DNA analysis in charred grains of naked wheat from several archaeological sites in Spain

Journal of Archaeological Science 40 (2013) 659e670

Contents lists available at SciVerse ScienceDirect

Journal of Archaeological Science journal homepage: http://www.elsevier.com/locate/jas

DNA analysis in charred grains of naked wheat from several archaeological sites in Spain E. Fernández a, e, *, S. Thaw a, T.A. Brown a, E. Arroyo-Pardo b, R. Buxó c, M.D. Serret d, J.L. Araus d a

Manchester Institute of Biotechnology, Faculty of Life Sciences, The University of Manchester, 131 Princess Street, Manchester M1 7DN, United Kingdom Dp. Toxicología y Legislación Sanitaria, Facultad de Medicina, Universidad Complutense de Madrid, Avda. Complutense S/N, 28040 Madrid, Spain c Museo de Arqueología de Cataluña, Passeig de Santa Madrona 39, 08038 Barcelona, Spain d Dp. Fisiología Vegetal, Facultad de Biología, Universidad de Barcelona, Avda. Diagonal 645, 08028 Barcelona, Spain e Instituto de Arqueologia e Paleociências, Universidades do Algarve e Nova de Lisboa, Dpto. História, Arqueologia e Património, Facultade de Ciências Humanas e Sociais, Universidade do Algarve, Campus de Gambelas, 8005-139 Faro, Portugal b

a r t i c l e i n f o

a b s t r a c t

Article history: Received 19 May 2012 Received in revised form 18 July 2012 Accepted 22 July 2012

In the present work we attempt to recover endogenous ancient DNA from cereal grains preserved under different conditions: charred, partially charred and waterlogged. A total of 126 grains from naked wheat and 18 from barley from different sites on the Eastern Iberian Peninsula ranging from the beginning of agriculture in the region to the turn of the Common Era, were studied. Two different extraction protocols were used, a standard phenolechloroform method and a silica-based DNA extraction procedure implemented for artificially charred seeds. Amplifications were directed to three markers: the large subunit of ribulose 1,5 biphosphate carboxylase (rbcL) and the microsatellite WCT12 in the chloroplast genome and the x and y subunits of the high molecular weight glutenin gene (Glu-1) in the nucleus. The first two were used to assess the preservation status of the samples, while with the third we tried to identify the wheat grains at species level. It was possible to obtain eleven positive amplifications in 8 partially charred seeds but only two amplifications of the Glu-1 gene from a single sample of the Early Bronze age were genome-specific. Different contamination sources were identified and reported. Cloning and alignment of sequenced clones showed a correspondence of the amplified fragment to modern wheat D genome haplotypes. This result suggests that the sample corresponds to hexaploid wheat (Triticum aestivum L.), thus being the first ancient DNA evidence to date for the cultivation of hexaploid wheat in the prehistoric agriculture of the Iberian Peninsula. Moreover, obtained results highlight contamination problems associated to the study of ancient archaeobotanical charred seeds suggest that the combination of a silica-based extraction method together with the amplification of specific targets is a good strategy for recovering endogenous ancient DNA from this kind of material. Ó 2012 Elsevier Ltd. All rights reserved.

Keywords: Ancient DNA Charred seeds Naked wheat Plant domestication

1. Introduction Wheat has been one of the most important crops in the Old World since the Neolithic. In spite of the spread of cereal agriculture in Europe being associated with cultivation of free-threshing wheat, methodological limitations prevent clear assignment of the prominent species(s) cultivated; either the hexaploid bread

* Corresponding author. Instituto de Arqueologia e Paleociências, Universidades do Algarve e Nova de Lisboa, Dpto. História, Arqueologia e Património, Facultade de Ciências Humanas e Sociais, Universidade do Algarve, Campus de Gambelas, 8005139 Faro, Portugal. Tel./fax: þ34 913941576. E-mail addresses: [email protected] (E. Fernández), susan.thaw@ manchester.ac.uk (S. Thaw), [email protected] (T.A. Brown), [email protected] (E. Arroyo-Pardo), [email protected] (R. Buxó), dserret@ ub.edu (M.D. Serret), [email protected] (J.L. Araus). 0305-4403/$ e see front matter Ó 2012 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.jas.2012.07.014

wheat (Triticum aestivum L.) or the tetraploid durum wheat (Triticum turgidum L. ssp. durum [Desf.] Husn.). For example, Maier (1996) concluded that tetraploid naked wheat spread from its point of origin in the Middle East via a Mediterranean route to southwest Europe. However, bread wheat has been identified as part of the cultivation assemblage at the Neolithic site of La Draga (Girona Province, Spain), one of the earliest sites in the Western Mediterranean where agriculture has been reported (Antolín and Buxó, 2011). Other studies have even suggested the coexistence of tetraploid and hexaploid naked wheat as far back as the early Neolithic near the Fertile Crescent (Fairbairn et al., 2002) and central Europe (Schlumbaum et al., 1998). Distinguishing between bread and durum wheat from the morphology of archaeobotanical remains is not easy. Only when the rachis is recovered it is possible to ascertain with a certain degree of confidence which of the two species is present (Antolín and Buxó,

660

E. Fernández et al. / Journal of Archaeological Science 40 (2013) 659e670

2011; Fairbairn et al., 2002). However, the rachis is not among the most frequently recovered cereal remains that are encountered in archaeological sites and therefore it is common to refer to naked wheat as T. aestivum/durum (Van Zeist and Bakker-Heeres, 1982) or T. aestivum/durum/turgidum (Jacomet and Schlichltherle, 1984) in archaeological studies of agriculture. Ancient plant DNA analyses from archaeobotanical remains and the use of molecular markers may represent an alternative way to identify the naked wheat specie(s) cultivated (Oliveira et al., 2012; Palmer et al., 2012a; Schlumbaum et al., 1998). The possibility of recovering ancient endogenous DNA from plant remains has been widely discussed in the literature (Brown, 1999; Gugerli et al., 2005). In an archaeological context, botanical evidence could survive through one of the following preservation methods: desiccation, waterlogging, charring (complete or partial) and mineralisation. Among them, desiccated remains are the most suitable for ancient DNA preservation due to rapid water exclusion causing a stop in hydrolysis reactions. However, this kind of preservation is restricted to very specific environments. Successful DNA recovery has been reported from a variety of desiccated plant tissues from different species (Palmer et al., 2012a). This is the case for olive pits (Elbaum et al., 2006), maize grains, cobs, kernels and rusks (Freitas et al., 2003; Goloubinoff et al., 1993; Jaenicke-Després et al., 2003; Lia et al., 2007; Rollo et al., 1987, 1994), radish seeds (O’Donoghue et al., 1994, 1996), wheat (Allaby et al., 1994; Blatter et al., 2002; Oliveira et al., 2012), cotton (Palmer et al., 2012b), sorghum grains (Deakin et al., 1998) and fruit rinds of bottle gourd (Lagenaria siceraria) (Erickson et al., 2005). Preservation through waterlogging is based on oxygen exclusion during the time of deposition. However, submerged remains are subjected to hydrolysis reactions causing a rapid decay in DNA. Ancient DNA survival in this case seems to be limited to hard tissues such as fruit stones (Elbaum et al., 2006; Pollmann et al., 2005) or seeds (Cappellini et al., 2010; Manen et al., 2003; Schlumbaum et al., 2012). The great bulk of plant material found in archaeological contexts corresponds to charred or partially charred evidence. Studies of DNA decay in aqueous solution suggest that DNA is not able to survive at temperatures higher than 250  C, like the ones used for cooking and baking, which are the two main methods involved in the charring process (Boardman and Jones, 1990). However, experiments performed with artificially charred seeds have evidenced DNA survival after a charring period of 5 h at temperatures up to 250  C (Threadgold and Brown, 2003). Studies on ancient charred material also support DNA survival, but recovery rates are significantly lower than for desiccated and waterlogged remains (Allaby et al., 1994, 1997, 1999; Blatter et al., 2002; Boscato et al., 2008; Brown et al., 1994, 1998; Goloubinoff et al., 1993; Mahmoudi Nasab et al., 2010; Manen et al., 2003; Schlumbaum et al., 1998). The fact that combustion experiments in vitro only monitor DNA degradation during the charring process while DNA preservation in the archaeological background depends mainly on soil, environmental conditions and taphonomic changes, could explain the differences in DNA recovery between both approaches. Nevertheless, all charring experiments agree on the level of oxygen during the charring process being a key factor in DNA survival. In an archaeological deposit, this would vary from largely anoxic environments found in sealed storage vessels or pits to aerobic seed concentrations. Moreover, these studies indicate that not all seeds from an assemblage contain ancient DNA (Allaby et al., 1994, 1997). Depending on the location of the grains in the storage system, different seeds can suffer from differential exposure to fire or oxygen. Differences in seed morphology could also account for a differential preservation of DNA content once the charring process is finished. Ancient DNA analysis of charred plant remains may be of great importance, for example, in the identification of wheat species,

especially the free-threshing kind. In this case, the threshing process results in naked grains that are impossible to identify merely by morphological traits. Moreover, the charring process may alter the shape of not only the seeds, but also other cereal remains, complicating their identification at species level. Thus, as a way of distinguishing between the two most agronomically important species of free-threshing domesticated wheat, genetic detection of durum wheat can be achieved by determining the ploidy level. While durum wheat is tetraploid (AABB), bread wheat resulted from amphidiploidization between the tetraploid wheat, Triticum dicoccum Schrank. (AABB), and the diploid goat grass, Aegilops tauschii Coss. (DD). The genetic characterisation of genes or genetic markers characteristic of the D genome would allow the distinction between either wheat species. The amplification of specific regions of the intergenic spacer (IGS) of ribosomal DNA (rDNA) produces products of different sizes between the A, B and D genomes, allowing differentiation between hexaploid and tetraploid wheat (Brown et al., 1998). This approach has been used in a recent study on naked wheat from desiccated grains. The authors demonstrated the presence of both durum and bread wheat in a naked grain assemblage from a pre-Hispanic grain silo on Gran Canaria island (Oliveira et al., 2012). However, these authors failed to amplify DNA from charred grains. The glutenin locus 1 (Glu-1) encodes for a seed storage protein of high molecular weight (HMW) that is involved in bread quality. The Glu-1 gene is located on wheat chromosome 1 of genomes A, B and D and it is divided into two paralogous genes named X and Y that code for two different glutenin subunits (Glu-x and Glu-y) (Payne et al., 1987). These genes are genome specific and multiallelic. The study of short regions of Glu-1 has been also employed to identify the ploidy level of ancient charred wheat seeds with different rates of success (Allaby et al., 1997, 1999; Brown et al., 1994, 1998; Mahmoudi Nasab et al., 2010; Palmer et al., 2012a; Schlumbaum et al., 1998). However, the potential and the difficulties in this field that are related to DNA preservation and to risks of contamination have to be highlighted, and this may even raise concerns about the conclusions attained by older studies (Gugerli et al., 2005). One of the key factors influencing the recovery of endogenous ancient DNA from charred plant material is the extraction protocol. The most popular DNA extraction protocols used with archaeobotanical material are the CTAB/DTAB methods and the silicabased ones using commercial kits (Lister et al., 2008; Yang et al., 1998) or home-made solutions (Höss and Pääbo, 1993; Poinar et al., 1998). Experiments performed with artificially charred seeds have suggested that silica-binding protocols are more efficient than traditional CTAB/DTAB extraction protocols (Giles and Brown, 2008). Compared to other extraction methods, this protocol is quick, easy to reproduce and sensitive enough to obtain DNA from single grains. However, in a recent study the extraction efficiency of commercial DNA (Lambda DNA, Fermentas) using different extraction protocols was compared: the standard CTAB, Giles and Brown (2008) and combinations of both were used (Oliveira et al., 2012). Examination of DNA extracts in agarose gels showed that the recovery of Lambda DNA was very limited when using the Giles and Brown (2008) protocol. Efficiencies of the other three protocols tested were high, but the CTAB extracts were highly inhibited by Maillard like products that were produced during the extraction process. Thus, a combination of CTAB-based extraction buffer with commercial silica columns was chosen as the most suitable combination for the analysis of ancient archaeobotanical DNA. In the present work we evaluate the usefulness of the protocol of Giles and Brown (2008) in the extraction of genuine ancient DNA from charred cereal seeds from six archaeological sites from the Iberian Peninsula. As the main objective, we aim to infer the ploidy

E. Fernández et al. / Journal of Archaeological Science 40 (2013) 659e670

level by means of the amplification of a fragment of the Glu-1 gene specific for the D genome. 2. Material and methods 2.1. Plant material The analysed material consisted of 126 grains of naked wheat (T. aestivum/durum) recovered from five archaeological sites from Eastern Spain, ranging from the beginnings of agriculture in the Western Mediterranean until the turn of the Common Era (Fig. 1). Except for some seeds from the site of La Draga that were recovered from a waterlogged context, samples were completely or partially charred. Samples were classified as either charred or partially charred based in a visual score. In the case, for example, of broken kernels with a charred surface but with some parts of the inner tissues looking brownish they were classified as partially charred. If the kernels, either intact of broken appeared homogeneously charred then they were considered as charred. Nevertheless the level of charring may be very variable, as suggested by the percentage of total carbon. Whereas this percentage in extant wheat and barley grains is nearly constant (about 40e42%) regardless of the environmental conditions (Reuter and Robinson, 1997), charring increases the %C in grains depending on its duration, temperature and aerobic conditions (Aguilera et al., 2008; Ferrio et al., 2004, 2006). The %C of archaeological kernels from the same sites and cultural periods as in our study suggest the charring conditions were very variable, with values ranging between 45% and 70% (Araus and Buxó, 1993; Araus et al., 1997a, 1997b; unpublished results). In addition, 18 grains of barley (Hordeum vulgare) from a sixth site were included in the study. An accurate description of the studied material is given in Table 1. Samples from La Draga, Cerro de la Virgen, Cerro del Alcázar and Ullastret were excavated by R. Buxó from the Museo de Arqueología de Cataluña. Waterlogged samples were stored in eppendorf microtubes at 20  C. Charred and partially charred material was stored in eppendorf microtubes at room temperature. Samples from Fortalesa d’Els Vilars and Tossal de Les Tenalles were excavated by N. Alonso from the Department of History at the University of Lleida. These samples were directly stored in plastic or glass tubes at room temperature.

Fig. 1. Location of Spanish archaeological sites from which ancient seeds were recovered.

661

2.2. DNA extraction As the number of seeds used for the extraction could affect the amount of preserved DNA and the concentration of PCR-inhibitors and Maillard products, DNA was extracted from a different number of seeds: 1, 2, 3, 5 or 10. Selection, preparation of samples and DNA extractions were performed in physically isolated laboratories. Extraction from waterlogged seeds was performed in the ancient DNA facilities at the Toxicology and Health Legislation Department at the Complutense University of Madrid, Spain. The extraction laboratory is used routinely for the extraction of ancient human remains and it is equipped with UV irradiation. Charred and partially charred materials were processed at the Manchester Institute of Biotechnology at The University of Manchester, United Kingdom. The extraction laboratory is equipped with UV irradiation and an ultra filtered air supply maintaining positive displacement pressure. Work-benches and equipment used were routinely cleaned with bleach and UV radiated. In the extractions, one-use materials were employed preferentially. The remaining tools and solutions were UV radiated prior to use. Two different extraction protocols were assayed with the available material. Waterlogged seeds were first radiated with UV for 15 min each side and then ground in a freezer mill filled with liquid nitrogen. The resulting powder was incubated overnight at 37  C with agitation in lysis solution (EDTA 5 mM, TriseHCl 10 mM, SDS 0.5%, proteinase K 50 mg/ml). DNA was extracted using a threestep phenolechloroform protocol implemented for ancient DNA bone/tooth extraction: 1 volume phenol þ ½ volume phenol and ½ chloroform þ ½ volume chloroform. The obtained extracts were concentrated with Centriplus-30000 micro concentrators (Millipore) (Fernández et al., 2008). Complete or partially charred seeds were wrapped in foil and crushed. The powder obtained was transferred to 1.5 ml screw-cap tubes. Extraction was performed using high pure PCR product purification columns (Roche) as described in Giles and Brown (2008). Different elution volumes with Elution Buffer (Roche) were tested: 25 ml, 50 ml, 75 ml and 150 ml. Some extracts were concentrated by ethanol precipitation using glycogen as inert carrier. In this case, pellets were dried and resuspended in 20 ml of UV-treated Milli-Q water. 2.3. PCR amplification and sequencing The amplification of a partial fragment of the promoter region of the nuclear High Molecular Weight (HMW) Glu-1 loci (positions 209 to 130 relative to the ORF) was achieved in wheat seeds through a nested-PCR approach. The first-round PCR (named Glu1) with primers 52F (50 ATTGCTCCTTGCTTATCCAGC30 ), B52F (50 ATTGCTCCTTACTTATCCAGC30 ) and 172R (50 GGTGAAGGTTCA GGAC30 ) was not genome specific and amplified both X and Y glutenin subunits from genomes A, B and D, providing a 132 bp product. In this reaction primer 52F amplified A and D genomes and primer B52F, which displays a 1bp difference with 52F, amplified B genomes. Nested PCR was D genome specific, but x and y subunits were required to be amplified in independent PCR experiments. Primers 52F and 156R (50 ACCATGGCTGCGTGCAC30 ) amplified the glutenin Dx subunit (Glu2x amplification) and primers 52F and DY156R (50 ACAATGGTTGTGTGCAC30 ) amplified the glutenin Dy subunit (Glu2y amplification), both producing an amplicon of 118 bp. Primers were designed and tested by R. Giles (personal communication). In addition, chloroplast DNA amplifications were used to screen for the presence of endogenous DNA in the obtained extracts. A 183 bp fragment of the large subunit of ribulose 1,5 biphosphate carboxylase (rbcL) was amplified in both wheat and barley

662

E. Fernández et al. / Journal of Archaeological Science 40 (2013) 659e670

Table 1 Description of the analysed material. Site

Age

Location

Species

La Draga

Neolithic (5250e5150 cal B.C.) Neolithic (5250e5150 cal B.C.) Neolithic (5250e5150 cal B.C.) Early Bronze Age (1800e1500 B.C. Bronze Age (ca. 1500 B.C.) Iron Age 550e425 B.C.

Banyoles (Girona, Spain)

Triticum aestivum/durum

30

Banyoles (Girona, Spain)

Triticum aestivum/durum

10

Banyoles (Girona, Spain)

Triticum aestivum/durum

24

Orce (Granada, Spain)

Triticum aestivum/durum

Baeza (Jaén, Spain)

La Draga La Draga Cerro de la Virgen Cerro del Alcázar Fortalessa d’Els Vilars Tossal de les Tenalles Puig de Sant Andreu Total

Iberian Culture 250e150 B.C. Iron Age (Iberian Culture, 500e450 B.C.)

Kind of deposit

Year of excavation

Preservation status

1998

Charred

1995

Waterlogged

1998

Partially charred

24

Assemblage, probably from storage pit Assemblage, probably from storage pit Assemblage, probably from storage pit Assemblage

1986

Partially charred

Triticum aestivum/durum

10

Assemblage

1998

Charred

Arbeca (Lleida, Spain)

Triticum aestivum/durum

14

1995

Partially charred

Sidamon (Lleida, Spain)

Triticum aestivum/durum

14

Combustion products recovered from housing levels Assemblage in vessel

1915

Partially charred

Ullastret (Girona, Spain)

Hordeum vulgare

18

Assemblage

1985

Partially charred

specimens using rbcL Z1 and rbcL 19 primers (Poinar et al., 1998). A 149 bp region of the wheat chloroplast microsatellite, WCT12 (Ishii et al., 2001), was amplified only in Triticum seeds. All amplifications were performed in a different and physically isolated room at the Manchester Institute of Biotechnology. Negative controls were carried out during extraction and PCR preparation. Three different polymerases and amplification strategies were used for DNA amplification. Cold-start amplification was performed using an unmodified Taq polymerase (MBI Fermentas) and two hotstart polymerases were used: Taq Gold (Applied Biosystems) and the Multiplex PCR Kit (Qiagen). Amplification and cycling conditions of each polymerase and primer pair are described in Table S1. Single PCR amplifications of 35e40 cycles were set up to amplify rbcL fragments with Taq Fermentas and the Multiplex PCR Kit, and WCT12 fragments with the Multiplex PCR Kit. Nested-PCR reactions (40 cycles þ 30 cycles) were employed to amplify rbcL, WCT12 and glutenin fragments with Taq Fermentas and Taq Gold, and HMWglutenins with the Multiplex PCR Kit. PCR products were visualised in a 2% agarose gel stained with ethidium bromide and purification was performed directly from the amplification reaction using Qiagen’s PCR purification kit according to the manufacturer’s instructions. Sequencing reactions were performed with the BigDyeTerminator Cycle Sequencing Reaction Kit vs 1.2 (Applied Biosystems, Darmstadt, Germany) using the forward primer. Six microlitres of the PCR product were added to a final volume of 10 ml containing 3 ml of the kit and 16 pmol of the selected primer. Cycling sequencing was performed in an Eppendorf Mastercycler according to the supplier’s recommendations. Amplification products were analysed on an ABI PRISMÔ 310 automated sequencer (Applied Biosystems, Darmstadt, Germany) using the Data Collection Software (Applied Biosystems). 2.4. Cloning of PCR products and sequencing of clones Amplifications were cloned using the pGEM-T Easy Vector System (Promega). To increase the ligation ratio, PCR products were incubated first for 30 min with 0.2 mM dATP, 1 PCR buffer, 2.5 mM MgCl2 and 0.1 U/ml Taq polymerase at 70  C to increase the ligation ratio. Three microlitres of the A-tailed products were ligated into pGEM-T Easy vector at 16  C overnight. Five microlitres of the ligation product were transformed into 100 ml of competent cells and the mixture directly plated on IPTG/X-Gal agar plates.

Number of seeds

144

Positive clones in white colonies were selected by colony-PCR (1 Biotools PCR buffer, 2 mM MgCl2 e Biotools, 0.2 mM dNTPs mix e Biotools, 0.4 mM each primer and 1.5 U Biotools Taq polymerase) using SP6 and T7 universal primers. Cycling conditions in an Eppendorf Mastercycler were as follows: 94  C 10 min, followed by 30 cycles of 94  C 1min, 52  C 1 min and 72  C 1 min, linked to a final extension step of 10 min at 72  C. Positive clones were grown in liquid LB medium and plasmid DNA was purified using the Jetquick Plasmid Miniprep Spin Kit (Genycell, Granada, Spain). Cloned DNA was sequenced with SP6 or T7 primers as described above. 2.5. BLAST search and sequence alignment The obtained direct sequences and sequenced clones were submitted to the Basic Local Alignment Search Tool (BLAST) on the NCBI site (Altschul et al., 1990) using the nucleotide BLAST database and the Megablast algorithm. The ancient WCT12 and glutenin sequences were aligned with BioEdit software v. 7.0.5 (Hall, 1999). Obtained glutenin sequences were aligned with modern and ancient glutenin sequences from the literature (Allaby et al., 1999; Anderson and Greene, 1989; Anderson et al., 1989; Brown et al., 1998; Forde et al., 1985; Giles and Brown, 2006; Halford et al., 1987; Mackie et al., 1996; Reddy and Appels, 1993; Sugiyama et al., 1985). 3. Results 3.1. DNA amplification Table 2 summarises the number of amplifications performed, the number of positive amplifications obtained and the amplification success (number of positive amplifications/total amplifications) in relation to the sample preservation status (charred, partially charred or waterlogged). Eleven amplification products of the correct size were obtained out of 616 amplifications using a nested-PCR approach: 3 for the rbcL1 fragment, 1 for the WCT12 microsatellite and 7 for the Glu-1 gene. In the last case, 3 positive amplifications were obtained after a first-round PCR with primers 52F, B52F and 172R. PCR products were then submitted to two separate PCR rounds with different primer sets in order to amplify glutenin x and y subunits of the D genome (Glu2x and Glu2y amplifications). Four positive amplifications were obtained, 2 corresponding to the Glu-x subunit and 2 to the Glu-y subunit.

E. Fernández et al. / Journal of Archaeological Science 40 (2013) 659e670 Table 2 Amplification efficiencies calculated by preservation status and amplified markers. Efficiencies are indicated in brackets, and were calculated by dividing the number of positive amplifications detected in agarose gels by the total number of amplifications performed.

Charred Partially charred Waterlogged Total

RBCL

WCT12

Glu1

Total

0/47 (0%) 3/142 (2.11%) 0/2 (0%) 3/191 (1.57%)

0/44 (0%) 1/128 (0.78%) 0/3 (0%) 1/175 (0.57%)

0/45 (0%) 7/180 (3.88%) 0/25 (0%) 7/250 (2.80%)

0/136 (0%) 11/450 (2.44%) 0/30 (0%) 11/616 (1.79%)

It is important to note that among all the analysed seeds only those that had been partially charred provided positive amplifications of an expected size. Charred and waterlogged seed extracts were not successfully amplified, even though in the latter case this could be due to the fact that just one extract was studied, or that the number of amplifications performed was reduced in comparison to the other two materials (30 vs 136 in charred seeds and 450 in partially charred seeds).

663

3.2. Sequencing and cloning of positive products and BLAST search The PCR products were sequenced and the obtained sequences were submitted to a BLAST search (Tables 3 and S2). RbcL sequences from the CV1b, CV15a and CV16a samples showed identity with different plant species, mainly from the Theaceae family. Similarly, the WCT12 microsatellite sequence of the DRA12a sample did not show the expected microsatellite pattern for T. aestivum/durum (Ishii et al., 2001). The BLAST search revealed several matches with bacterial, Drosophila melanogaster and Oryza sativa DNA fragments. Amplification of the HMW glutenin genes provided three positive amplifications of the expected size in the first-round PCR (Glu1) (Fig. 2). From these, only the one corresponding to sample CV4b (named CV4b Glu1/1) matched T. aestivum/A. tauschii glutenin units. Direct sequences derived from the other two amplifications (CV4b Glu1/2 and DRA11b Glu1/1) were not specific, yielding matches with mouse and bacterial sequences. Second-round amplification with glutenin y primers performed on these three PCR products produced two positive amplifications (CV4b Glu2Y1 and DRA11b Glu2Y/1). The latter could not be sequenced, whereas

Table 3 Summary of BLAST search results of the 11 sequenced PCR products. Only those results with the highest score are shown. Archaeological site

DNA extract

Amplified fragment

BLAST search matches family (number of entries)

Score

Cerro de la Virgen

CV1b

rbcL

154 (4  1035)

Cerro de la Virgen Cerro de la Virgen La Draga Cerro de la Virgen

CV15a CV16a DRA12a CV4b Glu1/1

rbcL rbcL WCT12 Glutenin 1

Cerro de la Virgen La Draga Cerro de la Virgen

CV4b Glu1/2 DRA11b Glu1/1 CV4b Glu2Y/1

Glutenin 1 Glutenin 1 Glutenin 2y

La Draga La Draga Cerro de la Virgen

DRA11b Glu2Y/1 DRA24a Glu2X/1 CV9a Glu2X/1

Glutenin 2y Glutenin 2x Glutenin 2x

Fam Theaceae (25) Fam. Hydrangeaceae (13) Fam. Nepenthaceae (8) Fam. Olacaceae (8) Fam. Hamamelidaceae (7) Fam. Araliaceae (6) Fam. Gunneraceae (6) Fam. Papaveraceae (6) Fam. Buxaceae (4) Fam. Pentaphylacaceae (4) Fam. Dilleniaceae (4) Fam. Platanaceae (3) Fam. Saxifragaceae (3) Fam. Ebenaceae (2) Fam. Torricelliaceae (2) Fam. Pennantiaceae (2) Fam. Aextoxicaceae (1) Fam. Aristolochiaceae (1) Fam. Cercidiphyllaceae (1) Fam. Diapensiaceae (1) Fam. Liliaceae (1) Fam. Loasaceae (1) Fam. Rubiaceae (1) Fam. Sapotaceae (1) Fam. Sarraceniaceae (1) Fam. Smilacaceae (1) Fam. Solanaceae (1) Fam. Symplocaceae (1) Fam. Theaceae (13) Fam. Theaceae (13) Drosophila melanogaster (2) Aegilops tauschii (7) Triticum aestivum (2) Triticum sp. (2) Aegilops bicorni (1) Leymus mollis (1) Mouse (2) Mouse (1) Aegilops tauschii (9) Triticum aestivum (8) Triticum sp. (2) Aegilops bicornis (1) Triticum spelta (1) No results No results No results

215 (3  1053) 202 (2  1049) 40.1 (0.54) 145e101 (3  1032)

33.4 (3.9) 40.1 (1.6) 134 (1  1028)

664

E. Fernández et al. / Journal of Archaeological Science 40 (2013) 659e670

Fig. 2. PCR amplification of the Glu-1 gene. Each lane corresponds to a different DNA extract. Lanes 1, 2: La Draga; Lane 3: Cerro del Alcázar; Lanes 4e19: Cerro de la Virgen (CV1eCV16); L1: l-Hind III DNA Ladder; L2: l-PstI DNA Ladder; C-1, C-2: PCR blanks. The size of the lower bands of the ladder is also shown. (a) Results of the non-specific firstround amplification with glutenin primers 52F, B52F and 172R. Positive amplification of expected size can be seen in Lane 7 (CV4b). (b) Results of the second-round amplification with glutenin Dy subunit primers 52F and DY156R. Positive amplification of expected size can be seen in Lane 7 (CV4b). Non-specific products were amplified on Lanes 1, 2, 3 and 12.

the former matched T. aestivum/A. tauschii sequences. Secondround amplification with glutenin X primers produced positive amplifications in samples DRA24a (La Draga) and CV9a (Cerro de La Virgen). These products could not be successfully sequenced. Amplifications of CV4b Glu1/1, CV4b Glu1/2, DRA11b Glu1/1 and CV4b Glu2Y/1 were successfully cloned, but only the clones of CV4b Glu1/1 and CV4b Glu2Y/1 resulted in T. aestivum/A. tauschii-specific sequences (Table S2). 3.3. Sequence alignments RbcL sequences from samples CV1b, CV15a and CV16a were aligned to a sequence of modern wheat that had also been amplified in the laboratory (Fig. 3). The three ancient sequences were identical to each other and exhibited 12 differences to the modern sequence. This confirmed that these PCR products were nonspecific, as was suggested by the BLAST alignment results. In order to investigate the affinities of the obtained wheatspecific direct sequences and clones to the different Triticum genomes, alignment was undertaken with modern sequences of T. aestivum and A. tauschii recovered from the literature (Fig. 4). Direct sequences of CV4b Glu1 and Glu2y fragments clearly

aligned with modern Glu-Dy alleles, lacking the characteristic substitutions of the A and B genomes. Except for a deletion at position 167, the CV4b Glu1 direct sequence is identical to the T. aestivum GluDy alleles TAE1 and TAE2 and to the A. tauschii alleles AE3, AE4, AE5, AE6, AE7, AE9 and GluD1-2c. The 131 T to C substitution characteristic of this sequence is also present in other GluD1 sequences. Excluding the primer region the CV4b Glu2y direct sequence differs at 6 positions from the aforementioned sequences. However, none of these differences appeared in 4 clones derived from this PCR product, with clones showing singleton substitutions in positions 206, 189, 187, 153, one deletion in position 187 and one insertion between positions 187 and 186. These non-reproducible mutations could be attributed to errors introduced by Taq polymerase during the amplification process. Only the substitution at position 206 is shared between two clones (7 and 12). This T to C transition probably corresponds to a post-mortem Type I miscoding lesion as it is not shared with other clones. Except for the aforementioned differences, clones from CV4b Glu2y are identical to the HMW GluDy allele, TAE2. This allele is currently widespread across Eurasia and was possibly the original lineage from which other alleles arose.

E. Fernández et al. / Journal of Archaeological Science 40 (2013) 659e670

665

Fig. 3. Comparison of the rbcL sequences obtained from samples CV1b, CV15a and CV16a with a sequence of modern T. aestivum amplified in the laboratory. Differences are highlighted in bold.

Fig. 4. Sequence alignment of direct sequences and Triticum/Aegilops specific clones from sample CV4b (Rows 2e6). Sequences from modern and ancient Triticum/Aegilops species were included for comparison. All sequences were compared to allele TA2 (Giles and Brown, 2006). Dots indicate sequence identity, and  deletions. Ta: T. aestivum, Ta/d: T. aestivum/durum, At: A. tauschii, TaCh: T. aestivum var. Cheyenne, TaYam: T. aestivum var. Yamhill, T. aestivum var. Galahad, Mixed: ancient mixed grains, TaAs: T. aestivum var. Asarce, TaHo: T. aestivum var. Hope, TdTra: T. dicoccum var. Tragi, Tti: T. timopheevi, Ttur: T. turgidum, Tu: T. urartu, Tm: T. monococcum, T.: Triticum sp., TaChi: T. aestivum var. Chinese spring. 1: Giles and Brown (2006) (accession numbers DQ233202eDQ233217); 2: This study; 3: Allaby et al. (1999) (X98583eX98592, X98711eX98715, Y12401eY12410); 4: Halford et al. (1987) (X61026); 5: Mackie et al. (1996); 6: Brown et al. (1998); 7: Sugiyama et al. (1985); 8: Anderson et al. (1989) (X12928); 9: Anderson and Greene (1989) (M22208, X13927); 10: Forde et al. (1985) (X03042); 11: Reddy and Appels (1993).

666

E. Fernández et al. / Journal of Archaeological Science 40 (2013) 659e670

4. Discussion 4.1. Protocols for the recovery of ancient DNA from charred seeds In recent years DNA analyses from artificially charred seeds have been performed, generating interesting results that provide a starting point for the application of specific protocols to archaeological charred material. Under this premise, the experiments of Giles and Brown (2008) demonstrated that silica-based DNA extraction is more efficient in the recovery of DNA from artificially charred modern seeds. This protocol has been applied successfully in ancient herbarium specimens (100 years old) (Lister et al., 2008). However, it has never been tested in ancient (several millennia) charred plant material. In this case, variables other than charring linked to diagenetic changes in the archaeological record are expected to have an unpredictable effect on DNA preservation. In the present study the suitability of this protocol to extract genuine ancient DNA from charred cereal seeds of different origins is

reported for the first time. Differences in DNA recovery rates using the protocol of Giles and Brown (2008) between this study and that of Oliveira et al. (2012) could be due to differences in the evaluation of the extraction efficiency and/or to the size and concentration of the recovered fragments. In the latter case, evaluation of the extraction efficiency was achieved through the addition of 600 ng of Lambda DNA (Fermentas, 48.5 kb) to the ground plant material and visualisation of the resulting extract by electrophoresis. In our case, ancient DNA extracts were not examined in stained agarose gels and protocol efficiency was computed by looking directly at the specificity of the amplified DNA. DNA extractions from single charred grains of archaeological origin are expected to contain highly fragmented DNA in very low concentrations, all of them below the limit for visualisation of DNA in ethidium bromide stained gels (Sambrook and Russell, 2001). On the other hand, it has been demonstrated that the efficiency of DNA absorption and subsequent elution to the silica filters (glass fibre fleece) depends on the loading concentration of the DNA. In the case of the High

Fig. 4. (continued).

E. Fernández et al. / Journal of Archaeological Science 40 (2013) 659e670

Pure PCR Purification Kit (Roche) used by Giles and Brown (2008), there is a decrease in the recovery efficiency of the kit for DNA concentrations higher than 25 ng (PCR applications manual 3rd Edition, Roche Applied Science). This should explain the absence of Lambda DNA signal in the extracts obtained with the Giles and Brown (2008) protocol. Compared to other protocols that have succeeded in extracting ancient archaeobotanical DNA, such as CTAB/DTAB (Blatter et al., 2002; Elbaum et al., 2006; Freitas et al., 2003; Manen et al., 2003; Pollmann et al., 2005), phenolechloroform (Cappellini et al., 2010; Goloubinoff et al., 1993), or home-made silica (Allaby et al., 1997; Andreasen et al., 2009; Jaenicke-Després et al., 2003; Schlumbaum et al., 1998), the protocol of Giles and Brown is quick and scalable. Moreover, it allows the extraction of amplifiable DNA from single grains (which amounts to a few mg in the case of charred kernels), while the amount of starting material required to set up the other protocols ranges between 20 and 500 mg. When working with small seeds, this is equivalent to 5e40 individual

667

grains. Analysis of single grains is of great importance, as archaeological grains in a grain mixture could belong to different species or different phenotypic variants from the same species. 4.2. Limitations of DNA analysis from charred archaeological grains The present work stresses the difficulty in obtaining endogenous DNA from charred archaeobotanical material and illustrates some of the technical problems associated with the analysis of this particular material. The rate of recovery of endogenous ancient DNA reported here is very low (one out of 126 analysed seeds) whereas the amplification of contaminant DNA is prevalent. The level of contamination is higher when non-specific primers are used, as in the case of rbcL Z1 and rbcL 19, which amplify a highlyconserved region among plant species: the large subunit of the photosynthetic enzyme ribulose bisphosphate carboxylase/oxygenase (Parry et al., 2003). The four contaminant sequences obtained from this gene matched several members of the Theaceae

Fig. 4. (continued).

668

E. Fernández et al. / Journal of Archaeological Science 40 (2013) 659e670

family, including the tea plant, Camellia sinensis (Tables 3 and S2). Both carry-over contamination with amplicons from previous PCR experiments and soil contamination with plant roots are unlikely to be responsible for the observed pattern, as analysis of members of the Theaceae family has never been performed in the laboratory and tea plants are not typical of the region from which the ancient seeds were recovered. The most probable contamination source in this case is consumption of tea and its breath transference either to the seeds during their collection and storage or to the clothes or gloves of researchers entering the clean laboratories. This result underscores the importance of preventing contamination in ancient DNA studies and suggests that more strict precautions in samples collection, storage and manipulation should be taken. Following general rules of the excavation of samples for ancient DNA analysis would be also desirable in this case, these including the use of gloves and face-masks during samples collection process and their immediate storage in sterile containers (Bollongino et al. 2008). Once in the laboratory, using single-use clothes, feet covers, face-masks and laboratory glasses when extracting and amplifying ancient DNA plant remains would help in reducing contamination introduced by the researcher. Moreover, our results alert against the use of non-specific markers as a screening method to verify the presence of endogenous DNA in archaeobotanical remains (Manen et al., 2003; Pollmann et al., 2005). Non-specific PCR contamination also occurred when primers specific to wheat were used (WCT12 and glutenin genes). The pattern observed in this case could correspond to reagent contamination or to primer hybridisation with soil bacterial DNA present in ancient DNA extracts. In this work, only one seed partially charred from the archaeological site of Cerro de La Virgen in South Spain produced endogenous ancient DNA, pointing out that a relationship between the morphology of the grain and the presence of endogenous DNA exists. In this site %C values were below 50%, suggesting also that the kernels were moderately charred. These conditions, however, are necessary but not sufficient to indicate DNA survival, as other seeds from the same site were also screened for DNA content and only contaminant products were obtained. This finding is in agreement with previous observations (Brown et al., 1994) and indicates that even with the same origin, not all ancient grains are likely to contain endogenous and amplifiable DNA. Depending on the location of the grain in the assemblage the initial exposure to fire could vary from grain to grain. Moreover, each seed can undergo a different degradation process as different microenvironments can exist within the same site (Torres et al., 2002). Independent replication of the results was impossible to achieve in this case as the extraction was performed with a single grain. However, the following factors support the authenticity of the results obtained: (1) Sample preparation, extraction and amplification procedures were conducted in exclusive ancient DNA laboratories meeting the most stringent international standards in the field; (2) Physical separation existed between the pre-PCR (extraction), PCR and post-PCR laboratories; (3) Specific primers were used in the amplification process to prevent non-specific amplification; (4) PCR produced short fragments (<150 bp), thus being compatible with the expected state of preservation of ancient DNA; (5) Extraction and amplification blanks showed no contamination; (6) PCR products were cloned and all clones showed a similar and coherent pattern; (7) Obtained sequences exhibited phylogenetic sense. In the light of the obtained results, working in ancient DNA dedicated facilities seems to be of great importance in controlling environmental contamination, especially when typing of fresh material is also being performed in the laboratory. To our knowledge, only two of the previous reports of HMW glutenin

genes from charred wheat grains fulfil this criterion (Mahmoudi Nasab et al., 2010; Schlumbaum et al., 1998). Despite this, Allaby et al. (1997) managed to replicate some of the results of Allaby et al. (1994).

4.3. Identification of the HMW glutenin gene and authenticity of the results Sequence analysis of a fragment of the HMW glutenin promoter showed that clones of sample CV4b (Cerro de La Virgen, Spain), an Early Bronze age site, belonging to the Argar culture, from the southeast of the Iberian Peninsula (Buxó and Piqué, 2008; Rodríguez Ariza, 1992), are fairly identical to modern sequences of the GluDy locus. A BLAST search of the clones confirmed the affinity of these sequences to the GluDy genome of T. aestivum and A. tauschii. Taken together these results clearly suggest that sample CV4b belongs to hexaploid wheat, T. aestivum. Even though there are no additional data allowing for the distinction between either species of naked wheat at this particular site, this result is in agreement with the presence in other sites of the area of some spikelet elements, such as the rachis, associated with T. aestivum.

5. Conclusions Our study demonstrated that the recovery of endogenous ancient DNA in charred seeds from archaeological environments is possible under the observation of strict working conditions and the use of suitable protocols. The silica-based extraction protocol of Giles and Brown (2008) followed by the amplification of specific targets has proven to be an adequate strategy to recover this kind of material. The obtained results confirm the presence of the hexaploid wheat, T. aestivum, in an Early Bronze age site from Southern Spain. To the best of our knowledge this is the first evidence from ancient DNA for the specific cultivation of hexaploid wheat in the prehistoric agriculture of the Iberian Peninsula. Even though the rate of recovery of endogenous DNA from charred plant material is remarkably low, the information that could be obtained is unique and extremely valuable. Much effort should be invested in improving existing protocols and testing new ones (Bunning et al., 2012) in order to develop an efficient technology to incorporate this new tool in disciplines such as Archaeology, Botany or Crop Sciences.

Acknowledgements This work was supported in part by the following research projects: CGL2009-13079-C02-02 and CGL2009-07959 (Spanish Ministry of Science and Innovation) and Agriwestmed (European Research Council). Human resources were funded by a Juan de la Cierva research contract from the Spanish Government and the European Social Fund and a post-doctoral grant from the Fundaçao para a Ciencia e a Tecnologia, Portugal (EF). Dr. Natalia Alonso, from the University of Lleida, Dr. Oliva Rodríguez Ariza, from the University of Jaén and Prof. Fernando Molina from the University of Granada are acknowledged for providing archaeological seeds for this study.

Appendix A. Supplementary material Supplementary material associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j.jas.2012. 07.014.

E. Fernández et al. / Journal of Archaeological Science 40 (2013) 659e670

References Aguilera, M., Araus, J.L., Voltas, J., Rodriguez-Ariza, M.O., Molina, F., Rovira, N., Buxo, R., Ferrio, J.P., 2008. Stable carbon and nitrogen isotopes and quality traits of fossil cereal grains provide clues on sustainability at the beginnings of Mediterranean agriculture. Rapid Commun. Mass Spectrom. 22, 1653e1663. Allaby, R.G., Banerjee, M., Brown, T.A., 1999. Evolution of the high molecular weight glutenin loci of the A, B, D and G genomes of wheat. Genome 42, 296e307. Allaby, R.G., Jones, M.K., Brown, T.A., 1994. DNA in charred wheat grains from the Iron Age hill fort at Danebury, England. Antiquity 68, 126e132. Allaby, R.G., O’Donoghue, K., Sallares, R., Jones, M.K., Brown, T.A., 1997. Evidence for the survival of ancient DNA in charred wheat seeds from European archaeological sites. Ancient Biomol. 1, 119e129. Altschul, S.F., Gish, W., Miller, W., Myers, E.W., Lipman, D.J., 1990. Basic local alignment search tool. J. Mol. Biol. 215, 403e410. Anderson, O.D., Greene, F.C., 1989. The characterisation and comparative analysis of high-molecular-weight glutenin genes from genomes A and B of a hexaploid bread wheat. Theor. Appl. Genet. 77, 689e700. Anderson, O.D., Greene, F.C., Ryan, E.Y., Halford, N.G., Shewry, P.R., MalpicaRomero, J.M., 1989. Nucleotide sequences of the two high-molecular-weight glutenin genes from the D-genome of a hexaploid bread-wheat, Triticum aestivum L. cv Cheyenne. Nucleic Acids Res. 17, 461e462. Andreasen, K., Manktelow, K., Razafimandimbison, S.G., 2009. Successful DNA amplification of a more than 200-year-old herbarium specimen: recovering genetic material from the Linnaean era. Taxon 58, 959e962. Antolín, F., Buxó, R., 2011. L’explotació de les plantes al jaciment de la Draga: contribució a la història de l’agricultura i de l’alimentació vegetal del neolític a Catalunya. In: Bosch, A., Chinchilla, J., Tarrús, J. (Eds.), El poblat lacustre del neolític antic de La Draga: Excavacions de 2000e2005. CASC-Museu d’Arqueologia de Catalunya, Girona, pp. 147e174. Araus, J.L., Buxó, R., 1993. Changes in carbon isotope discrimination in grain cereals from the North-Western Mediterranean basin during the past seven millenia. Aust. J. Plant Physiol. 20, 117e128. Araus, J.L., Buxó, R., Febrero, A., Camalich, M.D., Martín, D., Molina, F., RodríguezAriza, M.O., Voltas, J., 1997a. Identification of ancient irrigation practices based on the carbon isotope discrimination of plant seeds: a case study from the southeast Iberian Peninsula. J. Archaeol. Sci. 24, 729e740. Araus, J.L., Febrero, A., Buxó, R., Camalich, M.D., Martín, D., Molina, F., RodríguezAriza, M.O., Romagosa, I., 1997b. Changes in carbon isotope discrimination in grain cereals from different regions of the western Mediterranean Basin during the past seven millennia. Palaeoenvironmental evidence of a differential change in aridity during the Late Holocene. Glob. Change Biol. 3, 107e118. Blatter, R.H.E., Jacomet, S., Schlumbaum, A., 2002. Spelt-specific alleles in HMW glutenin genes from modern and historical European spelt (Triticum spelta L. Theor. Appl. Genet. 104, 329e337. Bollongino, R., Tresset, A., Vigne, J.-D., 2008. Environment and excavation: pre-lab impacts on ancient DNA analyses. Comptes Rendus Palevol. 7, 91e98. Boardman, S., Jones, G., 1990. Experiments on the effects of charring on cereal plant components. J. Archaeol. Sci. 17, 1e11. Boscato, P., Carioni, C., Brandolini, A., Sadori, L., Rottoli, M., 2008. Molecular markers for the discrimination of Triticum turgidum L. subsp. dicoccum (Schrank ex Schübl.) Thell. and Triticum timopheevii (Zhuk.) Zhuk. subsp. timopheevii. J. Archaeol. Sci. 35, 239e246. Brown, T.A., 1999. How ancient DNA may help in understanding the origin and spread of agriculture. Philos. Trans. R. Soc. Lond. B Biol. Sci. 354, 89e98. Brown, T.A., Allaby, R.G., Brown, K.A., O’Donoghue, K., Sallares, R., 1994. DNA in wheat seeds from European archaeological sites. Experientia 50, 571e575. Brown, T.A., Allaby, R.G., Sallares, R., Jones, G., 1998. Ancient DNA in charred wheats: taxonomic identification of mixed and single grains. Ancient Biomol. 2, 185e193. Bunning, S.L., Jones, G., Brown, T.A., 2012. Next generation sequencing of DNA in 3300-year-old charred cereal grains. J. Archaeol. Sci. 39, 2780e2784. Buxó, R., Piqué, R., 2008. Arqueobotánica. Los usos de las plantas en la península Ibérica. Ariel, Madrid. Cappellini, E., Gilbert, M.T., Geuna, F., Fiorentino, G., Hall, A., Thomas-Oates, J., Ashton, P.D., Ashford, D.A., Arthur, P., Campos, P.F., Kool, J., Willerslev, E., Collins, M.J., 2010. A multidisciplinary study of archaeological grape seeds. Naturwissenschaften 97, 205e217. Deakin, W.J., Rowley-Conwy, P.J., Shaw, C.H., 1998. Amplification and sequencing of DNA from preserved sorghum of up to 2800 years antiquity found at Qasr Ibrim. Ancient Biomol. 2, 27e41. Elbaum, R., Melamed-Bessudo, C., Boaretto, E., Galili, E., Lev-Yadun, S., Levy, A.A., Weiner, S., 2006. Ancient olive DNA in pits: preservation, amplification and sequence analysis. J. Archaeol. Sci. 33, 77e88. Erickson, D.L., Smith, B.D., Clarke, A.C., Sandweiss, D.H., Tuross, N., 2005. An Asian origin for a 10,000-year-old domesticated plant in the Americas. Proc. Natl. Acad. Sci. U. S. A. 102, 18315e18320. Fairbairn, A., Asouti, E., Near, J., Martinoli, D., 2002. Macro-botanical evidence for plant use at Neolithic Çatalhöyük, southcentral Anatolia, Turkey. Veget. Hist. Archaeobot. 11, 41e54. Fernández, E., Ortiz, J.E., Torres, T., Pérez-Pérez, A., Gamba, C., Tirado, M., Baeza, C., López-Parra, A.M., Turbón, D., Anfruns, J., Molist, M., Arroyo-Pardo, E., 2008. Mitochondrial DNA genetic relationships at the ancient Neolithic site of Tell Halula. Forensic Sci. Int. Genet. Suppl. Ser. 1, 271e273.

669

Ferrio, J.P., Alonso, N., Voltas, J., Araus, J.L., 2004. Estimating grain weight in archaeological cereal crops: a quantitative approach for comparison with current conditions. J. Archaeol. Sci. 31, 1635e1642. Ferrio, J.P., Alonso, N., Voltas, J., Araus, J.L., 2006. Grain weight changes over time in ancient cereal crops: potential roles of climate and genetic improvement. J. Cereal Sci. 44, 323e332. Forde, J., Malpica, J.M., Halford, N.G., Shewry, P.R., Anderson, O.D., Greene, F.C., Miflin, B.J., 1985. The nucleotide sequence of a HMW-glutenin subunit gene located on chromosome 1A of wheat (Triticum aestivum L.). Nucleic Acids Res. 13, 6817e6832. Freitas, F., Bendel, G., Allaby, R.G., Brown, T.A., 2003. DNA from primitive maize landraces and archaeological remains: implications for the domestication of maize and its expansion into South America. J. Archaeol. Sci. 30, 901e908. Giles, R.J., Brown, T.A., 2006. GluDy allele variations in Aegilops tauschii and Triticum aestivum: implications for the origins of hexaploid wheats. Theor. Appl. Genet. 112, 1563e1572. Giles, R.J., Brown, T.A., 2008. Improved methodology for extraction and amplification of DNA from single grains of charred wheat. J. Archaeol. Sci. 35, 2585e2588. Goloubinoff, P., Pääbo, S., Wilson, A.C., 1993. Evolution of maize according to nuclear DNA sequences from archaeological specimens. Proc. Natl. Acad. Sci. U. S. A. 90, 1997e2001. Gugerli, F., Parducci, L., Petit, R.J., 2005. Ancient plant DNA: review and prospects. New Phytol. 166, 409e418. Halford, N.G., Forde, J., Anderson, O.D., Greene, F.C., Shewry, P.R., 1987. The nucleotide and deduced amino-acid sequences of a HMW glutenin subunit gene from chromosome 1B of bread-wheat (Triticum aestivum L.) and comparison with those of genes from chromosomes 1A and 1D. Theor. Appl. Genet. 75, 117e126. Hall, T.A., 1999. BioEdit: a User-friendly Biological Sequence Alignment Editor and Analysis. In: Nucleic Acids Symposium Series, vol. 41, pp. 95e98. Höss, M., Pääbo, S., 1993. DNA extraction from Pleistocene bones by a silica-based purification method. Nucleic Acids Res. 21, 3913e3914. Ishii, T., Mori, N., Ogihara, Y., 2001. Evaluation of allelic diversity at chloroplast microsatellite loci among common wheat and its ancestral species. Theor. Appl. Genet. 103, 896e904. Jacomet, S., Schlichltherle, H., 1984. Der kleine Pfahlbauweizen Oswald Heer’s e Neue Untersuchungen zur Morphologie neolithischer Nacktweizen-Aehren. In: van Zeist, W., Casparie, W.A. (Eds.), Plants and Ancient Man: Studies in Paleoethnobotany. Balkema, Rotterdam, pp. 153e176. Jaenicke-Després, V., Buckler, E.S., Smith, B.D., Gilbert, M.T., Cooper, A., Doebley, J., Pääbo, S., 2003. Early allelic selection in maize as revealed by ancient DNA. Science 302, 1206e1208. Lister, D.L., Bower, M.A., Howe, C.J., Jones, M.K., 2008. Extraction and amplification of nuclear DNA from herbarium specimens of emmer wheat: a method for assessing DNA preservation by maximum amplicon length recovery. Taxon 57, 254e258. Lia, V.V., Confalonieri, V.A., Ratto, N., Cámara, J.A., Miante, A.M., Poggio, L., Brown, T.A., 2007. Microsatellite typing of ancient maize: insights into the history of agriculture in southern South America. Proc. Biol. Sci. 274, 545e554. Mackie, A.M., Sharp, P.J., Lagudah, E.S., 1996. The nucleotide and derived amino acid sequence of a HMW glutenin gene from Triticum tauschii and comparison with those from the D genome of bread wheat. J. Cereal Sci. 24, 73e78. Mahmoudi Nasab, H., Mardi, M., Talaee, H., Fazeli Nashli, H., Pirseyedi, S.M., Hejabri Nobari, A., Mowla, S.J., 2010. Molecular analysis of ancient DNA extracted from 3250e3450 year-old plant seeds excavated from Tepe Sagz Abad in Iran. J. Agric. Sci. Tech. 12, 459e470. Maier, U., 1996. Morphological studies of free-threshing wheat ears from a Neolithic site in southwest Germany, and the history of the naked wheats. Veget. Hist. Archaeobot. 5, 39e55. Manen, J.F., Bouby, L., Dalnoki, O., Marinval, P., Turgay, M., Schlumbaum, A., 2003. Microsatellites from archaeological Vitis vinifera seeds allow a tentative assignment of the geographical origin of ancient cultivars. J. Archaeol. Sci. 30, 721e729. O’Donoghue, K., Brown, T.A., Carter, J.F., Evershed, R.P., 1994. Detection of nucleotide bases in ancient seeds using gas chromatography/mass spectrometry and gas chromatography/mass spectrometry. Rapid Commun. Mass Spectrom. 8, 503e508. O’Donoghue, K., Clapham, A., Evershed, R.P., Brown, T.A., 1996. Remarkable preservation of biomolecules in ancient radish seeds. Proc. R. Soc. Lond. B. 263, 541e547.  , P., Morales, J., Rodríguez-Rodríguez, A., Lister, D.L., Jones, M.K., Oliveira, H.R., Civán 2012. Ancient DNA in archaeological wheat grains: preservation conditions and the study of pre-Hispanic agriculture on the island of Gran Canaria (Spain). J. Archaeol. Sci. 39, 828e835. Palmer, S.A., Clapham, A.J., Rose, P., Freitas, F.O., Owen, B.D., Beresford-Jones, D., Moore, J.D., Kitchen, J.L., Allaby, R.G., 2012b. Archaeogenomic evidence of punctuated genome evolution in Gossypium. Mol. Biol. Evol. http://dx.doi.org/ 10.1093/molbev/mss070. Palmer, S.A., Smith, O., Allaby, R.G., 2012a. The blossoming of plant archaeogenetics. Ann. Anat. 194, 146e156. Parry, M.A.J., Andralojc, P.J., Mitchell, R.A.C., Madgwick, P.J., Keys, A.J., 2003. Manipulation of Rubisco: the amount, activity, function and regulation. J. Exp. Bot. 54, 1321e1333.

670

E. Fernández et al. / Journal of Archaeological Science 40 (2013) 659e670

Payne, P.I., Nightingale, M.A., Krattiger, A.F., Holt, L.M., 1987. The relationship between HMW glutenin subunit composition and the breadmaking quality of British-grown wheat varieties. J. Sci. Food Agric. 40, 51e65. Poinar, H.N., Hofreiter, M., Spaulding, G.S., Martin, P.S., Stankiewicz, A.B., Bland, H., Evershed, R.P., Possnert, G., Pääbo, S., 1998. Molecular coproscopy: dung and diet of the extinct ground sloth Nothrotheriops hastensis. Science 281, 402e406. Pollmann, B., Jacomet, S., Schlumbaum, A., 2005. Morphological and genetic studies of waterlogged Prunus species from the Roman vicus Tasgetium (Eschenz, Switzerland). J. Archaeol. Sci. 32, 1471e1480. Reddy, P., Appels, R., 1993. Analysis of a genomic DNA segment carrying the wheat high molecular weight (HMW) glutenin Bx17 subunit and its use as an RFLP marker. Theor. Appl. Genet. 85, 616e624. Reuter, D.J., Robinson, J.B., 1997. Plant Analysis and Interpretation Manual, second ed. CSIRO, Australia. Rodríguez Ariza, O., 1992. Las relaciones hombre-vegetación en el sureste de la península Ibérica durante las edades del Cobre y Bronce a partir del análisis antracológico de siete yacimientos arqueológicos, Unpublished PhD, University of Granada, Granada. Rollo, F., Asci, W., Sassaroli, S., 1994. Assessing the genetic variation in pre-Columbian maize at the molecular level. In: Adams, R.P., Miller, J.S., Golenberg, E.M., Adams, J.E. (Eds.), Conservation of Plant Genes II: Utilization of Ancient and Modern DNA. Missouri Botanical Garden, Missouri, pp. 27e35.

Rollo, F., LaMarca, A., Amici, A., 1987. Nucleic acids in mummified plant seeds: screening of twelve specimens by gel electrophoresis, molecular hybridization and DNA cloning. Theor. Appl. Genet. 73, 501e505. Sambrook, J., Russell, D.W., 2001. Molecular Cloning: A Laboratory Manual, third ed. Cold Spring Harbor Laboratory Pr, Cold Spring Harbor, New York. Schlumbaum, A., Neuhaus, J.M., Jacomet, S., 1998. Coexistence of tetraploid and hexaploid naked wheat in a Neolithic lake dwelling of central Europe. Evidence from morphology and ancient DNA. J. Archaeol. Sci. 25, 1111e1118. Schlumbaum, A., van Glabeke, S., Roldan-Ruiz, I., 2012. Towards the onset of fruit tree growing north of the Alps: ancient DNA from waterlogged apple (Malus sp.) seed fragments. Ann. Anat. e Anatomischer Anzeiger 194, 157e162. Sugiyama, T., Rafalski, A., Peterson, D., Söll, D., 1985. A wheat HMW glutenin subunit gene reveals a highly repeated structure. Nucleic Acids Res. 13, 8729e8737. Threadgold, J., Brown, T.A., 2003. Degradation of DNA in artificially charred wheat seeds. J. Archaeol. Sci. 30, 1067e1076. Torres, T., Ortiz, J.E., Llamas, J.F., Canoira, L., Juliá, R., García-Martínez, M.J., 2002. Bear dentine aspartic acid racemization analysis: a proxy for the dating of Pleistocene cave infills. Archaeometry 44, 417e426. Yang, D.Y., Eng, B., Waye, J.S., Dudar, J.C., Saunders, S.R., 1998. Technical note: improved DNA extraction from ancient bones using silica-based spin columns. Am. J. Phys. Anthropol. 105, 539e543. Van Zeist, W., Bakker-Heeres, J.A.H., 1982. Archaeobotanical studies in the Levant 1. Neolithic sites in the Damascus basin: Aswad, Ghoraifé, Ramad. Palaeohistoria 24, 165e256.