Effects of additional DLmethionine in broiler starter diet on blood lipids and abdominal fat. Afr. J. Biotechnol. 11:7579–7581. 28. Schutte, J. B., J. De Jong, W. Smink, and M. Pack. 1997. Replacement value of betaine for DL-methionine in male broiler chicks. Poult. Sci. 76:321–325. 29. Takahashi, K., and Y. Abiba. 1995. Effect of methionine supplementation on lipogenesis and lipolysis in broiler chicks. Jpn. Poult. Sci. 32:99–106. 30. Fouad, A. M., and H. K. El-Senousey. 2014. Nutritional factors affecting abdominal fat deposition in poultry: a review. Asian Australas. J. Anim. Sci. 27:1057–1068. 31. Gonzalez, F. H. D., and S. C. Silva. 2006. Perfil bioqu´ımico sangu´ıneo. Pages 313–358 in Introduc¸a˜ o a bioqu´ımica cl´ınica veterin´aria. Gonzalez, F. H. D., and S. C. Silva, eds. UFRGS, Porto Alegre, Brazil. 32. Traesel, C. K., P. Wolkmer, C. Schmidt, C. B. Silva, F. C. Paim, A. P. Rosa, S. H. Alves, J. M. Santurio, and S. T. A. Lopes. 2011. Serum biochemical profile and performance of broiler chickens fed diets containing essential oils and pepper. Comp. Clin. Pathol. 20:453–460. 33. Campbell, T. W. (2007) Bioqu´ımica cl´ınica de aves. Pages 448–460 in Hematologia e Bioqu´ımica Cl´ınica Veterin´aria. Thrall, M. A., D. C. Baker, T. W. Campbell, D. Denicola, M. J. Fettman, E. D. Lassen, A. Rebar, and G. Weiser eds. Roca, S˜ao Paulo. 34. Tennant, B. C. 1997. Hepatic function. Pages 327– 352 in Clinical Biochemistry of Domestic Animals. Kaneko, J. J., J. W. Harvey, and M. L. Bruss, eds. Acad. Press, London, England.
Downloaded from https://academic.oup.com/japr/advance-article-abstract/doi/10.3382/japr/pfz062/5519684 by guest on 03 August 2019
3. Burley, H. K., K. E. Anderson, P. H. Patterson, and P. B. Tillman. 2016. Formulation challenges of organic poultry diets with readily available ingredients and limited synthetic methionine. J. Appl. Poult. Res. 25:443–454. 4. USDA, National Organic Program (NOP). 2012. Amendment to the national list of allowed and prohibited substances (Livestock). Fed. Regist. 77:57985– 57990. 5. Makinde, O. J., A. J. Ajibade, S. K. Omotugba, M. S. Tamburawa, E. A. Ibe, E. Opoola, and O. S. Zaccheaus. 2017. R improves growth perforHerbal methionine (Methiorep) mance of broiler chickens without affecting carcass characteristics and blood indices. Trop. Subtrop. Agroecosyst. 20:131–139. 6. Chattopadhyay, K., M. K. Mondal, and B. Roy. 2006. Comparative efficacy of DL-Methionine and herbal methionine on performance of broiler chicken. Int. J. Poult. Sci. 5:1034–1039. 7. COBB Vantress. 2013. Broiler management guide. Accessed Jul. 2018. http://www.cobb-vantress.com/docs/ default-source/management-guides/broiler-managementguide.pdf. 8. COBB Vantress. 2015. Broiler performance and nutrition supplement. Accessed Jul. 2018. http://www. cobb-vantress.com/docs/default-source/cobb-500-guides/ Cobb500 Broiler Performance And Nutrition Supplement. pdf. 9. Methiorep, M/S Ayurvet Limited, Baddi, India. 10. Alqhtani, A. H. 2016. The effect of pen size on water to feed ratio of broiler chickens. Master Thesis, Univ. Georgia, Athens. 11. Primers sequence PEPCK-1: 5’GGGGTGTCTATTGGGAAGGC3’/ 3’CACGGCTCCCCATTATCTGG, product size 100 bp. 12. Primers sequence FABP4: 5’GAGTTTGATGAGACCACAGCAGA3’/ 3’ATAACAGTCTCTTTGCCATCCCA5’, product size 107 bp. 13. Primers sequence FAS: 5’AGAGGCTTTGAA GCTCGGAC3’/ 3’GGTGCCTGAATACTTGGGCT5’, product size 127pb. 14. Total RNA was extracted from the tissue using QIAzolLysis Reagent (Qiagen, Germantown, MD) according to the manufacturer’s instruction. RNA quantity and purity were determined using a Nanodrop 1000 spectrophotometer. The cDNA was synthesized from total RNA (2 mg) using high-capacity cDNA reverse transcription kits (Qiagen, Germantown, MD) and was diluted to 10 ng/μl for qRT- PCR analysis. Glyceraldehyde-3-Phosphate Dehydrogenase (GAPDH) (5’TCAGCAGCAGGCTTCACTAC3’/ 3’GCTAAGGCTGTGGGGAAAGT5’, product size 161pb) was chosen as a reference gene. The qRT-PCR was performed on an Applied Biosystems StepOnePlusTM (Thermo Fisher Scientific,Waltham, MA) with iTaqTM Universal SYBR Green Supermix (BioRad, Hercules, CA) using the following conditions for all genes: 95◦ C for 15 s, 60◦ C for 20 s, and 72◦ C for 15 s. 15. Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2 (-Delta Delta C(T)) Method. Methods 25:402– 408. 16. Eppendorf Centrifuge 5430R, Eppendorf, Hamburg, Germany.
7
8
37. Hadinia, S., M. Shivazad, H. Moravej, M. AlahyariShahrasb, and M. M. Nabi. 2014. Bio-efficacy comparison of herbal-methionine and DL-methionine based on performance and blood parameters of broiler chickens. Vet. Res. Forum. 5:81–87. 38. Rajurker, S., D. S. Rekhe, S. Maini, and K. Ravikanth. 2009. Acute toxicity of polyherbal formulation (Methiorep Premix). Vet. World. 2:58–59.
Downloaded from https://academic.oup.com/japr/advance-article-abstract/doi/10.3382/japr/pfz062/5519684 by guest on 03 August 2019
35. Schmidt, E. M. S., R. Locatelli-Dittrich, E. Santin, and A. C. Paulillo. 2007. Clinical pathology in poultry – a tool to improve poultry health – a review. Arch. Vet. Sci. 12:9–20. 36. Meluzzi, A., G. Pimiceri, R. Giordani, and G. Fabris. 1992. Determination of blood constituents reference values in broilers. Poult. Sci. 71:337– 345.
JAPR: Research Report