- Email: [email protected]
DNA aptamers against FokI nuclease domain for genome editing applications
Biosensors and Bioelectronics xx (xxxx) xxxx–xxxx
Contents lists available at ScienceDirect
Biosensors and Bioelectronics journal homepage: www.elsevier.com/locate/bios
DNA aptamers against FokI nuclease domain for genome editing applications Maui Nishioa, Daisuke Matsumotoa, Yoshio Katob, Koichi Abea, Jinhee Leea, Kaori Tsukakoshia, ⁎ Ayana Yamagishib, Chikashi Nakamuraa,b, Kazunori Ikebukuroa, a
Department of Biotechnology and Life Science, Tokyo University of Agriculture and Technology, 2-24-16 Naka-cho, Koganei, Tokyo 184-8588, Japan Biomedical Research Institute, National Institute of Advanced Industrial Science and Technology (AIST), Central 5 1-1-1 Higashi, Tsukuba, Ibaraki 3058565, Japan b
A R T I C L E I N F O
A BS T RAC T
Key words: Aptamer Genome editing FokI Protein delivery
Genome editing with site-specific nucleases (SSNs) can modify only the target gene and may be effective for gene therapy. The main limitation of genome editing for clinical use is off-target effects; excess SSNs in the cells and their longevity can contribute to off-target effects. Therefore, a controlled delivery system for SSNs is necessary. FokI nuclease domain (FokI) is a common DNA cleavage domain in zinc finger nuclease (ZFN) and transcription activator-like effector nuclease. Previously, we reported a zinc finger protein delivery system that combined aptamer-fused, double-strand oligonucleotides and nanoneedles. Here, we report the development of DNA aptamers that bind to the target molecules, with high affinity and specificity to the FokI. DNA aptamers were selected in six rounds of systematic evolution of ligands by exponential enrichment. Aptamers F6#8 and #71, which showed high binding affinity to FokI (Kd=82 nM, 74 nM each), showed resistance to nuclease activity itself and did not inhibit nuclease activity. We immobilized the ZFN-fused GFP to nanoneedles through these aptamers and inserted the nanoneedles into HEK293 cells. We observed the release of ZFN-fused GFP from the nanoneedles in the presence of cells. Therefore, these aptamers are useful for genome editing applications such as controlled delivery of SSNs.
1. Introduction Genome editing is a genetic engineering tool to modify target sites on genomic DNA by site-specific nucleases (SSNs). SSNs used in genome editing include zinc finger nuclease (ZFN), transcription activator-like effector nuclease (TALEN), and the CRISPR/Cas9 system (Gaj et al., 2013). These genome-editing technologies can introduce double-strand (ds) DNA breaks (DSBs) at a target site. Subsequently, cellular DNA repair systems such as non-homologous end joining or homologous recombination can be used to knock a target gene out or in. Therefore, genome editing is thought to be applicable for gene therapy (Carroll, 2011; Cox et al., 2015; Perez et al., 2008). However, a major limitation to the clinical application of genome editing in humans is off-target effects, i.e., DSBs at non-target sites. Researchers have reported that off-target effects are common in genome editing by SSNs, which occur because of the uncontrollable duration and amount of SSN expression in the cells by transfecting plasmids (Cox et al., 2015; Wu et al., 2014; Liu et al., 2014). Therefore, a controlled system for delivering SSNs is necessary to reduce off-target
⁎
effects and apply genome editing in the clinical use. Previously, we reported that a nanoneedle of 200 nm in diameter on an AFM cantilever could be inserted into living cells with high efficiency and minimal damage (Obataya et al., 2005). And we have recently developed a nanoneedle array containing several ten thousands of nanoneedles on 5 mm square silicon chip and a home-made manipulator for it (Matsumoto et al., 2015) and the nanoneedle array system was applied for a protein delivery by combining with an aptamer-based oligonucleotide (Matsumoto et al., 2016). In this method, the conformation of the aptamer-based oligonucleotide is altered in the presence of ATP, releasing the zinc finger protein. Therefore, the controlled delivery of SSNs may be achieved using a combination of aptamer-based oligonucleotides and nanoneedles to reduce off-target effects in genome editing. Aptamers are oligonucleotides that bind to target molecules such as proteins and small molecules with high affinity and specificity compared to antibodies. Aptamers can be obtained through in vitro selection, also known as systematic evolution of ligands by exponential enrichment (SELEX) (Ellington and Szostak, 1990; Tuerk and Gold,
Corresponding author. E-mail address: [email protected] (K. Ikebukuro).
http://dx.doi.org/10.1016/j.bios.2016.11.042 Received 11 October 2016; Received in revised form 14 November 2016; Accepted 15 November 2016 Available online xxxx 0956-5663/ © 2016 Elsevier B.V. All rights reserved.
Please cite this article as: Nishio, M., Biosensors and Bioelectronics (2016), http://dx.doi.org/10.1016/j.bios.2016.11.042
Biosensors and Bioelectronics xx (xxxx) xxxx–xxxx
M. Nishio et al.
DNA library was incubated with only a blocked membrane, followed by incubation with a FokI-immobilized membrane at RT overnight. After washing the membrane, the FokI-immobilized area was cut out and oligonucleotides were eluted by phenol-chloroform extraction. The collected ssDNAs were used as the PCR template and amplified using forward primer (5′-CTATCTATGGTGAGTCCT-3′), 5′ biotinylated reverse primer (5′-TGATGCGTGTGTACTTAG-3′), and TaKaRa ExTaq Hot Start Version (TaKaRa Bio Inc., Shiga, Japan). After PCR, biotinylated reverse strands were removed using avidin agarose beads (Thermo Fisher Scientific, Waltham, MA, USA) for the subsequent round of screening. After six rounds of screening, the oligonucleotide pools were amplified by PCR. The oligonucleotide pools were cloned into E. coli DH5α competent cells (TaKaRa Bio Inc.), using the pGEM-T easy vector system (Promega, Madison, WI, USA). After 90 transformants were randomly picked, we prepared the sequencing samples, using the illustra TempliPhi DNA Amplification Kit (GE Healthcare). DNA sequencing was performed by Eurofins Genomics (Tokyo, Japan). The secondary structures of each oligonucleotide were predicted by the M-fold server (Zuker, 2003) and QGRS mapper (Kikin et al., 2006).
1990). The aptamers can be easily synthesized, modified, and labeled by chemical processes. Additionally, we developed various aptamerbased sensing systems by taking advantage of their conformational changes in the presence or absence of the target molecule (Yoshida et al., 2006, 2008, 2009). In this study, we developed and applied aptamers against SSNs, using a controlled delivery system. ZFN and TALEN are composed of two domains: a DNA-binding domain specific to the target sequence, and a DNA cleavage domain that can cleave the dsDNA non-specifically. The DNA-binding domains, such as a zinc finger domain or TAL effector, can be designed for each target sequence. The FokI nuclease domain (FokI) is a common DNA cleavage domain in ZFN and TALEN. FokI can cleave dsDNA by forming dimers at the target site. There are also some reports of genome editing using a combination of FokI and inactivated Cas9 (FokI-dCas9) (Guilinger et al., 2014; Tsai et al., 2014). The development of aptamers against FokI would be helpful for genome editing using DSB by FokI in ZFN, TALEN, or FokI-dCas9. Here, we describe DNA aptamers against FokI, which is the DNA cleavage domain of ZFN and TALEN. The obtained DNA aptamers against FokI with high affinity but were not cleaved by FokI itself and did not inhibit its nuclease activity. We succeeded in introducing one of the SSNs, ZFN, into HEK293 cells by combining the obtained aptamers and nanoneedles. Therefore, these aptamers can be applied in controlled delivery system of SSNs such as ZFN and TALEN for any target sequence and reduce off-target effects during genome editing.
2.3. Aptamer blotting assay FokI was spotted onto a nitrocellulose membrane and blocked as described above. For evaluation of binding specificity, we spotted 20 pmol of each protein, FokI, ZF-mEm, ZFN.L, and thrombin. The 5′biotinylated oligonucleotides were heated as described above. The membrane was incubated in 200 nM prepared oligonucleotides at RT for 1 h and washed with TBS-T. Next, the membrane was incubated with diluted horseradish peroxidase (HRP)-conjugated NeutrAvidin (NeutrAvidin-HRP) (Thermo Fisher Scientific) at RT for 30 min. Binding between the oligonucleotides and proteins was detected using an LAS 4000 mini (GE Healthcare) with Immobilon Western chemiluminescent HRP substrate (Merck Millipore, Billerica, MA, USA). For this analysis, the intensity of each dot was calculated using ImageJ software (NIH, Bethesda, MD, USA).
2. Material and methods 2.1. FokI and Zinc-finger proteins expression and purification The gene encoding FokI was amplified from pET.CCR5.L.FN (Gaj et al., 2012), using an NdeI-inserted forward primer 5′AAACATATGCAACTAGTCAAAAGTGAACTGGAGGA-3′ and T7 reverse primer 5′-CTAGTTATTGCTCAGCGG-3′. The amplified DNA was inserted into pET28a. ZFN-GFP was constructed by inserting variants of GFP (mEmerald) at the N-terminus of ZFN. ZF-mEm was zinc-finger protein fused with mEmerald (Matsumoto et al., 2016). All proteins were expressed in Escherichia coli BL21 (DE3) cells. Each protein FokI, ZF-mEm and ZFN.L was expressed using the Overnight Express Autoinduction system at 25 °C for 24 h (Studier, 2005). ZFN-GFP was also expressed in E. coli BL21 (DE3) cells by IPTG induction. The cell pellets were resuspended in cell lysis buffer (50 mM Tris-HCl, 500 mM NaCl, 10%(w/v) glycerol, 20 mM imidazole, 1 mM MgCl2, 10 μM ZnCl2, 1% (v/v) Triton X-100, pH 8.0). Next, the cells were homogenized using a French press, and centrifuged at 8000×g for 30 min at 4 °C. The proteins were purified using a HisTrap HP column (GE Healthcare, Little Chalfont, UK), by elution with buffer containing 500 mM imidazole. The eluted proteins were dialyzed against Trisbuffered saline (TBS) in the absence of EDTA. We added ZnCl2 (final concentration, f.c. 10 μM) to the TBS used to dialyze ZFNs and ZFmEm.
2.4. Native polyacrylamide gel electrophoresis (PAGE) 5′-Fluorescein-modified oligonucleotides (5′-TTT-aptamer sequence) were diluted in TBS (10 mM Tris-HCl, 150 mM NaCl, pH 7.4: not including EDTA) and heated as described above. We mixed each oligonucleotide and FokI (each f.c. 500 nM) followed by incubation at 37 °C for 1 h. After incubation, each sample was applied to a 20% (w/v) polyacrylamide gel and electrophoresed. We detected the fluorescence of fluorescein using a Typhoon 8600 (GE Healthcare). 2.5. Aptamer-antibody sandwich assay 5′-Biotinylated oligonucleotides were diluted with TBS and heated as described above. We immobilized the prepared oligonucleotides (100 nM, 100 μL/well) to a streptavidin-modified 96-well plate (Thermo Fisher Scientific). After washing three times with TBS-T, the plate was blocked by incubation with blocking buffer (4% (w/v) skim milk and 2 mM biotin in TBS-T) at RT for 1 h. FokI (0, 50 nM, and 100 nM; 100 μL/well) was added to each well and incubated at RT for 1 h. Next, 0.2 μg/mL anti-His-tag antibody (Medical & Biological Laboratories Co. Ltd., Nagoya, Japan) was added and the samples were incubated at RT for 1 h and washed. Alkaline phosphatase (ALP)conjugated anti-mouse IgG (Sigma-Aldrich, St. Louis, MO, USA) was added and incubated at RT for 1 h. After washing three times, binding between the oligonucleotides and FokI was detected using a CDP-star, ready-to-use (Roche, Basel, Switzerland), and measured using an Arvo MX 1420 multilabel counter (Perkin-Elmer, Waltham, MA, USA).
2.2. Selection of aptamers against FokI by SELEX DNA oligonucleotides were synthesized by Eurofins Genomics (Tokyo, Japan). A 66-nt single-stranded (ss) DNA library containing a 24-nt randomized region (N24) and 18-nt primer regions, each end of N24 with 3-nt thymine linkers, was used for selection (5′CTATCTATGGTGAGTCCTtttN24tttCTAAGTACACACGCATCA-3′) (Tsukakoshi et al., 2012). The DNA library was heated at 95 °C for 10 min and gradually cooled to 25 °C for 30 min in TBS (10 mM TrisHCl, 150 mM NaCl, 1 mM EDTA, pH 7.4) to fold the structures. Next, 20 pmol of FokI was spotted onto a nitrocellulose membrane. The membrane was blocked with 2% (w/v) bovine serum albumin (BSA) in 0.05% (v/v) Tween 20 in TBS (TBS-T) at room temperature, 25 °C (RT) for 1 h and washed with TBS-T. For the negative selection, the folded 2
Biosensors and Bioelectronics xx (xxxx) xxxx–xxxx
M. Nishio et al.
were prepared and heated as described above. Each aptamer was supported on a 5-mm2 silicon wafer by linkage to streptavidin at RT for 1 h. After rinsing with TBS, the aptamer-supported nanoneedle array was incubated with GFP-ZFN solution at RT for 30 min. The GFP-ZFNmodified nanoneedle array was rinsed with PBS prior to insertion into the cells. HEK293 cells expressing red fluorescent protein, DsRed2-NES, whose plasmid was constructed in our laboratory (Obataya et al., 2005), were seeded (105 cells) onto a collagen-coated 27φ glass base dish (IWAKI, Tokyo, Japan) and cultured in DMEM supplemented with 10% fetal bovine serum. The medium was changed to Opti-MEM (Thermo Fisher Scientific) prior to insertion of the nanoneedles into the cell. The details of manipulation of the nanoneedle array have been previously described (Matsumoto et al., 2015). Cells were pierced with the GFP-ZFN-supported nanoneedle array and scanned from the tip of the nanoneedles upwards by 25 µm, at a scan rate of 1 µm/slice (total 26 slices), using a confocal laser scanning microscope (CLSM) (IX71/ FV300, Olympus, Tokyo, Japan). Next, the fluorescence intensity of the XY image of the nanoneedles from the tip to the 5-μm upper region was analyzed using ImageJ. Nine nanoneedles were analyzed in this experiment for each condition, including inserted or not inserted.
2.6. Enzyme-linked oligonucleotide assay (ELONA) We immobilized FokI (100 nM or 150 nM; 100 μL/well) diluted with TBS on each well of a Maxisorp 96-well microtiter plate (Nunc, Rochester, NY, USA), at RT by incubating for 3 h. After washing with TBS-T, each well was blocked by incubation with 150 μL/well 2% (w/v) BSA in TBS-T for 1 h at RT. 5′-Biotinylated oligonucleotides were added to each well and incubated for 1 h at RT. After washing, NeutrAvidin-HRP was added to each well and incubated for 30 min at RT. Finally, 100 μL/well of BM chemiluminescence enzyme-linked immunosorbent assay substrate (Roche) was added to each well, and chemiluminescence was measured using the Arvo MX 1420 multilabel counter (Perkin-Elmer). 2.7. ZFN cleavage assay in vitro The target sequence and the recognition sequence of ZFN.L is shown in the Supplementary Table. The substrate plasmid was constructed by inserting dsDNA including the target sequence to the pCR2.1 vector by TA cloning (Thermo Fisher Scientific). In this assay, we evaluated F6#11 as a negative control for not binding to FokI, and F6#8 and #71, which bind to FokI with high affinity. These aptamers were prepared in TBS as described above. After preparation of the aptamers, we mixed 1 μL of the aptamers (f.c. 10 nM, 100 nM, 1 μM) and 1 μL ZFN.L (f.c. 100 nM) and incubated the samples for 30 min at RT. Next, we added 1 μL of 10X NEBuffer 4 (New England Biolabs, Ipswich, MA, USA), 50 ng of the substrate plasmid, and 6 μL of ultrapure water to the mixture. After incubation at 37 °C for 1 h, we added 1 μL of 10% (w/v) SDS was added to stop the reaction. Each sample was analyzed by electrophoresis on a 1.2% (w/v) agarose gel, which was then stained with GelGreen (Wako, Osaka, Japan).
3. Results & discussions 3.1. Screening of aptamers against FokI by SELEX and binding analysis of aptamers We performed SELEX using a nitrocellulose membrane to obtain DNA aptamers against FokI. The DNA library for the initial round contained 66-mer oligonucleotides with a 24-mer randomized region. To apply the aptamers against FokI for the controlled delivery of SSNs, aptamers that bind to FokI outside of the cells but release FokI inside the cells were required. Hence, we focused on potassium ions. The concentration of potassium ions in cells is over 100 mM (Lodish et al., 2000; Century et al., 1970). The structures of oligonucleotides such as G-quadruplex (G4) may change in the presence of potassium ions (Ambrus et al., 2006; Li et al., 2005). Therefore, we predicted that the structures of the obtained aptamers would change in the presence or absence of potassium ions and hence, we performed SELEX in the absence of potassium ions. On the nitrocellulose membrane, FokI can form dimers and cleave dsDNA non-specifically. Thus, the primer region of the DNA library may be cleaved and the DNA pools cannot be recovered. To avoid this, we performed SELEX using the ssDNA library
2.8. Modification of GFP-ZFN on nanoneedle array and intracellular release assay Silicon nanoneedle arrays (5 mm2) were cleaned with an O2 plasma asher (JPA300; J-SCISSNCE Lab Co. Ltd., Kyoto, Japan). After rinsing with ultrapure water and EtOH, the nanoneedle array was immersed in 1% hydrogen fluorite solution for 1 min to make the nanoneedle array surface hydrophobic. After rinsing with ultrapure water, hydrophobic nanoneedle array was immersed for 1 h in 1 μM biotinylated BSA solution. Next, streptavidin (1 μM) was reacted with the biotin on biotinylated BSA at RT for 1 h. 5′-Biotinylated aptamers against FokI
Table 1 Sequences identified from the 24-nt randomized region of the library after six rounds of SELEX against FokI. Gibb's energy (ΔG) and melting temperature (Tm) of each sequence was calculated by Mfold for predicted secondary structures. The G4 motifs, which may form G4 structures, were determined using QGRS Mapper (Options: Max length 24, Min G-group 2, Loop size 0–24). Sequences selected as aptamers against FokI are shown in bold. Name
Sequence (5–3′, 24-nt)
ΔG (kcal/mol)
Tm (°C)
G4 motif
F6#8 F6#11 F6#13 F6#14 F6#32 F6#39 F6#42 F6#49 F6#60 F6#63 F6#66 F6#67 F6#69 F6#70 F6#71 F6#83 F6#84 F6#94
GTTGCCCATGGAGTTGTTGTGGGG GAAAGAGGGCTCTGTGGGGCCGCT GAGACGGTCCCTACTGGGGTTATT GCCGGGGCTCGAGGGGCGGCGTGG GACGGGCGGCCCGGGCGATGGCAG GCCGAAGGGGAGTCGGTGGCTATC GGGATGGGGCCGGGGTTGGCGGTA GCTGGTGTGCATCAGCCGTGGTGT CGCGGTGATGGGAGCTGCGGTAGG GAGGGCGGCCTAAGTTGGTTGACC GGGGGGTCCGAAGGTAGTGTTCGG GTGCCGGCTGTCTTTGGCGCTGAG CCGCCGGAGGACGCGGTTTATGCG GGTCCGGCGCTCCTGGTTGTATGG GATCGGGCGGGGGGTGGTCGGTCT GCAGGTGGTCCGAGTGCTTTACGG GGGCGCTCTGGGAGGGCTGATGTT GCGGGCCGCGGTGGAGTGGCACTG
−2.9 −3.5 −2.67 −3.35 −5.17 −3.15 −2.41 −2.68 −2.6 −2.15 −3.49 −2.66 −4.68 −0.99 −1.72 −4.96 −4.03 −3.93
50.3 55.7 53.8 54.7 55.6 51.4 50.1 50.5 48.4 42.1 53.5 49.9 58.8 36.8 48 73.5 55.2 56.4
– – – + + + + – + – + – – + + – – +
3
Biosensors and Bioelectronics xx (xxxx) xxxx–xxxx
M. Nishio et al.
Fig. 2. Evaluation of binding affinity of the aptamers, by aptamer-antibody sandwich assay. ΔALP chemiluminescence is the difference of the signal in the presence of FokI from that in the absence of FokI.
showed higher signals compared to other aptamers. This suggests that these 3 aptamers bound to FokI with high affinity. These aptamers were predicted to form different structures based on their sequences, with F6#8 forming a stem-loop structure and F6#66 and #71 forming a G4 structure. Therefore, these aptamers recognize and bind to different regions of FokI. Additionally, the potassium ion concentration may affect the binding ability of F6#66 and #71, which can form G4. Even if oligonucleotides have the same sequence, the topology of G4 may change in the presence of potassium ion (Ambrus et al., 2006), which may affect their binding ability.
Fig. 1. Binding ability and specificity of aptamer candidates against FokI by aptamer blotting. polyT was used as a negative control to show that the oligonucleotides did not form secondary structures. (a) Binding ability of aptamer candidates. Dot intensity of FokI immobilized region on the nitrocellulose membrane was calculated using ImageJ (N=3). (b) Binding specificity of aptamer candidates. (ZF-mEm: mEmerald fused ZF protein, ZFN: zinc-finger nuclease for CCR5 gene).
3.2. Nuclease resistance of aptamers against FokI and their binding ability Since FokI shows non-specific DNA cleavage activity, aptamers may be cleaved by FokI itself. However, aptamer cleavage by FokI can be prevented for effective delivery of SSNs into cells, using a combination of the aptamer and nanoneedles. Therefore, we performed NativePAGE and evaluated the nuclease resistance of DNA aptamers. As a result, both in the presence and absence of FokI, each DNA aptamer showed the same bands (Supplementary Fig. 1). Therefore, the aptamers were likely not cleaved by FokI itself because the aptamers bind to different regions of the FokI catalytic site or some form G4 without a dsDNA region. In F6#66, two bands of different sizes were observed, indicating that F6#66 can form either dimers or multimers. Therefore, the increase in the binding signal of F6#66 may have been caused by the formation of a multimer, not by high-affinity binding to FokI. Based on these results, we selected two DNA aptamers, F6#8 and #71, against FokI, showing high affinity, which were folded into monomers. We evaluated their binding ability by ELONA and found that the dissociation constants of F6#8 and #71 were 82 nM and 74 nM, respectively (Supplementary Fig. 2). To apply these aptamers to the SSN delivery system by nanoneedles, it is necessary that these aptamers bind to FokI when nanoneedles are inserted into the cells. Previously, we reported a ZF protein delivery system, using aptamerfused ds oligonucleotides and a nanoneedle (Matsumoto et al., 2016). In that study, ZF protein showed nanomolar-order dissociation constant to the target dsDNA. Therefore, F6#8 and #71 showed sufficient ability to bind FokI to deliver SSNs into the cells by nanoneedles. Based on these results, we obtained aptamers against FokI with sufficient binding ability to immobilize FokI onto nanoneedles without being cleaved.
that did not contain the complementary strands to the primer regions to block intramolecular hybridization. After six rounds of SELEX, we sequenced the eluted DNA pool and obtained the 90 sequences. We selected 18 sequences as aptamer candidates because they were predicted to form stable secondary structures (Table 1) and performed an aptamer blotting assay. First, we evaluated the binding affinity of the obtained aptamer candidates (Fig. 1a). Based on the result, most of the aptamer candidates bound to FokI and F6#8, #66, and #71 bound to FokI with high affinity. Since FokI has a positive charge, enabling it to bind and cleave dsDNA, oligonucleotides with a negative charge may nonspecifically bind to FokI. Next, we evaluated binding specificity in an aptamer blotting assay. In this assay, we used two different proteins including FokI (FokI, ZFN), and two that did not include FokI (zinc-finger fused GFP variants (ZF-mEm), thrombin). A comparison of the dot intensities of 24 mer poly-thymine nucleotides (polyT) showed that some aptamer candidates such as F6#11, #14, #60, #63, and #71 had low affinity to other proteins, particularly ZF-mEm, which has a DNA binding domain, not including FokI (Fig. 1b). To apply to the DNA aptamers against FokI, these aptamers should bind to FokI with high affinity. Because the SSNs used in genome editing applications such as in delivery systems are typically purified, the specificity of the obtained aptamers is less important. Therefore, compared to polyT, we selected 7 sequences showing stronger spots in dot blotting or less binding to other proteins, as the aptamer against FokI. Next, we evaluated binding in an aptamer-antibody sandwich assay. In this assay, the biotinylated aptamers were immobilized to the streptavidin-modified plate and then FokI was added to the plate. Next, anti-Histag antibody was added as the primary antibody, and ALP-conjugated anti-mouse IgG was added as the secondary antibody. Finally, chemiluminescence intensity was determined. As the result, the highest signal was observed in F6#71 (Fig. 2). F6#8 and #66
3.3. Effect of F6#8 and #71 on FokI nuclease activity To apply these aptamers for genome editing, the aptamers should not inhibit FokI nuclease activity. Therefore, we performed a cleavage activity assay in the presence of the obtained aptamers. In this assay, 4
Biosensors and Bioelectronics xx (xxxx) xxxx–xxxx
M. Nishio et al.
293 (HEK293) cells. Immediately after insertion, the fluorescence intensities of nanoneedles which modified ZFN-GFP via aptamers were higher than that of modified via polyT (Fig. 4b). It was suggested that these aptamers bound to FokI with higher affinity comparing with polyT. In the presence of HEK293, the fluorescence intensity of the nanoneedle region, which contained immobilized F6#8 and #71, was decreased after 30 min of insertion. When immobilizing ZFN-GFP via polyT, the fluorescence intensity was not much decreased. Thus, we considered that these aptamers effectively released FokI in the presence of the cells. F6#8 is predicted to form a stem loop structure, and F6#71 can form a G4 structure. It was reported that a stem loop structurewas destabilized and a G4 was stabilized under molecular crowding conditions (Miyoshi et al., 2006; Nakano et al., 2014). The G4 structure were changed and stabilized in the presence of potassium ion. We also performed this assay in fresh medium without cells and conditioned medium used for various cell types (4T1, CHO-K1 and HEK293) (Data not shown). We observed the release of ZFN-GFP through the aptamers and polyT in the conditioned medium of all the cell types evaluated, but not in fresh medium. Therefore, the release of ZFN-GFP in the presence of cells may have occurred because the conformation of the aptamers changed with the surrounding environment such as the concentration of potassium ion, or because compounds secreted from the cells inhibited oligonucleotide-FokI interactions such as electrostatic interactions. The controlled release of SSNs, using a combination of aptamers and nanoneedles, seems to be a promising approach for introducing SSNs into cells with fewer offtarget effects.
Fig. 3. ZFN cleavage activity assay in vitro in the presence of DNA aptamers against FokI. F6#8 and #71 bound to FokI with high affinity and #11 bind to FokI with lower affinity than the other aptamers or polyT. Cut% was calculated using ImageJ, given by 100x[1-(the band intensity of uncleaved band in each sample/the sum of bands intensity)]. NC: negative control and only substrate plasmid, PC: positive control, which included the substrate plasmid and ZFN, but not the aptamers.
we evaluated F6#8 and #71, which bind to FokI with high affinity; and F6#11, which binds to FokI with low affinity, as a negative control. We used ZFN targeted to CCR5 (Gaj et al., 2012). First, the aptamers were incubated with ZFN and the conformed aptamer-ZFN complex. Next, the substrate plasmid was added and reacted at 37 °C for 1 h. After the reaction, SDS (f.c. 1% (w/v)) was added to stop the reaction and the samples were electrophoresed. We observed two or three different bands in the presence of ZFN (Fig. 3). The lowest band appeared to be the uncleaved plasmid while the other bands may have been cleaved plasmid. The upper two bands may be the cleaved or nicked substrate plasmid. There were no differences in band intensity, indicating that ZFNs actively cleaved the plasmid. These results suggest that the aptamers did not inhibit the nuclease activity of FokI. There are two possible reasons why these aptamers did not inhibit ZFN activity by binding to FokI. First, the aptamers did not bind to the catalytic site of FokI, based on the results of Native-PAGE. Second, the aptamers did not change the FokI structure upon binding and do not prevent ZFN from a forming dimer at the target site. Thus, nanoneedles were used to deliver modified SSNs that retained their activity using the aptamers.
4. Conclusion In this study, we developed DNA aptamers against FokI, which is the common DNA cleavage domain of ZFN and TALEN. This is the first report of using DNA aptamers against FokI for genome editing. We obtained seven DNA aptamers against FokI via six rounds of SELEX. Aptamer blotting and aptamer-sandwich assays showed that the aptamers bound to FokI. Particularly, ELONA revealed that F6#8 and #71 bound to FokI with high affinity, with dissociation constants of 82 nM and 74 nM, respectively. The results showed that the aptamers were not cleaved by FokI and did not inhibit FokI activity after binding. Additionally, the aptamers released FokI from the nanoneedles in the presence of cells. This is because these aptamers may change their conformations according to the surrounding conditions, such as salt concentration, or secrete compounds by cells that inhibit the oligonu-
3.4. FokI delivery into HEK293 cells by nanoneedles We introduced ZFN into the cell, using a combination of the DNA aptamers (F6#8 and #71) or polyT and nanoneedles (Fig. 4a). In this assay, we modified ZFN-GFP to nanoneedles using F6#8, #71 or polyT and inserted the modified nanoneedles into human embryonic kidney
Insert ion time
0 min
30 min
F6#8
Insert into cells
F6#71
polyT
Fig. 4. ZFN delivery into the HEK293 cells, using a combination of DNA aptamers against FokI (F6#8 and #71) and nanoneedles. (a) Scheme of this delivery system. ZFN-GFP was immobilized to nanoneedles via the obtained aptamers. (b) Fluorescence images fused with ZFN-GFP modified nanoneedles and Ds-Red expressed in HEK293 cells. Green indicates the fluorescence of ZFN-GFP and red indicates the fluorescence of Ds-Red detected by confocal laser scanning microscopy.(For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.).
5
Biosensors and Bioelectronics xx (xxxx) xxxx–xxxx
M. Nishio et al.
peptide-mediated delivery of TALEN proteins via bioconjugation for genome engineering. PLoS One 9 (1), e85755. Lodish, H., Berk, A., Zipursky, S.L., Matsudaira, P., Baltimore, D., Darnell, J., 2000. Molecular Cell Biology fourth ed.. W.H. Freeman, New York. Matsumoto, D., Nishio, M., Kato, Y., Yoshida, W., Abe, K., Fukazawa, K., Ishihara, K., Iwata, F., Ikebukuro, K., Nakamura, C., 2016. ATP-mediated release of a DNAbinding protein from a silicon nanoneedle array. Electrochemistry 84 (5), 305–307. Matsumoto, D., Rao Sathuluri, R., Kato, Y., Silberberg, Y.R., Kawamura, R., Iwata, F., Kobayashi, T., Nakamura, C., 2015. Oscillating high-aspect-ratio monolithic silicon nanoneedle array enables efficient delivery of functional bio-macromolecules into living cells. Sci. Rep. 5, 15325. Miyoshi, D., Karimata, H., Sugimoto, N., 2006. Hydration regulates thermodynamics of G-quadruplex formation under molecular crowding conditions. J. Am. Chem. Soc. 128 (24), 7957–7963. Nakano, S., Miyoshi, D., Sugimoto, N., 2014. Effects of molecular crowding on the structures, interactions, and functions of nucleic acids. Chem. Rev. 114 (5), 2733–2758. Obataya, I., Nakamura, C., Han, S., Nakamura, N., Miyake, J., 2005. Nanoscale operation of a living cell using an atomic force microscope with a nanoneedle. Nano Lett. 5 (1), 27–30. Perez, E.E., Wang, J., Miller, J.C., Jouvenot, Y., Kim, K.A., Liu, O., Wang, N., Lee, G., Bartsevich, V.V., Lee, Y.L., Guschin, D.Y., Rupniewski, I., Waite, A.J., Carpenito, C., Carroll, R.G., Orange, J.S., Urnov, F.D., Rebar, E.J., Ando, D., Gregory, P.D., Riley, J.L., Holmes, M.C., June, C.H., 2008. Establishment of HIV-1 resistance in CD4+ T cells by genome editing using zinc-finger nucleases. Nat. Biotechnol. 26 (7), 808–816. Studier, F.W., 2005. Protein production by auto-induction in high density shaking cultures. Protein Expr. Purif. 41 (1), 207–234. Tsai, S.Q., Wyvekens, N., Khayter, C., Foden, J.A., Thapar, V., Reyon, D., Goodwin, M.J., Aryee, M.J., Joung, J.K., 2014. Dimeric CRISPR RNA-guided FokI nucleases for highly specific genome editing. Nat. Biotechnol. 32 (6), 569–576. Tsukakoshi, K., Abe, K., Sode, K., Ikebukuro, K., 2012. Selection of DNA aptamers that recognize alpha-synuclein oligomers using a competitive screening method. Anal. Chem. 84 (13), 5542–5547. Tuerk, C., Gold, L., 1990. Systematic evolution of ligands by exponential enrichment: rna ligands to bacteriophage T4 DNA polymerase. Sci. (N.Y.) 249 (4968), 505–510. Wu, X., Kriz, A.J., Sharp, P.A., 2014. Target specificity of the CRISPR-Cas9 system. Quant. Biol. 2 (2), 59–70. Yoshida, W., Mochizuki, E., Takase, M., Hasegawa, H., Morita, Y., Yamazaki, H., Sode, K., Ikebukuro, K., 2009. Selection of DNA aptamers against insulin and construction of an aptameric enzyme subunit for insulin sensing. Biosens. Bioelectron. 24 (5), 1116–1120. Yoshida, W., Sode, K., Ikebukuro, K., 2006. Aptameric enzyme subunit for biosensing based on enzymatic activity measurement. Anal. Chem. 78 (10), 3296–3303. Yoshida, W., Sode, K., Ikebukuro, K., 2008. Label-free homogeneous detection of immunoglobulin E by an aptameric enzyme subunit. Biotechnol. Lett. 30 (3), 421–425. Zuker, M., 2003. Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res. 31 (13), 3406–3415.
cleotide-aptamer interactions. Using a combination of aptamers and nanoneedles, a system for controlled delivery of SSNs, which have a FokI DNA cleavage domain such as ZFN and TALEN, into cells may be a powerful tool for genome editing with fewer off-target effects. Acknowledgements This work was supported by a Grant-in-Aid for Scientific Research (A) (JP26249127) from the Japan Society for the Promotion of Science (JSPS, Japan). Appendix A. Supporting information Supplementary data associated with this article can be found in the online version at doi:10.1016/j.bios.2016.11.042. References Ambrus, A., Chen, D., Dai, J., Bialis, T., Jones, R.A., Yang, D., 2006. Human telomeric sequence forms a hybrid-type intramolecular G-quadruplex structure with mixed parallel/antiparallel strands in potassium solution. Nucleic Acids Res. 34 (9), 2723–2735. Carroll, D., 2011. Genome engineering with zinc-finger nucleases. Genetics 188 (4), 773–782. Century, T.J., Fenichel, I.R., Horowitz, S.B., 1970. The concentrations of water, sodium and potassium in the nucleus and cytoplasm of amphibian oocytes. J. Cell Sci. 7 (1), 5–13. Cox, D.B., Platt, R.J., Zhang, F., 2015. Therapeutic genome editing: prospects and challenges. Nat. Med. 21 (2), 121–131. Ellington, A.D., Szostak, J.W., 1990. In vitro selection of RNA molecules that bind specific ligands. Nature 346 (6287), 818–822. Gaj, T., Gersbach, C.A., Barbas, C.F., 3rd, 2013. ZFN, TALEN, and CRISPR/Cas-based methods for genome engineering. Trends Biotechnol. 31 (7), 397–405. Gaj, T., Guo, J., Kato, Y., Sirk, S.J., Barbas, C.F., 3rd, 2012. Targeted gene knockout by direct delivery of zinc-finger nuclease proteins. Nat. Methods 9 (8), 805–807. Guilinger, J.P., Thompson, D.B., Liu, D.R., 2014. Fusion of catalytically inactive Cas9 to FokI nuclease improves the specificity of genome modification. Nat. Biotechnol. 32 (6), 577–582. Kikin, O., D'Antonio, L., Bagga, P.S., 2006. QGRS mapper: a web-based server for predicting G-quadruplexes in nucleotide sequences. Nucleic Acids Res., W676–W682, 34(Web Server issue). Li, J., Correia, J.J., Wang, L., Trent, J.O., Chaires, J.B., 2005. Not so crystal clear: the structure of the human telomere G-quadruplex in solution differs from that present in a crystal. Nucleic Acids Res. 33 (14), 4649–4659. Liu, J., Gaj, T., Patterson, J.T., Sirk, S.J., Barbas, C.F., 3rd, 2014. Cell-penetrating
6
Contents lists available at ScienceDirect
Biosensors and Bioelectronics journal homepage: www.elsevier.com/locate/bios
DNA aptamers against FokI nuclease domain for genome editing applications Maui Nishioa, Daisuke Matsumotoa, Yoshio Katob, Koichi Abea, Jinhee Leea, Kaori Tsukakoshia, ⁎ Ayana Yamagishib, Chikashi Nakamuraa,b, Kazunori Ikebukuroa, a
Department of Biotechnology and Life Science, Tokyo University of Agriculture and Technology, 2-24-16 Naka-cho, Koganei, Tokyo 184-8588, Japan Biomedical Research Institute, National Institute of Advanced Industrial Science and Technology (AIST), Central 5 1-1-1 Higashi, Tsukuba, Ibaraki 3058565, Japan b
A R T I C L E I N F O
A BS T RAC T
Key words: Aptamer Genome editing FokI Protein delivery
Genome editing with site-specific nucleases (SSNs) can modify only the target gene and may be effective for gene therapy. The main limitation of genome editing for clinical use is off-target effects; excess SSNs in the cells and their longevity can contribute to off-target effects. Therefore, a controlled delivery system for SSNs is necessary. FokI nuclease domain (FokI) is a common DNA cleavage domain in zinc finger nuclease (ZFN) and transcription activator-like effector nuclease. Previously, we reported a zinc finger protein delivery system that combined aptamer-fused, double-strand oligonucleotides and nanoneedles. Here, we report the development of DNA aptamers that bind to the target molecules, with high affinity and specificity to the FokI. DNA aptamers were selected in six rounds of systematic evolution of ligands by exponential enrichment. Aptamers F6#8 and #71, which showed high binding affinity to FokI (Kd=82 nM, 74 nM each), showed resistance to nuclease activity itself and did not inhibit nuclease activity. We immobilized the ZFN-fused GFP to nanoneedles through these aptamers and inserted the nanoneedles into HEK293 cells. We observed the release of ZFN-fused GFP from the nanoneedles in the presence of cells. Therefore, these aptamers are useful for genome editing applications such as controlled delivery of SSNs.
1. Introduction Genome editing is a genetic engineering tool to modify target sites on genomic DNA by site-specific nucleases (SSNs). SSNs used in genome editing include zinc finger nuclease (ZFN), transcription activator-like effector nuclease (TALEN), and the CRISPR/Cas9 system (Gaj et al., 2013). These genome-editing technologies can introduce double-strand (ds) DNA breaks (DSBs) at a target site. Subsequently, cellular DNA repair systems such as non-homologous end joining or homologous recombination can be used to knock a target gene out or in. Therefore, genome editing is thought to be applicable for gene therapy (Carroll, 2011; Cox et al., 2015; Perez et al., 2008). However, a major limitation to the clinical application of genome editing in humans is off-target effects, i.e., DSBs at non-target sites. Researchers have reported that off-target effects are common in genome editing by SSNs, which occur because of the uncontrollable duration and amount of SSN expression in the cells by transfecting plasmids (Cox et al., 2015; Wu et al., 2014; Liu et al., 2014). Therefore, a controlled system for delivering SSNs is necessary to reduce off-target
⁎
effects and apply genome editing in the clinical use. Previously, we reported that a nanoneedle of 200 nm in diameter on an AFM cantilever could be inserted into living cells with high efficiency and minimal damage (Obataya et al., 2005). And we have recently developed a nanoneedle array containing several ten thousands of nanoneedles on 5 mm square silicon chip and a home-made manipulator for it (Matsumoto et al., 2015) and the nanoneedle array system was applied for a protein delivery by combining with an aptamer-based oligonucleotide (Matsumoto et al., 2016). In this method, the conformation of the aptamer-based oligonucleotide is altered in the presence of ATP, releasing the zinc finger protein. Therefore, the controlled delivery of SSNs may be achieved using a combination of aptamer-based oligonucleotides and nanoneedles to reduce off-target effects in genome editing. Aptamers are oligonucleotides that bind to target molecules such as proteins and small molecules with high affinity and specificity compared to antibodies. Aptamers can be obtained through in vitro selection, also known as systematic evolution of ligands by exponential enrichment (SELEX) (Ellington and Szostak, 1990; Tuerk and Gold,
Corresponding author. E-mail address: [email protected] (K. Ikebukuro).
http://dx.doi.org/10.1016/j.bios.2016.11.042 Received 11 October 2016; Received in revised form 14 November 2016; Accepted 15 November 2016 Available online xxxx 0956-5663/ © 2016 Elsevier B.V. All rights reserved.
Please cite this article as: Nishio, M., Biosensors and Bioelectronics (2016), http://dx.doi.org/10.1016/j.bios.2016.11.042
Biosensors and Bioelectronics xx (xxxx) xxxx–xxxx
M. Nishio et al.
DNA library was incubated with only a blocked membrane, followed by incubation with a FokI-immobilized membrane at RT overnight. After washing the membrane, the FokI-immobilized area was cut out and oligonucleotides were eluted by phenol-chloroform extraction. The collected ssDNAs were used as the PCR template and amplified using forward primer (5′-CTATCTATGGTGAGTCCT-3′), 5′ biotinylated reverse primer (5′-TGATGCGTGTGTACTTAG-3′), and TaKaRa ExTaq Hot Start Version (TaKaRa Bio Inc., Shiga, Japan). After PCR, biotinylated reverse strands were removed using avidin agarose beads (Thermo Fisher Scientific, Waltham, MA, USA) for the subsequent round of screening. After six rounds of screening, the oligonucleotide pools were amplified by PCR. The oligonucleotide pools were cloned into E. coli DH5α competent cells (TaKaRa Bio Inc.), using the pGEM-T easy vector system (Promega, Madison, WI, USA). After 90 transformants were randomly picked, we prepared the sequencing samples, using the illustra TempliPhi DNA Amplification Kit (GE Healthcare). DNA sequencing was performed by Eurofins Genomics (Tokyo, Japan). The secondary structures of each oligonucleotide were predicted by the M-fold server (Zuker, 2003) and QGRS mapper (Kikin et al., 2006).
1990). The aptamers can be easily synthesized, modified, and labeled by chemical processes. Additionally, we developed various aptamerbased sensing systems by taking advantage of their conformational changes in the presence or absence of the target molecule (Yoshida et al., 2006, 2008, 2009). In this study, we developed and applied aptamers against SSNs, using a controlled delivery system. ZFN and TALEN are composed of two domains: a DNA-binding domain specific to the target sequence, and a DNA cleavage domain that can cleave the dsDNA non-specifically. The DNA-binding domains, such as a zinc finger domain or TAL effector, can be designed for each target sequence. The FokI nuclease domain (FokI) is a common DNA cleavage domain in ZFN and TALEN. FokI can cleave dsDNA by forming dimers at the target site. There are also some reports of genome editing using a combination of FokI and inactivated Cas9 (FokI-dCas9) (Guilinger et al., 2014; Tsai et al., 2014). The development of aptamers against FokI would be helpful for genome editing using DSB by FokI in ZFN, TALEN, or FokI-dCas9. Here, we describe DNA aptamers against FokI, which is the DNA cleavage domain of ZFN and TALEN. The obtained DNA aptamers against FokI with high affinity but were not cleaved by FokI itself and did not inhibit its nuclease activity. We succeeded in introducing one of the SSNs, ZFN, into HEK293 cells by combining the obtained aptamers and nanoneedles. Therefore, these aptamers can be applied in controlled delivery system of SSNs such as ZFN and TALEN for any target sequence and reduce off-target effects during genome editing.
2.3. Aptamer blotting assay FokI was spotted onto a nitrocellulose membrane and blocked as described above. For evaluation of binding specificity, we spotted 20 pmol of each protein, FokI, ZF-mEm, ZFN.L, and thrombin. The 5′biotinylated oligonucleotides were heated as described above. The membrane was incubated in 200 nM prepared oligonucleotides at RT for 1 h and washed with TBS-T. Next, the membrane was incubated with diluted horseradish peroxidase (HRP)-conjugated NeutrAvidin (NeutrAvidin-HRP) (Thermo Fisher Scientific) at RT for 30 min. Binding between the oligonucleotides and proteins was detected using an LAS 4000 mini (GE Healthcare) with Immobilon Western chemiluminescent HRP substrate (Merck Millipore, Billerica, MA, USA). For this analysis, the intensity of each dot was calculated using ImageJ software (NIH, Bethesda, MD, USA).
2. Material and methods 2.1. FokI and Zinc-finger proteins expression and purification The gene encoding FokI was amplified from pET.CCR5.L.FN (Gaj et al., 2012), using an NdeI-inserted forward primer 5′AAACATATGCAACTAGTCAAAAGTGAACTGGAGGA-3′ and T7 reverse primer 5′-CTAGTTATTGCTCAGCGG-3′. The amplified DNA was inserted into pET28a. ZFN-GFP was constructed by inserting variants of GFP (mEmerald) at the N-terminus of ZFN. ZF-mEm was zinc-finger protein fused with mEmerald (Matsumoto et al., 2016). All proteins were expressed in Escherichia coli BL21 (DE3) cells. Each protein FokI, ZF-mEm and ZFN.L was expressed using the Overnight Express Autoinduction system at 25 °C for 24 h (Studier, 2005). ZFN-GFP was also expressed in E. coli BL21 (DE3) cells by IPTG induction. The cell pellets were resuspended in cell lysis buffer (50 mM Tris-HCl, 500 mM NaCl, 10%(w/v) glycerol, 20 mM imidazole, 1 mM MgCl2, 10 μM ZnCl2, 1% (v/v) Triton X-100, pH 8.0). Next, the cells were homogenized using a French press, and centrifuged at 8000×g for 30 min at 4 °C. The proteins were purified using a HisTrap HP column (GE Healthcare, Little Chalfont, UK), by elution with buffer containing 500 mM imidazole. The eluted proteins were dialyzed against Trisbuffered saline (TBS) in the absence of EDTA. We added ZnCl2 (final concentration, f.c. 10 μM) to the TBS used to dialyze ZFNs and ZFmEm.
2.4. Native polyacrylamide gel electrophoresis (PAGE) 5′-Fluorescein-modified oligonucleotides (5′-TTT-aptamer sequence) were diluted in TBS (10 mM Tris-HCl, 150 mM NaCl, pH 7.4: not including EDTA) and heated as described above. We mixed each oligonucleotide and FokI (each f.c. 500 nM) followed by incubation at 37 °C for 1 h. After incubation, each sample was applied to a 20% (w/v) polyacrylamide gel and electrophoresed. We detected the fluorescence of fluorescein using a Typhoon 8600 (GE Healthcare). 2.5. Aptamer-antibody sandwich assay 5′-Biotinylated oligonucleotides were diluted with TBS and heated as described above. We immobilized the prepared oligonucleotides (100 nM, 100 μL/well) to a streptavidin-modified 96-well plate (Thermo Fisher Scientific). After washing three times with TBS-T, the plate was blocked by incubation with blocking buffer (4% (w/v) skim milk and 2 mM biotin in TBS-T) at RT for 1 h. FokI (0, 50 nM, and 100 nM; 100 μL/well) was added to each well and incubated at RT for 1 h. Next, 0.2 μg/mL anti-His-tag antibody (Medical & Biological Laboratories Co. Ltd., Nagoya, Japan) was added and the samples were incubated at RT for 1 h and washed. Alkaline phosphatase (ALP)conjugated anti-mouse IgG (Sigma-Aldrich, St. Louis, MO, USA) was added and incubated at RT for 1 h. After washing three times, binding between the oligonucleotides and FokI was detected using a CDP-star, ready-to-use (Roche, Basel, Switzerland), and measured using an Arvo MX 1420 multilabel counter (Perkin-Elmer, Waltham, MA, USA).
2.2. Selection of aptamers against FokI by SELEX DNA oligonucleotides were synthesized by Eurofins Genomics (Tokyo, Japan). A 66-nt single-stranded (ss) DNA library containing a 24-nt randomized region (N24) and 18-nt primer regions, each end of N24 with 3-nt thymine linkers, was used for selection (5′CTATCTATGGTGAGTCCTtttN24tttCTAAGTACACACGCATCA-3′) (Tsukakoshi et al., 2012). The DNA library was heated at 95 °C for 10 min and gradually cooled to 25 °C for 30 min in TBS (10 mM TrisHCl, 150 mM NaCl, 1 mM EDTA, pH 7.4) to fold the structures. Next, 20 pmol of FokI was spotted onto a nitrocellulose membrane. The membrane was blocked with 2% (w/v) bovine serum albumin (BSA) in 0.05% (v/v) Tween 20 in TBS (TBS-T) at room temperature, 25 °C (RT) for 1 h and washed with TBS-T. For the negative selection, the folded 2
Biosensors and Bioelectronics xx (xxxx) xxxx–xxxx
M. Nishio et al.
were prepared and heated as described above. Each aptamer was supported on a 5-mm2 silicon wafer by linkage to streptavidin at RT for 1 h. After rinsing with TBS, the aptamer-supported nanoneedle array was incubated with GFP-ZFN solution at RT for 30 min. The GFP-ZFNmodified nanoneedle array was rinsed with PBS prior to insertion into the cells. HEK293 cells expressing red fluorescent protein, DsRed2-NES, whose plasmid was constructed in our laboratory (Obataya et al., 2005), were seeded (105 cells) onto a collagen-coated 27φ glass base dish (IWAKI, Tokyo, Japan) and cultured in DMEM supplemented with 10% fetal bovine serum. The medium was changed to Opti-MEM (Thermo Fisher Scientific) prior to insertion of the nanoneedles into the cell. The details of manipulation of the nanoneedle array have been previously described (Matsumoto et al., 2015). Cells were pierced with the GFP-ZFN-supported nanoneedle array and scanned from the tip of the nanoneedles upwards by 25 µm, at a scan rate of 1 µm/slice (total 26 slices), using a confocal laser scanning microscope (CLSM) (IX71/ FV300, Olympus, Tokyo, Japan). Next, the fluorescence intensity of the XY image of the nanoneedles from the tip to the 5-μm upper region was analyzed using ImageJ. Nine nanoneedles were analyzed in this experiment for each condition, including inserted or not inserted.
2.6. Enzyme-linked oligonucleotide assay (ELONA) We immobilized FokI (100 nM or 150 nM; 100 μL/well) diluted with TBS on each well of a Maxisorp 96-well microtiter plate (Nunc, Rochester, NY, USA), at RT by incubating for 3 h. After washing with TBS-T, each well was blocked by incubation with 150 μL/well 2% (w/v) BSA in TBS-T for 1 h at RT. 5′-Biotinylated oligonucleotides were added to each well and incubated for 1 h at RT. After washing, NeutrAvidin-HRP was added to each well and incubated for 30 min at RT. Finally, 100 μL/well of BM chemiluminescence enzyme-linked immunosorbent assay substrate (Roche) was added to each well, and chemiluminescence was measured using the Arvo MX 1420 multilabel counter (Perkin-Elmer). 2.7. ZFN cleavage assay in vitro The target sequence and the recognition sequence of ZFN.L is shown in the Supplementary Table. The substrate plasmid was constructed by inserting dsDNA including the target sequence to the pCR2.1 vector by TA cloning (Thermo Fisher Scientific). In this assay, we evaluated F6#11 as a negative control for not binding to FokI, and F6#8 and #71, which bind to FokI with high affinity. These aptamers were prepared in TBS as described above. After preparation of the aptamers, we mixed 1 μL of the aptamers (f.c. 10 nM, 100 nM, 1 μM) and 1 μL ZFN.L (f.c. 100 nM) and incubated the samples for 30 min at RT. Next, we added 1 μL of 10X NEBuffer 4 (New England Biolabs, Ipswich, MA, USA), 50 ng of the substrate plasmid, and 6 μL of ultrapure water to the mixture. After incubation at 37 °C for 1 h, we added 1 μL of 10% (w/v) SDS was added to stop the reaction. Each sample was analyzed by electrophoresis on a 1.2% (w/v) agarose gel, which was then stained with GelGreen (Wako, Osaka, Japan).
3. Results & discussions 3.1. Screening of aptamers against FokI by SELEX and binding analysis of aptamers We performed SELEX using a nitrocellulose membrane to obtain DNA aptamers against FokI. The DNA library for the initial round contained 66-mer oligonucleotides with a 24-mer randomized region. To apply the aptamers against FokI for the controlled delivery of SSNs, aptamers that bind to FokI outside of the cells but release FokI inside the cells were required. Hence, we focused on potassium ions. The concentration of potassium ions in cells is over 100 mM (Lodish et al., 2000; Century et al., 1970). The structures of oligonucleotides such as G-quadruplex (G4) may change in the presence of potassium ions (Ambrus et al., 2006; Li et al., 2005). Therefore, we predicted that the structures of the obtained aptamers would change in the presence or absence of potassium ions and hence, we performed SELEX in the absence of potassium ions. On the nitrocellulose membrane, FokI can form dimers and cleave dsDNA non-specifically. Thus, the primer region of the DNA library may be cleaved and the DNA pools cannot be recovered. To avoid this, we performed SELEX using the ssDNA library
2.8. Modification of GFP-ZFN on nanoneedle array and intracellular release assay Silicon nanoneedle arrays (5 mm2) were cleaned with an O2 plasma asher (JPA300; J-SCISSNCE Lab Co. Ltd., Kyoto, Japan). After rinsing with ultrapure water and EtOH, the nanoneedle array was immersed in 1% hydrogen fluorite solution for 1 min to make the nanoneedle array surface hydrophobic. After rinsing with ultrapure water, hydrophobic nanoneedle array was immersed for 1 h in 1 μM biotinylated BSA solution. Next, streptavidin (1 μM) was reacted with the biotin on biotinylated BSA at RT for 1 h. 5′-Biotinylated aptamers against FokI
Table 1 Sequences identified from the 24-nt randomized region of the library after six rounds of SELEX against FokI. Gibb's energy (ΔG) and melting temperature (Tm) of each sequence was calculated by Mfold for predicted secondary structures. The G4 motifs, which may form G4 structures, were determined using QGRS Mapper (Options: Max length 24, Min G-group 2, Loop size 0–24). Sequences selected as aptamers against FokI are shown in bold. Name
Sequence (5–3′, 24-nt)
ΔG (kcal/mol)
Tm (°C)
G4 motif
F6#8 F6#11 F6#13 F6#14 F6#32 F6#39 F6#42 F6#49 F6#60 F6#63 F6#66 F6#67 F6#69 F6#70 F6#71 F6#83 F6#84 F6#94
GTTGCCCATGGAGTTGTTGTGGGG GAAAGAGGGCTCTGTGGGGCCGCT GAGACGGTCCCTACTGGGGTTATT GCCGGGGCTCGAGGGGCGGCGTGG GACGGGCGGCCCGGGCGATGGCAG GCCGAAGGGGAGTCGGTGGCTATC GGGATGGGGCCGGGGTTGGCGGTA GCTGGTGTGCATCAGCCGTGGTGT CGCGGTGATGGGAGCTGCGGTAGG GAGGGCGGCCTAAGTTGGTTGACC GGGGGGTCCGAAGGTAGTGTTCGG GTGCCGGCTGTCTTTGGCGCTGAG CCGCCGGAGGACGCGGTTTATGCG GGTCCGGCGCTCCTGGTTGTATGG GATCGGGCGGGGGGTGGTCGGTCT GCAGGTGGTCCGAGTGCTTTACGG GGGCGCTCTGGGAGGGCTGATGTT GCGGGCCGCGGTGGAGTGGCACTG
−2.9 −3.5 −2.67 −3.35 −5.17 −3.15 −2.41 −2.68 −2.6 −2.15 −3.49 −2.66 −4.68 −0.99 −1.72 −4.96 −4.03 −3.93
50.3 55.7 53.8 54.7 55.6 51.4 50.1 50.5 48.4 42.1 53.5 49.9 58.8 36.8 48 73.5 55.2 56.4
– – – + + + + – + – + – – + + – – +
3
Biosensors and Bioelectronics xx (xxxx) xxxx–xxxx
M. Nishio et al.
Fig. 2. Evaluation of binding affinity of the aptamers, by aptamer-antibody sandwich assay. ΔALP chemiluminescence is the difference of the signal in the presence of FokI from that in the absence of FokI.
showed higher signals compared to other aptamers. This suggests that these 3 aptamers bound to FokI with high affinity. These aptamers were predicted to form different structures based on their sequences, with F6#8 forming a stem-loop structure and F6#66 and #71 forming a G4 structure. Therefore, these aptamers recognize and bind to different regions of FokI. Additionally, the potassium ion concentration may affect the binding ability of F6#66 and #71, which can form G4. Even if oligonucleotides have the same sequence, the topology of G4 may change in the presence of potassium ion (Ambrus et al., 2006), which may affect their binding ability.
Fig. 1. Binding ability and specificity of aptamer candidates against FokI by aptamer blotting. polyT was used as a negative control to show that the oligonucleotides did not form secondary structures. (a) Binding ability of aptamer candidates. Dot intensity of FokI immobilized region on the nitrocellulose membrane was calculated using ImageJ (N=3). (b) Binding specificity of aptamer candidates. (ZF-mEm: mEmerald fused ZF protein, ZFN: zinc-finger nuclease for CCR5 gene).
3.2. Nuclease resistance of aptamers against FokI and their binding ability Since FokI shows non-specific DNA cleavage activity, aptamers may be cleaved by FokI itself. However, aptamer cleavage by FokI can be prevented for effective delivery of SSNs into cells, using a combination of the aptamer and nanoneedles. Therefore, we performed NativePAGE and evaluated the nuclease resistance of DNA aptamers. As a result, both in the presence and absence of FokI, each DNA aptamer showed the same bands (Supplementary Fig. 1). Therefore, the aptamers were likely not cleaved by FokI itself because the aptamers bind to different regions of the FokI catalytic site or some form G4 without a dsDNA region. In F6#66, two bands of different sizes were observed, indicating that F6#66 can form either dimers or multimers. Therefore, the increase in the binding signal of F6#66 may have been caused by the formation of a multimer, not by high-affinity binding to FokI. Based on these results, we selected two DNA aptamers, F6#8 and #71, against FokI, showing high affinity, which were folded into monomers. We evaluated their binding ability by ELONA and found that the dissociation constants of F6#8 and #71 were 82 nM and 74 nM, respectively (Supplementary Fig. 2). To apply these aptamers to the SSN delivery system by nanoneedles, it is necessary that these aptamers bind to FokI when nanoneedles are inserted into the cells. Previously, we reported a ZF protein delivery system, using aptamerfused ds oligonucleotides and a nanoneedle (Matsumoto et al., 2016). In that study, ZF protein showed nanomolar-order dissociation constant to the target dsDNA. Therefore, F6#8 and #71 showed sufficient ability to bind FokI to deliver SSNs into the cells by nanoneedles. Based on these results, we obtained aptamers against FokI with sufficient binding ability to immobilize FokI onto nanoneedles without being cleaved.
that did not contain the complementary strands to the primer regions to block intramolecular hybridization. After six rounds of SELEX, we sequenced the eluted DNA pool and obtained the 90 sequences. We selected 18 sequences as aptamer candidates because they were predicted to form stable secondary structures (Table 1) and performed an aptamer blotting assay. First, we evaluated the binding affinity of the obtained aptamer candidates (Fig. 1a). Based on the result, most of the aptamer candidates bound to FokI and F6#8, #66, and #71 bound to FokI with high affinity. Since FokI has a positive charge, enabling it to bind and cleave dsDNA, oligonucleotides with a negative charge may nonspecifically bind to FokI. Next, we evaluated binding specificity in an aptamer blotting assay. In this assay, we used two different proteins including FokI (FokI, ZFN), and two that did not include FokI (zinc-finger fused GFP variants (ZF-mEm), thrombin). A comparison of the dot intensities of 24 mer poly-thymine nucleotides (polyT) showed that some aptamer candidates such as F6#11, #14, #60, #63, and #71 had low affinity to other proteins, particularly ZF-mEm, which has a DNA binding domain, not including FokI (Fig. 1b). To apply to the DNA aptamers against FokI, these aptamers should bind to FokI with high affinity. Because the SSNs used in genome editing applications such as in delivery systems are typically purified, the specificity of the obtained aptamers is less important. Therefore, compared to polyT, we selected 7 sequences showing stronger spots in dot blotting or less binding to other proteins, as the aptamer against FokI. Next, we evaluated binding in an aptamer-antibody sandwich assay. In this assay, the biotinylated aptamers were immobilized to the streptavidin-modified plate and then FokI was added to the plate. Next, anti-Histag antibody was added as the primary antibody, and ALP-conjugated anti-mouse IgG was added as the secondary antibody. Finally, chemiluminescence intensity was determined. As the result, the highest signal was observed in F6#71 (Fig. 2). F6#8 and #66
3.3. Effect of F6#8 and #71 on FokI nuclease activity To apply these aptamers for genome editing, the aptamers should not inhibit FokI nuclease activity. Therefore, we performed a cleavage activity assay in the presence of the obtained aptamers. In this assay, 4
Biosensors and Bioelectronics xx (xxxx) xxxx–xxxx
M. Nishio et al.
293 (HEK293) cells. Immediately after insertion, the fluorescence intensities of nanoneedles which modified ZFN-GFP via aptamers were higher than that of modified via polyT (Fig. 4b). It was suggested that these aptamers bound to FokI with higher affinity comparing with polyT. In the presence of HEK293, the fluorescence intensity of the nanoneedle region, which contained immobilized F6#8 and #71, was decreased after 30 min of insertion. When immobilizing ZFN-GFP via polyT, the fluorescence intensity was not much decreased. Thus, we considered that these aptamers effectively released FokI in the presence of the cells. F6#8 is predicted to form a stem loop structure, and F6#71 can form a G4 structure. It was reported that a stem loop structurewas destabilized and a G4 was stabilized under molecular crowding conditions (Miyoshi et al., 2006; Nakano et al., 2014). The G4 structure were changed and stabilized in the presence of potassium ion. We also performed this assay in fresh medium without cells and conditioned medium used for various cell types (4T1, CHO-K1 and HEK293) (Data not shown). We observed the release of ZFN-GFP through the aptamers and polyT in the conditioned medium of all the cell types evaluated, but not in fresh medium. Therefore, the release of ZFN-GFP in the presence of cells may have occurred because the conformation of the aptamers changed with the surrounding environment such as the concentration of potassium ion, or because compounds secreted from the cells inhibited oligonucleotide-FokI interactions such as electrostatic interactions. The controlled release of SSNs, using a combination of aptamers and nanoneedles, seems to be a promising approach for introducing SSNs into cells with fewer offtarget effects.
Fig. 3. ZFN cleavage activity assay in vitro in the presence of DNA aptamers against FokI. F6#8 and #71 bound to FokI with high affinity and #11 bind to FokI with lower affinity than the other aptamers or polyT. Cut% was calculated using ImageJ, given by 100x[1-(the band intensity of uncleaved band in each sample/the sum of bands intensity)]. NC: negative control and only substrate plasmid, PC: positive control, which included the substrate plasmid and ZFN, but not the aptamers.
we evaluated F6#8 and #71, which bind to FokI with high affinity; and F6#11, which binds to FokI with low affinity, as a negative control. We used ZFN targeted to CCR5 (Gaj et al., 2012). First, the aptamers were incubated with ZFN and the conformed aptamer-ZFN complex. Next, the substrate plasmid was added and reacted at 37 °C for 1 h. After the reaction, SDS (f.c. 1% (w/v)) was added to stop the reaction and the samples were electrophoresed. We observed two or three different bands in the presence of ZFN (Fig. 3). The lowest band appeared to be the uncleaved plasmid while the other bands may have been cleaved plasmid. The upper two bands may be the cleaved or nicked substrate plasmid. There were no differences in band intensity, indicating that ZFNs actively cleaved the plasmid. These results suggest that the aptamers did not inhibit the nuclease activity of FokI. There are two possible reasons why these aptamers did not inhibit ZFN activity by binding to FokI. First, the aptamers did not bind to the catalytic site of FokI, based on the results of Native-PAGE. Second, the aptamers did not change the FokI structure upon binding and do not prevent ZFN from a forming dimer at the target site. Thus, nanoneedles were used to deliver modified SSNs that retained their activity using the aptamers.
4. Conclusion In this study, we developed DNA aptamers against FokI, which is the common DNA cleavage domain of ZFN and TALEN. This is the first report of using DNA aptamers against FokI for genome editing. We obtained seven DNA aptamers against FokI via six rounds of SELEX. Aptamer blotting and aptamer-sandwich assays showed that the aptamers bound to FokI. Particularly, ELONA revealed that F6#8 and #71 bound to FokI with high affinity, with dissociation constants of 82 nM and 74 nM, respectively. The results showed that the aptamers were not cleaved by FokI and did not inhibit FokI activity after binding. Additionally, the aptamers released FokI from the nanoneedles in the presence of cells. This is because these aptamers may change their conformations according to the surrounding conditions, such as salt concentration, or secrete compounds by cells that inhibit the oligonu-
3.4. FokI delivery into HEK293 cells by nanoneedles We introduced ZFN into the cell, using a combination of the DNA aptamers (F6#8 and #71) or polyT and nanoneedles (Fig. 4a). In this assay, we modified ZFN-GFP to nanoneedles using F6#8, #71 or polyT and inserted the modified nanoneedles into human embryonic kidney
Insert ion time
0 min
30 min
F6#8
Insert into cells
F6#71
polyT
Fig. 4. ZFN delivery into the HEK293 cells, using a combination of DNA aptamers against FokI (F6#8 and #71) and nanoneedles. (a) Scheme of this delivery system. ZFN-GFP was immobilized to nanoneedles via the obtained aptamers. (b) Fluorescence images fused with ZFN-GFP modified nanoneedles and Ds-Red expressed in HEK293 cells. Green indicates the fluorescence of ZFN-GFP and red indicates the fluorescence of Ds-Red detected by confocal laser scanning microscopy.(For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.).
5
Biosensors and Bioelectronics xx (xxxx) xxxx–xxxx
M. Nishio et al.
peptide-mediated delivery of TALEN proteins via bioconjugation for genome engineering. PLoS One 9 (1), e85755. Lodish, H., Berk, A., Zipursky, S.L., Matsudaira, P., Baltimore, D., Darnell, J., 2000. Molecular Cell Biology fourth ed.. W.H. Freeman, New York. Matsumoto, D., Nishio, M., Kato, Y., Yoshida, W., Abe, K., Fukazawa, K., Ishihara, K., Iwata, F., Ikebukuro, K., Nakamura, C., 2016. ATP-mediated release of a DNAbinding protein from a silicon nanoneedle array. Electrochemistry 84 (5), 305–307. Matsumoto, D., Rao Sathuluri, R., Kato, Y., Silberberg, Y.R., Kawamura, R., Iwata, F., Kobayashi, T., Nakamura, C., 2015. Oscillating high-aspect-ratio monolithic silicon nanoneedle array enables efficient delivery of functional bio-macromolecules into living cells. Sci. Rep. 5, 15325. Miyoshi, D., Karimata, H., Sugimoto, N., 2006. Hydration regulates thermodynamics of G-quadruplex formation under molecular crowding conditions. J. Am. Chem. Soc. 128 (24), 7957–7963. Nakano, S., Miyoshi, D., Sugimoto, N., 2014. Effects of molecular crowding on the structures, interactions, and functions of nucleic acids. Chem. Rev. 114 (5), 2733–2758. Obataya, I., Nakamura, C., Han, S., Nakamura, N., Miyake, J., 2005. Nanoscale operation of a living cell using an atomic force microscope with a nanoneedle. Nano Lett. 5 (1), 27–30. Perez, E.E., Wang, J., Miller, J.C., Jouvenot, Y., Kim, K.A., Liu, O., Wang, N., Lee, G., Bartsevich, V.V., Lee, Y.L., Guschin, D.Y., Rupniewski, I., Waite, A.J., Carpenito, C., Carroll, R.G., Orange, J.S., Urnov, F.D., Rebar, E.J., Ando, D., Gregory, P.D., Riley, J.L., Holmes, M.C., June, C.H., 2008. Establishment of HIV-1 resistance in CD4+ T cells by genome editing using zinc-finger nucleases. Nat. Biotechnol. 26 (7), 808–816. Studier, F.W., 2005. Protein production by auto-induction in high density shaking cultures. Protein Expr. Purif. 41 (1), 207–234. Tsai, S.Q., Wyvekens, N., Khayter, C., Foden, J.A., Thapar, V., Reyon, D., Goodwin, M.J., Aryee, M.J., Joung, J.K., 2014. Dimeric CRISPR RNA-guided FokI nucleases for highly specific genome editing. Nat. Biotechnol. 32 (6), 569–576. Tsukakoshi, K., Abe, K., Sode, K., Ikebukuro, K., 2012. Selection of DNA aptamers that recognize alpha-synuclein oligomers using a competitive screening method. Anal. Chem. 84 (13), 5542–5547. Tuerk, C., Gold, L., 1990. Systematic evolution of ligands by exponential enrichment: rna ligands to bacteriophage T4 DNA polymerase. Sci. (N.Y.) 249 (4968), 505–510. Wu, X., Kriz, A.J., Sharp, P.A., 2014. Target specificity of the CRISPR-Cas9 system. Quant. Biol. 2 (2), 59–70. Yoshida, W., Mochizuki, E., Takase, M., Hasegawa, H., Morita, Y., Yamazaki, H., Sode, K., Ikebukuro, K., 2009. Selection of DNA aptamers against insulin and construction of an aptameric enzyme subunit for insulin sensing. Biosens. Bioelectron. 24 (5), 1116–1120. Yoshida, W., Sode, K., Ikebukuro, K., 2006. Aptameric enzyme subunit for biosensing based on enzymatic activity measurement. Anal. Chem. 78 (10), 3296–3303. Yoshida, W., Sode, K., Ikebukuro, K., 2008. Label-free homogeneous detection of immunoglobulin E by an aptameric enzyme subunit. Biotechnol. Lett. 30 (3), 421–425. Zuker, M., 2003. Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res. 31 (13), 3406–3415.
cleotide-aptamer interactions. Using a combination of aptamers and nanoneedles, a system for controlled delivery of SSNs, which have a FokI DNA cleavage domain such as ZFN and TALEN, into cells may be a powerful tool for genome editing with fewer off-target effects. Acknowledgements This work was supported by a Grant-in-Aid for Scientific Research (A) (JP26249127) from the Japan Society for the Promotion of Science (JSPS, Japan). Appendix A. Supporting information Supplementary data associated with this article can be found in the online version at doi:10.1016/j.bios.2016.11.042. References Ambrus, A., Chen, D., Dai, J., Bialis, T., Jones, R.A., Yang, D., 2006. Human telomeric sequence forms a hybrid-type intramolecular G-quadruplex structure with mixed parallel/antiparallel strands in potassium solution. Nucleic Acids Res. 34 (9), 2723–2735. Carroll, D., 2011. Genome engineering with zinc-finger nucleases. Genetics 188 (4), 773–782. Century, T.J., Fenichel, I.R., Horowitz, S.B., 1970. The concentrations of water, sodium and potassium in the nucleus and cytoplasm of amphibian oocytes. J. Cell Sci. 7 (1), 5–13. Cox, D.B., Platt, R.J., Zhang, F., 2015. Therapeutic genome editing: prospects and challenges. Nat. Med. 21 (2), 121–131. Ellington, A.D., Szostak, J.W., 1990. In vitro selection of RNA molecules that bind specific ligands. Nature 346 (6287), 818–822. Gaj, T., Gersbach, C.A., Barbas, C.F., 3rd, 2013. ZFN, TALEN, and CRISPR/Cas-based methods for genome engineering. Trends Biotechnol. 31 (7), 397–405. Gaj, T., Guo, J., Kato, Y., Sirk, S.J., Barbas, C.F., 3rd, 2012. Targeted gene knockout by direct delivery of zinc-finger nuclease proteins. Nat. Methods 9 (8), 805–807. Guilinger, J.P., Thompson, D.B., Liu, D.R., 2014. Fusion of catalytically inactive Cas9 to FokI nuclease improves the specificity of genome modification. Nat. Biotechnol. 32 (6), 577–582. Kikin, O., D'Antonio, L., Bagga, P.S., 2006. QGRS mapper: a web-based server for predicting G-quadruplexes in nucleotide sequences. Nucleic Acids Res., W676–W682, 34(Web Server issue). Li, J., Correia, J.J., Wang, L., Trent, J.O., Chaires, J.B., 2005. Not so crystal clear: the structure of the human telomere G-quadruplex in solution differs from that present in a crystal. Nucleic Acids Res. 33 (14), 4649–4659. Liu, J., Gaj, T., Patterson, J.T., Sirk, S.J., Barbas, C.F., 3rd, 2014. Cell-penetrating
6