- Email: [email protected]
DNA-based characterisation and classification of forensically important flesh flies (Diptera: Sarcophagidae) in Malaysia
Forensic Science International 199 (2010) 43–49
Contents lists available at ScienceDirect
Forensic Science International journal homepage: www.elsevier.com/locate/forsciint
DNA-based characterisation and classification of forensically important flesh flies (Diptera: Sarcophagidae) in Malaysia Siew Hwa Tan a, Mohammed Rizman-Idid b, Edah Mohd-Aris c, Hiromu Kurahashi d, Zulqarnain Mohamed a,* a
Division of Genetics and Molecular Biology, Institute of Biological Sciences, Faculty of Science, University of Malaya, 50603, Kuala Lumpur, Malaysia Division of Bioinformatics, Institute of Biological Sciences, Faculty of Science, University of Malaya, 50603, Kuala Lumpur, Malaysia Division of Biohealth, Institute of Biological Sciences, Faculty of Science, University of Malaya, 50603, Kuala Lumpur, Malaysia d Department of Medical Entomology, National Institute of Infectious Diseases, Toyama 1-23-1, Shijuku-ku, Tokyo, 162-8640, Japan b c
A R T I C L E I N F O
A B S T R A C T
Article history: Received 1 April 2009 Received in revised form 22 December 2009 Accepted 24 February 2010 Available online 13 April 2010
Insect larvae and adult insects found on human corpses provide important clues for the estimation of the postmortem interval (PMI). Among all necrophagous insects, flesh flies (Diptera: Sarcophagidae) are considered as carrion flies of forensic importance. DNA variations of 17 Malaysian, two Indonesian and one Japanese flesh fly species are analysed using the mitochondrial COI and COII. These two DNA regions were useful for identifying most species experimented. However, characterisation of the species was not sufficiently made in the case of Sarcophaga javanica. Seventeen Malaysian species of forensic importance were successfully clustered into distinct clades and grouped into the six species groups: peregrina, albiceps, dux, pattoni, princeps and ruficornis. These groups correspond with generic or subgeneric taxa of the subfamily Sarcophaginae: Boettcherisca, Parasarcophaga, Liosarcophaga, Sarcorohdendorfia-Lioproctia, Harpagophalla-Seniorwhitea and Liopygia. The genetic variations found in COI and COII can be applied not only to identify the species of forensic importance, but also to understand the taxonomic positions, generic or subgeneric status, of the sarcophagine species. ß 2010 Elsevier Ireland Ltd. All rights reserved.
Keywords: Sarcophagidae Cytochrome oxidase DNA-based identification Flesh flies Malaysia Forensic entomology
1. Introduction A quick and accurate identification system is desirable in any forensic studies as well as ecology. In recent years, there has been an increase in the use of DNA sequence data in the studies of carrion flies as an aid to accurately identify insect species, even in the cases of immature stages [1–3]. Molecular techniques have the advantage of being applicable to any life stages and have the potential to distinguish morphologically similar species or even genera, such as in the case of sarcophagine flesh flies [4]. DNAbased identification techniques are also easily transferable between laboratories and are not limited to the requirements of specific taxonomical expertise. In Malaysia, the occurrence of carrion-related arthopods has hitherto been known to include dipteran flies such as Sarcophagidae, Calliphoridae, Muscidae and Stratiomyidae [5–7]. Reviews of Malaysian forensic studies showed that calliphorid flies, such as
* Corresponding author at: Division of Genetics and Molecular Biology, Institute of Biological Sciences, Faculty of Science, University of Malaya, 50603, Kuala Lumpur, Malaysia. Tel.: +603 7967 5890; fax: +603 7967 5908. E-mail addresses: [email protected], [email protected] (Z. Mohamed). 0379-0738/$ – see front matter ß 2010 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.forsciint.2010.02.034
Chrysomya megacephala (Fabricius) and Achoetandrus rufifacies (Macquart), were observed as the predominant species found in human cadavers, especially in the early stages of decomposition [8–10]. Although sarcophagine flesh flies are also important as forensic indicators, their identification was mostly carried out only to the genus level [9,10]. Sarcophagine flies are notoriously difficult to identify due to their highly similar morphological appearance [11–13]. These authors suggested and demonstrated that mitochondrial DNA sequences could be successfully employed to distinguish some species of the sarcophagine flesh flies. Despite the availability of mitochondrial DNA sequencing techniques, a robust taxonomic classification of these flies is still required. Such methods of species identification would be truly useful if more comprehensive baseline data could be established. Therefore, this study analysed the mitochondrial cytochrome oxidase gene subunits I and II (COI and COII) sequences of many oriental flesh fly species from Malaysia, Indonesia and Japan that has not been well represented in the previous studies [4,11,13]. The sequence data obtained would be useful as standards for future analyses and the practical identification of species in forensics. Phylogenies estimated from these DNA sequences also provide implications towards the understanding of the taxonomy and systematics of the sarcophagine flesh flies.
44
S.H. Tan et al. / Forensic Science International 199 (2010) 43–49
2. Materials and methods 2.1. Specimens Sarcophagine flesh flies were caught using chicken liver or meat as bait. The specimens were killed using ethyl acetate, pinned and kept under dry conditions with silica gel until DNA extraction was performed. The remaining portions of the vouchers were then stored at 20 8C for further reference. Adult males were identified based on the morphological characteristics of the male genitalia using the identification keys from the fourth author, H. Kurahashi. However, the taxonomical names and systematics of the flies were assigned according to the Catalogue of the Sarcophagidae of the World (Insecta: Diptera) [14]. The morpho-species of female specimens were more difficult to determine due to fewer distinguishing features of the genitalia compared to the male. Nevertheless, some of the female flies were successfully identified (by unambiguous identification of their male offspring reared in the laboratory) and included in the present study. A total of 38 fly specimens were analysed, representing 20 species which included 17 species of Sarcophaga sensu lato and three species of Calliphoridae as outgroups (Table 1). Of the Sarcophaga s. lat. species, three were non-Malaysia species: Sarcophaga dumonga (Indonesia), S. aureolata (Indonesia) and S. crassipalpis (Japan) were collected by the fourth author (HK) and included for comparison. 2.2. DNA extraction Two right legs from each adult fly specimen were used for DNA extraction using the QIAamp1 DNA Mini Tissue Kit (Qiagen, Germany) according to the manufacturer’s protocols. Briefly, legs were ground into powder using sterile plastic micro-pestles in 1.5-ml microfuge tubes immersed in liquid nitrogen. The samples were homogenised in buffer (supplied with the kit) and incubated overnight with proteinase K. Incubation with RNaseA was performed the following day prior to cell lysis and DNA extraction. At the end of the extraction process, the DNA was eluted twice in 200 ml of elution buffer. The tube was left to stand for 5 min at room temperature before the second eluate was collected by centrifugation. The remaining portions of voucher specimens were kept in the Division of Genetics and Molecular Biology, University of Malaya, for future reference. 2.3. PCR amplification and sequencing The amplified mtDNA region spans a total of 2.3 kb, and includes the cytochrome oxidase I and II genes (COI and COII) and the tRNA leucine gene. Polymerase chain reaction (PCR) reaction mixtures were prepared in 50-ml reactions containing 100 ng template DNA, 1 unit of Taq polymerase, 1 PCR reaction buffer, 2 mM MgCl2 (BioTools, Spain), 200 mM of each dNTP (Fermentas, USA) and 2 mM of each forward and reverse primers (amplification of COI gene using primers TY-J-1460: 50 TACAATTTATCGCCTAAACTTCAGCC and C1-N-2800: 50 -CATTTCAAGCTGTGTAAGCATC, whereas COII gene using primers C1-J-2495: 50 -CAGCTACTTTATGAGCTTTAGG and TK-N-3775: 50 -GAGACCATTACTTGCTTTCAGTCATCT) [15]. PCR was performed in an MJ Research PTC-200 thermal cycler (MJ Research, USA), and the thermal cycling programme consisted of an initial denaturation step of 94 8C of 5 min, followed by 35 cycles of denaturation at 94 8C for 1 min, an annealing step for 1 min 30 s and an extension step at 72 8C for 2 min. The annealing temperatures were optimised for primer pairs TY-J-1460/C1-N-2800 and C1-J-2495/TK-N-3775 at 46 8C and 58 8C, respectively, rather than the recommended annealing temperature of 45 8C and 47 8C [16]. The final elongation step was 72 8C for 5 min. The PCR products were then purified using the QIAquick1 PCR Purification Kit (Qiagen, Germany) following the manufacturer’s protocol. QIAquick1 Gel Extraction Kit (Qiagen, Germany) was also used when the PCR products showed traces of non-specific amplification fragments. For this purpose, the desired PCR fragments were excised from the gel using a sterile scalpel and the purification steps were carried out essentially as described in the manufacturer’s protocol. Sequencing was performed using the ABI PrismTM BigDyeTM Terminator Cycle Sequencing Ready Reaction Kit version 3.1 (Applied Biosystems, Foster City, CA, USA) according to the manufacturer’s recommendations. All the samples were sequenced for both forward and reverse DNA strands. Electrophoresis and detection of the sequencing reaction products were carried out in the capillary electrophoresis system ABI PRISM 3730l capillary DNA Sequencer with a capillary length of 80 cm. 2.4. Data and phylogenetic analysis DNA sequence reads were edited manually using the Chromas software (v2.32) to remove the sequences of primers and to eliminate discrepancies between contig sequences. Sequences were aligned using Clustal W [17]. Sequences of COI and COII were analysed separately, and combined to increase the phylogenetic signal. Analysis of DNA sequence variation, nucleotide composition and genetic distance was performed using Molecular Evolutionary Genetics Analysis (MEGA) version 4.0 [18]. Prior to phylogenetic analysis, sequence alignment was tested for the best-fit evolutionary model using Modeltest 3.8 [19]. Neighbour-joining (NJ) and maximum parsimony (MP) phylogenetic trees were constructed using PAUP* 4.0b10 [20]. For both analyses, 10,000 replicates were bootstrapped. Full heuristic search was performed with 10 random sequence additions and tree bisection–reconnection
(TBR) branch swapping. A Bayesian inference analysis was performed using MrBayes 3.1.2 [21]. Four Markov chains (three heated chains and one cold chain) were run for three million generations and the trees were sampled every 100th generation. All trees were rooted with the Calliphoridae species, whereas only branches with over 70% bootstraps were considered for phylogenetic inference [22].
3. Results 3.1. DNA sequence variation A total of 38 carrion fly sequences ranging from 2292 to 2294 bp in length were successfully generated and deposited into GenBank (Table 1). The final sequence alignment obtained was 2294 bp, which encompassed the complete sequences of COI, tRNA-leucine and COII genes The alignment revealed the inclusion of 2-bp indels within the spacer region between the tRNA-leucine and COII gene. The sequence alignment consists of 689 variable sites, whereby 602 sites were considered parsimony informative. All the taxa showed an even distribution of nucleotide variation across the COI and COII genes, with almost no variation at the tRNA-leucine gene, except for two substitutions and a single one for S. inextricata and S. crassipalpis, respectively. As expected, this region of mtDNA was observed to have a strong AT bias (69.9%), which is characteristic of insect mitochondrial DNA [23] where the nucleotide compositions were T (37.9%), C (15.9%), A (32.0%) and G (14.2%). 3.2. Models of evolution The combined dataset resulted in the best likelihood score for the general time reversible (GTR) model with invariable sites and rate heterogeneity. Base frequencies were unequal; A = 0.3139, C = 0.1356, G = 0.1451, T = 0.4055; and the estimated proportion of invariable sites (I) were 0.6241. The substitution model incorporated the following rate matrix: [A–C] = 6.6007, [A–G] = 37.1439, [A–T] = 17.8570, [C–G] = 1.1399, [C–T] = 142.7236, [G–T] = 1.0000. The shape parameter of the gamma distribution was a = 1.8312. This model was used to determine the number of substitution types and the inclusion of the gamma rate distribution and proportion of invariable sites in the Bayesian analyses. 3.3. Phylogenetic analysis Almost similar tree topologies were recovered from the NJ and MP analyses (Fig. 1). The phylogeny of sarcophagine flies was separated into six genetic clades (A–F) that were supported by high bootstrap values. Clade A, which could be considered as the peregrina-group, is comprised of Sarcophaga javanica, S. krathonmai, S. peregrina and S. dumoga. Clade B also consists of several species: S. albiceps, S. misera and S. taenionota that loosely defined the albiceps-group. Clade C is known as the duxgroup as it contains S. dux and also S. brevicornis. Clade D, the pattoni-group, comprised S. inextricata, S. aureolata, S. saprianovae and S. pattoni. Species S. kempi and S. princeps were united under clade E as the princeps-group, whereas S. ruficornis and S. crassipalpis formed the ruficornis-group, also known as clade F. Although the phylogenetic affinities of these species were determined, only clades A and B were resolved as sister groups. The branching order among clades D, E and F were unresolved in both NJ and MP analyses. The Bayesian analysis, which incorporated the evolutionary model GTR+I+G, recovered a fully resolved phylogenetic tree (Fig. 2), with over 80% bootstrap values at the deeper branches of the tree. Clade F was identified as the most basal group within sarcophagines, followed by clade E. Sister groups of clades A and B were inferred as most recent among the diverged sarcophagine groups.
S.H. Tan et al. / Forensic Science International 199 (2010) 43–49
45
Table 1 Collection locality and reference data for specimens used in this study. Asterisk (*) indicates female flies. Species 1.
Sarcophaga (s. lat.) javanica variant A
Sarcophaga (s. lat.) javanica variant B
2.
3.
Sarcophaga (s. lat.) peregrina
Sarcophaga (s. lat.) krathonmai
Voucher number
Collection site
S26
Kuala Lumpur (UM)
S40
Kuala Lumpur (UM)
S32
Kuala Lumpur (UM)
S125
Pahang (KJB)
S-CH2
Cameron Highlands, Pahang
S-CH9*
Cameron Highlands, Pahang
BN
Sarawak
S-SWK-288
Sarawak
4.
Sarcophaga (s. lat.) dumoga
BD
Indonesia
5.
Sarcophaga (s. lat.) misera
S9*
Kuala Lumpur (UM)
S107
Pahang (KJB)
PA1
Sarawak
S152
Kuala Lumpur
S103
Pahang (KJB)
S127
Kuala Lumpur
S-CH14
Cameron Highlands, Pahang
S23*
Kuala Lumpur (UM)
S69
Selangor (KS)
S132
Terengganu
SY9
Kelantan
S37
Kuala Lumpur (UM)
S131*
Terengganu
LS
Sarawak
LS2
Sarawak
6.
7.
8.
9.
10.
11.
Sarcophaga (s. lat.) albiceps
Sarcophaga (s. lat.) taenionota
Sarcophaga (s. lat.) brevicornis
Sarcophaga (s. lat.) dux
Sarcophaga (s. lat.) inextricata
Sarcophaga (s. lat.) saprianovae
GPS reference 0
00
387 50.59 N 1018390 22.4400 E 38 70 50.5900 N 1018390 22.4400 E 38 70 50.5900 N 1018390 22.4400 E 38200 31.5500 N 1018530 0.7100 E
GenBank accession number EF405925 EF405926 EF405922 EF405923
48300 49.8900 N 1018250 23.1700 E 48300 49.8900 N 1018250 23.1700 E
EF405927
18320 47.8800 N 1108200 49.4600 E 18320 47.8800 N 1108200 49.4600 E Information not available
EF405924
38 70 50.5900 N 1018390 22.4400 E 38200 31.5500 N 1018530 0.7100 E
EF405928
GU174023 EF405950 EF405930 EF405929
18320 47.8800 N 1108200 49.4600 E 38 70 50.5900 N 1018390 22.4400 E
EF405931
38200 31.5500 N 1018530 0.7100 E 38 70 50.5900 N 1018390 22.4400 E
EF405933
48300 49.8900 N 1018250 23.1700 E 38 70 50.5900 N 1018390 22.4400 E
EF405935
38200 33.0300 N 1018140 48.4800 E 58120 19.3800 N 1038120 5.7500 E 58580 20.6500 N 1028140 43.9600 E
EF405937
38 70 50.5900 N 1018390 22.4400 E 58120 19.3800 N 1038120 5.7500 E 18320 47.8800 N 1108200 49.4600 E 18320 47.8800 N 1108200 49.4600 E
EF405932
EF405934
EF405936
EF405938 EF405939
EF405942 EF405943
EF405944 EF405945
12.
Sarcophaga (s. lat.) aureolata
LA
Indonesia
Information not available
EF405951
13.
Sarcophaga (s. lat.) pattoni
S494
Kuala Lumpur (UM)
38 70 50.5900 N 1018390 22.4400 E
FJ479724
14.
Sarcophaga (s. lat.) crassipalpis
15.
16.
17.
Sarcophaga (s. lat.) ruficornis
Sarcophaga (s. lat.) kempi
Sarcophaga (s. lat.) princeps
LP-Gom
Selangor (Gom)
J69
Japan
S21*
Kuala Lumpur (UM)
SY5
Kelantan
S102*
Pahang (KJB)
S134*
Kuala Lumpur (UM)
S274
Kuala Lumpur (UM)
S25*
Kuala Lumpur (UM)
S71
Kuala Lumpur (UM)
FJ479723 Information not available 0
00
38 7 50.59 N 1018390 22.4400 E 58580 20.6500 N 1028140 43.9600 E
GU174024 EF405940 EF405941
38200 31.5500 N 1018530 0.7100 E 38 70 50.5900 N 1018390 22.4400 E 38 70 50.5900 N 1018390 22.4400 E
EF405946
38 70 50.5900 N 1018390 22.4400 E 38 70 50.5900 N 1018390 22.4400 E
EF405948
EF405947 GU174025
EF405949
S.H. Tan et al. / Forensic Science International 199 (2010) 43–49
46 Table 1 (Continued ) Species
Voucher number
Collection site
GPS reference 0
00
GenBank accession number
18.
Chrysomya megacephala
CM3
Kuala Lumpur
38 7 50.59 N 1018390 22.4400 E
AY909052
19.
Achoetandrus rufifacies
CR5
Kuala Lumpur
38 70 50.5900 N 1018390 22.4400 E
AY909055
20.
Ceylonomyia nigripes
CN-UM-20-8
Kuala Lumpur
38 70 50.5900 N 1018390 22.4400 E
GU174026
All trees showed strongly supported monophyletic groupings for all species, with the exception of S. javanica, where S. javanica variant A is more closely related to S. peregrina rather than S. javanica variant B. Most clades showed less than 4.1% sequence divergence, except for clade D with 6.7% sequence divergence accounted by
the deep branches of S. inextricata, S. saprianovae and S. pattoni. Comparisons between clades revealed 6.9–10.7% sequence variation, which is almost twice higher than the within-clade variation. Table 2 shows that most of the intra-specific variation is less than 1.00% with a maximum of 1.35%, whereas the minimum inter-specific variation is 1.94%. This may allow for
Fig. 1. Neighbour-joining phylogram with branch length constructed by PAUP* using model GTR+I+G based on 2294 bp of COI+COII sequences. Percentages of the 10,000 bootstrap replicates from neighbour-joining and maximum parsimony analyses are indicated respectively at the branch. Asterisks denote that both values are the same. Six major clades were identified as (A) peregrina-group; (B) albiceps-group; (C) dux-group; (D) pattoni-group; (E) princeps-group; (F) ruficornis-group.
S.H. Tan et al. / Forensic Science International 199 (2010) 43–49
47
Fig. 2. Bayesian consensus tree after burn-in 25% for three million generations. Posterior probabilities are shown at each node. Six major clades were identified as (A) peregrina-group; (B) albiceps-group; (C) dux-group; (D) pattoni-group; (E) princeps-group; (F) ruficornis-group.
easy designation of flies to respective clades or even the delineation of species. 4. Discussion The present study is the first to report a more comprehensive phylogeny of sarcophagine species estimated from complete sequences of COI and COII genes.
With specimens covering 17 oriental sarcophagine species, some include both sexes, the phylogeny appears to be robust for Malaysian forensic application. DNA-based identification of S. javanica, S. krathonmai, S. dumoga, S. inextricata, S. aureolata, S. saprianovae, S. kempi and S. princeps was also reported for the first time. The current application of DNA sequencing has made allowances for the revival of taxonomic studies of these flies, many of which are taxonomically ambiguous with incomplete species checklist.
S.H. Tan et al. / Forensic Science International 199 (2010) 43–49
48
Table 2 Percentage of intraspecific variation for species that are represented by more than one individual. Species Sarcophaga Sarcophaga Sarcophaga Sarcophaga Sarcophaga Sarcophaga Sarcophaga Sarcophaga Sarcophaga Sarcophaga Sarcophaga Sarcophaga Sarcophaga Sarcophaga Sarcophaga a b
javanica variant A javanica variant B peregrina krathonmai misera albiceps taenionota brevicornis dux inextricata saprianovae pattoni kempi princeps ruficornis
Number of specimena
Intraspecific variation (%)
Number of variation/totalb
2 2 2 2 2 2 2 2 3 2 2 2 3 2 2
0.22 1.35 0.92 1.09 0.22 0.61 0.31 0.13 0.83 0.09 0.65 0.39 0.74 0.39 0.57
5/2292 31/2292 21/2292 25/2292 5/2293 14/2293 7/2293 3/2293 19/2294 2/2293 15/2292 9/2292 17/2294 9/2294 13/2294
Number of specimen more than 2, the maximum number of variation is taken. Total number varies due to indels between tRNA-leucine and COII genes.
Investigations on the oriental sarcophagine flesh flies were first made by Lopes et al. [24], during which they recorded 21 species from Malaysia. Sugiyama et al. [25] listed 22 species from Malaya (Malaysia), North Borneo and Singapore. More recently, Kurahashi and Leh recorded 19 species, including one new species from Sarawak, East Malaysia [26], 14 of which were analysed in the present study. In contrast to the very well-documented calliphorid flies, the Sarcophagidae is poorly studied due to challenges in its identification [1,2,16]. To date, not many published DNA-based sarcophagid studies are available for reference and, if any, are reports from non-tropical regions such as United States, Czech Republic, Japan and China [4,11,13,27]. Almost all of these studies used partial sequences of COI or short ITS2 regions [4,11,13,27]. By incorporating more species, complete COI, tRNA-leucine and COII sequences and powerful Bayesian analysis, the present phylogenetic tree appears to be resolved at the species level and the deeper divergence among major clades. The six genetic clades (A–F) in the phylogenetic trees suggest that the taxonomic application of a single genus Sarcophaga sensu
lato for the subfamily Sarcophaginae may require revision. For example, species in clade A, which was loosely defined as the peregrina-group, corresponds well to genus Boettcherisca that have been traditionally proposed by the authorities such as Lopes [28,29], Lopes et al. [24], Verves [30], Shewell [31] and Rohdendorf [32,33]. Likewise, all the other clades (B–F) show similar compliance to such genus classification; clade B as Parasarcophaga; clade C as Liosarcophaga; clade D consists of two genera: Sarcorohdendorfia and Lioproctia, clade E also consists of two genera: Harpagophalla and Seniorwhitea; and clade F comprises of genus Liopygia. Our findings therefore provided stronger support for the traditional classification as opposed to the classification rationale of Pape, who treated all these taxa as subgenera of the genus Sarcophaga s. lat. in his Catalogue of the Sarcophagidae of the World [14]. Molecular analysis perhaps will provide the information to solve the taxonomic problem in the generic and subgeneric grouping of sarcophagine species. Sequence data of complete COI and COII genes have the potential to identify species and place them into the respective clades. The availability of such DNA database will facilitate forensic cases by allowing immature stages to be identified [34]. The database also assists in the species assignment of the female flies that are morphologically more difficult to identify. The application of DNA sequences to accurately delineate species depends especially on the extent of, and separation between, intra-specific variation and inter-specific divergence in the chosen genetic marker. This study demonstrated no overlapping values between the intra-specific and inter-specific variation, whereby the maximum intra-specific variation is less than the minimum inter-specific variation. As shown in clade A, the maximum intra-specific variation and the minimum inter-specific variation were 1.35% and 1.94%, respectively, and this enabled unambiguous species identification even for those that have only recently diverged (Tables 2 and 3). Among the identified species, S. javanica appears to be polyphyletic as S. javanica variant A was related to S. peregrina, whereas S. javanica variant B was closer to S. krathonmai. This distinction is not due to geographical isolation because both variants were collected in the same collection site in Kuala Lumpur (Table 1). This polyphyly may be accounted by convergent evolution, ancestral polymorphism, incomplete lineage sorting
Table 3 Pairwise divergence between species (%) for 2294-bp.
[1] [2] [3] [4] [5] [6] [7] [8] [9] [10] [11] [12] [13] [14] [15] [16] [17] [18] [19] [20] [21]
[1]
[2]
[3]
[4]
[5]
[6]
[7]
[8]
[9]
[10]
[11]
[12]
[13]
[14]
[15]
[16]
[17]
[18]
[19]
[20]
6.77 4.98 14.00 13.28 13.79 13.93 13.78 13.36 12.81 12.89 11.75 12.47 13.46 14.40 14.46 13.79 13.23 12.88 12.08 12.31
7.53 13.66 13.43 13.04 13.33 13.06 11.89 11.76 11.65 11.34 11.33 14.01 13.65 13.35 12.85 12.79 12.11 11.94 12.16
14.98 14.18 14.48 14.56 14.27 12.84 12.62 12.58 12.13 12.25 13.76 14.37 14.25 13.89 13.50 12.42 12.17 12.67
1.94 2.90 2.88 6.77 8.49 8.76 8.26 8.92 8.24 10.72 10.97 11.34 11.25 11.02 10.55 9.63 10.33
2.95 2.85 6.82 7.96 7.92 7.58 8.21 7.98 10.62 10.63 10.95 11.12 10.49 10.15 8.88 10.15
2.28 6.76 7.51 8.15 7.82 7.96 7.88 10.02 10.57 10.92 10.56 10.70 10.44 9.34 10.01
6.46 7.43 8.04 7.72 8.40 8.12 10.28 10.53 11.12 10.89 10.59 10.12 9.27 10.17
8.83 8.92 8.12 8.70 7.74 10.69 11.14 11.51 11.21 11.61 9.99 9.91 10.59
5.11 5.07 7.51 6.98 10.32 9.87 10.56 10.74 10.39 9.68 8.33 8.55
4.24 6.86 6.89 9.67 10.02 10.73 10.60 10.50 9.20 7.90 7.92
6.90 6.44 10.04 10.05 9.74 9.84 10.03 8.77 7.70 8.25
5.53 8.68 9.65 8.96 8.74 9.68 8.36 7.82 7.63
8.71 9.33 9.49 9.45 9.31 8.07 7.91 7.92
9.83 10.09 9.63 10.18 10.53 10.33 10.06
6.41 6.36 10.81 10.46 9.78 10.09
1.75 10.67 10.37 9.23 9.75
10.49 9.96 9.27 9.45
6.42 9.44 9.94
8.34 8.45
4.24
[1] Chyrsomya megacephala, [2] Achoetandrus rufifacies, [3] Ceylonomyia nigripes; [4–20] are species from Sarcophaga (s.l.): [4] javanica variant A, [5] peregrina, [6] krathonmai, [7] javanica variant B, [8] dumoga, [9] misera, [10] albiceps, [11] taenionota, [12] brevicornis, [13] dux, [14] inextricata, [15] saprianovae, [16] aureolata, [17] pattoni, [18] kempi, [19] princeps, [20] ruficornis, and [21] crassipalpis.
S.H. Tan et al. / Forensic Science International 199 (2010) 43–49
or even introgressive hybridisation [3,35]. Perhaps the variants could be an example of cryptic species because they are very similar in external morphology. In order to investigate the polyphyletic status of S. javanica, more specimens of these forms are needed, which include field colonies from different localities across wider geographical and ecological ranges. 5. Conclusion The available DNA sequence of sarcophagine flies encompassing the complete COI, tRNA-leucine and COII genes allows for the identification of these species, particularly useful for local forensic purposes. The phylogeny provides insight about the evolutionary relationships of these species, which could be assigned into any of the six clades. The molecular phylogeny is generally congruent with most morphologically based classification systems. Suggestion of taxonomic revision may be premature, as the current phylogeny can benefit from the sampling of more taxa. Acknowledgements This study was supported by the short-term research grants F0163/2004A, F0181/2005C, PS085/2007B, FS294/2008A from University of Malaya, Malaysia and the National e-Science Fund number 02-01-03-SF0092 received from the Ministry of Science, Technology and Innovation, Malaysia. The first author (S.H. Tan) is indebted to the Ministry of Science, Technology and Innovation, Malaysia, for her PhD. National Science Fellowship and short-term research attachment programme to Japan. She wishes to express her sincere thanks to Drs. M. Kobayashi, Y. Tsuda and T. Hayashi from the Department of Medical Entomology, National Institute of Infectious Diseases, Tokyo, Japan, for their assistance during her stay. She also would like to thank Dr. Ng Ching Ching for her kind assistance. References [1] J.F. Wallman, S.C. Donnellan, The utility of mitochondrial DNA sequences for the identification of forensically important blowflies (Diptera: Calliphoridae) in southeastern Australia, Forens. Sci. Int. 120 (2001) 60–67. [2] J.D. Wells, F.A.H. Sperling, DNA-based identification of forensically important Chrysomyinae (Diptera: Calliphoridae), Forens. Sci. Int. 120 (2001) 110–115. [3] J.D. Wells, D.W. Williams, Validation of a DNA-based method for identifying Chrysomyinae (Diptera: Calliphoridae) used in a death investigation, Int. J. Legal Med. 121 (2005) 1–8. [4] R. Zehner, J. Amendt, S. Schu¨tt, J. Sauer, R. Krettek, D. Povolny´, Genetic identification of forensically important flesh flies (Diptera: Sarcophagidae), Int. J. Legal Med. 118 (2004) 245–247. [5] H.L. Lee, T. Marzuki, Preliminary observation of arthropods on carrion and its application to forensic entomology in Malaysia, Trop. Biomed. 10 (1993) 5–8. [6] B. Omar, M.A. Marwi, P. Oothuman, H.F. Othman, Observations on the behaviour of immatures and adults of some Malaysian sarcosaprophagous flies, Trop. Biomed. 11 (1994) 149–153. [7] B. Omar, M.A. Marwi, S. Sulaiman, P. Oothuman, Dipteran succession in monkey carrion at a rubber tree plantation in Malaysia, Trop. Biomed. 11 (1994) 77–82. [8] N.A. Hamid, B. Omar, M.A. Marwi, A.F. Mohd. Salleh, H. Mansar, S.F. Siew, N. Moktar, A review of forensic specimens sent to forensic entomology laboratory Universiti Kebangsaan Malaysia for the year 2001, Trop. Biomed. 21 (2003) 27–31. [9] H.L. Lee, M. Krishnasamy, A.G. Abdullah, J. Jeffery, Review of forensically important entomological specimens in the period of 1972–2002, Trop. Biomed. 21 (2004) 69–75.
49
[10] A.F. Mohd Salleh, M.A. Marwi, J. Jeffery, N.A. Abd Hamid, R.M. Zuha, B. Omar, Review of forensic entomology cases from Kuala Lumpur Hospital and Hospital Universiti Kebangsaan Malaysia, 2002, J. Trop. Med. Parasitol. 30 (2007) 51–54. [11] J.D. Wells, T. Pape, F.A.H. Sperling, DNA-based identification and molecular systematics of forensically important Sarcophagidae (Diptera), J. Forens. Sci. 46 (2001) 1098–1102. [12] J.H. Byrd, J.L. Castner, Insects of forensic importance, in: J.H. Byrd, J.L. Castner (Eds.), Forensic Entomology—The Utility of Arthropods in Legal Investigations, CRC Press, Boca Raton, 2001, pp. 43–80. [13] K. Saigusa, M. Takamiya, Y. Aoki, Species identification of the forensically important flies in Iwate prefecture, Japan based on mitochondrial cytochrome oxidase gene subunit I (COI) sequences, Legal Med. 7 (2005) 175–178. [14] T. Pape, Catalogue of the Sarcophagidae of the World (Insecta: Diptera), Associated Publishers, Florida, USA, 1996. [15] F.A.H. Sperling, G.S. Anderson, D.A. Hickey, A DNA-based approach to the identification of insect species used for post-mortem interval estimation, J. Forens. Sci. 39 (1994) 418–427. [16] H. Schroeder, H. Klotzbach, S. Elias, C. Augustin, K. Pueschel, Use of PCR-RFLP for differentiation of calliphorid larvae (Diptera, Calliphoridae) on human corpses, Forens. Sci. Int. 132 (2003) 76–81. [17] J. Thompson, D. Higgins, T. Gibson, CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positionspecific gap penalties and weight matrix choice, Nucleic Acids Res. 22 (1994) 4673–4680. [18] K. Tamura, J. Dudley, M. Nei, S. Kumar, MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0, Mol. Biol. Evol. 24 (2007) 1596–1599. [19] D. Posada, K.A. Crandall, Modeltest: testing the model of DNA substitution, Bioinformatics 14 (1998) 817–818. [20] D.L. Swofford, PAUP*, Phylogenetic analysis using parsimony (*and other methods), Version 4, Sinauer Associates, Sunderland, Massachusetts, 1998. [21] J.P. Huelsenbeck, F.R. Ronquist, MRBAYES: Bayesian inference of phylogeny, Biometrics 17 (2001) 754. [22] D.M. Hillis, J.J. Bull, An empirical test of bootstrapping as a method for assessing confidence in phyogenetic analysis, Syst. Biol. 42 (1993) 182–192. [23] R.H. Crozier, Y.C. Crozier, The mitochondrial genome of the honeybee Apis mellifera: complete sequence and genome organization, Genetics 133 (1993) 97–117. [24] H.S. Lopes, R. Kano, S. Shinonaga, H. Kurahashi, Family Sarcophagidae, in: M.D. Delfinado, D.L. Hardy (Eds.), A Catalogue of the Diptera of the Oriental Region, vol. 3, Univ. Press Hawaii, Honolulu, 1977, pp. 557–583. [25] E. Sugiyama, S. Shinonaga, R. Kano, Sarcophagine flies from Malaysia and Singapore with the description of six new species (Diptera, Sarcophagidae), Jpn. J. Sanit. Zool. 41 (1990) 81–91. [26] H. Kurahashi, M.U. Leh, The flies from Sarawak, East Malaysia (Diptera: Muscidae, Calliphoridae, Sarcophagidae and Tachinidae), Med. Entomol. Zool. 58 (2007) 261–273. [27] Z.K. Song, X.Z. Wang, G.Q. Liang, Species identification of some common necrophagous flies in Guangdong province, southern China based on the rDNA internal transcribed spacer 2 (ITS2), J. Forens. Sci. 172 (2008) 17–22. [28] H.S. Lopes, Family Sarcophagidae, in: N. Papavero (ed.), A catalog of the Diptera of the Americas south of the United States, Departmento de Zoologia, Secretaria da Agricultura, Sao Paulo, 1969, pp. 1–88. [29] H.S. Lopes, Family Sarcophagidae, in: N.L. Evenhuis (ed.), Catalog of the Diptera of the Australasian and Oceanian Regions, Bishop Museum Special Publication, 86, Bishop Museum Press & E.J. Brill, 1989, pp. 721–732. [30] Y. Verves, Family Sarcophagidae, in: A´. Soo´s, L. Papp (eds.), Catalogue of Palaearctic Diptera Calliphoridae-Sarcophagidae, vol. 12, Akade´miai Kiado´, Budapest, 1986, pp. 58–193. [31] G.E. Shewell, Sarcophagidae, in: J.F. McAlpine (Ed.), Manual of Nearctic Diptera, vol. 2, Research Branch, Agriculture Canada, Ottawa, 1987, pp. 1159–1186. [32] B.B. Rohdendorf, Fauna U.S.S.R. Ins., Dipt. 19, No.1, Sarcophagidae Part 1, Zool. 1937 [Transl. pp. 1-38], Inst. Acad. Sci. USSR, Moscow. [33] B.B. Rohdendorf, Composition of the tribe Sarcophagini (Diptera, Sarcophagidae) in Eurasia, Ent. Rev., Wash. 44 (1965) 397–406. [34] S.H. Tan, E. Mohd Aris, J. Surin, B. Omar, H. Kurahashi, Z. Mohamed, Sequence variation in the cytochrome oxidase subunit I and II genes of two commonly found blow fly species. Chrysomya megacephala (Fabricius) and Chrysomya rufifacies (Macquart) (Diptera: Calliphoridae) in Malaysia, Trop. Biomed. 26 (2009) 173– 181. [35] J.R. Steven, R. Wall, J.D. Wells, Paraphyly in Hawaiian hybrid blowfly populations and the evolutionary history of anthropophilic species, Insect Mol. Biol. 11 (2002) 141–148.
Contents lists available at ScienceDirect
Forensic Science International journal homepage: www.elsevier.com/locate/forsciint
DNA-based characterisation and classification of forensically important flesh flies (Diptera: Sarcophagidae) in Malaysia Siew Hwa Tan a, Mohammed Rizman-Idid b, Edah Mohd-Aris c, Hiromu Kurahashi d, Zulqarnain Mohamed a,* a
Division of Genetics and Molecular Biology, Institute of Biological Sciences, Faculty of Science, University of Malaya, 50603, Kuala Lumpur, Malaysia Division of Bioinformatics, Institute of Biological Sciences, Faculty of Science, University of Malaya, 50603, Kuala Lumpur, Malaysia Division of Biohealth, Institute of Biological Sciences, Faculty of Science, University of Malaya, 50603, Kuala Lumpur, Malaysia d Department of Medical Entomology, National Institute of Infectious Diseases, Toyama 1-23-1, Shijuku-ku, Tokyo, 162-8640, Japan b c
A R T I C L E I N F O
A B S T R A C T
Article history: Received 1 April 2009 Received in revised form 22 December 2009 Accepted 24 February 2010 Available online 13 April 2010
Insect larvae and adult insects found on human corpses provide important clues for the estimation of the postmortem interval (PMI). Among all necrophagous insects, flesh flies (Diptera: Sarcophagidae) are considered as carrion flies of forensic importance. DNA variations of 17 Malaysian, two Indonesian and one Japanese flesh fly species are analysed using the mitochondrial COI and COII. These two DNA regions were useful for identifying most species experimented. However, characterisation of the species was not sufficiently made in the case of Sarcophaga javanica. Seventeen Malaysian species of forensic importance were successfully clustered into distinct clades and grouped into the six species groups: peregrina, albiceps, dux, pattoni, princeps and ruficornis. These groups correspond with generic or subgeneric taxa of the subfamily Sarcophaginae: Boettcherisca, Parasarcophaga, Liosarcophaga, Sarcorohdendorfia-Lioproctia, Harpagophalla-Seniorwhitea and Liopygia. The genetic variations found in COI and COII can be applied not only to identify the species of forensic importance, but also to understand the taxonomic positions, generic or subgeneric status, of the sarcophagine species. ß 2010 Elsevier Ireland Ltd. All rights reserved.
Keywords: Sarcophagidae Cytochrome oxidase DNA-based identification Flesh flies Malaysia Forensic entomology
1. Introduction A quick and accurate identification system is desirable in any forensic studies as well as ecology. In recent years, there has been an increase in the use of DNA sequence data in the studies of carrion flies as an aid to accurately identify insect species, even in the cases of immature stages [1–3]. Molecular techniques have the advantage of being applicable to any life stages and have the potential to distinguish morphologically similar species or even genera, such as in the case of sarcophagine flesh flies [4]. DNAbased identification techniques are also easily transferable between laboratories and are not limited to the requirements of specific taxonomical expertise. In Malaysia, the occurrence of carrion-related arthopods has hitherto been known to include dipteran flies such as Sarcophagidae, Calliphoridae, Muscidae and Stratiomyidae [5–7]. Reviews of Malaysian forensic studies showed that calliphorid flies, such as
* Corresponding author at: Division of Genetics and Molecular Biology, Institute of Biological Sciences, Faculty of Science, University of Malaya, 50603, Kuala Lumpur, Malaysia. Tel.: +603 7967 5890; fax: +603 7967 5908. E-mail addresses: [email protected], [email protected] (Z. Mohamed). 0379-0738/$ – see front matter ß 2010 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.forsciint.2010.02.034
Chrysomya megacephala (Fabricius) and Achoetandrus rufifacies (Macquart), were observed as the predominant species found in human cadavers, especially in the early stages of decomposition [8–10]. Although sarcophagine flesh flies are also important as forensic indicators, their identification was mostly carried out only to the genus level [9,10]. Sarcophagine flies are notoriously difficult to identify due to their highly similar morphological appearance [11–13]. These authors suggested and demonstrated that mitochondrial DNA sequences could be successfully employed to distinguish some species of the sarcophagine flesh flies. Despite the availability of mitochondrial DNA sequencing techniques, a robust taxonomic classification of these flies is still required. Such methods of species identification would be truly useful if more comprehensive baseline data could be established. Therefore, this study analysed the mitochondrial cytochrome oxidase gene subunits I and II (COI and COII) sequences of many oriental flesh fly species from Malaysia, Indonesia and Japan that has not been well represented in the previous studies [4,11,13]. The sequence data obtained would be useful as standards for future analyses and the practical identification of species in forensics. Phylogenies estimated from these DNA sequences also provide implications towards the understanding of the taxonomy and systematics of the sarcophagine flesh flies.
44
S.H. Tan et al. / Forensic Science International 199 (2010) 43–49
2. Materials and methods 2.1. Specimens Sarcophagine flesh flies were caught using chicken liver or meat as bait. The specimens were killed using ethyl acetate, pinned and kept under dry conditions with silica gel until DNA extraction was performed. The remaining portions of the vouchers were then stored at 20 8C for further reference. Adult males were identified based on the morphological characteristics of the male genitalia using the identification keys from the fourth author, H. Kurahashi. However, the taxonomical names and systematics of the flies were assigned according to the Catalogue of the Sarcophagidae of the World (Insecta: Diptera) [14]. The morpho-species of female specimens were more difficult to determine due to fewer distinguishing features of the genitalia compared to the male. Nevertheless, some of the female flies were successfully identified (by unambiguous identification of their male offspring reared in the laboratory) and included in the present study. A total of 38 fly specimens were analysed, representing 20 species which included 17 species of Sarcophaga sensu lato and three species of Calliphoridae as outgroups (Table 1). Of the Sarcophaga s. lat. species, three were non-Malaysia species: Sarcophaga dumonga (Indonesia), S. aureolata (Indonesia) and S. crassipalpis (Japan) were collected by the fourth author (HK) and included for comparison. 2.2. DNA extraction Two right legs from each adult fly specimen were used for DNA extraction using the QIAamp1 DNA Mini Tissue Kit (Qiagen, Germany) according to the manufacturer’s protocols. Briefly, legs were ground into powder using sterile plastic micro-pestles in 1.5-ml microfuge tubes immersed in liquid nitrogen. The samples were homogenised in buffer (supplied with the kit) and incubated overnight with proteinase K. Incubation with RNaseA was performed the following day prior to cell lysis and DNA extraction. At the end of the extraction process, the DNA was eluted twice in 200 ml of elution buffer. The tube was left to stand for 5 min at room temperature before the second eluate was collected by centrifugation. The remaining portions of voucher specimens were kept in the Division of Genetics and Molecular Biology, University of Malaya, for future reference. 2.3. PCR amplification and sequencing The amplified mtDNA region spans a total of 2.3 kb, and includes the cytochrome oxidase I and II genes (COI and COII) and the tRNA leucine gene. Polymerase chain reaction (PCR) reaction mixtures were prepared in 50-ml reactions containing 100 ng template DNA, 1 unit of Taq polymerase, 1 PCR reaction buffer, 2 mM MgCl2 (BioTools, Spain), 200 mM of each dNTP (Fermentas, USA) and 2 mM of each forward and reverse primers (amplification of COI gene using primers TY-J-1460: 50 TACAATTTATCGCCTAAACTTCAGCC and C1-N-2800: 50 -CATTTCAAGCTGTGTAAGCATC, whereas COII gene using primers C1-J-2495: 50 -CAGCTACTTTATGAGCTTTAGG and TK-N-3775: 50 -GAGACCATTACTTGCTTTCAGTCATCT) [15]. PCR was performed in an MJ Research PTC-200 thermal cycler (MJ Research, USA), and the thermal cycling programme consisted of an initial denaturation step of 94 8C of 5 min, followed by 35 cycles of denaturation at 94 8C for 1 min, an annealing step for 1 min 30 s and an extension step at 72 8C for 2 min. The annealing temperatures were optimised for primer pairs TY-J-1460/C1-N-2800 and C1-J-2495/TK-N-3775 at 46 8C and 58 8C, respectively, rather than the recommended annealing temperature of 45 8C and 47 8C [16]. The final elongation step was 72 8C for 5 min. The PCR products were then purified using the QIAquick1 PCR Purification Kit (Qiagen, Germany) following the manufacturer’s protocol. QIAquick1 Gel Extraction Kit (Qiagen, Germany) was also used when the PCR products showed traces of non-specific amplification fragments. For this purpose, the desired PCR fragments were excised from the gel using a sterile scalpel and the purification steps were carried out essentially as described in the manufacturer’s protocol. Sequencing was performed using the ABI PrismTM BigDyeTM Terminator Cycle Sequencing Ready Reaction Kit version 3.1 (Applied Biosystems, Foster City, CA, USA) according to the manufacturer’s recommendations. All the samples were sequenced for both forward and reverse DNA strands. Electrophoresis and detection of the sequencing reaction products were carried out in the capillary electrophoresis system ABI PRISM 3730l capillary DNA Sequencer with a capillary length of 80 cm. 2.4. Data and phylogenetic analysis DNA sequence reads were edited manually using the Chromas software (v2.32) to remove the sequences of primers and to eliminate discrepancies between contig sequences. Sequences were aligned using Clustal W [17]. Sequences of COI and COII were analysed separately, and combined to increase the phylogenetic signal. Analysis of DNA sequence variation, nucleotide composition and genetic distance was performed using Molecular Evolutionary Genetics Analysis (MEGA) version 4.0 [18]. Prior to phylogenetic analysis, sequence alignment was tested for the best-fit evolutionary model using Modeltest 3.8 [19]. Neighbour-joining (NJ) and maximum parsimony (MP) phylogenetic trees were constructed using PAUP* 4.0b10 [20]. For both analyses, 10,000 replicates were bootstrapped. Full heuristic search was performed with 10 random sequence additions and tree bisection–reconnection
(TBR) branch swapping. A Bayesian inference analysis was performed using MrBayes 3.1.2 [21]. Four Markov chains (three heated chains and one cold chain) were run for three million generations and the trees were sampled every 100th generation. All trees were rooted with the Calliphoridae species, whereas only branches with over 70% bootstraps were considered for phylogenetic inference [22].
3. Results 3.1. DNA sequence variation A total of 38 carrion fly sequences ranging from 2292 to 2294 bp in length were successfully generated and deposited into GenBank (Table 1). The final sequence alignment obtained was 2294 bp, which encompassed the complete sequences of COI, tRNA-leucine and COII genes The alignment revealed the inclusion of 2-bp indels within the spacer region between the tRNA-leucine and COII gene. The sequence alignment consists of 689 variable sites, whereby 602 sites were considered parsimony informative. All the taxa showed an even distribution of nucleotide variation across the COI and COII genes, with almost no variation at the tRNA-leucine gene, except for two substitutions and a single one for S. inextricata and S. crassipalpis, respectively. As expected, this region of mtDNA was observed to have a strong AT bias (69.9%), which is characteristic of insect mitochondrial DNA [23] where the nucleotide compositions were T (37.9%), C (15.9%), A (32.0%) and G (14.2%). 3.2. Models of evolution The combined dataset resulted in the best likelihood score for the general time reversible (GTR) model with invariable sites and rate heterogeneity. Base frequencies were unequal; A = 0.3139, C = 0.1356, G = 0.1451, T = 0.4055; and the estimated proportion of invariable sites (I) were 0.6241. The substitution model incorporated the following rate matrix: [A–C] = 6.6007, [A–G] = 37.1439, [A–T] = 17.8570, [C–G] = 1.1399, [C–T] = 142.7236, [G–T] = 1.0000. The shape parameter of the gamma distribution was a = 1.8312. This model was used to determine the number of substitution types and the inclusion of the gamma rate distribution and proportion of invariable sites in the Bayesian analyses. 3.3. Phylogenetic analysis Almost similar tree topologies were recovered from the NJ and MP analyses (Fig. 1). The phylogeny of sarcophagine flies was separated into six genetic clades (A–F) that were supported by high bootstrap values. Clade A, which could be considered as the peregrina-group, is comprised of Sarcophaga javanica, S. krathonmai, S. peregrina and S. dumoga. Clade B also consists of several species: S. albiceps, S. misera and S. taenionota that loosely defined the albiceps-group. Clade C is known as the duxgroup as it contains S. dux and also S. brevicornis. Clade D, the pattoni-group, comprised S. inextricata, S. aureolata, S. saprianovae and S. pattoni. Species S. kempi and S. princeps were united under clade E as the princeps-group, whereas S. ruficornis and S. crassipalpis formed the ruficornis-group, also known as clade F. Although the phylogenetic affinities of these species were determined, only clades A and B were resolved as sister groups. The branching order among clades D, E and F were unresolved in both NJ and MP analyses. The Bayesian analysis, which incorporated the evolutionary model GTR+I+G, recovered a fully resolved phylogenetic tree (Fig. 2), with over 80% bootstrap values at the deeper branches of the tree. Clade F was identified as the most basal group within sarcophagines, followed by clade E. Sister groups of clades A and B were inferred as most recent among the diverged sarcophagine groups.
S.H. Tan et al. / Forensic Science International 199 (2010) 43–49
45
Table 1 Collection locality and reference data for specimens used in this study. Asterisk (*) indicates female flies. Species 1.
Sarcophaga (s. lat.) javanica variant A
Sarcophaga (s. lat.) javanica variant B
2.
3.
Sarcophaga (s. lat.) peregrina
Sarcophaga (s. lat.) krathonmai
Voucher number
Collection site
S26
Kuala Lumpur (UM)
S40
Kuala Lumpur (UM)
S32
Kuala Lumpur (UM)
S125
Pahang (KJB)
S-CH2
Cameron Highlands, Pahang
S-CH9*
Cameron Highlands, Pahang
BN
Sarawak
S-SWK-288
Sarawak
4.
Sarcophaga (s. lat.) dumoga
BD
Indonesia
5.
Sarcophaga (s. lat.) misera
S9*
Kuala Lumpur (UM)
S107
Pahang (KJB)
PA1
Sarawak
S152
Kuala Lumpur
S103
Pahang (KJB)
S127
Kuala Lumpur
S-CH14
Cameron Highlands, Pahang
S23*
Kuala Lumpur (UM)
S69
Selangor (KS)
S132
Terengganu
SY9
Kelantan
S37
Kuala Lumpur (UM)
S131*
Terengganu
LS
Sarawak
LS2
Sarawak
6.
7.
8.
9.
10.
11.
Sarcophaga (s. lat.) albiceps
Sarcophaga (s. lat.) taenionota
Sarcophaga (s. lat.) brevicornis
Sarcophaga (s. lat.) dux
Sarcophaga (s. lat.) inextricata
Sarcophaga (s. lat.) saprianovae
GPS reference 0
00
387 50.59 N 1018390 22.4400 E 38 70 50.5900 N 1018390 22.4400 E 38 70 50.5900 N 1018390 22.4400 E 38200 31.5500 N 1018530 0.7100 E
GenBank accession number EF405925 EF405926 EF405922 EF405923
48300 49.8900 N 1018250 23.1700 E 48300 49.8900 N 1018250 23.1700 E
EF405927
18320 47.8800 N 1108200 49.4600 E 18320 47.8800 N 1108200 49.4600 E Information not available
EF405924
38 70 50.5900 N 1018390 22.4400 E 38200 31.5500 N 1018530 0.7100 E
EF405928
GU174023 EF405950 EF405930 EF405929
18320 47.8800 N 1108200 49.4600 E 38 70 50.5900 N 1018390 22.4400 E
EF405931
38200 31.5500 N 1018530 0.7100 E 38 70 50.5900 N 1018390 22.4400 E
EF405933
48300 49.8900 N 1018250 23.1700 E 38 70 50.5900 N 1018390 22.4400 E
EF405935
38200 33.0300 N 1018140 48.4800 E 58120 19.3800 N 1038120 5.7500 E 58580 20.6500 N 1028140 43.9600 E
EF405937
38 70 50.5900 N 1018390 22.4400 E 58120 19.3800 N 1038120 5.7500 E 18320 47.8800 N 1108200 49.4600 E 18320 47.8800 N 1108200 49.4600 E
EF405932
EF405934
EF405936
EF405938 EF405939
EF405942 EF405943
EF405944 EF405945
12.
Sarcophaga (s. lat.) aureolata
LA
Indonesia
Information not available
EF405951
13.
Sarcophaga (s. lat.) pattoni
S494
Kuala Lumpur (UM)
38 70 50.5900 N 1018390 22.4400 E
FJ479724
14.
Sarcophaga (s. lat.) crassipalpis
15.
16.
17.
Sarcophaga (s. lat.) ruficornis
Sarcophaga (s. lat.) kempi
Sarcophaga (s. lat.) princeps
LP-Gom
Selangor (Gom)
J69
Japan
S21*
Kuala Lumpur (UM)
SY5
Kelantan
S102*
Pahang (KJB)
S134*
Kuala Lumpur (UM)
S274
Kuala Lumpur (UM)
S25*
Kuala Lumpur (UM)
S71
Kuala Lumpur (UM)
FJ479723 Information not available 0
00
38 7 50.59 N 1018390 22.4400 E 58580 20.6500 N 1028140 43.9600 E
GU174024 EF405940 EF405941
38200 31.5500 N 1018530 0.7100 E 38 70 50.5900 N 1018390 22.4400 E 38 70 50.5900 N 1018390 22.4400 E
EF405946
38 70 50.5900 N 1018390 22.4400 E 38 70 50.5900 N 1018390 22.4400 E
EF405948
EF405947 GU174025
EF405949
S.H. Tan et al. / Forensic Science International 199 (2010) 43–49
46 Table 1 (Continued ) Species
Voucher number
Collection site
GPS reference 0
00
GenBank accession number
18.
Chrysomya megacephala
CM3
Kuala Lumpur
38 7 50.59 N 1018390 22.4400 E
AY909052
19.
Achoetandrus rufifacies
CR5
Kuala Lumpur
38 70 50.5900 N 1018390 22.4400 E
AY909055
20.
Ceylonomyia nigripes
CN-UM-20-8
Kuala Lumpur
38 70 50.5900 N 1018390 22.4400 E
GU174026
All trees showed strongly supported monophyletic groupings for all species, with the exception of S. javanica, where S. javanica variant A is more closely related to S. peregrina rather than S. javanica variant B. Most clades showed less than 4.1% sequence divergence, except for clade D with 6.7% sequence divergence accounted by
the deep branches of S. inextricata, S. saprianovae and S. pattoni. Comparisons between clades revealed 6.9–10.7% sequence variation, which is almost twice higher than the within-clade variation. Table 2 shows that most of the intra-specific variation is less than 1.00% with a maximum of 1.35%, whereas the minimum inter-specific variation is 1.94%. This may allow for
Fig. 1. Neighbour-joining phylogram with branch length constructed by PAUP* using model GTR+I+G based on 2294 bp of COI+COII sequences. Percentages of the 10,000 bootstrap replicates from neighbour-joining and maximum parsimony analyses are indicated respectively at the branch. Asterisks denote that both values are the same. Six major clades were identified as (A) peregrina-group; (B) albiceps-group; (C) dux-group; (D) pattoni-group; (E) princeps-group; (F) ruficornis-group.
S.H. Tan et al. / Forensic Science International 199 (2010) 43–49
47
Fig. 2. Bayesian consensus tree after burn-in 25% for three million generations. Posterior probabilities are shown at each node. Six major clades were identified as (A) peregrina-group; (B) albiceps-group; (C) dux-group; (D) pattoni-group; (E) princeps-group; (F) ruficornis-group.
easy designation of flies to respective clades or even the delineation of species. 4. Discussion The present study is the first to report a more comprehensive phylogeny of sarcophagine species estimated from complete sequences of COI and COII genes.
With specimens covering 17 oriental sarcophagine species, some include both sexes, the phylogeny appears to be robust for Malaysian forensic application. DNA-based identification of S. javanica, S. krathonmai, S. dumoga, S. inextricata, S. aureolata, S. saprianovae, S. kempi and S. princeps was also reported for the first time. The current application of DNA sequencing has made allowances for the revival of taxonomic studies of these flies, many of which are taxonomically ambiguous with incomplete species checklist.
S.H. Tan et al. / Forensic Science International 199 (2010) 43–49
48
Table 2 Percentage of intraspecific variation for species that are represented by more than one individual. Species Sarcophaga Sarcophaga Sarcophaga Sarcophaga Sarcophaga Sarcophaga Sarcophaga Sarcophaga Sarcophaga Sarcophaga Sarcophaga Sarcophaga Sarcophaga Sarcophaga Sarcophaga a b
javanica variant A javanica variant B peregrina krathonmai misera albiceps taenionota brevicornis dux inextricata saprianovae pattoni kempi princeps ruficornis
Number of specimena
Intraspecific variation (%)
Number of variation/totalb
2 2 2 2 2 2 2 2 3 2 2 2 3 2 2
0.22 1.35 0.92 1.09 0.22 0.61 0.31 0.13 0.83 0.09 0.65 0.39 0.74 0.39 0.57
5/2292 31/2292 21/2292 25/2292 5/2293 14/2293 7/2293 3/2293 19/2294 2/2293 15/2292 9/2292 17/2294 9/2294 13/2294
Number of specimen more than 2, the maximum number of variation is taken. Total number varies due to indels between tRNA-leucine and COII genes.
Investigations on the oriental sarcophagine flesh flies were first made by Lopes et al. [24], during which they recorded 21 species from Malaysia. Sugiyama et al. [25] listed 22 species from Malaya (Malaysia), North Borneo and Singapore. More recently, Kurahashi and Leh recorded 19 species, including one new species from Sarawak, East Malaysia [26], 14 of which were analysed in the present study. In contrast to the very well-documented calliphorid flies, the Sarcophagidae is poorly studied due to challenges in its identification [1,2,16]. To date, not many published DNA-based sarcophagid studies are available for reference and, if any, are reports from non-tropical regions such as United States, Czech Republic, Japan and China [4,11,13,27]. Almost all of these studies used partial sequences of COI or short ITS2 regions [4,11,13,27]. By incorporating more species, complete COI, tRNA-leucine and COII sequences and powerful Bayesian analysis, the present phylogenetic tree appears to be resolved at the species level and the deeper divergence among major clades. The six genetic clades (A–F) in the phylogenetic trees suggest that the taxonomic application of a single genus Sarcophaga sensu
lato for the subfamily Sarcophaginae may require revision. For example, species in clade A, which was loosely defined as the peregrina-group, corresponds well to genus Boettcherisca that have been traditionally proposed by the authorities such as Lopes [28,29], Lopes et al. [24], Verves [30], Shewell [31] and Rohdendorf [32,33]. Likewise, all the other clades (B–F) show similar compliance to such genus classification; clade B as Parasarcophaga; clade C as Liosarcophaga; clade D consists of two genera: Sarcorohdendorfia and Lioproctia, clade E also consists of two genera: Harpagophalla and Seniorwhitea; and clade F comprises of genus Liopygia. Our findings therefore provided stronger support for the traditional classification as opposed to the classification rationale of Pape, who treated all these taxa as subgenera of the genus Sarcophaga s. lat. in his Catalogue of the Sarcophagidae of the World [14]. Molecular analysis perhaps will provide the information to solve the taxonomic problem in the generic and subgeneric grouping of sarcophagine species. Sequence data of complete COI and COII genes have the potential to identify species and place them into the respective clades. The availability of such DNA database will facilitate forensic cases by allowing immature stages to be identified [34]. The database also assists in the species assignment of the female flies that are morphologically more difficult to identify. The application of DNA sequences to accurately delineate species depends especially on the extent of, and separation between, intra-specific variation and inter-specific divergence in the chosen genetic marker. This study demonstrated no overlapping values between the intra-specific and inter-specific variation, whereby the maximum intra-specific variation is less than the minimum inter-specific variation. As shown in clade A, the maximum intra-specific variation and the minimum inter-specific variation were 1.35% and 1.94%, respectively, and this enabled unambiguous species identification even for those that have only recently diverged (Tables 2 and 3). Among the identified species, S. javanica appears to be polyphyletic as S. javanica variant A was related to S. peregrina, whereas S. javanica variant B was closer to S. krathonmai. This distinction is not due to geographical isolation because both variants were collected in the same collection site in Kuala Lumpur (Table 1). This polyphyly may be accounted by convergent evolution, ancestral polymorphism, incomplete lineage sorting
Table 3 Pairwise divergence between species (%) for 2294-bp.
[1] [2] [3] [4] [5] [6] [7] [8] [9] [10] [11] [12] [13] [14] [15] [16] [17] [18] [19] [20] [21]
[1]
[2]
[3]
[4]
[5]
[6]
[7]
[8]
[9]
[10]
[11]
[12]
[13]
[14]
[15]
[16]
[17]
[18]
[19]
[20]
6.77 4.98 14.00 13.28 13.79 13.93 13.78 13.36 12.81 12.89 11.75 12.47 13.46 14.40 14.46 13.79 13.23 12.88 12.08 12.31
7.53 13.66 13.43 13.04 13.33 13.06 11.89 11.76 11.65 11.34 11.33 14.01 13.65 13.35 12.85 12.79 12.11 11.94 12.16
14.98 14.18 14.48 14.56 14.27 12.84 12.62 12.58 12.13 12.25 13.76 14.37 14.25 13.89 13.50 12.42 12.17 12.67
1.94 2.90 2.88 6.77 8.49 8.76 8.26 8.92 8.24 10.72 10.97 11.34 11.25 11.02 10.55 9.63 10.33
2.95 2.85 6.82 7.96 7.92 7.58 8.21 7.98 10.62 10.63 10.95 11.12 10.49 10.15 8.88 10.15
2.28 6.76 7.51 8.15 7.82 7.96 7.88 10.02 10.57 10.92 10.56 10.70 10.44 9.34 10.01
6.46 7.43 8.04 7.72 8.40 8.12 10.28 10.53 11.12 10.89 10.59 10.12 9.27 10.17
8.83 8.92 8.12 8.70 7.74 10.69 11.14 11.51 11.21 11.61 9.99 9.91 10.59
5.11 5.07 7.51 6.98 10.32 9.87 10.56 10.74 10.39 9.68 8.33 8.55
4.24 6.86 6.89 9.67 10.02 10.73 10.60 10.50 9.20 7.90 7.92
6.90 6.44 10.04 10.05 9.74 9.84 10.03 8.77 7.70 8.25
5.53 8.68 9.65 8.96 8.74 9.68 8.36 7.82 7.63
8.71 9.33 9.49 9.45 9.31 8.07 7.91 7.92
9.83 10.09 9.63 10.18 10.53 10.33 10.06
6.41 6.36 10.81 10.46 9.78 10.09
1.75 10.67 10.37 9.23 9.75
10.49 9.96 9.27 9.45
6.42 9.44 9.94
8.34 8.45
4.24
[1] Chyrsomya megacephala, [2] Achoetandrus rufifacies, [3] Ceylonomyia nigripes; [4–20] are species from Sarcophaga (s.l.): [4] javanica variant A, [5] peregrina, [6] krathonmai, [7] javanica variant B, [8] dumoga, [9] misera, [10] albiceps, [11] taenionota, [12] brevicornis, [13] dux, [14] inextricata, [15] saprianovae, [16] aureolata, [17] pattoni, [18] kempi, [19] princeps, [20] ruficornis, and [21] crassipalpis.
S.H. Tan et al. / Forensic Science International 199 (2010) 43–49
or even introgressive hybridisation [3,35]. Perhaps the variants could be an example of cryptic species because they are very similar in external morphology. In order to investigate the polyphyletic status of S. javanica, more specimens of these forms are needed, which include field colonies from different localities across wider geographical and ecological ranges. 5. Conclusion The available DNA sequence of sarcophagine flies encompassing the complete COI, tRNA-leucine and COII genes allows for the identification of these species, particularly useful for local forensic purposes. The phylogeny provides insight about the evolutionary relationships of these species, which could be assigned into any of the six clades. The molecular phylogeny is generally congruent with most morphologically based classification systems. Suggestion of taxonomic revision may be premature, as the current phylogeny can benefit from the sampling of more taxa. Acknowledgements This study was supported by the short-term research grants F0163/2004A, F0181/2005C, PS085/2007B, FS294/2008A from University of Malaya, Malaysia and the National e-Science Fund number 02-01-03-SF0092 received from the Ministry of Science, Technology and Innovation, Malaysia. The first author (S.H. Tan) is indebted to the Ministry of Science, Technology and Innovation, Malaysia, for her PhD. National Science Fellowship and short-term research attachment programme to Japan. She wishes to express her sincere thanks to Drs. M. Kobayashi, Y. Tsuda and T. Hayashi from the Department of Medical Entomology, National Institute of Infectious Diseases, Tokyo, Japan, for their assistance during her stay. She also would like to thank Dr. Ng Ching Ching for her kind assistance. References [1] J.F. Wallman, S.C. Donnellan, The utility of mitochondrial DNA sequences for the identification of forensically important blowflies (Diptera: Calliphoridae) in southeastern Australia, Forens. Sci. Int. 120 (2001) 60–67. [2] J.D. Wells, F.A.H. Sperling, DNA-based identification of forensically important Chrysomyinae (Diptera: Calliphoridae), Forens. Sci. Int. 120 (2001) 110–115. [3] J.D. Wells, D.W. Williams, Validation of a DNA-based method for identifying Chrysomyinae (Diptera: Calliphoridae) used in a death investigation, Int. J. Legal Med. 121 (2005) 1–8. [4] R. Zehner, J. Amendt, S. Schu¨tt, J. Sauer, R. Krettek, D. Povolny´, Genetic identification of forensically important flesh flies (Diptera: Sarcophagidae), Int. J. Legal Med. 118 (2004) 245–247. [5] H.L. Lee, T. Marzuki, Preliminary observation of arthropods on carrion and its application to forensic entomology in Malaysia, Trop. Biomed. 10 (1993) 5–8. [6] B. Omar, M.A. Marwi, P. Oothuman, H.F. Othman, Observations on the behaviour of immatures and adults of some Malaysian sarcosaprophagous flies, Trop. Biomed. 11 (1994) 149–153. [7] B. Omar, M.A. Marwi, S. Sulaiman, P. Oothuman, Dipteran succession in monkey carrion at a rubber tree plantation in Malaysia, Trop. Biomed. 11 (1994) 77–82. [8] N.A. Hamid, B. Omar, M.A. Marwi, A.F. Mohd. Salleh, H. Mansar, S.F. Siew, N. Moktar, A review of forensic specimens sent to forensic entomology laboratory Universiti Kebangsaan Malaysia for the year 2001, Trop. Biomed. 21 (2003) 27–31. [9] H.L. Lee, M. Krishnasamy, A.G. Abdullah, J. Jeffery, Review of forensically important entomological specimens in the period of 1972–2002, Trop. Biomed. 21 (2004) 69–75.
49
[10] A.F. Mohd Salleh, M.A. Marwi, J. Jeffery, N.A. Abd Hamid, R.M. Zuha, B. Omar, Review of forensic entomology cases from Kuala Lumpur Hospital and Hospital Universiti Kebangsaan Malaysia, 2002, J. Trop. Med. Parasitol. 30 (2007) 51–54. [11] J.D. Wells, T. Pape, F.A.H. Sperling, DNA-based identification and molecular systematics of forensically important Sarcophagidae (Diptera), J. Forens. Sci. 46 (2001) 1098–1102. [12] J.H. Byrd, J.L. Castner, Insects of forensic importance, in: J.H. Byrd, J.L. Castner (Eds.), Forensic Entomology—The Utility of Arthropods in Legal Investigations, CRC Press, Boca Raton, 2001, pp. 43–80. [13] K. Saigusa, M. Takamiya, Y. Aoki, Species identification of the forensically important flies in Iwate prefecture, Japan based on mitochondrial cytochrome oxidase gene subunit I (COI) sequences, Legal Med. 7 (2005) 175–178. [14] T. Pape, Catalogue of the Sarcophagidae of the World (Insecta: Diptera), Associated Publishers, Florida, USA, 1996. [15] F.A.H. Sperling, G.S. Anderson, D.A. Hickey, A DNA-based approach to the identification of insect species used for post-mortem interval estimation, J. Forens. Sci. 39 (1994) 418–427. [16] H. Schroeder, H. Klotzbach, S. Elias, C. Augustin, K. Pueschel, Use of PCR-RFLP for differentiation of calliphorid larvae (Diptera, Calliphoridae) on human corpses, Forens. Sci. Int. 132 (2003) 76–81. [17] J. Thompson, D. Higgins, T. Gibson, CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, positionspecific gap penalties and weight matrix choice, Nucleic Acids Res. 22 (1994) 4673–4680. [18] K. Tamura, J. Dudley, M. Nei, S. Kumar, MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) software version 4.0, Mol. Biol. Evol. 24 (2007) 1596–1599. [19] D. Posada, K.A. Crandall, Modeltest: testing the model of DNA substitution, Bioinformatics 14 (1998) 817–818. [20] D.L. Swofford, PAUP*, Phylogenetic analysis using parsimony (*and other methods), Version 4, Sinauer Associates, Sunderland, Massachusetts, 1998. [21] J.P. Huelsenbeck, F.R. Ronquist, MRBAYES: Bayesian inference of phylogeny, Biometrics 17 (2001) 754. [22] D.M. Hillis, J.J. Bull, An empirical test of bootstrapping as a method for assessing confidence in phyogenetic analysis, Syst. Biol. 42 (1993) 182–192. [23] R.H. Crozier, Y.C. Crozier, The mitochondrial genome of the honeybee Apis mellifera: complete sequence and genome organization, Genetics 133 (1993) 97–117. [24] H.S. Lopes, R. Kano, S. Shinonaga, H. Kurahashi, Family Sarcophagidae, in: M.D. Delfinado, D.L. Hardy (Eds.), A Catalogue of the Diptera of the Oriental Region, vol. 3, Univ. Press Hawaii, Honolulu, 1977, pp. 557–583. [25] E. Sugiyama, S. Shinonaga, R. Kano, Sarcophagine flies from Malaysia and Singapore with the description of six new species (Diptera, Sarcophagidae), Jpn. J. Sanit. Zool. 41 (1990) 81–91. [26] H. Kurahashi, M.U. Leh, The flies from Sarawak, East Malaysia (Diptera: Muscidae, Calliphoridae, Sarcophagidae and Tachinidae), Med. Entomol. Zool. 58 (2007) 261–273. [27] Z.K. Song, X.Z. Wang, G.Q. Liang, Species identification of some common necrophagous flies in Guangdong province, southern China based on the rDNA internal transcribed spacer 2 (ITS2), J. Forens. Sci. 172 (2008) 17–22. [28] H.S. Lopes, Family Sarcophagidae, in: N. Papavero (ed.), A catalog of the Diptera of the Americas south of the United States, Departmento de Zoologia, Secretaria da Agricultura, Sao Paulo, 1969, pp. 1–88. [29] H.S. Lopes, Family Sarcophagidae, in: N.L. Evenhuis (ed.), Catalog of the Diptera of the Australasian and Oceanian Regions, Bishop Museum Special Publication, 86, Bishop Museum Press & E.J. Brill, 1989, pp. 721–732. [30] Y. Verves, Family Sarcophagidae, in: A´. Soo´s, L. Papp (eds.), Catalogue of Palaearctic Diptera Calliphoridae-Sarcophagidae, vol. 12, Akade´miai Kiado´, Budapest, 1986, pp. 58–193. [31] G.E. Shewell, Sarcophagidae, in: J.F. McAlpine (Ed.), Manual of Nearctic Diptera, vol. 2, Research Branch, Agriculture Canada, Ottawa, 1987, pp. 1159–1186. [32] B.B. Rohdendorf, Fauna U.S.S.R. Ins., Dipt. 19, No.1, Sarcophagidae Part 1, Zool. 1937 [Transl. pp. 1-38], Inst. Acad. Sci. USSR, Moscow. [33] B.B. Rohdendorf, Composition of the tribe Sarcophagini (Diptera, Sarcophagidae) in Eurasia, Ent. Rev., Wash. 44 (1965) 397–406. [34] S.H. Tan, E. Mohd Aris, J. Surin, B. Omar, H. Kurahashi, Z. Mohamed, Sequence variation in the cytochrome oxidase subunit I and II genes of two commonly found blow fly species. Chrysomya megacephala (Fabricius) and Chrysomya rufifacies (Macquart) (Diptera: Calliphoridae) in Malaysia, Trop. Biomed. 26 (2009) 173– 181. [35] J.R. Steven, R. Wall, J.D. Wells, Paraphyly in Hawaiian hybrid blowfly populations and the evolutionary history of anthropophilic species, Insect Mol. Biol. 11 (2002) 141–148.