DNA-bending properties of TF1

J. Mol. Biol. (1991) 221, 777-794

DNA-bending Properties of TFl George J. Schneider?, Michael H. Sayre$ and E. Peter Geiduschek Department of Bioloau and Center for Molecular Genetics University of Califohia, &‘I_&Diego, La joEla, CA 92093-0634, U.S.A. (Received 10 December 1990; accepted 3 June 1991) Transcription factor 1 (TFl) is the Bacillus subtilis phage SPOl-encoded member of the family of DNA-binding proteins that includes Escherichia coli HU and integration host factor, IHF. A gel electrophoretic retardation method has been used to show that a TFl dimer binding to one of its preferred sites in (&hydroxymethyl)uracil (hmUra)-containing DNA sharply bends the latter. In fact, the DNA-bending properties of TFl and E. co&iIHF are indistinguishable. Substitutions at amino acid 61 in the DNA-binding “arm” of TFI are known to affect DNA-binding affinity and site selectivity. Experiments described here show that these substitutions also affect DNA bending. The selectivity of TFl binding is very greatly diminished and the affinity is reduced when hmUra is replaced in DNA by thymine (T). An extension of the gel retardation method that permits an analysis of DNA bending by non-specifically bound TFl is proposed. Under the assumptions of this analysis, the reduced affinity of TFl for T-containing DNA is shown to be associated with bending that is still sharp. The analysis of the TFl-DNA interaction has also been extended by hydroxyl radical (9OH) and methylation interference footprinting at two DNA sites. At each of these sites, and on each strand, TFl strongly protects three segments of DNA from attack by OH. Patches of protected DNA are centered approximately ten base-pairs apart and fall on one side of the B-helix. Methylation in either the major or minor groove in the central ten basepairs of the two TFl binding sites quantitatively diminishes, but does not abolish, TFl binding. We propose that multiple protein contacts allow DNA to wrap around the relatively small TFl dimer, considerably deforming the DNA B-helix in the process. Keywords:

DNA-protein complexes; transcription factor 1; phage SPOl: DNA-bending proteins; HU proteins

tein, also called HU, is a heterodimer, and the relatively less abundant E. coli integration host factor (IHF) is a heterodimer of slightly larger subunits (93 to 98 amino acid residues). The experiments that are described and analyzed in this paper deal with a type II DNA-binding protein called TFl (for transcription factor 1). TFl is encoded by the Bacillus subtilis phage SPOl, and was the first DBP II to be identified and purified (Wilson & Geiduschek, 1969; Johnson & Geiduschek, 1972). In phage SPOl DNA, (5hydroxymethyl)uracil (hmUra) replaces thymine. TFl binds preferentially to DNA containing hmUra (Johnson & Geiduschek, 1977). TFI also exhibits a strong binding preference for certain sites in the SPOl genome (Greene & Geiduschek, 1986o). The property of hmUra-specific binding sets TFl apart from all the other DBP II; the property of siteselectivity is shared with IHF (Craig & Nash, 1984). The preferential binding properties of TFI are thought to determine its ability to selectively

1. Introduction The type II DNA-binding proteins (DBP 110) are prominent components of bacterial chromatin, both by reason of their relatively high abundance and because more is known about them than about other members of an incompletely defined group of proteins (Gualerzi & Pon, 1986; Pettijohn, 1988; Kellenberger, 1988). Most of the type II DNA-binding proteins are homodimers of 96 to 91 amino acid subunits, but the Escherichia coli prot Present address: Gen-Probe, Inc., 9880 Campus Point Drive, San Diego, CA 92121,U.S.A. $ Present address: Department of Cell Biology, Stanford University School of Medicine, Stanford, CA 94305, U.S.A. $ Abbreviations used: DBP II, type II DNA-binding proteins; HU, E. co& type II DNA-binding protein; IHF, E. IX& integration host factor; TFl, transcription factor I; hmUra, (5,-hydroxymethyl)uracil; bp, basepair(s); kb, 10’ base-pairs; DMS, dimethyl sulfate. 777 002%2836/91/190777-18

$03.00/O

0

1991 Academic Press Limited

778

G.

J. Schneider et al.

inhibit transcription of hmUra-containing DNA by bacterial RNA polymerases in vitro. TFl is essential for phage SPOl development (Sayre & Geiduschek, 1988). Under non-permissive conditions, a temperature-sensitive mutant of TFl is defective in viral gene regulation and is surmised to be defective in phage-head morphogenesis (Sayre & Geiduschek, 199Oa). The following salient characteristics of the interaction of TFl with preferred binding sites in SPOl DNA are known. The unit of DNA binding is a TFl dimer (Schneider & Geiduschek, 1990), which binds to a preferred “core” binding site. Nested higherorder complexes (Greene & Geiduschek, 1985a; Greene et al., 1986a,b) containing two, three and more TFl dimers (Schneider & Geiduschek, 1990) form at higher protein concentrations by lateral accretion of protein to a core-protein-DNA complex. SPOl DNA is compacted and negative supercoils are restrained by TFl binding (Johnson & Geiduschek, 1977; Greene & Geiduschek, 19856). The determination of the structure of the Bacillus stearothermophilus DBP II by X-ray crystallography (Tanaka et al., 1984; White et al., 1989) has been important in guiding thought about how the related TFl interacts with DNA. The dimeric B. stearothermophilus protein has a tightly packed body that is stabilized by hydrophobic interactions; two antiparallel B strand arms, one for each monomer, radiate from the body of the protein in a way that suggests their ability to interact with DNA (Tanaka et al., 1984). TFl is identical with the B. stearothermophilus DBP II at 42 of the latter’s 90 amino acid residues; many substitutions are conservative with regard to polar or hydrophobic character. TFl does deviate strongly from homology with DBP II in a segment of the arm and also in its C-terminal nine amino acid “tail”. The tail of TFl is absolutely required for DNA binding (Sayre & Geiduschek, 1988). A Trp residue replacing the wildtype Phe at amino acid 61 in the arm of TFl has been shown to lie in one of the DNA grooves (H%rd et al., 1989b). Another substitution at the same position, Phe + Arg, generates a leaky temperaturesensitive phenotype (Arg is the amino acid at position 61 in all other known DBP II), while the uncharged hydrophilic Ser and Gln very severely diminish DNA binding in vitro (Sayre & Geiduschek, 1990b). Thus, the arm of TFl also plays an important part in DNA binding. In these experiments, we analyze DNA bending that occurs when a dimer of TFl binds at a preferred site in hmUra-containing DNA, and show that substitutions at amino acid 61 affect the gel retardation properties of protein-DNA complexes. We suggest a way of analyzing DNA bending by TFl and related proteins when they bind nonspecifically, and use the method to compare DNA bending in T-containing and hmUra-containing DNA. We further analyze the TFl-DNA interaction by methylation interference and hydroxyl radical footprinting and present a model of the protein-DNA interaction.

2. Materials and Methods (a) Puri$cation of DNA probes DNA-bending probes were prepared by ligating a fragment of SPOI DNA into pCY4AR,, a derivative of plasmid pCY4 (Prentki et al., 1987b). The leftward EcoRI site in pCY4 was eliminated by partial EcoRI digestion followed by treatment with the Klenow fragment of DNA polymerase. After ligation, the DNA was used to transform E. coli HBlOl, and the desired AR, construct was identified by restriction analysis of miniprep plasmid DNA from ampicillin-resistant colonies. pCY4AR, was cut with BgZII and EcoRI and then passed over a BioGel A-05 m column to separate the 22 bp BgETI-EcoRI fragment from the remaining plasmid DNA. A 191 bp DNA fragment that contains a TFl corebinding site was cut from the 5’ end-labeled SPOl DNA fragment RB400 (Greene et al., 1986u) by BstYI and purified on a 4% (w/v) polyacrylamide gel. This fragment (RY191) was ligated to pCY4AR, cut with BgZII and EcoRI in an approximate molecular ratio of plasmid to insert of 50 : 1 for 4 h at 25°C. The ligation products were extracted with phenol/CHCl, and precipitated with ethanol. After resuspension in water, the sample was distributed into 5 portions for cutting with HindIII, B&NI, EcoRV, NheI or BarnHI. The 575 bp fragments diagrammed in Figure 1 were purified from these 5 digests by polyacrylamide gel electrophoresis. Probes for methylation interference and hydroxyl radical footprinting were prepared from a 1% kb BstYl fragment of SPOI DNA that contains the P,4, 5 and 6 promoters. (There is 1 copy of this fragment in each of the long terminal repeats of the SPOl genome.) Fragment YD89 was cut from RY191 with DdeI. RK131 was cut from the P,6-containing fragment RY.500 (Schneider & Geiduschek, 1990) with KpnI. (b) Hydroxyl radical footprinting The hydroxyl radical footprinting procedure of Tullius & Dombrowski (1986) was carried out’ as follows: TFl-DNA complexes were formed in 20 ~1 of binding buffer (Sayre & Geiduschek, 1990b) lacking glycerol. In all, 2 /*l of 3 mM-Fe(NH,),(SO,),, 3 mM-Na,EDTA. 20 mM-sodium ascorbate, made fresh from solid reagent~s. were mixed into the binding reaction, immediately followed by 2 ~1 of 0.6% (v/v) H,O,. The reaction was stopped after 1 min incubation at room temperature by the addition of 80 ~1 of 1 M-LiCl, 5 mM-Na,EDTA, 0.1 y/o (w/v) SDS, 12.5 mM-thiourea, 62.5 pg glycogen/ml. Each sample was extracted with phenol/CHCl, and precipitated with ethanol before analysis on a denaturing polyacrylamide gel. (c) Other methods and

materials

Other experimental procedures and sources of materials have been described by Sayre & Geiduschek (1990b). FOI ease of reference, we add that protein-DNA complexes were separated by electrophoresis on 4% (w/v) polyacrylat room amide gels (29 : 1 acrylamide/bisacrylamide) temperature in 49 mM-TBE buffer (49 mw-Tris base, 49 mw-boric acid. 1 mM-Na,EDTA (pH 8.3): Maniatis et al.. 1982). unless otherwise noted. (d) Correlating

gel retardation

and DNA

bending

The relative mobilities of DNA fragments containing different numbers of A,.T, tracts spaced at 10 bp inter-

DNA-bending Properties of TFl

(a )

120

5’GATC~ACGCTGTGTkAAATTTTA&lAAAAGGT 3'CTAGGTGCGACACATTTTTAAAATGTTTTTTCC

270

300

GACA~AGGACTTA~TGCAGGTGG~TGAGAAGTA~GAGCAGTGC~ACATAG CTGTCGTCCTGAATAACGTCCACCGACTCTTCATACTCGTCACGGTGTATC (b) Figure 1. Structures of bending probes. (a) 171 bp BstYI-EcoRI fragment of SPOl DNA (open bar) containing a highaffinity TFl-binding site (filled bar) was ligated between the direct repeats in pCY4AR, cut with BglII and EcoRI (thin line). Positions are numbered from the 3rd A in the filled-in EcoRI site in pCY4AR,. The numbers in bold type refer to the sequence in (b). In all, 5 probe fragments of essentially equal size (577 to 581 bp) were generated by digestion with the specified restriction enzymes and are shown in the diagram. The arrowheads mark the center of each probe fragment. (b) Sequence of the SPOl DNA insert; (5hydroxymethyl)uracil residues are connoted by T. The preferred binding site for TFl (the filled bar in (a)) is underlined; the -35 and - 10 consensus sequences of promoter Ps4 are bared and the transcriptional start site is indicated by an arrow. The bottom DNA strand is the transcriptional template at Ps4. The G residues at positions 116 and 306 are part of the bounding B&Y1 and EcoRI sites, respectively. The numbering is consistent with Greene et al. (1986a) at the left, but differs from the previously published partial sequence of SPOl fragment RB400, which contains this sequence, by the addition of 3 G.C base-pairs around position 190.

vals (center-to-center) has been used to estimate the bending angle of protein-DNA complexes (Thompson & Landy, 1988). Estimates of the bending angle introduced by a single A,. Td tract range from 17” to 21” (Koo et al., 1990). Following Thompson & Landy (1988) a value of 18” was used here. Eleotropboretic mobility in gels becomes relatively insensitive to the number of A, tracts for larger number of tracts, as also found by Zinkel t Crothers (1990). The empirical procedure of Thompson & Landy (1988) relies on 2 assumptions: (1) that a potentially highly localized bend in a protein-DNA complex can be adequately modsled by the cumulative bending of helically phased A, *T,, segments; and (2) that the effect of bound protein on electrophoretic mobility, exclusive of bending, is independent of the position of the binding site and therefore given by the mobility of a DNA fragment with protein bound to one end, relative to the mobility of free DNA (R,,,). A number of problems have been noted in regard to these assumptions (Hagerman, 199Ou). With regard to the 1st assumption, is has been noted that bends

due to A,. T, tracts spaced 10 bp apart in B-DNA are not in perfect helical phase. DNA containing A, tracts must trace a spiraling average trajectory. Chirality of this kind should only minimally affect electrophoretic mobility in low percentage polyacrylamide gel (Drak & &others, 1991), particularly in view of the fact that the chiral deviations (approx. 14” for each A, tract added to the 1st one) are not great. A 2nd criticism concerns application to DNA fragments whose lengths considerably exoeed the persistence length of DNA. This criticism might not apply to comparisons of A, tract standards and protein-DNA complexes of comparable length. Nowever, in our analysis, the DNA fragments with precisefy pasitirrned TFl binding sites are slightly longer than the calibration standards (approx. 570 bp verBuB350 to 440 bp). An underestimation of bending angles might be anticipated from this discrepancy. With respect to the 2nd assumption, evidence exists that DNA-binding proteins can all&t electrophoretic mobility in gels in complex ways. Streptavidin (relative

G. J. Schneider

780

molecular mass 48,000) can hang up large single-stranded DNA fragments in denser polyacrylamide gels. Field inversion diminishes or eliminates the effect, the duration of the required field reversals correlating with DNA length (Ulanovsky et al., 1990). However, when the retardation of TFl complexes with 2 fragments of SPOl DNA in field inversion and standard electrophoresis was compared, retardations due to protein binding were either unaffected or only minimally changed by periodic reversal of the electric field (L. Andera, unpublished results). It has also been shown that the very acidic, dimeric DNA-binding protein GCN4 (relative molecular mass approx. 60,000) generates a very large retardation when bound very close to one end of an approx. 200 bp DNA fragment, and a very minor position-dependent variation of retardation that is claimed not to be due to DNA bending. The source of the very large electrophoretic retardation of near-terminally bound GCN4 is a matter of speculation (Gartenberg et aZ., 1990). It should be noted that the retardation of many proteins specifically bound near the ends of DNA fragments is small. For several of these proteins, including E. coli IHF, CAP, the human and bovine papillomavirus E2 proteins, a comparison of the published data on gel retardation in a suitable system BstNI

HindlII

+

-

et al.

of reduced co-ordinates has shown that there is a more or less common variation of mobility with the position of the bound protein in diverse restriction fragments examined under various conditions of analysis (Leveillard et al.. 1991). A calibration using DNA fragments containing 2 to 11 A,. T, tracts (kindly provided by S. Niines-Duby and A. Landy) was made in a 4% polyacrylamide gel (29 : 1 and 375 : 1 acrylamide/bis) in 50 mm-TBE and in 20 m&r-Tris. HCl (pH 8.0) 2 mnr-EDTA by T. Leveilard (see Leveillard et aE., 1991). For 29 : 1 acrylamide/bis in either buffer, the ratio of electrophoretic mobilities of centrally placed and terminally placed bends (Rcenter/Ren,J ranged from 697 for 2 A, tracts to 0.72 for 7 tracts and 066 for 11 tracts. This calibration was used in calculating equivalent bending angles of protein-DNA complexes. 3.

(a) DNA

bending

A 191 bp fragment of SPOl DNA that contains the preferred TFI binding site overlapping the early promoter EcoRV

+

Results

P,4

was ligated

into the circular

Me1 +

permu-

L%I?7HI +

-

+

Ygure 2. Mobility shift assay of TFl binding to the 5 bending probes. Each probe was incubated without ( - ) or wi I 605 ng of TFl. Free and complexed DNA were separated on a 4% (w/v) polyacrylamide gel.

DNA-bending

781

Properties of TFl

tation plasmid pCY4AsL. Five different DNA fragments, each containing the SPOl DNA insert in a different position relative to the ends of the fragment, were generated by digestion with restriction enzymes as diagrammed in Figure 1. These probes, to whioh we refer collectively as the bending probes, and individually as the HindIII, BstNI, EcoRV, NheI and BumHI fragments, are unusual in that they are generated by DNA ligation in vitro, and in that they provide two levels of site-selectivity for TFl : (1) the previously documented preferred binding site within the 191 bp SPOl DNA insert (Greene & Geiduschek, 198&z); and (2) hmUra-DNA flanked by thymine-containing DNA (Johnson & Geiduschek, 1977; Greene et al., 1986b). We used these probes in a mobility shift analysis that tested TFl for its ability to bend DNA (Wu & Crothers, 1984; Fig. 2). For each probe, the first lane of a pair shows the bending probe without added protein and the second shows a sample that included 905 ng TFl, an amount of protein that yielded nearly equal proportions of free and TFl-complexed DNA, the latter primarily as complex 1, in which one molecule of TFl dimer binds to the probe (Schneider t Geiduschek, 1990). In the absence of protein, all of the permuted DNA fragments had the same mobility, indicating that the DNA of the TFl-binding site contains no detectable net bend, but not ruling out the existence of compensating local bends, especially in the region of the A *hmUra blocks that is centered about 25 bp from the B&Y1 end of the insert DNA (Fig. l(b)). However, the mobilities of the TFl-DNA complexes varied greatly, depending on the position of the proteinbinding site relative to the DNA ends. These results enabled us to map the center of the TFl-induced bend (Fig. 3). The fragments with the lowest mobility relative to free DNA R = distance migrated by protein-DNA complex distance migrated by free DNA should have the site of bending closest to the center of the fragment (Wu & Crothers, 1984; Lumpkin &

Zimm, 1982). The apparent bend center lies between the centers of the B&N1 and EcoRV probe fragments, and maps in, or very near to, the TFl corebinding site (Fig. 1 (b)) that has been identified by DNase I footprinting (Greene et al., 198&a). We refer to curves of R as a function of the location of the binding and DNA-bending site like those in Figure 3 as “bending curves”. IHF, the other type II DNA-binding protein that possesses site-specific binding properties, has been examined in the same way (Thompson & Landy, 1988; Robertson & Nash, 1988) and has been found to bend DNA through a very large angle. In fact, the data of Robertson & Nash (1988) and data for TFl obtained under identical conditions generate superimposable bending curves (Fig. 3(b)). Since IHF and TFl both bind DNA as dimers (Yang & Nash, 1988; Schneider & Geiduschek, 1990), have almost the same size, are both members of the

Position of the probe center o-3

“F”

400

,

,

,

500

,

I

600

,

I

700

,

bp

0.4 0.5 0.6 p:

0.7 0.8 0.9 -

IO0 b.80

I.00

0.70

0.60

0.80

0.50

040

0.60

0.30

0.40

0.20

0.20

0.10

C

0,

x

(b)

Figure 3. (a) Bending analysis for TFI ,3 amino acid 61 mutants of TFl and E. co& HU. R is the electrophoretic mobility of bound, relative to free, DNA for the 1st TFl-DNA complexes (as shown in Fig. 2) for (0) wildtype TFl, (0) TFl-W61, (A) TFl-R61, (m) TFl-L61 and (4) HU. R is plotted as a function of the position of the center of each bending probe in by (top scale; the numbers are according to the map in Fig. l(a)), and as a function of z, the fractional distance of the binding site from the left end of each probe (bottom scale). The cartoon of the SPOl DNA insert at the top is also taken from Fig. l(a) and drawn to the same scale. (b) Comparison of the DNA bending properties of TFl and IHF. Data for IHF binding to DNA fragments of different sizes (466 and 361 bp) and analyzed in a 5% polyacrylamide gel (29 : 1 acrylamide/bis) are from Robertson b Nash (1988). Data for TF1, similar to Fig. 2, were redetermined in a 5% polyacrylamida gel for this comparison. (0) TFl, (+) IHF on a 460 bp fragment, (H) IHF on a 361 bp fragment.

family of DBP II and probably have the same general form (Tanaka et al., 1984; White et aZ., 1989) the most straightforward interpretation of this result is that, within the resolution of this technique, TFl and IHF bend their respective binding sites in the same manner.

782

G. J. Schneider et al.

the ratio of The relative mobility RCenter/Rena, relative mobilities of DNA fragments with their binding sites located in the middle (R,,,,,,) and at one end (Rend), has been used to estimate the angle of bending of protein-DNA complexes (Thompson & Landy, 1988). For this TFl-DNA complex, R center= O-39. None of the probes had the center of the TFl binding site at one end, the closest being the BamHI probe that put the center of the TFl binding site 58 bp from one end. This presented us with the choice of a not entirely secure extrapolation for Rend from the data of Figure 3(a), or an independent estimate. The latter was provided by the very close similarity between IHF and TFl (Fig. 3(b)). We estimated Rend= 0.96 based on an IHF complex with the plasmid pSClO1 origin of replication at a site whose center was 25 bp from the end of a 453 bp DNA fragment (Stenzel et al., 1987). Thus, for TFl, Reenter/Rend=@41. We interpret the identical gel retardation characteristics of dimeric TFl and the dimeric IHF as suggesting that they bend the DNA of their binding sites comparably. The observed values of Reenter/Rendlie well below the A, tract calibration, which extends to approximately 140”. Thus, it may be that TFl bends DNA through greater than 140” or, more properly, 180( + < 40)“, since symmetric bending angles about 180” may not be distinguished by this analysis. The very low value of Reenter/Rendis discussed below. The DNA-bending properties of three position 61 mutants of TFl (Sayre & Geiduschek, 1990b), and also of E. coli HU, were examined. TFl-R61, TFl-W61 and TFl-L61 produced bending curves with R,,,,,, = 0.52, O-51 and O-48, respectively (Fig. 3(a)). If we can assume that Rend is also 696 for these similar proteins, then they must bend DNA less than wild-type TFl does, although they still lie beyond the range of the A6 tract calibration curve. We noted that complexes formed by all three mutants with the BamHI probe had a lower mobility than the corresponding wild-type complex. We interpret this as reflecting less site-specific binding by the mutant proteins, which had the effect of increasing R for probes with centrally placed binding sites and decreasing R for probes with distal binding sites, flattening out the bending curve. We also noted that the mobility of the TFl-W61 complex with the Hind111 probe was greater than the corresponding TFl-R61 and TFl-L61 complex mobilities, while the TFl-W61 complex with the BamHI probe had smaller mobility than the other two mutant complexes. This had the effect of consistently shifting the bend center for TFl-W61 complexes slightly to the right relative to the core-binding site, placing it closer to the center of the SPOl DNA insert. However, the DNase I footprints of wild-type TFl and TFl-W61 on this DNA fragment show that their preferred binding sites are in the same place. These observations are consistent with the previously noted decrease affinity of TFl-R61 for hmUra-containing DNA and diminished binding site selectivity of TFl-W61 (Sayre & Geiduschek, 199Ob).

In contrast to wild-type TFl and its variants, the E. coli HU protein produced a bending curve with only a slight curvature (R = 0.83 for the EcoRV fragment, relative to 0.87 for the BamHI fragment), and a small reduction in mobility. Our analysis of this information follows the lines of a previous suggestion (Greene et al., 1986b) that a DNA-binding protein with a relatively brief site-residence time explores all possible binding sites on the DNA molecule with which it is associated during the time of an electrophoresis run. It does so either by sliding along the DNA or by occasionally dissociating and rapidly reassociating within its gel-matrix “cage”. (Pentki et a2. (1987a) proposed the same interpretation to account for the number of bands observed in gel retardation analysis of IHF binding to DNA multiple, specifically fragments containing positioned binding sites.) The observed relative electrophoretic mobility, R, for such a complex is the average for all possible protein-DNA complexes, weighted for the probability of occupancy, that is, for the affinity, of each one. In these terms, the very shallow curvature of the bending curve for HU is primarily due to its almost nonspecific binding. Mobility shift and DNase I protection assays showed that TFl has about a tenfold lower aggregate affinity for T-containing DNA than for hmUracontaining DNA and that it binds T-containing DNA without site-specificity or with greatly reduced site specificity (Sayre & Geiduschek, 1990b; Greene et al., 1986b). To examine the ability of TFI to bend T-DNA, a set of bending probes was constructed with an insert of identical sequence but purified from cloned T-containing DNA. (These are conventional all-T probes, but constructed in the unconventional manner of the hmUra-containing bending probes for which they served as a control.)

Postlon

of the probe center

0.5 1

0.61

n-a-f-J-u---

0.9

t

I.01 ’ 0.80

’ ’ ’ ’ ’ ’ ’ ’ ’ ’ ’ ’ ’ ’

0.70

0.60

0.50

0.40

0.30

0.20

0.10

0.

Figure 4. Bending curves for TFI, 2 amino acid 61. mutants of TFl and HU complexed with T-containing DNA. The results of gel retardation analyses, like those shown in Fig. 2, with (m) TFl, (0) TFl-WAI, (A) TFl-R61 and (0) HU were plotted as for Fig. 3.

DNA-bending

Properties

ofTFl

783

DNA-bending geometry, one binding with perfect selectivity and the other entirely non-selectively and each capable of exploring all possible binding sites on DNA during eleetctsophoresis,would yield bending curves shown in Figure 5(a). In particular, the areas under the respective curves of R as a function of permuted binding site location, x, for these two proteins would be equal. In Figure 5(b) we scaled the equal-area-curves so that the site-selective bending curve matched the data for TFl-hmUra-DNA complexes in Figure 3(a), and added the data for TFl-T-DNA complexes from Figure 4. The area under the TFl-T-DNA bending curve is clearly less than equal to the area under the TFl-hmUra-DNA bending curve. We therefore concluded that complexes of wild-type and mutant TFl with T-containing DNA were, on average, less sharply bent than the corresponding complexes with hmUra-DNA. The relationship between bending and affinity is considered further below. The bending curve of HU complexes with T-containing DNA was also almost flat, with R = 049. In comparing the bending curves produced by HU on hmUra containing and T-containing DNA in Figures 3 and 4, we noted that the mobilities of complexes with the Hind111 and BarnHI hmUra and T-DNA probes were nearly identical, but that HU complexes with hmUracontaining versions of the middle three probes had lower mobilities than their T-DNA counterparts. The increased area under the hmUra-DNA bending curve relative to the T-DNA curve had to be due to increased bending of the hmUra-DNA insert on average, either alone or together with some binding preference of HU for the insert. If the difference had been due only to HU having a preference for hmUra-containing DNA but bending it the same amount as T-containing DNA, then the total area under the bending curve would have been the same for the two types of DNA (see Fig. 4). Since this was not the case, we concluded that HU bends hmUracontaining DNA on average more than it bends T-containing DNA of identical sequence.

identical

(a )

0.4 0.5 0.6 9: 0.7 0.8

I.0 I.000900-80~70

0*60050 0~400-30020 o-100.00 X

(b) Figure 5. (a) Bending curves for site-selective and nonselective binding. Curve a: R as a function of 2 (see Fig. 3) for a site-selectively binding, bend-inducing protein. Curve b: R for the same set of probes, associated with a 2nd protein that is otherwise identical but binds nonselectively yet has the same bending angle as the 1st protein at each site of occupancy and can slide along the DNA during electrophoresis. For curve b, each probe retains the same associated value of x that it has for curve a. The shaded areas under the two curves are equal. (b) Explanatory diagram in support of the argument that TFI bends T-containing DNA, to which it binds nonselectively, less than it bends its preferred DNA binding site in Ps4 in the hmUra-containing DNA. (0) TFl bound to hmUra-DNA, (m) TFl bound to T-DNA.

TFl binding retarded each of the T-containing DNA probes nearly equally (Fig. 4). The lack of dependence of R on the location of the preferred core-binding sequence. for TFl confirmed that sitespecificity was almost completely lost in replacing hmUra with T. TFl-R61, TFl-W61 and the wildtype protein generated identical bending curves on these T-DNA probes with R varying in a narrow range between 677 and 072. We were intrigued by the possibility that TFl might bend T-containing DNA and hmUracontaining DNA through the same angle even though it binds non-specifically to the one and siteselectively to the other. To attempt to answer this question, we proposed that two proteins with

(b) Footprinting The TFl binding site overlapping the SPOl early promoter Ps4 (Fig. 1) which was the subject of the preceding analysis of DNA bending, and an additional site near Ps6 located on a 131 bp by EcoRI-KpnI fragment, were analyzed for sites at which methyl&ion of purine bases interferes with binding. Uniquely end-labeled DNA was lightly methylated with dimethyl sulfate (DMS) and bound to TFl. Free and TFl-bound DNA were separated on a gel, the DNA extracted from the gel, cleaved at the methylated bases by NaOH and analyzed on a sequencing gel, yielding an autoradiogram that was scanned on a densitometer. Densitometric traces for the bound and free DNA were compared in order to detect interference signals. The rersults of an experiment with a probe containing the TFl binding site in Pa4 (probe YD89), 5’ end-labeled at the BstYI

784

G. J. Schneider

et al.

Gl67 ET_

.

Gl66 Gl65 Al64 A 162

(a)

Fig. 6.

end (Fig. l(b)), are shown in Figure 6(a). Bands corresponding to G166 and G167 of the sequence in Figure 1(b) were strongly reduced in the bound lane indicating interference with TFl binding at these sites, while methylation at A162, A164, G165, G169 and G171 caused weak interference. Methylation at these sites also interfered with binding by TFl-R61, although the degree of inteference caused by methylation at G166 was reduced and interference due to methylation at G169 was increased (data not shown). Similar experiments were performed with YD89 3’ end-labeled at the same end (Fig. 6(b)). The signals were not nearly as strong for G166 and G167 on the top strand, only weak interference by methylation at G154, A155, A156, G159, Al68 and A170 was detected. The change in relative peak

heights corresponding to nearby purine bases was especially helpful in assessing methylation interference on this strand. The TFl binding site overlapping Ps6 was also analyzed for interference with binding by DNA methylation. On the bottom strand of RK131, A60, G61, A62 and A63 interfered and G59 interfered weakly with wild-type and R61-TFl binding (Fig. 7). These two TFl-binding sites were also examined by hydroxyl radical footprinting (Tullius & Dombroski, 1986). The results, presented in Figure 8, show that TFl strongly protects three segments of its core binding site from attack by . OH. These patches of protection are centered 10 bp apart, and thus fall on one side of a B-form DNA helix. They

DNA-bending

Properties of TFl

785

A170 Al68

Cl63

Gl59 Al56 A 155 Gl54

(b)

Figure 6. Methylation interference analysis of TFl binding. TFl-DNA complexes formed with a subsaturating amount of TFl and lightly methylated YD89 (a subfragment of RB400 lying between the B&Y1 and DdeI restriction enzyme sites: Fig. l(b)) were separated on a native polyacrylamide gel. Free, F, and bound, B, DNA were isolated, cleaved and analyzed on a denaturing polyacrylamide gel (left). The area of core DNase I protection is diagrammed at the left. An autaradiogram of the gel was scanned with a densitometer. The scans for free and protein-bound DNA were adjusted to match at the edges and interference was measured SXJa difference between the 2 tracings and is shown at the right. The corresponding DNA sequence is written on the right. (a) Top strand (as shown in Fig. l(b)); (b) bottom strand.

are located between sites of enhanced DNase I cleavage that are located on the other side of the DNA helix. Weaker protection from the cleavage by *OH extends outside the boundary defined by prominent DNase I cleavage sites and is also periodic, giving the hydroxyl radical footprint the general chara&r of a damped oscillation centered on the oore TFl-binding site. The hydroxyl radical footprints of the complementary strands are essen-

tially duplicates of each other, but displaced 3 to 4 bp in the 3’ direction. This pattern is consistent with an effect of TFl on accessibility of the minor groove to attack by hydroxyl radical, but does not necessarily indicate protein contacts in the minor groove itself as discussed below. Key features of the footprinting and methylation interference analyses of these two TFl binding sites are summarized by projecting onto DNA helices, in Figure 9.

G. J. Schneider et al.

786 F

B

I

/

1

-

A63 A62 G61 A60 G59

.

50 .

5

.

.

.

.

.

TTCGGCTAC~TTGTCCGATACAATGACATCAAAATCACAGTG

3’ AAGCCGATGGAACAGGCTATGTTACTGTAGTTTTAGTGTCACCTCATCCGATGTGGATGAG~CATTCT

. ATTTTGCAAkAGTA TAAAACGTTTTTCAT

150 CACTAGGGGk.ATTGGACAhGATGATGGA;TAAGCAAGc.... GTGATCCCCCTTAACCTGTACTACTACCTAATTCGTTCG.... (b)

Figure 7. Methylation interference analysis ofTFl binding to the site upstream of Ps6. (a) Bottom strand of DNA fragment RK131. (b) Sequence of DNA fragment RK131. The - 10 and -35 sequences of P,6 are boxed, and the start site as well as the direction of transcription are indicated. The bottom strand is the transcriptional template. The preferred core-binding site for TFl is underlined; hmUra residues are connoted by T.

DNA-bending Properties of TFl *on

DNawI

A/G

0

I

3

IO

30

0

I

(0 1

Fig. 8.

3

IO

30

0

“a TFI

G. J. Schneider et al.

150 1 t 5’ T TG AC

160 0.0

TTTCC

170

1

. ...00

180 . . .O

*

CT A C AGGGTGTGTAATAATTTAATTA

+TFI

-

TFI

-TFI

+TFI

180 (b) Fig. 8.

DNA-bending

Properties of

TFl

789

5 6 70 40 80 (o****oo I v I 0.0 I o.**o *I 5' G T G GAGTAG GC TACACCT A CTCTTTGTAAGAATTTTGCAAA

w

+TFI

+TFI

C A C C TC CTCCGATGT o'**oo I 4 40 50

G G A TGAGAAACAT . . . ..oo 60

TCTTAAAACGTTT 5' o***o I 4 70 80

(cl Figurrt 8.Hydroxyl radical footprints of TFl. (a) The 5’ end-labeled fragment RY191 was subjected to DNase I or hydroxyl radical attack in the absence of TFl or in the presence of 1 to 30 ng of TFl and analyzed on a denaturing polyacrylamide gel. The areas of core protection by TFl are diagrammed at each site. Hydroxyl radical footprints of (b) fragment RYl91 (Ps4) and (c) RRsp270 (Ps6) presented as densitometric tracings of autoradiogrsms, aligned with the DNA sequence. Top and bottom strands are shown above and below, respectively. Footprints without TFl and with 30 ng of TFl are compared, and the filled-m tracings show density difference due to TFl binding. Sequences (hmUra connoted by T) are annotated to show locations of enhanced cleavage (1) by DNase I ss well as (0) major and (0) minor protection from . OH radical cleavage in the TFI complexes.

G. J. Schneider

790

A150 I G152

et al.

T181 TIM I I

Figure 9. TFl interactions with preferred binding sites. Representations of the preferred TFl binding sites in P,4 (sequence and numbering as in Fig. l(b)) and near PE6 (sequence and numbering aa in Fig. 7(c)) are shown as B-form DNA (105 bp per helical turn), with sites of enhanced DNase I cleavage marked by arrows and identified in Roman script for the top strand, italics for the complementary strand. A and G are shown as circles and squares, respectively. Purine residues whose methylation interferes with TFl binding are designated by filled symbols and weaker interference is indicated by stippled symbols. Hatched parts of the backbone mark areas of protection from hydroxyl radical cleavage. hmUra residues are connoted by T.

4.

Discussion

In these experiments, we have further analyzed the properties of complexes between TFI and its preferential binding sites in SPOI DNA. In considering how to lit this information into a coherent picture of protein-DNA interaction, it is useful to list what is already known from other work. (1) TFI forms nested complexes with DNA in which one dimer of the protein (relative molecular mass 23,000) binds to a core site that covers at least 30 bp of DNA; additional dimers extend the nucleoprotein complex laterally (Greene & Geiduschek, 1985a; Schneider & Geiduschek, 1990; Fig. 8(a); and see below). (2) DNA binding brings Y94 in the carboxy-terminal tail of TFI into proximity of the DNA helix and W61 in the arm into one of the DNA (3) Certain other groves (Hard et al., 1989a,b). substitutions at amino acid 61 severely diminish the affinity of TFI for DNA or diminish the selectivity of binding, but appear to retain the large core DNA-binding site (Sayre & Geiduschek, 1990b). (4) Elimination of the nine carboxy-terminal amino acid residues generates a closer homolog of the type II DNA-binding proteins but destroys the ability of TFI to bind to DNA (Sayre & Geiduschek, 1988). (5) TFI restrains negative supercoiling in SPOI DNA (Greene & Geiduschek, 19853). We have shown here that TFI bends DNA very sharply. The relative electrophoretic mobilities of protein-DNA complexes containing one TFI or one IHF dimer (Robertson & Nash, 1988) are almost precisely the same (Fig. 3(b)); a plausible interpretation of this result is that the induced bending angles are indistinguishable. The degree of retarda-

tion of centrally positioned IHF-DNA and TFI-DNA complexes is greater than that of any comparably placed A, tracts. We suspect that this may be a special property of these tightly wound DNA-protein complexes, and that the form of the IHF-DNA and TFI-DNA complexes is very similar. Hard & Kearns (1990) have also reasoned that TFI must bend DNA, basing their arguments on the effects that low concentrations of TFl exert on the time-resolved fluorescence polarization anisotropy of intercalated ethidium in SPOI DNA. The magnitude of the bending angle and the size of the binding site demand that DNA make multiple contacts with a TFI dimer. The arms and tails of the TFI dimer are already identified as making such contacts; if B. stearothermophilus DBPII (Tanaka et al., 1984; White et al., 1989) serves as a suitable structural model for TFI, then it is likely that TFI also has a helix-turn-helix motif in each monomer. We suppose that multiple protein contacts allow DNA to wrap around the relatively small TFl dimer. In that process, the DNA B-helix must be considerably deformed. The catabolite activator protein (CAP) of E. coli is another small protein that bends DNA through a very large angle, estimated at 90” to 150” (Thompson & Landy, 1988; Warwicker et al., 1987; Zinkel & Crothers, 1990). It has been proposed that DNA makes extensive contacts with the surface of CAP that are energetically favored because of electrostatic interactions. These multiple contacts allow the DNA to be bent without the benefit of arm or tail extensions on the protein. One can examine hydroxy radical (. OH) and DNase I footprints of the TFI-DNA complex, and

DNA-bending

Properties

the results of the methylation interference analysis (Figs 6 and 7) from this point of view. We note that TFl complexes with two preferred binding sites share the following dominant features (Fig. 9). (1) There is strong enhancement of sensitivity to DNase I near each end of the core-binding site. Enhanced sensitivity to DNase I can be generated by expanding the minor groove (Suck et al., 1988). Thus, these strong DNase I cutting sites may be located in outward-facing, expanded minor grooves of the bent DNA. In order to be deformed at these sites, DNA must be restrained distally, suggesting that the core TFl-binding site in fact extends at least a few base-pairs outside the sites of enhanced DNase I cutting (Aggarwal et al., 1988). Evidence for this extension has been obtained by titrating the RY191 DNA probe with TFl and analyzing the products in parallel by DNase I footprinting and gel retardation. The comparison of these titrations shows that three elements of the footprint, the core region of DNase I protection between bp 156 and 180, the DNase I enhancements at bp 184 and 152 and the DNase I protections from bp 144 to 1.50, appear in direct proportion to the fraction of DNA molecules containing at least one bound TFl dimer (data not shown). (2) The DNA backbone is protected from attack by . OH at three sites that are centered 10 bp apart on the opposite side of the helix from the DNase enhancement sites. Burkhoff & Tullis (1987) have shown that poly(A) tracts are cleaved less frequently by hydroxyl radical, consistent with dependence of reactivity with hydroxyl radical on minor groove width. Thus, protection does not necessarily require occlusion by protein bound in the minor groove but may result from minor groove compression. When DNA is continuously bent around a protein core, the protein-facing minor groove is compressed. On the basis of these considerations, we argue that the down-facing DNA minor grooves in Figure 9 face toward the body of the TFl dimer, and the up-facing minor grooves are oriented away from the body of the protein. Why, then, is the up-facing minor groove around bp 161 and 172 in probe RY191 and around bp 57 and 67 in probe RK131 (Fig. 9) protected from, rather than especially susceptible to, DNase I? We postulate that access to the minor groove at these positions is blocked, perhaps by the arms of TFl lying either within or across it. Methylation in either the major or minor groove in the central 10 bp of the TFl binding site can interfere with TFl binding (e.g. at G166 and 6167 of the TFl site overlapping Pz4 and at A62 and A63 of the site overlapping Ps6: Figs 6(a) and 7). Interference is not absolute and can be overcome at higher protein concentrations, as though methylation quantitatively diminished affinity but did not abolish binding. The same situation has been noted for interference by methylation with binding of IHF (Yang & Nash, 1989). Interference with binding by methyl groups that are located at corresponding positions in two binding sites but in either groove can be explained if methylation is not only capable

of TFl

791

of interfering with the formation of proper protein-DNA contacts but also with the conformational adaptation of DNA (Hagerman, 19905): methylation in the outward-facing major groove at G166 and G167 of probe RY191 might block TFl-DNA contacts, while methylation at A62 and A63 of probe RK131 might add to the energetic cost of minor groove narrowing. In comparing our analysis of TFl with what has previously been found for IHF (Robertson & Nash, 1988; Yang & Nash, 1989), we note that the binding unit of IHF is also a dimer and that the sizes of the IHF binding site and the TFl core-binding sites are nearly the same. Many of the methylations that interfere with IHF binding are located at positions that correspond with the methylation interference signals of the TFl binding sites, but are almost exclusively on A, in the minor groove. At least some of these methyl groups may obstruct minor groove narrowing (the block is not absolute, as stated above) rather than protein binding. In correlating bending and binding, it is necessary to bear in mind that a protein that binds DNA through the formation of many contacts can exist in multiple bound states. A protein-DNA complex explores these states as it moves through a gel, so that the measured bending angle is a weighted average of contributions from all bound states. For example, the protein contacts at the periphery of a binding site are separately at equilibrium between their own free and bound forms, with different associated bending angles. Any shift in these equilibria is associated with a corresponding change of the measured bending angle. (For internal contacts, the situation is less obvious both with regard to equilibria and with regard to conformation.) We suggest that the correlation between the weaker binding of TFl to T-containing DNA and the smaller apparent bending angle may arise in this way. The effect of mutations at position 61 is also consistent with this proposal, if one considers that the ability of parts of the TFl body to come into contact with the bent DNA is conditional on tight binding by the arms. Without a strong central anchor, contacts of the body of TFl with the periphery of the binding site would be less favored, shifting local binding equilibria more towards their free forms, with a smaller associated bending angle. We have interpreted the gel retardation properties of HU-DNA complexes in a speculative way to suggest that a single HU dimer may also be capable of sharply bending DNA. A value of R = 989 for the first HU-DNA complex (Fig. 4) analyzed under the assumptions of Figure 5(a) with the A, calibration of bending angle referred to in Materials and Methods, would imply a bending angle of 75”. The considerations of the preceding paragraph imply that this represents an average over several binding states and that a single HU dimer that is fully engaged with its DNA site is capable of bending the latter even more. Such a high degree of bending probably requires multiple protein-DNA contacts, suggesting that the DNA interaction of HU is not

G. J. Schneider et al.

792

I

140

PE4

vvv

V’I

TTTTACAAAAA GGTATTGACTTTCCCTsG#GeGTAATAATTTAATTACAGGCGGG 40

VV

I

V‘I

AAAAAGTACTTG

66

AAAATCACAGTGGAGTAGGCTACACCzTC$TTpGAATTTTGC

PE5

TTTTGCAAAAAGTTGTTGACTTTATCTSGGEGGCATAATAATCTTAACAACAGC I I tttt-CAaAaaGgtgTtGaCTttacCT~-~g~g--AtaaTt--attAa--aC-gg I

-40

‘I

I

Figure 10. Comparison of DPU’Asequences of core TFl-binding sites in the vicinity of 3 SPOl early promoters. Short inverted repeats (horizontal aarrows) and sites of enhanced DNase I cleavage in the written-out strand (v) and its complementary strand (V) are indicated.

merely due to its arms and /I strand cradle, and that the DNA-binding site of a single HU dimer is larger than the previously suggested approximately 10 bp (Tanaka et al., 1984; White et al., 1989). This would contradict the conclusions of just-published experiments with short DNA duplexes, which have been interpreted to indicate that the DNA-binding site of approximately 9 bp (Bonnefoy & HU is Rouviere-Yaniv, 1991). However, one notes the orders-of-magnitude differences of apparent affinity of 21, 26 and 29 bp DNA duplexes for the formation of their first HU complexes in this work. A detailed analysis of the dependence of the affinity of CAP-DNA complexes on DNA duplex length first suggested a full size DNA-binding site for the CAP protein extending well beyond its central consensus sequence (Liu-Johnson et al., 1986). One can, by analogy, argue for a DNA site for the first HU dimer that is not less than about 25 bp. A binding site of that size would require multiple protein-DNA contacts around the globular HU, consistent with substantial DNA bending. The principal conclusion of this line of reasoning is that TFl , IHF and HU may engage their DNA sites in comparable ways. The sources of the binding site-selectivity of TFl remain elusive. A comparison of bending curves for the hmUra and T-containing probes (Figs 3(a) and 4) reinforces the conclusion that not only is affinity diminished in the absence of hmUra (Johnson & Geiduschek, 1977) but selectivity is almost entirely lost (see also, Sayre & Geiduschek, 1990b). One might consider whether hmUra-containing DNA, with its anomalously low melting temperature (by 13”), is generally more flexible. On the contrary, Hard & Kearns (1990) have shown that the torsional rigidity of SPOl DNA, as reflected in long “wavelength” motions on nanosecond timescales, is no less for SPOl DNA than for T-containing DNA, and that SPOl DNA does not have interspersed flexible joints. The possibility that local configurations of hmUra *A and T*A-containing base-pair doublets and triplets differ significantly remains untested.

DNA bendability clearly cannot be the only determinant of site selection because binding is protein-specific. The TFl-binding sites are not specifically recognized by HU (Fig. 3; Sayre & Geiduschek, 1990b) or by IHF (data not shown). In comparing the three TFl-binding sites that are located near promoters Pz4, 5 and 6, one can note certain weak elements of consensus and symmetry (Fig. 10); the core binding sites lack internal blocks of A or hmUra and are not grossly pre-bent (Fig. 2). It has been proposed that IHF uses its arms to recognize its consensus binding site and that these arms lie along the minor groove (Yang & Nash, 1989). A well-known problem with sequence recognition from the minor groove is the lack of distinguishing contacts, although this may be alleviated in a wide minor groove, as pointed out by Yang & Nash (1989). However, IHF, and TFl, differ from B. stearotherwwphilus HU and most other type II DNA-binding proteins in possessing C-terminal extensions. TFl, a homodimer, has two symmetrical tails that are essential for DNA-binding activity, and might recognize its symmetrical consensus element with them. IHF is a heterodimer, with an a-subunit that is extended by five more amino acid residues at its C terminus than the B-subunit. The IHF consensus is located asymmetrically in the binding site footprint (Craig & Nash, 1984; Yang & Nash, 1989). Thus, the C-terminal tails of TFl and IHF may provide the additional protein-DNA contacts required for extensive DNA bending, as well as a means of specific sequence recognition. We thank D. Ades for helpful discussion. G.J.S grate fully acknowledges a National Research Service postdoctoral fellowship of the National Institute of General Medical Sciences. M.H.S. has held a predoctoral fellowship of the National Science Foundation. Our research was supported by a grant from the National Institute of General Medical Sciences.

References Aggarwal, A. K., Rogers, D., Drottar, M., Ptashne, M. & Harrison, S. C. (1988). Recognition of a DNA opera-

DNA-bending

tor by the repressor of phege 434; a view at high resolution, rScielace,242, 899-967. Bonnefoy, E. & Rouviere-Yaniv, J. (1991). HU and IHF, two homologous histone-like proteins of Escherichia r&i form different protein-DNA complexes with short DNA fragments. EMBO J. 10, 687-696. Burkhoff, A. M. & Tullius, T. D. (1987). The unusual conformation adopted by the adenine tracts in kinetoplast DNA. Cell, 48, 935-943. Craig, N. L. t Nash, H. A. (1984). E. wli integration host factor binds to specific sites in DNA. Cell, 39, 707-716. Drak, J. & Crothers, D. M. (1991). Helical repeat and chirality effects on DNA gel electrophoretic mobility. Proc. Nat. Acud. Sci., U.S.A. 88, 3074-4078. Gartenberg, M. R., Ampe, C., Steitz, T. A. & Crothers, D. M. (1999). Molecular characterization of the GCN4-DNA complex. Proc. Nut. Acad. Sci., U.S.A. 87, 66346038. Greene, J. R. & Geiduschek, E. P. (1985a). Site-specific binding by a bacteriophage SPOl-encoded type II DNA-binding protein. EMBO J. 4, 13451349. Greene, J. R. & Geiduschek, E. P. (198%). Interaction of a virus-coded type II DNA-binding protein. In Scequence Speci$city in Transcription and Translation (Calendar, R. & Gold, L., eds), pp. 255-269, Liss, New York. Greene, J. R., Morrisscy, L. M., Foster, L. M. & Geiduschek, E. P. (1986a). DNA-binding by the bacteriophage SPO 1-encoded type II DNA-binding protein, TFl: formation of nested complexes at a Biol. Chem. 261, site. J. selective binding 12820-12827. Greene, J. R., Morrissey, L. M. & Geiduschek, E. P. DNA-binding by the bacteriophage (19866). SPOI-encoded type II DNA-binding protein, TFl: site-specific binding requires 5-hydroxymethyluracilcontaining DNA. J. Biol. Chem. 261, 12828-12833. Gualerzi, C. 0. & Pon, C. L. (1986). Bacterial Chromutin, Springer Verlag, KG, Berlin. Hagerman, P. J. (199&z). Sequence-directed curvature of DNA. Annu. Rev. B&hem, 59, 755-781. Hagerman, P. J. (1999b). Pyrimidine 5-methyl groups influence the magnitude of DNA curvature. Biochemistry, 29, 1980-1983. Hard, T. & Kearns, D. R. (1996). Reduced DNA flexibility in complexes with a type II DNA-binding protein. Biochemistry, 29, 959-965. Hard, T., Hsu, V., Sayre, M. H., Geiduschek, E. P., Appelt, K. & Kearns, D. R. (1989a). Fluorescence studies of a single tyyrosine in a type II DNA binding protein. Biochemistry, 28, 396-406. Hard, T., Sayre, M. H., Geiduschek, E. P. & Kearns, D. R. (198%). A type II DNA-binding protein genetically engineered for fluorescence spectroscopy: the “arm” of TFl binds in the DNA grooves. Biochemtitry, 28, 2813-2819. Johnson, G. G. & Geiduschek, E. P. (1972). Purification of the bacteriophage SPOI transcription factor 1. J. Biol. CLm. 247, 3571-3578. Johnson, G. G. & Geiduschek, E. P. (1977). Specificity of the weak binding between the phage SPOl transcription-inhibitory protein, TFl, and SPOl DNA. Biochemistry, 16, 1473-1485. Kellenberger, E. (1988). About the organization of condensed and decondensed non-eukaryotic DNA and the concept of vegetative DNA (a critical review). Biophys. Chem. 29, 51-62. Koo, H.-S., Drak, J., Rice, J. A. & Crothers, D. M. (1996).

Properties

ctf TFl

Determination of the extent of DNA bending by an 29, 4227-4234. sdenine thymine tract. Biockietry, IKveillard, T., Kassavetis, G. A. & Geiduscbek, E. P. (1991). Sacc~romyces cerevisiae transcription factors IIIB and IIIC bend the DNA of a tRNAG’” gene. J. Biol. Chm. 266, 5162-5168. Liu-Johnson, H.-N., Gartenberg, M. R. & Crothers, D. M. (1986). The DNA binding domain and bending angle of E. coli CAP protein. Cell, 47, 995-1005. Lumpkin, 0. J. & Zimm, B. H. (1982). Mobility of DNA in gel electrophoresis. Biopolyn+ers, 21, 2315-2316. Maniatis, T., Fritsch, E. F. & Sambrook, J. (1982). Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Pettijohn, D. E. (1988). Histone-like proteins and bacterial chromosome structure. J. Biol. Chem. 263, 12793-12796. Prentki, P., Chandler, M. k Galas, D. .J. (1987a). Escherichia coli integration host factor bends the DNA at the ends of IS1 and in an insertion hotspot with multiple IHF binding sites. EMBO J. 6, 2479-2487. Prentki, P., Pham, M.-H. & Galas, D. J. (198%). Plasmid permutation vectors to monitor DNA bending Nucl. Acids Res. 15, 16660. Robertson, C. A. & Nash, H. A. (1988). Bending of the bacteriophage lambda attachment site by Escherichia coli integration host factor. J. Biol. Chem. 263, 3554-3557. Sayre, M. H. t Geiduschek, E. P. (1988). TFl, the bacteriophage SPOl-encoded type TI DNA-binding protein, is essential for viral multiplication. J. Viral. 62, 3455-3462. Sayre, M. H. & Geiduschek, E. P. (199Ou). Construction and properties of a temperature-sensitive mutant in the gene for the bacteriophage SPOl DNA-binding protein TFI. J. Bacterial. 172, 46724681. Sayre, M. H. & Geiduschek, E. P. (19906). The effects of mutations at amino acid 61 in the arm of TFl on its DNA-binding properties. J. Mol. Baol. 216, 819-833. Schneider, G. & Geiduschek, E. P. (1996). Stoichiometry of DNA binding by the bacteriophage SPOl-encoded type II DNA-binding protein TFl. .I. Biol. Chem. 265, 10198-10206. Stenzel, T. T., Patel, P. & Bastia, D. (1987). The integration host factor of Escherichia coli binds to bent DNA at the origin of replication of the plasmid pSClO1. Cell, 49, 769717. Suck, D., Lahm, A. & Oefner, C. (1988). Structure refined at 2 A of a nicked DNA octanucleotide complex with DNase I. Nature (London), 332, 464-468. Tanaka, I., Appelt, K., Dijk, J., White, S. W. & Wilson, K. S. (1984). 3 A resolution structure of a protein with histone-like properties in prokaryotes. Nature (London), 310, 376-381. Thompson, J. F. Landy, A. (1988). Empirical estimation of protein-induced DNA bending angles: applications to lambda site-specific recombination complexes. Nucl. Acids Ree. 16, 9687-9705. Tullius, T. D. & Dombroski, B. A. (1986). Hydroxyl radical “footprinting”: high-resolution information about DNA-protein contacts and application to I repressor and Cro protein. Proc. Nat. Acod Sci., U.S.A. 83, 5469-5473. Ulanovsky, L., Drouin, G. & Gilbert, W. (1996). DNA trapping electrophoresis. Nature (IAndon), 343, 196192. Warwicker, J., Engelman, B. P. & Steitz, T. A. (1987).

794

G. J. Schneider et al.

Electrostatic calculations and model-building suggest that DNA bound to CAP is sharply bent. Proteins, 2, 283-289. White, S. W., Appelt, K., Wilson, K. S. & Tanaka, I. (1989). A protein structural motif that bends DNA. Proteins, 5, 281-288. Wilson, D. L. & Geiduschek, E. P. (1969). A templateselective inhibitor of in vitro transcription. Proc. Nat. Acad. Sci., U.S.A. 62, 514-520. Wu, H.-M. & Crothers, D. M. (1984). The locus of

DNA sequence-directed and protein-induced bending. Nature (London), 308, 5099513. Yang, C.-C. & Nash, H. A. (1989). The interaction of E. coli IHF protein with its specific binding sites. Cell, 57, 869-880. Zinkel, S. S. & Crothers, D. M. (1990). Comparative gel electrophoresis measurement of the DNA bend angle activator protein induced by the catabolite Riopolymers, 29, 29-38.

Edited by P. von Hippel