DNA bending and its relation to nucleosome positioning

J. Mol. Biol. (1985) 186, 773-790

DNA Bending and its Relation to Nucleosome Positioning Horace R. Drew and Andrew A. Travers MRC Laboratory of Molecular Biology Hills Road, Cambridge CB2 2&H, England (Received 5 August

1985)

X-ray and solution studies have shown that the conformation of a DNA double helix depends strongly on its base sequence. Here we show that certain sequence-dependent modulations in structure appear to determine the rotational positioning of DNA about the nucleosome. Three different experiments are described. First, a piece of DNA of defined sequence (169 base-pairs long) is closed into a circle, and its structure examined by digestion with DNAase I: the helix adopts a highly preferred configuration, with short runs of (A: T) facing in and runs of (G, C) facing out. Secondly, the same sequence is reconstituted with a histone octamer: the angular orientation around the histone core remains conserved, apart from a small uniform increase in helix twist. Finally, it is shown that the average sequence content of DNA molecules isolated from chicken nucleosome cores is non-random, as in a reconstituted nucleosome: short runs of (A, T) are preferentially positioned with minor grooves facing in, while runs of (G, C) tend to have their minor grooves facing out,. The periodicity of this modulation in sequence content (10.17 base-pairs) corresponds to the helix twist in a local frame of reference (a result that bears on the change in linking number upon nucleosome formation). The determinants of translational positioning have not been identified, but one possibility is that long runs of homopolymer (dA) . (dT) or (dG) . (dC) will be excluded from the central region of the supercoil on account of their resistance to curvature.

phenomena as the recognition of DNA by nucleases (Drew & Travers, 1984, 1985; Keene & Elgin, 1984), the binding specificity of antibiotics (Becker & Dervan, 1979; Low et al., 1984; Fox & Waring, 1984), and the stimulation of gene expression by negative supercoiling (Brahms et al., 1985; Drew et al., 1985). Similarly, studies of nucleosome positioning in both reconstituted and naturally occurring systems (Simpson & Stafford, 1983; Edwards & Firtel, 1984; Gottschling & Cech, 1984: Palen & Cech, 1984; Ramsay et al., 1984) have shown that these proteins adopt precise well-defined locations with respect to the primary DNA sequence. Here, we link the two phenomena and show that the positioning of DNA about the histone octamer depends largely, if not entirely, on the anisotropic resistance of DNA to bending stress. Very often one sees references in the literature to nucleosome “phasing”. If one draws a long piece of DNA as a line, and then places histone octamers at various intervals along the line, then their relative positions may be given by a single number, which is often called the phase, although in a strict sense some other term such as periodicity might be more appropriate. In three-dimensional space, the

1. Introduction The problem of nucleosome positioning is central to understanding the structure and function of chromosomes. It is essentially as follows: given a very long piece of chromosomal DNA, how do a great many histone octamers distribute themselves along it? The DNA wraps twice around each octamer, then continues for some distance until another octamer is reached. Clearly, if the DNA is isotropic (i.e. has the same resistance to structural deformation in all directions and at all places along it), then the octamers will attach at random, occupying various positions until the helix is full. But this is not the case, for the base sequence of a chromosomal DNA molecule changes with infinite variety throughout its length, and this in turn controls its resistance to deformation. Previous X-ray and solution studies have demonstrated that the structural and mechanical properties of DNA change as a function of its base sequence (Dickerson & Drew, 1981; Lomonossoff et al., 1981; Calladine, 1982; Wang et al., 1982; Calladine & Drew, 1984; McCall et al., 1985), and that this is responsible for such biologically relevant ~22-2836!85/240773~1x

$03.00/O

773

0

1985 Academic

Press Inc.

(London)

Ltd.

774

H. II. Drew and A. A. Traverx

problem is rather different. The DNA wraps twice around each histone octamer (Finch et al., 1977: Richmond et al., 1984), and in order to define its position one needs to specify at least two variables: a rotation and a translation. The rotation tells which side of the DNA faces outward, away from the protein, as compared to inward, touching the protein; while the translation tells where the protein is located along the path of the DNA. It is thus analogous to the x co-ordinate in a one-dimensional view. In this paper, we use nuclease digestion methods to show that anisotropic bending preferences of the DNA largely determine the rotational degree of freedom, in a way that is consistent with other st)udies of DNA bending (Hagerman, 1984; Glyanov & Zhurkin, 1984; Wu & Crothers, 1984: Widom. 1985). It, is not clear what determines the translational parameter, whether the information lies solely in the DNA, or rather in a specific protein-DNA contact, but studies are underway that, should provide an answer to this question in the near future. 2. Materials (a) Preparation

lua enzyme \

Llpase only I

i19ase pius cxo m /

and Methods

and digestion of the circle

A 2300 bpt plasmid containing the tyrT promoter and its flanking sequences was cut open at a unique SmaI site to yield 2 blunt ends; treated with an excess of EcoRI linker C-G-G-A-A-T-T-C-C-G in the presence of DPU’A ligase; then cut to completion with EcoRI so as to remove all but the last copy of linker from the ends of the DNA molecule, and to separate the tyrT fragment from t’hr large bulk of plasmid DNA. The tyrT fragment. now with unpaired bases A-A-T-T at either end. could be purified from the other products by careful excision from a long Soi, (w/v) polyacrylamide gel. Restriction enzyme cleavage of the purified product, at, sites C-C-C-G-A-G (AvaI) and G-G-T-T-A-C-C (BstEII) near eit,her end, confirmed the efficiency of linker addit’ion. In preparation of the closure rea&ion. 100 ng of purified material were treated first wit’h alkaline phosphatase, then with bacteriophage T4 polynucleotide kinase and [y-32P]ATP, so as to place radioactive phosphate groups at either of the 2 protruding 5’ termini. Without, further delay, the reaction volume was increased to 500 ~1 by the addition of 50 mM-Tris. HCI (pH 7.8). 10 mM-Mgcl,. 20 mM-2-mercaptoethanol. 1.0 mM-ATP: and the tyrT molecule incubated with 10 units of phagr T4 DNA ligase at 20°C for 2 h. A single. slowly migrating product of ligation was obtained, typically in 70 to 9596 yield, as shown in Fig. 1. This product may be identified as a circle by its complete resistance to digestion b) exonuclease III (Horowitz & Wang. 1984). One may further deduce that it is a monomeric 169 bp rather than a dimeric 338 bp circle by redigestion with EcoRI. AVQI or BstEII, to give a single product that co-migrates with the linear starting material. It seems to be a relaxed circle. rather than supercoiled. sinre incubation with topoisomerase I in the presence of ethidium bromide increases t,he gel mobility. whereas incubation with t Abbreviation used: bp. base-pair(s): SDS. sodium dodecvl sulnhate. I

1

LIneor

)

Figure 1. (‘losure of 169 bp tyrT DNL4 mtcl a c~rc~lr. using DNA ligase at a very low concentration of nuvlric~ acid (0.02 pg/ml). Products of ligat’ion were applied to a gel. The circular non-denaturing 59, polyacrylamide molecule migrates much more slowly than the lineal molecule, and is completely resistant to tiigrstion 1)~ exonurlrasr 111 (exoTI1)

DNA Bending t,opoisomerase I in the absence of ethidium bromide has no effect. circle, having been synthesized and The t?rT characterized carefully, was then subjected to digestion by DNAase I in 100 mM-Tris HCl (pH 7.8), 40 mM-NaCl, 6 m&r-MgCl, at an enzyme concentration of 0.04 units/ml. DPu’Aase I was added first (60 min, 37”C), followed by EeoRI (5 min, 37°C) to open the circle. and AvuI or B&E11 (5 min. 37°C) to generate a uniquely labelled 5’ end. This circle could be opened with EcoRI before digestion with DNAase I, so as to obtain a pattern of DNAase 1 cleavage from the linear molecule. Products of digestion were fractionated on SyA polyacrylamide gels containing Tris-borate/EDTA buffer (pH 8.3) and 7 Murea; these gels were fixed in lOo,b (v/v) acet’ir acid, dried under vacuum at 70°C. and subjected to autoradiography at -7O”C! for 1 to 3 days. (b) Preparation reconstituted

Nucleosome 0.0

mre

(mg /ml

I.0

0.5

)

2.0

and digestion of the core particle

Approximately 500 ng of tyrT DNA were cut out of a plasmid by the use of EcoRI and AwaI. treat’ed with reverse transcriptase and [c(-32P]dATP or dCTP so as to label selectively 1 of the 2 recessed 3’ ends left by restriction enzyme cleavage; then isolated in pure form gel. This purified by excision from a 69, polyacrylamide material could then be incubated with loo-fold molar excess of nucleosome core part,icles from chicken, in 20 ~1 of 20 m,n-Tris’ HCl (pH 78), 800 mM-NaCl. 0.2 mMEDTA, 0.2 mM-phenylmethylsulphonylfluoride (20 min, 37°C). Within the space of a few minutes, all of the labelled tyrT DNA exchanges with a small fraction of the unlabelled chicken core DKA molecules. In order to freeze t.his equilibrium, the salt, concentration must, be lowered from 800 to 100 mM-NaCl or less, most simply by the stepwise addition of 20 mlvr-Tris in 5-,ul portions (once every 10 min, 20°C). The 2 crit,ical paramet,ers in this procedure are the starting salt concentration. which must not be less than 600 mM, and t,he concentration of cores, which must not be less t)han 1.O mg/ml. These cores should be freshly prepared from chicken red blood cells, stored at 7 to 10 mg/ml stock solution at. 4°C. and checked for proteolysis at various stages of the experiment. The of reconstitution efficiency mav be monitored conveniently on 0.7%” agarose minigels. run at low voltage and low salt (50 mm) to prevent dissociation of the complex. A typical example is shown in Fig. 2. Here the free 160 bp tyrT DNA is seen to migrate slightly more rapidly than the tyrT core complex. Only trace amounts (1 to 306) of free DNA remain at a core concentration of 2-O mg/ml, and very little complexation of the DXA with 2 histone octamers is detectable. Virtually identical profiles of electrophoresis are observed when native chicken cores and free 147 bp chicken core DNA are applied to the same gel system. and the gel stained with ethidium bromide. Digestion of the reconstituted material with DNAase I was performed in parallel with the digestion of a free DNA control, which had been taken through all of the steps of reconstitution without having been exposed t.o nucleosomes. In a typical experiment, 35 ~1 of core complex (or free DNA) were adjusted to 1 mM-MgCl, and incubated with DKAase I (10 min, 37°C.) at an enzyme concentration of 5.0 units/ml for core. or I.0 unit/ml for free DNA. The reaction was st,opped by adjustment of 2 mM-EDTA; and then the histone octamer removed by extensive digestion with proteinase K (0.5 mg/ml. 30 min. 27

Figure 2. Reconstitution

of the histone octamer with DKA by the method of salt-exchange. A small amount of radioactively labelled tyrT DNA is mixed with a large molar excess of chicken nucleosome core particles at concentrations ranging from 0.0 to 2.0 mg!ml in 08 MNaCl, so that the radioactively labelled DNA can exchange with its unlabelled chicken counterpart. The mixture is then diluted to 0.1 M-NaCl or less. and the course of reconstitution followed on a 0.7’9, agarose gel. The reconstituted tyrT core particle migrates a little more slowly than free tyrT DPU’A. tyrT

37”C, 146 (w/v) sodium dodecyl sulphate). In order to isolate the DNA from t.his mixture. the entire reaction volume had to be extracted twice with phenol/ chloroform, twice with ether, adjusted to 0.3 M-sodium acetate and precipitated with ethanol. Products of digestion were fractionated on 8O,b polyacrylamidr gels containing 7 M-urea. (c) Isolation

of chicken

core Z),VA

Nucleosome cores were prepared from chicken Hlstripped long chromatin (Lutter. 1978) by very minimal digestion with micrococcal nuclease. This leaves a great many 147 bp monomeric cores, 596 stacked dimers. 0 to 5% insoluble material and a large quantity of heavily digested linker DNA, 55 to 60 bp before digestion. The monomer cores can be purified from this mixture by column chromatography on Sepharose 6B or Ultragel AC-34. One may estimate the percentage recovery of monomer cores by measuring the ratio of core DI$A to linker DNA in the column profile: IOOO;, recovery gives a ratio of 147/55 = 2.7 (absorbance at 260 nm in NaOH), whereas 80% recovery gives a ratio of 147(0.8)/ 55(1.2) = 1.8, assuming that the unrecovered (‘ores have been converted to free DNA. The experimental values for this ratio range from 2.7 to 1.8. depending on the preparation; so one may estimate t’hat 80 to lOOo/o of the

776

H. R. Drew and A. A. Tracers -

available cores polynucleosomes.

are

reeovered

from

digestion

of 120

(d) Statistical

sequencing

of cow f),VA

Approximately 40 pg of freshly prepared cshicken nucleosome core particles were treated wit,h 0.5 mg proteinaseK/ml (60min, 37°C. lqb SDS) t,o remove the histone octamer: extracted 3 t,imes with phenol/ chloroform, 3 times with ether to isolate the DSA; incubated with T4 polynucleotide kinase and [;I-~‘P]ATP to place radioactive phosphate groups at both 5’ ends of the duplex; then applied to a long 6% polyacrylamide gel so as to purify and size-fractionate the mixed-sequencr material. Only molecules in the range 147( +3) bp were observed. no other fragments were detectable in a moderately exposed autoradiograph. Digestions of this purified 147 bp core l)NA b> DNAase I were performed in 10 mM-Tris. HCl (pH 7.X). 10 mM-NaCl, 0.5 mM-MgCl,, 0.5 mM-MnC1, for 10 min at 37°C: appropriate enzyme concentrat.ions were 0~01 unit/ml for the native or chromomycin samples. or els( 0.04 unit/ml for distamycin samples. Each digestion experiment contained approximately 60 ng of DNA. and 60 to 120 ng of the selected antibiotic. Products of’ digestion were fractionated on 890 polyacrylamidr gels containing 7 M-urea. (e) Densitometry

and probability

100

SO

s t ;: a

60

40

arccll?ysis

All autoradiographs were scanned on a Joyce-Loebl a relative so as t,o determine microdensitometer probability of cleavage at each bond. Methods for this have been described by Lutter (1978). Lomonossoff rt al. (1981) and Drew & Travers (1984). Due to the largt~ number of data points, we found it necessary to estimate the area under each peak by drawing a triangle. rather bhan by fitting a precise Gaussian function. Tn the case of mixed-sequence core DKA. individual gel bands were not resolved to the point where one could measure the area under each and every peak: these gels were scanned to produce the most accurate tracing possible. then the tracings so obtained were copied onto a sheet of papet and reduced photographically. The positions of druginduced maxima and minima in these tracings are plotted in Fig. 3. and describe a linear function of slope 10.17( kO.05) bp.

20

I 2

I 4

I 6 Max /mr

I 8 no.

_- .IO

Figure 3. Plot of maxima and minima obtainrd front statistical sequencing data (after data in Fig. 7). Thr upper line plots minima induced by distamycin (0) along with maxima induced by c>hromomyrin (0) and has a slope of 10.12. The lower line plots maxima incluc+cd l)> distamycin (0) along with minima inducrd by rhromomycin (0) and has a slope of 10.2%. In no (*ase is there any overlap of points between lines, and they differ by a mean 5 bp in the vertica,l direction. The a.vera,ge xlopc~ fog, both curves is 1@17( k WX) bpjperiod.

3. Results (a) Earlier

work

Soon after crystallization of the nucleosome core complex (Finch et aE., 1977), attempts were made to replace the mixed-sequence. heterogeneous DNA population of this particle with a more uniform, defined-sequence polymer. Two groups, Rhodes (1979) and Simpson & Kunzler (1979), found independently that certain sequences such as poly(dA-dT) and poly(dG-dC) would wrap with great ease around the histone octamer, whereas other sequences such as poly(dA) . poly(dT) and poly(dG) . poly(dC) would not. Several authors have attributed this to the preferred parallel stacking of purine bases, which should make a homopolymeric difficult to bend in any direction sequence (Dickerson & Drew, 1981; McCall et al., 1985).

in this problem indirect,lT. We became interested through a study of promoter function in l&cherichw coli. Many bacterial promoters extend for just a short. distance upstream from t,he start site of transcription, but, others such as tyrT from E. roli extend upstream for at least 100 bp (Fig. 4). Deletion of the upstream promoter element reduces t,he amount of product made by a factor of 10 to 12 (Lamond & Travers, 1983). One possibility is t)hat the DNA in this region bends around the polymerase so as to opt,imize promoter function (Drew &, Travers, 1984) and. very recently. supporting evidence for this has been present.ed (Rossi & Smith. 1984). The conserved sequence features that influence bending are in many cases

777

DNA Bending

A/T-rich

, A/T-rich

A/T-rich

,

I

I

CCGGTTACCTTTAATCCGTTACGGATGAAAATTACGCAACCAGTTCATTTTTCTCAACGT 10

0

Polymerase

20 binding

40

30

50

60

site

I

I

Start

e

AACACTTTACAGCGGCGCGTCATTTGATATGATGCGCCCC~CTTCCCGATAAGGGAGCAG 70

60

60

100

90

110

120

GCCAGTAAAAAGCATTACCCCGTGGTGGGGGTTCCCGAGA 130

120

140

150

160

Figure 4. Sequence of tyrT DNA. The tRNA gene begins at position 100 in this numbering. Canonical RNA polymerase recognition signals “ - 35” T-T-T-A-C-A and “- 10” T-A-T-G-A-T-G lie upstream at positions 68 and 90, respectively. Further upstream there are 3 A+T-rich blocks T-T-T-A-A-T, A-A-A-A-T-T-A and A-T-T-T-T-T at positions 12, 30 and 50. A mutant promoter containing a “- 10” sequence T-A-T-G-A-A-G was used for the experiments described in Figs 5 and 6. Sequence hyphens are omitted from Figures for clarity. short runs of homopolymer (dA) . (dT) interspersed with mixed-sequence DNA (Wu & Crothers, 1984). Previously, in a study of DNA promoter st’ructure by nuclease digestion methods, we showed regions (positions 12, 30 that these A+T-rich and 50 in Fig. 4) adopt a distinctive double-helical conformation in solution, most probably characteristic of a narrow minor groove (Drew & Travers, 1984). A DNA double helix has two grooves, a major and a minor, and these may vary in size according to the helix conformation. If the minor groove is narrow, then the major groove on the other side of the helix will be wide, and vice VP?-<%Z.

(b) DNA orientation in a small 169 bp circle When DNA bends, all of the grooves on the inside of the circle (both major and minor) must narrow somewhat due to the compression associat,ed with bending; while those on the outside of the curve become correspondingly wider. One may see this by an application of simple geometry. Suppose we have a DNA molecule 169 bp in length. If the two ends of this molecule are joined smoothly to make a circle, then the circle will have a circumference of 588 A and a radius of 89 8. Now the width of a DNA molecule is 20 A, so let us draw circles, one of radius 79 A for the inside of the molecule, and one of 99 A for the outside. The circumference of the inner circle will be 496 & and the outer 622 A. Because the circular molecule contains 169/10*56 = 16 duplex turns, then each turn on the inside will extend for 496116 = 31 8, but on the outside for 622116 = 39 A. So within any turn, the sum of major and minor grooves must be, on the average, 8 A narrower inside than outside. How does a DNA molecule accommodate itself to such a distortion? One possibility is that it will orient itself so as to place all of the grooves that are already narrow, or can easily become narrow, on

the inside of the circle, and those grooves that are already wide on the outside. Thus, for a sequence such as that shown in Figure 4, the narrow minor grooves associated with A+T-rich segments at positions 12, 30 and 50 should point inward towards the centre of curvature. In two other places, positions 75 and 97, the minor groove is thought to be rather wide due to its G+C-content (Drew & Travers, 1984), so these should point, outward away from the centre of curvature. An experimental test of this hypothesis is shown in Figure 5(a) to (c). The 169 bp tyrT sequence was covalently closed into a small circle using DNA the enzyme ligase , and then digested with DNAase I to determine which parts of the molecule face out and which parts face in. In Figure 5(a) and (b) are shown electrophoretic profiles of digestion for the upper (Watson) and lower (Crick) strands, respectively. Patterns of cleavage for linear and circular molecules appear in adjacent lanes, with an additional 2 x exposure of the “circular” track included for the sake of clarity. Even at first glance. one may notice that the relative intensities of gel bands in both Watson and Crick circular tracks are modulated with a periodicity of approximately ten nucleotides. For example, in the right-hand part of Figure 5(a), bonds around positions 15, 25, 35, 45 and 55 are cut strongly by DNAase I. whereas those at positions 20, 30, 40 and 50 are cut weakly, if at, all. This suggests that the circular DNA adopts a highly preferred configuration, with one side facing in and the other facing out, and thus that bending is restricted to one plane of a topological circle. However, in order to interpret these data simple visual inspection is quantitatively, insufficient; so we must turn to the densitometric analysis shown in Figure 5(c). Here we have plotted the data as a difference function, taking the relative probability of cleavage for each bond In the circular molecule and subtracting from it the corresponding probability of

DNAose

r

I20

*

100

*

I

- - wotson

l-

Lineor

I

\

I

Circular

/

<

00

>

60

>

(0

1

Fig. 5.

x2

60

779

DNA Bending

--

DNAose I

Crick

Circular Linear

X2

\I

20 D

40 D

100 D

(b)

Fig. 5.

I

Circular X2

/

780

H. R. Drew and A. A. Tracers

Ln (probability

of cleavage)

: DNAase

I,

circular

CATTTGATATGAAGCGCCCCGCTTCCCGATAAGGGAGCAGGCCAGTAAAAAGCATTACCCCGTGGTGGGGGTTCCCGAGCCCCGG 80 . 90 GTAAACTATACTTCECGGG~~GAAEGGCT~~TCCC;CGTIC2COGGTT;3TOCGT~ATGG~~CACC~CCC~~AAGEGCTC;;6GOGGCC;TAA

- Linear

-3’ -5’

Figure 5. Digestion of a 169 bp circle by DNAase I. Electrophoretic profiles of digestion for the (a) \Vatson and (1)) Crick strands. (c) A difference probability plot. After digestion, the circle was opened with EcoRl and another restriction enzyme, either AvaI or BatEII, to generate a uniquely labelled .5’ end. Products of digestion were fractionated on 8% polyacrylamide gels containing 7 M-Wea: for more detail. see Materials and Methods. Hatchrd regions in (c) identify locations of enhanced cleavage.

cleavage for each bond in the linear molecule. This procedure removes most of the original preferences associated with DNAase I cleavage due to base sequence (e.g. see Drew & Travers, 1984), and leaves us with a clearer view of the effect of bending a DNA double helix. From this plot, we can deduce the orientation of the helix in the small circle. Vertical scales on left and right are in unit’s of difference In (probabi1it.y) to signify: enhanced cleavage in the circle (+Z). no difference in cutting between circular and linear (0). or reduced cleavage in circular as compared to linear (-2, -4). Several features of this plot, are noteworthy. First, as noted above, the occurrence of cutting follows a sinusoidal periodicity of about ten nucleotides. Favoured positions of cleavage appear as maxima in the difference functions, far above or below the baseline sequence, while less-favoured positions of cleavage appear as minima in the difference function, close to the baseline sequence. How does this arise? By analogy with the experiments of Rhodes & Klug (1980). where DNA was placed on a flat surface and similar results obtained, the enzyme DNAase I must experience hindered access to one side of the double helix as compared with the other. Since the geometry is that of a closed circle, it seems obvious that the hindered portion will be the inside, while the accessible part will be the outside. It is perhaps unexpected that a small protein such as DNAase I should experience hindered access, but t,he result speaks for itself. If one counts all the maxima or minima of either

the strand (it, is necessary to assume that chara.cteristic modulat8ion of cutt,ing will continue through regions of missing data on either end). then one will find 16 periods in all to yield an average repeat of 169/16 = 10.56 bp per period. There are no surprises here: this is simply the st,ructural periodicit’y of a mixed-sequence DNA double helix: and the overall lengt~h of the molecule was carefully chosen so as to include a precisely integral number of helix turns, and thereby produce eficient closure during ligation (Shore X: Baldwin, 1983; Horowitz & Wang, 1984). Secondly, probabilit.ies of cleavage for t.hr upper Watson strand do not quit’e line up with those for the lower Crick strand: instead. they s~~ernshifted to the right by approximat,ely two bonds. This asymmetry comes about. becLause we have drawn the helix in a distorted fashion by plotting it, onto iI sheet of paper. The enzyme DSAase 1 is positionecl above the minor groove and (buts phosphate groups symmetrically to e&her side. according to t,he 1oca.l twofold symmet,ry of the tloubl~ helix. These symmet’ry-related phosphate groups arr pra(%icall\ nearest-neighbourx in space. but lie several bonds apart when plotted in t.wo dimensiolls. .1 mor(’ accurate represtant,ation of’ the helix. as thv protein sees it. would be to shift the upper strand to the left by one bond and the lower strand to the right by the same amount, (Luttrr, 1978: l)rew, 1984). A third point. and perhaps t,he most important. is that the angular orientation of the I)h’A in this small circular molecule is as predicted with A +

781

DNA Bending T-rich minor grooves facing in and G +C-rich minor grooves facing out. If we accept that access of DNAase I to the inside of the circle is somewhat hindered, then we may identify regions of preferred cutting with t,he exterior surface of the molecule and regions of less preferred cutting with the interior. For example, the sequence A-A-A-A-T-T-A spanning positions 27 to 34 lies between two minima at position 31 on the upper strand and position 29 on the lower; the base-pair step facing most directly inward is thereby determined to be (31+29)/2 = 30. Through use of this method, we may assign positions 9, 19, 30, 4O,fl, 61, 72, 82, 93, 103, 114, 124, 135 and 145 to the inside of the circle, and positions 14. 24, 35, 45, 56, 66, 77, 87, 98, 108, 119, 129 and 140 to the outside. It is particularly noteworthy that all three A+T-rich segments mentioned above (positions 12, 30 and 50) point approximately inward, whereas the two G +C-rich segments at positions 75 and 97 point out. We attribute this to sequence-dependence variation of DNA helix structure in the original linear molecule, which is then enhanced upon circularization (compared with stringing a bow). The narrow grooves tend to position themselves on the inside, while the wide grooves tend to position themselves on the outside, insofar as these requirements are compatible. Interestingly enough, the observed direction of bending would leave the two conserved promoter homologies T-T-T-A-C-A (position 67 in Fig. 4) and T-A-T-G-A-T-G (position 90 in Fig. 4) in excellent functional orientation, with their minor grooves facing out and their major grooves facing inward to interact’ with the polymerase (Siebenlist et al., 1980; Drew et al., 1985). Of course, in any sequence as varied as this there will always be a few helix segments whose rotational position is imposed not by local constraints but by the preferred configuration of t’hr whole molecule. In the plot in Figure 5(c) one may discern four examples of this: at positions 33 Crick, 44 Crick, 65 Crick and 130 Watson, where t’he minor-groove surfaces of A + T-rich sequences lie on the outside. All four of these regions are cut somewhat more readily by DNAase 1 in the circular form than in the linear, and this may be attributed to a slight change of DNA helix structure upon bending. The enzyme DNAase I prefers mediumsized grooves over either narrow or wide (Drew &, Travers, 1984), so by placing these A +T-rich minor grooves on the outer surface we have forced them to open somewhat, from approximately 10 to 12 A. In at least one instance, position 65 Crick. a very similar enhancement of enzymatic cleavage is observed in the complex of this DNA with RNA polymerase (Travers et al., 1983). This section has included a detailed examination of a particular example of DNA bending. We have learned something about DNA angular orientation in a small circle, its origins on a local scale, and how t,his relates to promoter design and funct,ion. But what about the problem of nucleosome positioning?

There the DNA is not floating free in solution, but instead is wrapped securely about an octameric set of four different histone proteins. The DNA is bent twice as tightly into a supercoil of radius 43 A, or just 7.6 duplex turns per superhelical turn, and the path of bending may be slightly irregular due to irregularities along the protein surface. Do the same structural principles apply? (c) DNA orientation and placement about the histone octamer We used the salt-exchange method of Ramsay et al. (1984) to place the tyrT sequence around the chicken histone octamer, and then carried out nuclease digestion experiments on the reconstituted complex in precisely the same fashion as had been done for the circle. Electrophoretic profiles of digestion by DNAase I are shown in Figure 6(a) and (b) for upper (Watson) and lower (Crick) strands, respectively; while a differential probability plot is presented in Figure 6(c). Once again, it is easy to see that the relative intensities of gel bands in both Watson and Crick “core” tracks are modulated with a periodicity of about ten nucleotides. For example, in the righthand part of Figure 6(b), bonds around positions 22, 32, 42, 52 and 62 are cut well, whereas those around positions 17, 27, 37, 47 and 57 are cut poorly. But other regions of sequence are blocked out entirely: for example, in Figure 6(a) there is a large blank region extending from positions 85 to 130 where DNAase I cuts hardly at all. It is especially important that data such as these be analysed in a quantitative fashion by densitometry and, for that purpose, let us turn to the differential probability plot shown in Figure 6(c). Here we are taking the difference between two numbers, In (probability, core) - In (probability, linear), and plotting this difference for each bond individually throughout the entire length of the sequence of both strands (except at either end, where accurate measurements become difficult). No cutting nucleosome previous analysis of periodicities has been carried out in such fine detail, so let us study the plot carefully to see what information can be gained. First of all, it seems clear that favoured positions of cleavage within nucleosome core DNA lie roughly at intervals of ten nucleotides, as would be expected for a right-handed double helix lying on a protein surface. By taking the average positions of maxima and minima on the two strands, one may deduce which regions of the DNA minor groove face outward and which face inward. For example, in the vicinity of the sequence A-A-A-A-T-T-A spanning positions 27 to 34, minima are centred on position 30 of the upper Watson strand and position 26 of the lower Crick to give a best position of (30+26)/2 = 28 for the most inward-facing part of the minor groove. By use of this method, we can assign positions 18, 28, 39, 49, 60, 70, 80, 90, 100, 112, 121 and 131 to the inner surface of the DNA

782

H. R. Drew and A. A. Travers

DNAasc

- - wctson

I

(0)

Fig. 6.

783

DNA Bending

DNAast

Frtt

I

I

COW

t

--

I

+

60

(bl

Fig. 6.

Crick

Fret

COW

H. R. Drew and A. A. Travers

Ln (probability

-4 -

of

cleavage

1 :

DNAase

I , core-

;-AATTCCGGTTACCTTTAATCCGTTACGGATGAAAATTACGCAACCAGTTCATTTTTCTCAACGTAACACTTTACAGCGGC~CCT 0 . Iii . JO . 30 . 40 . if’ . AAGGCCAATGGAAATTAGGCAATGCCTACTTTTAATGCGTiGGTCAAGTAAAAAGAGTTGCATlGTGAAATGTCGCCG~GCA

linear


.

.

8

;-

--

4

_-

6

.

i

-2 o-

CATTTGATATGAAGCGCCCCGCTTCCCGATAAGGGAGCAGGCCAGTAAAAAGCATTACCCCGTGGTGGGGGTTCCC -4 -

80GTAA~CTAT%~TTCECGGG~~GAAEGGCT;;~TCCC;CGT~~GGT~ATTT~~CGT~ATGd~CACC~CCC~~AAGEGCT

-2 o-

.

.-

.

-3’ -5

0 _ i?

+2 -

(cl Figure 6. Digestion of the tyrT core complex by DKAase I. Electrophorrtir profiles of digestion for the (n) \2’atson and (b) Crick strands. (c) A difference probability plot. Before reconstitution. tyrT DX.4 was labelled at caithrr of its 3’ ends using reverse transcriptase; this radioact,ively labelled DPL’A was mixed with chicken nucleosomr c~,res to nlake +I tyrT core complex. Products of digestion were fractionated on 8% polyacrylamide gels containing 7 n-urru: for morn detail, see Materials and Methods. Hatched regions in (c) identify locations of enhanred cleavage.

supercoil, and positions 13, 23, 33, 44, 55, 65, 74, 84, 94, 106, 116 and 126 to its outer surface. The cross-strand stagger of maxima and minima now appears somewhat variable, but seems in an overall sense to be slightly larger than before, about three to four bonds instead of just two; and this difference may be interpreted in terms of an altered containing slightly fewer helix conformation residues per turn. Indeed, the periodicity of cutting in nucleosome core DNA is reduced somewhat from the value of 10.56 bp found for the circle. Now the relative positions of minima differ by 131- 18 = 113 bonds over 11 periods to give 113/l 1 = 10.27 bp per period: while the positions of maxima differ by 126 - 13 = 113 bonds over 11 periods to give the same value. A linear plot of the positions of maxima and minima (not shown), using all data and not just the two extremes, gives a more accurate value of 10.32. Because of the detailed geometry of the st,ructure, discussed by Klug & Lutter (1981), this nuclease periodicity (of 10.32 bp per turn) sets an upper bound to the structural periodicity of DNA within the core complex. It compares with a value of 10.4 for the nuclease periodicity of mixedsequence DNA on the nucleosome core (Lutt,er, 1979). Although it is clear that the rotational setting of the DNA on the nucleosome is well defined it is not eert,ain exactly where along the path of the DSA the protein is located. A careful inspection of gel photographs suggests that the rightmost end of the

tyrT sequence (positions 140 to 160) remains almost whereas the leftmost find free from protein. (positions 0 t)o 15) appears Cghtly bound. Since thr histone octamer protects approximakly 140 bp of DNA from enzymatic cleavage, t,his would place one end of the DNA supercoil near position 0 and the ot- ot positions 65 to 75. Certain variations in cutting probahilit~ were observed by Lutter (1978) in his study of mixedsequence nucleosome cores. and these have bc~r attributed to tight contacts between protein ~lncl DNA, or to irregularities in the pat,h of’ the 1)X=\ as it winds around the protein: the more it is bent. t hc, less it is cut (Richmond et nl., 1984). Similar irregularities are observed here: tbr esa~mplr. the> weak cutting associated with maxima at ver? positions 94 and 106; but the ~orresporldcnct, between Lutter’s data and ours is not auficicntl> rigorous t,o use this as a method of’ tk%wmining where along the path of thr I)NA tk fjrotein lies. One other quesbion of crit,ic*al importnncf> i+ whether the directionality of bending remains the same in the core as in the c:ir&t. (‘omparisotl of Figures 5(c) and ti(c>) rthreals that fhr angular orientation of the DNA rtmains largely c~mser~ti t,o wit,hin orw bond in going from circlr to (Lore. with

DNA

positions 18- 19 on the inside of the curve at one end of the molecule and positions 121 to 124 on the inside at, the other. The few slight differences that are observed mav be attributed to a reduction in double-helical tw&, from 10.56 to 10.32 bp per turn or less, upon nucleosome formation. regions what. about of enhanced Finally, cleavage! Three instances of this appear at positions 30 Crick, 72 Crick and 74 Watson in sequences are where the Figure 6(c), A-A-A-A-T-T-A and G-C-G-G-C-G-C-G, respectively. Neither of these sequences is cut especially well by DNAase I in their linear form, presuma,bly on account of their narrow or wide minor grooves; so we must ask how these grooves become more intermediate in size by wrapping around the histone octamer. In a very tightly bent DNA molecule. all of the minor grooves on t,he outside of the coil become very wide (17 8): while those on the inside become very narrow (9 A); it is only those grooves on top or bottom that become intermediate in size (see Fig. 2 of Richmond et al., 1984; or Fig. 9 of Epstein, 1985). Thus, from a knowledge of enzyme specificity, one might, expect that all t’hree regions of enhanced DNAase I sensitivity noted in Figure 6(c) should lie along the top or bottom surface of the DNA supercoil, rather than along its outer edge. Indeed, this is precisely what is observed. A series of maxima at positions 22: 42, 53, 64, 84, 94 and 104 define the outermost edge of the Crick strand; both regions of enhanced cleavage, 30 Crick and 72 Crick, lie offset by two bonds from the expected maxima at positions 32 and 74. Similarly, a series of maxima at positions 25. 35, 45, 56, 66, 86, 96 and 107 define the outermost edge of the Watson strand; the region of enhanced cleavage at 74 Watson lies offset by two bonds from the expected maximum at, position 76. This section has included a precise description of what ha.ppens when a promoter DNA from E. co& is reconstituted wit,h t’he histone octamer: (1) the DNA minor groove becomes exposed for cleavage with a cutting periodic+ of IO.32 bp; (2) t,he protein adopts a well-defined translational orientat,ion with respect to the primary DNA sequence, although it is difficult to be certain of the exact placement of the histone dyad: and (3). most importa.nt1-y. the angular setting of the DNA remains conserved in going from circle to core. This final observation suggests that the rotational preference in nucleosome positioning may stem largely from t,he innate tendency of a DNA molecule to bend in some preferred direction, according to its base sequence. Hut is tyrT typical of other nucleosome core sequences that have been isolat’ed from natural sources? We show now that t’his is the case. (d) Statistical

srquencing

of chick

core DNA

If one prepares nucleosome core particles from chicken blood. then isolates the 147 bp DNA by

Bending

785

digestion with proteinase K: labels the ends with and does a sequence radioactive phosphorus analysis by the Maxam-Gilbert procedure, all four sequence t.racks (G +A, G, C+T. C) will look rsther alike. No clear or convincing modulations in band intensity will be apparent, at’ least if the sample has been prepared properly. If one then performs a similar experiment, but looks for runs of G +C or runs of A+T (by a method to be described below). t,he result shown in Figure 7 is obtained. Figure 7 shows the densitometer t,racings from two control lanes (a and 1)) and two “statistical” sequencing tracks (c and d). Both strands of t.he DN4 have been labelled at their 5’ ends, and all numbers refer to distance in nucleot’ides from the 5’ end. The particle dyad lies at posit,ion 14712 = 73.5 in the base sequence, or position 73.5 + 1.5 = 75.0 in the present numbering, once t,hc characteristic stagger of DNAase I cleavage sites has been taken into account (Lutter, 1978). Curve a is the uncut starting material. It exhibits two peaks near the right-hand end of the trace: a small one at position 106 and a large one at position 128. These are the result, of micrococcal nuclease digestion wit)hin the core during prepa,ra,tion of the particle from Hl-stripped long chromatin (Cockell et al., 1983); for present) purposes they should be ignored. Curve b shows a DNAase T digest of naked core DNA. A fairly uniform distribut’ion of fragment lengths is obtained, apart from a small. peak at position 55. to which we do not attribute an! significance. Curve c is a DNAase I digest of core l>?iA in the presence of distamycin, an antibiotic that) binds selectively to runs of four or more A .T base-pairs. It prot’erts t,he double helix from enzymatic cleavage t,hroughout its binding site. and sometimes enhances the rate of cleavage in nearby runs of G +C (Van Dyke et al., 1982; Fox & Waring, 1984). The binding of this drug to mixed sequence core DNA produces minima in the pattern of I)NAase I digestion at positions 31. 41, 51, 61. (71 absent). 81 (weak), (91 absent), 101 and 11%. Tt produces maxima at 25, 36, 46. 56, (66 absent), 75. (86 absent). 95 (weak), 106 and 117. The absolute variat.ion in band int,ensity may be as great as 30 to 4004, judging from t,he zero marker on t’he left-hand side of the trace. The clear interpretation of this result. is that posit’ions 31, 41, . : 112 in mixed-sequence core DNA are rich in runs of A+T, whereas positions 25, 36, . . . 117 are not. The periodic&y of this sequence modulation now corresponds. we assume. t’o the periodic rotation of the double helix along the surface of t,he nucleosome. It is found by difference to be approximatBel\ (112.31)/ the 8 = 10.13 bp using minima (115-25)/g = IO.22 bp using the maxima. Since thoi minor groove faces outward at position 75. which is the particle dyad (Lutter, 1978). one may further deduce on this basis that all of the distamycininduced minima (31, 41, etc.) correspond to places

786

H. Ft. Drew and A. A. 7’raver.s

Figure 7. Statistical sequencing of chicken core D&A. Densitometer tracings of’& samples; (a) no rn~yn~. no &ug: tllr 2 peaks at 106 and 128 are due to single-strand cleavage by micrococcal nuclease during preparation of th
where the minor groove faces approximateIF inward, toward the histone octamer. interpretations are considerably These strengthened by the tracing shown in curve d. which is a DNAase I digest of core DNA in t,he presence of chromomycin. Now the modulations seen in curve c are reversed, with minima becoming maxima and vice versa. This is because chromomycin binds selectively to runs of four or more G . C’ base-pairs, exactly the reverse specificity of distamyrin. It protects the double helix from enzymatic cleavage throughout its binding site, and sometimes enhances the rate of cleavage in nearb) runs of A +T (Van Dyke & Dervan, 1983: K. Fox, unpublished results). The binding of chromomycin to mixed-sequence core DNA produces minima in the pattern of DNAase I digestion at positions 25, 35, 45, 55, 66 (weak). (76 absent), 86 (weak), 97, 108 and 118. Maxima are observed at positions 30, 40, 50, 61, 71 (weak), (81 absent), 91, 103 and 112. The minima are spaced approximately at intervals of (1 l&25)/9 = 10.33 bp, while the maxima lie (112-30)/s = lo-25 bp apart. The position of the particle dyad (75) lies in helical

phase with several nearby minitna in the chromemycin t.rack (lifi, 66. 86 and 97); so sequences in these regions must be rich in mns of’ (; +(‘, with their minor grooves f&cing out. A linear plot of all t,hP maxima and minima gives an optimal value of 10.17( +@05) bp for the two drugs c>ombined (set, Fig. 3). Two other commonly- used antibiotics, atztino(:p(‘) and mycin (specific for the dinucleotidr echinomycin (specific for CpG). were tested. ThestB drugs did not significantly modulate the pat,tern of DNAase T cleavage at concentrations where theil base specificity remains well-defined (Fox 1?1Waring. 1984: Low et al.. 1984: ‘l’an I)yke & Dervan, I 984). A sample of core DNA from beet’kidnr~y was used to confirm that thr results shown here are not species-specific. When treated with I)X;Aase 1 in t’hr presence of distamycirt. patt,prns of cleavage in htaet kidney (‘ore DXA appea,r similar to those shown in caurve C’ of’ Figure 5 hut are slightly less well resolvrd.

DNA

exhibits a periodic fluctuation of 10*17( +0*05) bp in Secondly, the observed its sequence content. fluctuation is not primarily in single-nucleotide composition, but relates to the angular disposition in short, runs of (A, T) or of (G, C). This kind of argues strongly that the sequence variation rotational orientation of DNA within the nucleosome is determined primarily by certain directional bending preferences of the DNA, rather than by any specific protein-DNA contact. Finally, one should note that the modulations seen in tracks c and d are not perfectly continuous: they become weak or disappear in the centre of the particle, positions 66 to 86. When examined in the crystal, the path of the DNA in this region appears less circular and more sinusoidal than in other locations (Richmond et al., 1984). It seems, therefore, that a change in the plane of bending correlat,es with a change in sequence content.

4. Discussion In this article we have learned a little about DNA a few things about protein-DNA bending, recognition, a great deal about nucleosome core DNA, and perhaps nothing at all about chromat’in. Let us consider each of these subjects in turn. (a) DNA

bending

The phenomenon of DNA bending came into the forefront several years ago when it was discovered by Crothers and colleagues that certain definedsequence fragments of kinetoplast DNA were naturally bent, as a simple consequence of their nucleot,ide sequence and not through interaction with anv protein (Marini et al., 1982; Hagerman, 1984; gu & Crothers, 1984). Now it seems that many, if not most, DNA molecules from natural sources may be bent somewhat due to heterogeneities in their local structural composition, and that kinet,opl& DNA was just an extreme example (Bossi & Smith, 1984). How does this bending work? Can we predict the extent and direction of bending from sequence considerations alone? As the result of work presented here, it now appears that we may be able to predict in which direction a DNA molecule will bend: but we cannot predict how extensive the bend will be. An overall curvature of the helix axis results from building a long base-pair stack out of variously shaped pieces: if an oddly shaped piece is placed every helix turn (10 bp), this will cause the stack to bend: yet if the same odd piece is placed every half-helix turn (5 bp), then the stack will remain straight though distorted. Originally it was thought that the oddly shaped sequence could only be a short run of homopolymer (dA) * (dT), such as X-A-A-A-T, but) now we know that both A+Tricsh and G +C-rich sequences may have helical caonformations different from that, of mixedsequence DNA (Drew & Travers, 1984; McCall et al., 1985). Tf A + T-rich and G + C-rich sequences

787

Bending

are set at a half-period separation in a sequence such as A-A-A-A-X-G-G-G-G, then t,his should set the plane of bending quite strongly: the minorgroove edges of A. T pairs will face inward towards the centre of curvature, whereas the minor-groove edges of G *C pairs will face out. It’ is less clear, however, whether the extent of bending can be enhanced by placing two different sequence elements within the same helix t’urn. Perhaps the helical conformation of DNA cannot vary rapidly enough, in the absence of protein, to let the basesequence information be expressed. In any case, a definite distinction should be made between sequences that are bent to begin with, and sequences that are not bent of their own accord but may be bent by external forces to yield a unique structure. (b) Protein-DNA

recognition

When proteins bind to DNA, then t’he rules change somewhat. The protein will select for a certain direction and extent’ of bending? and it is only important whether the DNA sequence in question can fit into the chosen shape. It is not necessary that the sequence be bent free in solution before interaction with the protein. Several specific examples serve to illustrate this point’. The tyrT promoter, used here as a model system to study DNA bending, extends upstream from the start site of transcription for about 100 nucleot’ides (Lamond & Travers, 1983). Several blocks of homopolymer (dA) * (dT) lie at positions - 50, - 70 and these and -88 relative to the startpoint, sequences are conserved among a wide variety of other promoters for transfer RNA and ribosomal RNA in E. coli (Travers, 1984). This DNA does not appear to be bent very much in the absence of protein but, once it closed into a small circle, then all three blocks of (dA) +(dT) lie with their minor grooves along the inner surface. A similar angular orientation is observed in the ceomplex of this DNA with RNA polymerase (Travers et al., 1983) where, presumably, the polymerase lies on t’he inside of a gentle curve. In a related case. hi& from Salmonella, the upstream DNA is actually bent) somewhat in the absence of protein. and a 3 bp deletion mutation that removes the curvature also reduces promot’er activity (Bossi & Smit,h, 1984). Many eukaryotic t’ranscription factors, notab TFTIIA from Xenopus, prot)ect’ up to 50 bp of DNA from enzymatic cleavage, yet somehow manage to induce regions of enhanced cleavage within their binding sites (Sakonju & Brown, 1982). It will be interesting to see whether these regions of enhanced sensitivity can be explained by any of the structural arguments used here for DNA bent into a circle, or wrapped around the histonr oc>t>amer. (c) The question of selectivity in isolation of nucleosorne cores

It could be argued that the nucleosome core DNA used in our “statistical” sequencing experiment

788

/I. R. Drew and A. A. Tra~vers

represents a special populat,ion of molecules. due to the use of micrococcal nucleasr in the isolat,ion procedure. Micrococca,l nuclease prefers strongly to cut at’ A or T residues as opposed to G or C (e.g. see Cockell et a,l.. 1983; Drew 1984). One might itnaginc that overdigestion wit,h this enzyme could produce a subset populat’ion of molecules t’hat would be depleted in A +T-content (McGhee & Felsenfeld, 1983). Yet, as described in Materials and Methods, we recover at least SOY/, of the core DNA molecules from Hl -stripped chicken polynucleosomes. No more than 20%. perhaps less, is lost during purification. Sequence analysis of 109 independent clones from this SOoi;, population yields a mean A +T-content of 57.496 very close to the 57.30/, of chicken blood DNA in bulk (8. Satchwell. unpublished results); so t,he possibilitv of sele&on by depletion in A + T-content can be ruled out,

With the crystal struct’ure of the nucleosome core solved to a resolution of 7 A (Richmond et al.. 1984). it is now possible to make some definitive statements concerning the long-standing issue of structural periodicity in core DNA and its relation to the change in linking number upon nucleosome formation. For the discussion that will follow, we define the local twist as the instantaneous torsion about a moving helix axis tangential t,o the space curve of the molecule (Crick, 1953, 1976). In a, supercoil this is not the same function as the angle between two successive base-pairs in a laborat,ory frame of reference. We obtain a mean value of 10.32 bp for the cutting periodicity of DNAase T within the core and, as explained by Klug & Lutter (1981), this sets an upper limit to the periodic rotation of the double helix. By a novel method. statistical sequencing, we obtain a mean value of IO.17 bp for the modulation of sequence content within a mixed populat’ion of chicken core DNA molecules; and this number of 10.17 can be identified directly with the average periodic rotation of the DNA4 as it winds along the surface of the protein. This number differs sub stantially from the helical repeat of 10*6( +O.l) bp turn for the same DNA when freed from t)he nucleosome (Rhodes & Klug, 1980). On the basis of the sequence-dependent preferences for bending deduced in the first, two experiment’s of this paper, it appears experimentally that periodicities in ba,se sequence are being used to facilitate the tight bending of DNA as it wraps around the protein core, by being placed in the appropriate rotational setting. We therefore conclude that the average sequence periodic@ can be equated to the average local twist of the double helix. Then every 10.17th residue. so to speak, would be brought into a regularly repeated equivalent position on the nucleosome. So if the pat,h of the double helix on the nucleosome core followed a uniform superhelix the measured average periodicity would obtain at each point. However.

examination of thfb crystal structure of the nucleosome shows that deviations from sucbha path are substantial. Therefore the value of the local twist, may vary along the pat,h of thr superhelis and. at any one point. differ from the average value of IO.1 7 hp. Such variations would not. however. 1)~ themselves affect, the caalculat’ion of linking number that now follows. How do these new data bear on the so-c~llrd “linking number paradox”, where the 1)NA maktas approximat,ely two left-handed t,urns around t’hr> hist,one oct,amer but only one t,urn appears in ii topological sense! (i.e. there is a change in linking number of only about unity when t.hr DNA folds from solution into a nucleosome)! As pointed out by. Finch of al. (1977) and Klug B Lutter (1981). t hc change in linking number is given not) just by the number of superhelical turns, but by the sum of two quantit’ics: t,he number of superhelical turns plus any change in local t,wist indmed by the protrin. If the avrragck loc*al twist changes frotn IO.6 to atjout IO bp/turn t>hen there is no paradox at all. Out, (tati1 confirm this proposal. From the crystal structurra. we know t)hat one superhelical turn contains. OII average. 7.6 double helical turns and thereforcx 7% x 10.17 = 77.3 residues. The DNA can be seen to wrap about 1.8 t,urns around each histonr octamer and so the core contains 139 bp in tht> bent region (Richmond of -. So the change in linking number csa.nnot be approximat’ed sitnpty a,s t tit> number of superhelical turns creat’ed. but, must be calculated as the sum of two quant,iGs to yield - 1.X +-0.55 = - 1.25 turn. The cxahutatrd raluts of - 1.25 turns t,hus agrees closely with t.hgxmeasurecl value of about -- 1 to -- 1.25 (Germond cl Cl/.. 19iT,: Ktug & I,utt,rr. 1981).

There have been earlier theoretical at,tempts t’c~ find a caorrelation between DNA bending lt~d sequence periodicity, but, t,he detailed predictions that have been made arc not hrnc out by the experimental results. Zhurkin (1983. 1985) ha:: suggest’ed that. when DNA bends, pyrimidim purine steps prefer t,o adopt a posit,ion with minor grooves faring out and purine-pyrimidine steps with minor grooves facing in. He came to this conclusion through StudJ of the X-ray st,ruct,ure ot (‘-G-(!-C:-A-A-T-T-(‘-G-(‘-(:. done by one of us (H. I).). There, C‘-(: steps open slight,ly to the minor, groove while the single A-T st,ep opens to the major groove. Such variat,ions clearly exist, but non appear to be less important t’han variations in thtx relative dispositions of (A. 7’) and (f:. (‘j in determining how a DNA molecule bends. Trifonov (1980) and MengeritskJ- & Trifono\’ (1983) havch studied t,he periodicity of’ sequen(‘t cont’ent in total genomic DNA. From this the?. conclude that. when DNA bends. purim purim

DNA

steps prefer to occupy helical positions 5 bp removed from pyrimidine-pyrimidine steps, in no specified orientation. Further, they suggest that the periodicity of sequence content in nucleosome core DNA should be 10.5 bp, the same as in total genomic DNA. Neither of these theoretical concepts is in accord with our experimental data. If A-A and T-T steps, for example, were to occupy positions 5 bp apart,, then the two Fourier periodicities would cancel and we would not see the modulations of A +T content shown in Figure 7. Further, the periodicity of sequence content within a natural population of core DNA is 10.17 bp, not 10.5. Finally we know from many high-resolution structural analyses of D&A in the crystal (Dickerson & Drew, 1981; Wang et al., 1982; Fratini et al., 1983; Shakked et al., 1983; McCall et al., 1985) that a double helix bends preferentially into either of its two grooves, and not just in any general direction. McGhee & Felsenfeld (1983) have observed in periodicities of sequence content certain nucleosome core DNA by digestion with restriction enzymes. Their data show that Hue111 (G-G-C-C) and AluT (A-G-C-T) cut where the minor groove points out near positions 33, 43, 53, 63, etc. In another case, MspI (C-C-G-G) cuts where the minor groove points in near positions 28, 38, 48 and 58. The reported sites of Hue111 cleavage are consistent with our results and with those of other workers (Wang et al., 1982; McCall et al., 1985), all of which show that the sequence G-G-C-C opens to the minor groove for structural reasons. No X-ray data are available for a sequence A-G-C-T, but’ theory suggests that it should be similar to G-G-C-C (Calladine & Drew, 1984). The sequence C-C-G-G is an anomaly: according to the X-ray data (Conner et al., 1982; Wang et al., 1982), the minor groove should face out; yet in the sample examined by McGhee B Felsenfeld (1983) it does not. Perhaps the extensive methylation of this sequence in chicken blood D?IJA to C-“C-G-G makes it behave differently. It has been shown that bromination of a T-C-G-C sequence to T-B-C-G-C strongly influences helix “bendability” (Fratini et al.. 1983). Rurlingame et al. (1985) have presented an X-ray structure for t,he histone octamer alone, in the absence of DNA. The relation of their proposed model to chromatin is discussed elsewhere (Klug et al., 1985). It does not appear relevant t’o the present discussion, since it contains no nucleic acid. (f) Concluding

remarks

The problem of nucleosome positioning is not fully solved. In order to define the position of the histone octamer with respect to the primary DNA sequence, it is necessary to specify at least two variables: a rotation and a translation. Here we have presented evidence to show that the rotational setting of D?L’A about the histone oct’amer follows primarily from the preference t’o turn minor grooves inward at runs of A +T and outward at runs

789

Bending

of G+C; but the problem of translational placement remains unclear. One possibility is that the histone octamer may exclude all runs of homopolymer (dA) . (dT) or (dG) . (dC) longer than about 10 bp, on account of their resistance to curvature (Kunkel & Martinson, 1981; Prunell, 1982; Edwards & Firtel, 1984). Another is that the preferred direction of curvature in eukaryotic DNA may switch from one helical phase to another over 200 bp intervals, so as to exclude histones from intermediate locations. Alternatively, it may be that certain arms of the protein reach into helix grooves to form specific contacts with Dn’A basepairs (in the vicinity, for example. of the protein dyad). A related problem concerns the nature of “linker” DNA between nucleosomes in t’he 300 A fibre (Finch 8r Klug, 1976; Widom & Klug, 1985). Neither the path of the linker nor its sequence any certainty. An content are known with important observation was made by Edwards & Firtel (1984), who showed the regions of DNA that lie in the linker are cut poorly by DNAase I. From previous studies of enzyme specificity (Drew & Travers. 1984), we know that DNAase I cuts poorly at runs of homopolymer (dA) . (dT) or (dG) +(dC), so it seems likely that the linker is enriched in such sequences. This would be consistent with the earlier observation reported by Rhodes (1979) and Simpson & Kunzler (1979) that homopolymer sequences (dA) . (dT) and (dG) . (dC) cannot be reconstituted to form nucleosome cores. It will be necessary to gat’her more data of a precise nature before we can understand the implications of such results. Tn the future, we would like to be able to calculate the preferred positions of nucleosomes from sequence considerations alone. For this purpose, it will be necessary to describe DNA bending not in terms of helix groove widths, as we have done here, but rather in t’erms of the basepairs and how they stack upon one another in a curved framework. The “bendability” of the DNA can then be calculated as the vector sum of certain “roll-slide” parameters, the values of which depend on base sequence (Calladine & Drew, 1984: McCall et al.. 1985). Appropriate corrections for the “deformability” of each sequence type, and for the det,ailed shape of the supercoil, will also be necessary. We thank Drs D. Rhodes, C. R. Calladine. K. Fox and B. Rushton for supplies and advice, and are especially grateful to Dr A. Klug, under whose guidanct: the work was done. H.R.D. was supported by PHS grant no, CBO6971-03 of the Xational Cancer Instit,utr. DHHS.

References Becker. M. M. & Dervan. P. B. (1979). J. Amer. Chem. Sot. 101. 3664-3666. Bossi, L. & Smith, D. M. (1984). Cell, 39. 643-652. Brahms, *J. G., Dargouge, O., Brahms, S., Ohara, Y. & Wagner. V. (1985). J. MOE. Biol. 181. 455-465.

Burlingame. R. W.. Love, W. E., W’ang. B.-c’., Hamlin, R., Xuong, N.-H. & Moudrianakis. E. pu’. (1985). Science, 228, 546-553.

(‘alladine. C. R. (1982). J. ivoZ. Viol. 161. 343-352. (“alladine. C. R. BEDrew. H. R. (1984). J. Md. Biol. 178. 773-182. (‘ockell. M.. R,hodes. I). & Klug, A. (1983). J. ,voZ. Hiol. 170, 423-446. Conner, R. N., Takano. T., Tanaka. S.. Itakura, K. & 295, 294Dickerson, R. E. (1982). Natuw (London), 299.

(‘rick. F. H. C’. (1953). dcta Crystullogr. 6, 685.. 689, Crick. F. H. (1. (1976). Proc. Nut. dcad. Sci., i’.S..4. 73. 2639-2643. Dickerson, R. E. & Drew. H. R. (1981). J. iMo/. Hiol. 149. 761-786. Drew. H. R. (1984). J. Mol. Biol. 176, 535-557. Drew. H. R. & Travers. A. A. (1984). Cell. 37. 49lN502. Drew. H. R. & Travers. A. A. (1985). Nucl. Acids Res. 13. 4445-4467. Drew, H. R., Weeks, J. R. Kr Travers, A. A. (1985). EMBO J. 4. 102551032. Edwards, C. A. & Firtel, R. A. (1984). J. NoZ. BioZ. 180. 73-90. Epstein. D. (1985). New Sci. 106 (1451). 29-32. Finch. ,J. T. & Klug, A. (1976). Pro<. .Vut. Acad. Sci.. I:.S.d. 73. 1897-1901. Finch. ,J. T., Lutter, L. (‘.. Rhodes, D.. Brown. R. S.. Rushton, B.. Levitt, M. & Klug, A. (1977). Xaturr (London),

269, 29-36.

Fox, K. R. & Waring. M. (1984). Xucl. Acids Res. 12. 9271-9285. Fratini. A. V.. Kopka, M. L.. Drew. H. R. B Dickerson. R. E. (1983). J. Riol. (Them. 257. 14686-14707. Grrmond, ,J. E., Hirt. B., Oudet, P.. Gross-Bellard. M. 8 Chambon. P. (1975). Proc. Xzt. ilcad. Sci., F.S.d. 72. 1843-1847. (:ottschling. D. E. & Crch. T. R. (1984). (‘ell. 38. 5Olm 510. Hagerman. I’. ,I. (1984). I’roc. Na,t. dead. SC?., I-.S.il. 81. 4632-4636. Horowitz. D. J. & Wang, .J. c‘. (1984). ,/. &Z. HioZ. 173. 75-91. Keene, M. A. & Elgin, S. C. R. (1984). (‘ell, 36. 12l~ml49. Klug. A. & Lutter. L. C. (1981). LVucl. Acids Res. 9, 426iF 4283. Klug. A., Finch, ,J. & Richmond. T. (1985). Science. 229. 1109~1110. Kunkrl. G. R. & Martinson. H. (:. (1981). ,l’ucl. =Icids Rrs. 9. 6869-6888. Lamond, A. I. & Travers. 4. A. (1983). Yaturr (London). 305, 248-250. l,omonossoff, G. P.. Butler, P. J, G. & Klug. A. (1981). J. Mol. RioZ. 149, 745-760.

Low. L.. Drew. H. R. & Waring. &l. (1984). .Vuc/. .&,u~.s RPS. 12. 4865-4879. Lut,ter. L. (‘. (1978). ,/. .UoZ. Biol. 124. 39-420. Luttrr, L. (‘. (1979) NucZ. Acids Res. 6, 41 -56. Marini. ,I. (‘.. Levrnr. S. I).. Crothers. 1) M. & Englund, P. T. (I 982). I’roc. Xut. Acarl. Sci., f -.5’.,4, 79. 7664 7668. McCall. M. .J.. Brown. ‘I’. & Kennard. 0. ( 1!%5). J. No/. Biol. 183, 385-396. 3lcGhee. .I. 11. & Felsenfeld. (4. (1983). (‘rll. 32. ld(h5 1215. Mengeritsk),. (:. & Trifcmov. E. S. (1983). .Vuc/. .-lcids Res. 11. 3833~~385I Palen, T. E. & Cech, T. R. (1984). (‘rll. 36, 93%!)42. Prunell, A. (1982). E’&ZBO J. 1. 173 179. R’amsay. ?r’.. Felsmfeld. (i.. R’ushton. H. & .UrGhee. . R. B Klug, A. (1980). S~trrrc (London), 286. 573-578. Richmond. T ,J.. Finch. ,J. T.. K,usht,on. Ii.. Rhodes. I) & Klug. A. (1984). ,V&urr (London). 311. 532-5X. Sakonju. S. & Brown. J.). I). (1982). (‘e/l, 31. 395-405. Shakked. Z.. Rabinovicah. I>.. Rennard. 0 ( ‘Y~ISI~. W. B. T.. Salisbury. S. .A. & Viswamitra. 11. .\ (1983). J. Mol. Rio/. 166. 18% 201. Shore. 1). & Baldwin. R. 1,. (1983). J. :blol. Wiol. 170. !45i 981. Siebfxnlist. r.. Simpson. Ii. 8: (:ilbrrt. \\‘. (1980). (‘r/i 20. %69--S I Simpson, R. 7’. KT Kanzler. I’. (19i9). .\‘crc./. .-lrlds /fr.v. 6. 1387 1415. Travrrs, ;\. :\. (1984). 9ucl. .4cids Krs. 12. %05-%1X Trarers. ‘-1. A.. Lamond. A. 1.. Mace. H. .J. F. k I
79. :396%A97r’.

1Vidom. .I. (1985). Hioessclys. 2. 11 I-i. \$‘idom. ,I. R Klug!. A. (198.5). (‘~11. in the press. \z’u, H. & C’rothers. 1). M. (1984). .lir/ure (/,orrdon). 308. 309 5 1:I. Zhurkin. \Y. B. (1983). b’EBS Letters. 158. 2!W 297. Zhurkin. \.. IS. (1985). .J. BiomoZ. Strrrct. I),yrtcrrn. 2. 7% 804.

.Vototradded iv1proof. Two rerent articles by Thotna C Simpson (,V~tcr~ (Lorrdo,/ /. 315 ( 19%). SO 2.Y) at~tl Linxweiler & Horz (CleZZ42 (1985). 281-290). argue that seyuencr-drpentlrnt interactions between histones and DKA. such as those described here, play a decisive role in the positioning of nucleosomes iu ~‘//YJ and in vitro. Edited

hy J. (‘. Kendrew