- Email: [email protected]
DNA hypermethylation of tumor suppressor genes RASSF6 and RASSF10 as independent prognostic factors in adult acute lymphoblastic leukemia
Accepted Manuscript Title: DNA hypermethylation of tumor suppressor genes RASSF6 and RASSF10 as independent prognostic factors in adult acute lymphoblastic leukemia Authors: Samareh Younesian, Sepideh Shahkarami, Parisa Ghaffari, Shaban Alizadeh, Roya Mehrasa, Ardeshir Ghavamzadeh, Seyed H. Ghaffari PII: DOI: Reference:
S0145-2126(17)30497-6 http://dx.doi.org/10.1016/j.leukres.2017.08.016 LR 5821
To appear in:
Leukemia Research
Received date: Revised date: Accepted date:
5-8-2017 27-8-2017 28-8-2017
Please cite this article as: Younesian Samareh, Shahkarami Sepideh, Ghaffari Parisa, Alizadeh Shaban, Mehrasa Roya, Ghavamzadeh Ardeshir, Ghaffari Seyed H.DNA hypermethylation of tumor suppressor genes RASSF6 and RASSF10 as independent prognostic factors in adult acute lymphoblastic leukemia.Leukemia Research http://dx.doi.org/10.1016/j.leukres.2017.08.016 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
DNA hypermethylation of tumor suppressor genes RASSF6 and RASSF10 as independent prognostic factors in adult acute lymphoblastic leukemia
Running title: RASSF6 and RASSF10 hypermethylation in ALL
Samareh Younesiana,b, Sepideh Shahkaramia, c, Parisa Ghaffaria, Shaban Alizadehd, Roya Mehrasaa, Ardeshir Ghavamzadeha, Seyed H. Ghaffaria *
a
Hematology, Oncology and Stem Cell Transplantation Research Center, Shariati Hospital,
Tehran University of Medical Sciences, Tehran, Iran b
Department of Hematology, School of Allied Medical Sciences, International Campus,
Tehran University of Medical Sciences, Tehran, Iran c
Department of Medical Genetics, School of Medicine, Tehran University of Medical
Sciences, Tehran, Iran d
Department of Hematology, School of Allied Medical Sciences, Tehran University of
Medical Sciences, Tehran, Iran
Corresponding author: Seyed H. Ghaffari, Ph.D.; Hematology, Oncology and Stem Cell Transplantation Research Center, Shariati Hospital, Tehran University of Medical Sciences, Tehran, Iran Tel.: +989121157009 Fax: +982188004140 Email address: [email protected]
1
Graphical abstract
Highlights
RASSF6 and RASSF10 were frequently hypermethylated at diagnosis in adult ALL.
RASSF6 frequently methylated B-ALL; whereas, RASSF10 in T-ALL.
First to report RASSF6 methylation at a high frequency in pre-B ALL patients.
Methylation of RASSF6 was significantly associated with inferior OS in pre-B ALL.
Hypermethylation of RASSF6 can serve as a useful prognosis biomarker in pre-BALL.
Abstract Background: The Hypermethylation of Ras association domain family (RASSF) often plays a key role in malignant progression of solid tumors; however, their impact on the prognosis and survival of adult ALL patients remain elusive. Methods: The frequency of the promoter methylation pattern of RASSF6 and RASSF10 were analyzed in the peripheral blood (PB) samples taken at the time of diagnosis of 45 ALL patients. The methylation-specific PCR (MSP) assay was used to detect the DNA methylation patterns. 2
Results: RASSF6 was frequently hypermethylated in patients diagnosed with pre-B-ALL (90.9%) and B-ALL (87.5%), followed by T-ALL (66.7%); whereas, RASSF10 methylation was more confined to T-ALL (80%) as compared to B-ALL (25%) and pre-B ALL (9.1%) patients. Moreover, hypermethylation of RASSF6 was significantly associated with a poor prognosis and shorter overall survival (OS) in patients with pre-B-ALL (log-rank test; P = 0.041). Conclusion: RASSF6 and RASSF10 were frequently hypermethylated in the samples at the time of diagnosis of adult ALL patients. Our study represents the first report of methylation of RASSF6 at a high frequency in patients with pre-B ALL. Furthermore, hypermethylation of RASSF6 was significantly associated with inferior overall survival in pre-B ALL patients. It may suggest that the frequent epigenetic inactivation of RASSF6 plays an important role in the pathogenesis and progression of pre-B-ALL.
Keywords: RASSF6; RASSF10; acute lymphoblastic leukemia, DNA hypermethylation, tumor suppressor gene, prognostic
1. Introduction Acute lymphoblastic leukemia (ALL) is an aggressive malignancy that emanates in a single B- or T-lymphocyte progenitor. This disease is most common among children and comparably less diagnosed in adults, approximately comprising one-third of reported ALL cases. Aberrant epigenetic modifications and the presence of CpG methylation have both been described in ALL. The evidence demonstrates that the methylation of several tumor suppressor genes (TSGs) are involved in the pathogenesis of ALL, and the methylation of these genes were more eminent in children than adult ALL patients [1]. The DNA hypermethylation of gene promoters often leads to extinguish of TSGs, which is found to be correlated with resistance to chemotherapy in ALL patients. The treatment with demethylating agents, including decitabine or 5-azacytidine, are conducive to an increased sensitivity to chemotherapy [2]. The RASSF (Ras association domain family) family of proteins consists of 10 members, and based on the position of the RA domains in the C-terminal or N-terminal, 3
they are divided into two groups: C-terminal members (RASSF1 to RASSF6) and Nterminal members (RASSF7 to RASSF10). Many of these are TSGs that undergo loss of expression through promoter methylation in numerous types of cancers such as melanoma, breast, prostate, neck, lung, brain, colorectal and kidney cancers as well as leukemia [3-18]. In addition to their tumor suppressor function, RASSF proteins act as scaffolding agents in microtubule stability, regulate mitotic cell division, modulate apoptosis, control cell migration and cell adhesion, and modulate NF-κB activity as well as the duration of inflammation. The ubiquitous functions of these proteins highlight the importance of their role in numerous physiological pathways [19]. Certain members of the RASSF family, such as RASSF6 and RASSF10, are inactivated by promoter methylation at a high frequency in a broad range of cancers and their methylation were often related to a poor survival [3, 8, 11, 13, 20]. Evidence suggests that RASSF6 and RASSF10 like other members can stabilize p53, regulate the cell cycle, inhibit tumor growth, induce apoptosis and inhibit cell migration [4, 6, 11, 19, 21]. Additionally, RASSF6 and RASSF10 trigger the inhibition of NFκB and Wnt/bcatenin signaling pathways, respectively [12, 21]. The methylation of RASSF genes has infrequently been reported in leukemia. Recent evidence demonstrates that the epigenetic silencing in some of the RASSFs’ family may play essential roles in leukemia development [19]. The epigenetic silencing of RASSF6 and RASSF10 has been shown in chronic lymphoblastic leukemia, in addition to pediatric B- and T-acute lymphoblastic leukemia (ALL) [17, 18], and it has been suggested that the methylation of RASSF6 and RASSF10 may be a trait of blasts in the bone marrow of B- and T-ALL patients [17]. However, their role as a prognostic value in ALL patients has not yet been determined. Since the RASSF6 and RASSF10 are involved in the regulation of signaling pathways that are aberrantly activated in ALL, it’s likely that the epigenetic silencing of RASSF6 and RASSF10 should have an impact on the patient’s prognosis and survival. Therefore, their role still has to be determined as a prognostic value or therapeutic target. Here, we have investigated the frequency of RASSF6 and RASSF10 promoter methylation at the time of diagnosis and have correlated them with the clinical outcome and overall survival (OS) in adult patients with ALL. 2. Patients and methods 2.1. Ethics statement 4
The Regional Ethics Committee of Tehran University of Medical Sciences approved the study and the patients and/or their guardians provided a written informed consent. This study was carried out according to the Helsinki of Declaration 2.2. Samples from patients and controls Peripheral blood (PB) samples from 45 patients with well-defined ALL included into the Hematology, Oncology and Stem Cell Transplantation Research Center of Shariati Hospital between the years of 2015-2017 for the treatment of adult patients with ALL were analyzed prospectively. In all the patients, the diagnosis was confirmed by centrally monitored morphology and immunophenotyping. Adults diagnosed with ALL were treated with the Hyper-CVAD chemotherapy program. The PB samples of 10 healthy individuals were used as the control. 2.3. Methylation assays Mononuclear cells (MNC) were isolated from the PB by Ficoll-Hypaque (Lymphodex, Germany) density gradient centrifugation. Genomic DNA was extracted from MNC pellets by the DNA extraction mini kit (Yekta Tajhiz Azma, Iran). Bisulfite treatment was performed on 1μg of DNA using the EpiTect Fast DNA Bisulfite Kit (Qiagen, Hilden, Germany). A bisulfite solution and DNA protect reagent was added to each sample and incubated at 95°C for 5 min followed by 60°C for 20 min, 95°C for 5 min and finally 60°C for 20 min. Each sample was then desulfonated and eluted in a final volume of 15μl. The MethPrimer (http://www.urogene.org/methprimer/) was utilized to design methylation-specific polymerase chain reaction (MSP) primers (Table 1). The 25μl reaction consisted of 8μl of Taq DNA polymerase master mix red (Ampliqon), 1μl of 10μM of forward and reverse primers, 2μl of converted DNA template (containing 20 to 40 ng/μl) and 14μl of ddH2O. Thermal cycling was performed with a 5-min hot start at 95°C, followed by 35 cycles at 95°C for 25s, 60°C for 40s, 72°C for 25s and a final extension at 72°C for 10 min. All PCR amplifications were visualized on a 2% agarose gel.
3. Statistical analysis 5
The clinical and laboratory data were gathered from the patients' clinical records and this data was analyzed using SPSS software package version 21.0. The relationship of RASSF6 and RASSF10 methylation status, additional prognostic factors of interest; such as age, gender, WBC and platelet count, hemoglobin level, and ALL immunophenotypes, were determined by using the Student’s t-test and Chi-square (χ2) test. A p-value of less than 0.05 was considered to be statistically significant. The analysis of overall survival (OS) was demonstrated by using the Kaplan-Meier method with 95% confidence intervals and was compared by the log-rank test. The OS rate was considered from the date of diagnosis until the time of death or censorship of the patients’ data. A p-value of <0.05 was considered statistically significant. 4. Results 4.1.Patients The clinical-laboratory features of 45 adult patients with ALL at the time of diagnosis are summarized in Table 2. The study population consisted of 19 females and 26 males with the median age of 28 years (range: 14 to 80 years). The patients, according to the ALL immunophenotypes, were divided into three groups: pre-B-ALL, B-ALL and TALL. Additionally, the PB samples from 10 healthy individuals consisting of 7 females and 3 males with the ages ranging from 27 to 52 years were included in this study as the control. The hematologic complete remission (CR) was achieved in in 36 (80%) patients, and they were monitored for relapse and mortality for approximately 25 months (median 10; range 1–25). The total of 22 (48.9%) patients died by the end of the follow-up period; 9 (20%) patients died during the course of induction therapy and the other 13 (28.9%) died following a relapse. 4.2. Methylation status of RASSF6 and RASSF10 The methylation specific polymerase chain reaction (MSP) analysis of the methylation status of RASSF6 and RASSF10 in PB-MNC of the patients with pre-BALL, B-ALL and T-ALL are shown in Fig. 1 and 2, respectively. The vast majority of adult ALL patients (91.1%) demonstrated methylation of the promoters in either RASSF6 or RASSF10; about 26.7% had both RASSF6 and RASSF10 promoter methylation at the same time. We found RASSF6 to be methylated in 90.9% of the pre-B-ALL (20/22), 6
87.5% of the B-ALL (7/8) and 66.7% of the T-ALL (10/15) patients (Table 3). The RASSF10 promoter was methylated in 9.1% of the pre-B-ALL (2/22), 25% of the B-ALL (2/8) and 80% of the T-ALL (12/15) patients. None of the healthy controls revealed any RASSF6 or RASSF10 promoter methylation. 4.3. Correlation of RASSF6 and RASSF10 methylation with clinical parameters In this study, the patients were divided into two groups according to the methylation status of RASSF6 and RASSF10; methylated and unmethylated. Furthermore, their correlation with the clinical parameters of interest, such as age, gender, WBC and platelet count, hemoglobin level, and immunophenotypes were analyzed using the Student’s t-test and Chi-square (χ2) test (Table 3). Neither RASSF6 nor RASSF10 methylation correlated with any of the aforementioned parameters in the analyzed cohort. 4.4. Impact of RASSF6 and RASSF10 methylation status on survival As previously mentioned, 22 out of the 45 cases died by the end of the follow-up period; 9 patients deceased during the induction therapy; the remaining 13 patients who achieved complete remission (CR) died following a relapse. Interestingly, 18 of these 22 patients had RASSF6 methylation. Moreover, the Kaplan-Meier curve showed that RASSF6 methylation status was significantly associated with a worse out-come in patients with pre-B-ALL. As seen in Fig. 3, pre-B-ALL patients with methylated RASSF6 had a shorter overall survival (OS) when compared to patients without methylation (log-rank test; P = 0.041). Among the T-ALL and B-ALL patients, no significant difference was observed in the OS rates of patients with or without hypermethylation of the RASSF6 gene. Additionally, the methylation status of RASSF10 did not significantly correlate with the OS rates of patients with ALL (Fig. 4).
5. Discussion Aberrant epigenetic modifications are well-recognized drivers for oncogenesis. Acute lymphoblastic leukemia (ALL) is no exception and leukemogenesis of ALL is heavily influenced by epigenetics, particularly DNA hypermethylation. In recent years, many tumor suppressor genes (TSGs) have been found to be epigenetically inactivated in ALL [22, 23], indicating that aberrant promoter methylation and associated silencing of genes 7
are hallmarks of leukemogenesis and the probable critical factors concerning the outcome of chemotherapy. Several RASSF members, in particular RASSF6 and RASSF10 which are regarded as the putative tumor suppressors of the RASS family, play an important role in cancer, regulating several physiological processes, including cell proliferation, apoptosis and tumor development. They are frequently methylated and down regulated in a variety of solid tumors [3-16], as well as in leukemia [17, 18]. Here, we analyzed the promoter methylation status of RASSF6 and RASSF10 in newly diagnosed adult ALL patients by MSP. Our results showed very frequent hypermethylation of RASSF10, the most prominent member of the N-terminal RASSFs. In our T-ALL patients (80%); instead, a lower frequency was observed in B-ALL and pre-B ALL (25% and 9.1%, respectively). On the other hand, RASSF6, the most prominent member of the C-terminal RASSFs, exhibited significant promoter methylation in patients with pre-B-ALL and B-ALL (90.9%, 87.5%, respectively) as well as exhibiting a lesser extent in T-ALL (66.7%) patients. There is only a limited study of data on the methylation status of RASSF6 and RASSF10 in ALL patients. A recent study has reported that RASSF6 and RASSF10 genes are frequent targets of epigenetic inactivation in childhood ALL. Their analysis showed that RASSF6 (94% and 41%) and RASSF10 (16% and 88%) were hypermethylated in pediatric B-ALL and T-ALL, respectively [17]. However, no correlation of these aberrant methylation patterns with any clinical parameters or with the patient’s outcome was reported in ALL. Our data supports this finding and demonstrates that the promoter region of RASSF6 and RASSF10 are highly methylated in both B- and T-ALL patients. The frequencies of methylation in both studies were approximately similar; however, the methylation of RASSF6 in patients with T-ALL was higher in our study when compared to the previous study (66.7% vs 44%). This difference could be due to the differences in age, the number of patients in the different subgroups, ethnic diversity and the use of different methods for assessing DNA methylation. In both studies, none of the healthy controls showed promoter methylation of RASSF6 and RASSF10. The results together indicated that aberrant promoter methylation of RASSF6 and RASSF10 is a feature of blasts ALL, and could have a prognostic value in ALL.
8
In addition to previous studies, our study represents the first report of methylation of RASSF6 at a high frequency in patients with pre-B ALL. It is particularly interesting that RASSF6 methylation occurred more frequently in pre-B-ALL, followed by B-ALL; whereas, RASSF10 hypermethylation was confined to T-ALL. Furthermore, in our cohort of pre-B ALL, patients with RASSF6 methylation were significantly associated with a poor prognosis and shorter overall survival (OS) (log-rank test; P = 0.041). Hence, this finding suggests that the RASSF6 methylation status may be a poor prognostic biomarker in pre-B ALL. The frequent hypermethylation of RASSF6 in pre-B-ALL and its significant association with poor prognosis raises the question of the potential importance of epigenetic inactivation of RASSF6 in the progression of pre-B-ALL. RASSF6; the putative tumor suppressor of the C-RASSF family proteins, is frequently silenced in human cancers and the low expression correlates with an advanced stage and poor prognosis. Only RASSF6 has the PDZ-binding motif (PBM) [21], and the loss of PDZ-binding capacity might contribute to an increased Ras signaling and malignant potential [24], hence, possibly contributing to leukemogenesis [25]. RASSF6 induces apoptosis through caspasedependent and -independent pathways. [21, 26, 27]. Currently, the inhibition of NF-κB [27, 28] and MAPK [11, 29] signaling pathways are implicated in RASSF6-induced apoptosis. In this regard, studies have indicated that NF-κB complexes are constitutively activated in many ALL patients, and this activation has a critical role in the survival of ALL cells either by blocking apoptosis or by enhancing proliferation [30]. Also, it has been reported that the possible causes of resistance to therapy in pediatric pre-B ALL cases could be the frequent involvement of an increased signaling of the NF-κB survival pathway [31]. Even though the role of RASSF6 in leukemia is unknown, it seems that the frequent epigenetic inactivation of RASSF6 in ALL patients, particularly in pre-B-ALL, may play an important role in the pathogenesis and progression of ALL. Perhaps, the activation of the NF-κB survival signaling pathway in the absence of RASSF6 could be the reason for resistance to treatment and inferior survival in the RASSF6-methylated preB-ALL patients. Nevertheless, this hypothesis will require further functional investigations in the biology of ALL malignancies. Moreover, RASSF10, the most recent member of the N-terminal RASSFs, function and role in leukemia is still not clear. Studies in solid tumors suggest that RASSF10 induces apoptosis via a caspase-dependent pathway [6]. RASSF10 interacted with 9
MDM2, stabilized P53, and induced apoptosis via P53 signaling pathways [6, 32]. Similar to a previous study [17], our study shows that RASSF10 methylation is more confined to T-ALL (80% vs 9% in pre-B ALL). This may raise the question of whether RASSF10 methylation plays an important role in the progression of T-ALL. It has been reported that abnormal WNT signaling activation occurs in a significant portion of patients with TALL [33]. RASSF10 is involved in the inhibition of Wnt/b-catenin signaling pathways [12]. Based on the above findings, epigenetically, inactivation of RASSF10 may lead to the abnormal activation of WNT signaling pathways and disease progression in T-ALL patients. Thus, RASSF10 methylation may be a novel oncogenic event in T-ALL. In conclusion, our results show that RASSF6 and RASSF10 were frequently hypermethylated in the samples at the time of diagnosis of adult ALL patients. The most frequent methylation of RASSF6 was found in patients with pre-B-ALL and then B-ALL; whereas,
RASSF10
hypermethylation
was
confined
to
T-ALL.
Furthermore,
hypermethylation of RASSF6 was significantly associated with a poor prognosis and shorter overall survival in pre-B ALL patients suggesting that the frequent epigenetic inactivation of RASSF6 plays an important role in the pathogenesis and progression of pre-B-ALL. Our study shows that the frequent hypermethylation of RASSF6 can potentially serve as a useful predictive biomarker in pre-B-ALL patient prognosis.
Funding: This study was supported by Hematology, Oncology and Stem Cell Transplantation Research Center, Shariati Hospital, Tehran University of Medical Sciences, Tehran, Iran. (Grant number: 31971-36-01-95)
Conflict of Interest The authors declare that they have no conflict of interest
Acknowledgements This study was supported by Hematology, Oncology and Stem Cell Transplantation Research Center, Shariati Hospital, Tehran University of Medical Sciences, Tehran, Iran. (Grant number: 31971-36-01-95).
10
References [1] K. Kaushansky, J.T. Prchal, O.W. Press, M.A. Lichtman, M. Levi, L.J. Burns, Michael A. Caligiuri, Williams hematology, McGraw-Hill Medical2016. [2] T. Bhatla, J. Wang, D.J. Morrison, E.A. Raetz, M.J. Burke, P. Brown, W.L. Carroll, Epigenetic reprogramming reverses the relapse-specific gene expression signature and restores chemosensitivity in childhood B-lymphoblastic leukemia, Blood 119(22) (2012) 5201-5210. [3] W.-J. Xue, Y. Feng, F. Wang, P. Li, Y.-F. Liu, Y.-B. Guo, Z.-W. Wang, Q.-S. Mao, The value of serum RASSF10 hypermethylation as a diagnostic and prognostic tool for gastric cancer, Tumor Biology 37(8) (2016) 11249-11257. [4] W. Liu, J. Wang, L. Wang, C. Qian, Y. Qian, H. Xuan, W. Zhuo, X. Li, J. Yu, J. Si, Rasassociation domain family 10 acts as a novel tumor suppressor through modulating MMP2 in hepatocarcinoma, Oncogenesis 5(6) (2016) e237. [5] A.M. Richter, S.K. Walesch, R.H. Dammann, Aberrant Promoter Methylation of the Tumour Suppressor RASSF10 and Its Growth Inhibitory Function in Breast Cancer, Cancers 8(3) (2016) 26. [6] Y. Jin, B. Cao, M. Zhang, Q. Zhan, J.G. Herman, M. Yu, M. Guo, RASSF10 suppresses hepatocellular carcinoma growth by activating P53 signaling and methylation of RASSF10 is a docetaxel resistant marker, Genes & cancer 6(5-6) (2015) 231. [7] F. Wang, Y. Feng, P. Li, K. Wang, L. Feng, Y.-F. Liu, H. Huang, Y.-B. Guo, Q.-S. Mao, W.-J. Xue, RASSF10 is an epigenetically inactivated tumor suppressor and independent prognostic factor in hepatocellular carcinoma, Oncotarget 7(4) (2016) 4279. [8] W. Guo, Z. Dong, Y. Guo, S. Shen, X. Guo, G. Kuang, Z. Yang, Decreased expression and frequent promoter hypermethylation of RASSF2 and RASSF6 correlate with malignant progression and poor prognosis of gastric cardia adenocarcinoma, Molecular carcinogenesis 55(11) (2016) 16551666. [9] J. Deng, H. Liang, G. Ying, H. Li, X. Xie, J. Yu, D. Fan, X. Hao, Methylation of ras association domain protein 10 (RASSF10) promoter negative association with the survival of gastric cancer, American journal of cancer research 4(6) (2014) 916. [10] Z. Li, X. Chang, D. Dai, P. Deng, Q. Sun, RASSF10 is an epigenetically silenced tumor suppressor in gastric cancer, Oncology reports 31(4) (2014) 1661-1668. [11] J.J. Mezzanotte, V. Hill, M.L. Schmidt, T. Shinawi, S. Tommasi, D. Krex, G. Schackert, G.P. Pfeifer, F. Latif, G.J. Clark, RASSF6 exhibits promoter hypermethylation in metastatic melanoma and inhibits invasion in melanoma cells, Epigenetics 9(11) (2014) 1496-1503. [12] Z. Wei, X. Chen, J. Chen, W. Wang, X. Xu, Q. Cai, RASSF10 is epigenetically silenced and functions as a tumor suppressor in gastric cancer, Biochemical and biophysical research communications 432(4) (2013) 632-637. [13] A. Djos, T. Martinsson, P. Kogner, H. Carén, The RASSF gene family members RASSF5, RASSF6 and RASSF7 show frequent DNA methylation in neuroblastoma, Molecular cancer 11(1) (2012) 40. [14] T. Dansranjavin, F. Wagenlehner, S. Gattenloehner, K. Steger, W. Weidner, R. Dammann, U. Schagdarsurengin, Epigenetic down regulation of RASSF10 and its possible clinical implication in prostate carcinoma, The Prostate 72(14) (2012) 1550-1558. [15] V. Hill, N. Underhill-Day, D. Krex, K. Robel, C. Sangan, H. Summersgill, M. Morris, D. Gentle, A.D. Chalmers, E. Maher, Epigenetic inactivation of the RASSF10 candidate tumor suppressor gene is a frequent and an early event in gliomagenesis, Oncogene 30(8) (2011) 978. [16] U. Schagdarsurengin, A.M. Richter, C. Wöhler, R.H. Dammann, Frequent epigenetic inactivation of RASSF10 in thyroid cancer, Epigenetics 4(8) (2009) 571-576. [17] L.B. Hesson, T.L. Dunwell, W.N. Cooper, D. Catchpoole, A.T. Brini, R. Chiaramonte, M. Griffiths, A.D. Chalmers, E.R. Maher, F. Latif, The novel RASSF6 and RASSF10 candidate tumour suppressor genes are frequently epigenetically inactivated in childhood leukaemias, Molecular cancer 8(1) (2009) 42. [18] T. Shinawi, V. Hill, A. Dagklis, P. Baliakas, K. Stamatopoulos, A. Agathanggelou, T. Stankovic, E.R. Maher, P. Ghia, F. Latif, KIBRA gene methylation is associated with unfavorable biological prognostic parameters in chronic lymphocytic leukemia, Epigenetics 7(3) (2012) 211-215. 11
[19] N. Volodko, M. Gordon, M. Salla, H.A. Ghazaleh, S. Baksh, RASSF tumor suppressor gene family: biological functions and regulation, FEBS letters 588(16) (2014) 2671-2684. [20] A.M. Richter, G.P. Pfeifer, R.H. Dammann, The RASSF proteins in cancer; from epigenetic silencing to functional characterization, Biochimica et Biophysica Acta (BBA)-Reviews on Cancer 1796(2) (2009) 114-128. [21] H. Iwasa, X. Jiang, Y. Hata, RASSF6; the putative tumor suppressor of the RASSF family, Cancers 7(4) (2015) 2415-2426. [22] G. Garcia-Manero, H. Yang, S.-Q. Kuang, S. O'Brien, D. Thomas, H. Kantarjian, Epigenetics of acute lymphocytic leukemia, Seminars in hematology, Elsevier, 2009, pp. 24-32. [23] T.L. Dunwell, L.B. Hesson, T.V. Pavlova, V. Zabarovska, V.I. Kashuba, D. Catchpoole, R. Chiaramonte, A.T. Brini, M. Griffiths, E.R. Maher, Epigenetic analysis of childhood acute lymphoblastic leukemia, Epigenetics 4(3) (2009) 185-193. [24] G. Radziwill, R. Erdmann, U. Margelisch, K. Moelling, The Bcr kinase downregulates Ras signaling by phosphorylating AF-6 and binding to its PDZ domain, Molecular and cellular biology 23(13) (2003) 4663-4672. [25] P.J. Kourlas, M.P. Strout, B. Becknell, M.L. Veronese, C.M. Croce, K.S. Theil, R. Krahe, T. Ruutu, S. Knuutila, C.D. Bloomfield, Identification of a gene at 11q23 encoding a guanine nucleotide exchange factor: evidence for its fusion with MLL in acute myeloid leukemia, Proceedings of the National Academy of Sciences 97(5) (2000) 2145-2150. [26] M. Ikeda, S. Hirabayashi, N. Fujiwara, H. Mori, A. Kawata, J. Iida, Y. Bao, Y. Sato, T. Iida, H. Sugimura, Ras-association domain family protein 6 induces apoptosis via both caspase-dependent and caspase-independent pathways, Experimental cell research 313(7) (2007) 1484-1495. [27] N. Allen, H. Donninger, M. Vos, K. Eckfeld, L. Hesson, L. Gordon, M. Birrer, F. Latif, G. Clark, RASSF6 is a novel member of the RASSF family of tumor suppressors, Oncogene 26(42) (2007) 6203. [28] J.H. Kim, W.S. Kim, C. Park, Epstein–Barr virus latent membrane protein 1 increases genomic instability through Egr-1-mediated up-regulation of activation-induced cytidine deaminase in B-cell lymphoma, Leukemia & lymphoma 54(9) (2013) 2035-2040. [29] Y. Mi, D. Zhang, W. Jiang, J. Weng, C. Zhou, K. Huang, H. Tang, Y. Yu, X. Liu, W. Cui, miR181a-5p promotes the progression of gastric cancer via RASSF6-mediated MAPK signalling activation, Cancer letters 389 (2017) 11-22. [30] U. Kordes, D. Krappmann, V. Heissmeyer, W. Ludwig, C. Scheidereit, Transcription factor NF[kappa] B is constitutively activated in acute lymphoblastic leukemia cells, Leukemia 14(3) (2000) 399. [31] V.J. Weston, B. Austen, W. Wei, E. Marston, A. Alvi, S. Lawson, P.J. Darbyshire, M. Griffiths, F. Hill, J.R. Mann, Apoptotic resistance to ionizing radiation in pediatric B-precursor acute lymphoblastic leukemia frequently involves increased NF-κB survival pathway signaling, Blood 104(5) (2004) 1465-1473. [32] J. Guo, Y. Yang, Y. Yang, E. Linghu, Q. Zhan, M.V. Brock, J.G. Herman, B. Zhang, M. Guo, RASSF10 suppresses colorectal cancer growth by activating P53 signaling and sensitizes colorectal cancer cell to docetaxel, Oncotarget 6(6) (2015) 4202. [33] O. Ng, Y. Erbilgin, S. Firtina, T. Celkan, Z. Karakas, G. Aydogan, E. Turkkan, Y. Yildirmak, C. Timur, E. Zengin, Deregulated WNT signaling in childhood T-cell acute lymphoblastic leukemia, Blood cancer journal 4(3) (2014) e192.
12
Figure ligands
Fig. 1. The methylation status of RASSF6 in adult ALL: The representative MSP results of RASSF6 in the PB samples obtained at the time of diagnosis from (a) Pre-B-ALL and B-ALL patients; (b) T-ALL patients; (c) normal human PB samples. Abbreviations: M, Methylated; U, Unmethylated; P, Patient.
Fig. 2. The methylation status of RASSF10 in adult ALL: The representative MSP results of RASSF10 in the PB samples obtained at the time of diagnosis from (a) Pre-B-ALL and BALL patients; (b) T-ALL patients; (c) normal human PB samples. Abbreviations: M, Methylated; U, Unmethylated; P, Patient.
Fig. 3. The Kaplan-Meier estimate of the OS according to the methylation status of RASSF6 in adult T-ALL and Pre-B-ALL: Figure shows the OS for 45 newly diagnosed T-ALL (a) and pre-B ALL (b) patients, with respect to aberrant RASSF6 promoter methylation (log-rank test; P = 0.272 and P= 0.041, respectively).
Fig. 4. The Kaplan-Meier estimate of the OS according to the methylation status of RASSF10 in adult T-ALL and Pre-B-ALL: The OS for 45 newly diagnosed T-ALL (a) and Pre-B ALL (b) patients, with respect to aberrant RASSF10 promoter methylation (log-rank test; P = 0.912 and P = 0.937, respectively).
13
Figure 1
14
Figure 2
15
Figure 3
16
Figure 4 17
Table 1. Nucleotide sequences of the primers used for MSP-PCR.
Name
Sequences
TM
Size (bp)
RASSF6-M
F:5'TTTTAGGATCGTTGATCGCGTC3' R:5'CTACCGAACTAAAACTCCGCG3'
60 °C
143
RASSF6-U
F:5'GGTTTTAGGATTGTTGATTGTGTT3' R:5'CTCTACCAAACTAAAACTCCACA3'
60 °C
147
RASSF10-M
F: 5'GTAGAGTTAGAGCGGCGGGAGTC3' R:5'ATTCCCCCGCTACGCACCG3'
60 °C
135
RASSF10-U
F: 5'GGGTATTTTGGGTAGAGTTAGAGTG3' 60 °C R: 5'AAACAAACTAAAAAACAACTACAAC3'
126 [10]
Abbreviations: F, Forward primer; R, Reverse primer; M, Methylated-specific primer; U, Unmethylated-specific primer; bp, base pair; TM, Annealing Temperature.
18
Table 2. The demographic and clinicopathologic characteristics of newly diagnosed adult ALL patients (45 patients).
Clinical Factor Sex Male Female
Number
Age; median (range), years
28 (14-80)
Blast; median (range), % WBC; median (range), /µl Plt; median (range), /µl Hb; median (range), g/dl Time of follow-up, median (range), months Complete Remission (45 patients) Yes No Relapse (after CR, 36 patients): Yes No Mortality (22/45 patients) During induction therapy During follow-up None Immunophenotype Pre-B-ALL B-ALL T-ALL RASSF6 methylation RASSF10 methylation
81% (15-95) 19000 (600-400000) 37000 (2000-314000) 9 (4.9-13.9)
26 (57.8%) 19 (42.2%)
10 (1-25) 36 (80%) 9 (20%) 18 (50%) 18 (50%) 9 (20%) 13 (28.9%) 23 (51.1%) 22 (48.9%) 8 (17.8%) 15 (33.3%) 37 (82.2%) 16 (35.6%)
Abbreviations: WBC, white blood cell; Plt, Platelet; Hb, hemoglobin; CR, complete remission.
19
Table 3. A summary of studied clinical and laboratory data in ALL patients with and without RASSF6 and RASSF10 methylation RASSF6 methylation
p-value
RASSF10 methylation
p-value
Meth
Un-meth
Meth
Un-meth
Number
37
8
16
29
Age Gender
32.64
21.5
.057
25.37
31.52
.185
Male Female Blast (%)
21(80.8%) 16 (84.2%)
5 (19.2%) 3 (15.8%)
.766
9 (34.6%) 7 (36.8%)
17 (65.4%) 12 (63.2%)
.878
74.13
80.37
.411
77.44
74.03
.575
WBC (×10^9/Liter) Hb (g/dl)
67.54 9.04
93.59 9.18
.532 .884
88.54 8.88
63.15 9.18
.445 .695
Plt (×10^9/Liter) Relapse
58.37 13
64.87 5
.811 .714
91.94 8
41.66 10
.017 .508
Deceased Type:
18
4
1.00
7
15
.758
Pre-B-ALL B-ALL T-ALL Achieved CR:
20 (90.9%) 7 (87.5%) 10 (66.7%)
2 (9.1%) 1 (12.5%) 5 (33.3%)
2 (9.1%) 2 (25%) 12 (80%)
20 (90.9%) 6 (75%) 3 (20%)
28 (77.8%) 9 (100%)
8 (22.2%) 0 (0%)
14 (38.9%) 2 (22.2%)
22 (61.1%) 7 (77.8%)
13 (72.2%) 15 (83.3%)
5 (27.8%) 3 (16.7%)
8 (44.5%) 6 (33.3%)
10 (55.5%) 12 (66.7%)
9 (69.2%) 19 (82.6%)
4 (30.8%) 4 (17.4%)
5 (38.5%) 9 (39.1%)
8 (61.5%) 14 (60.9%)
9 (100%) 9 (69.2%) 19 (82.6%)
0 (0%) 4 (30.8%) 4 (17.4%)
2 (22.2%) 5 (38.5%) 9 (39.1%)
7 (77.8%) 8 (61.5%) 14 (60.9%)
Yes (36 patients) No (9 patients)
.152
.119
.000
.350
Relapse (after CR, 36 patients): Yes No
.376
.420
Mortality (after CR, 36 patients): Yes No
.185
.608
Mortality (45 patients): During induction therapy (9) During follow-up (13) None (23)
.090
.646
Abbreviations: WBC, white blood cell; Plt, Platelet; Hb, hemoglobin; Pre-B-ALL, Precursor-B-cell acute lymphoblastic leukemia; B-ALL, B-cell acute lymphoblastic leukemia; T-ALL, T-cell acute lymphoblastic leukemia; CR, complete remission.
20
21
S0145-2126(17)30497-6 http://dx.doi.org/10.1016/j.leukres.2017.08.016 LR 5821
To appear in:
Leukemia Research
Received date: Revised date: Accepted date:
5-8-2017 27-8-2017 28-8-2017
Please cite this article as: Younesian Samareh, Shahkarami Sepideh, Ghaffari Parisa, Alizadeh Shaban, Mehrasa Roya, Ghavamzadeh Ardeshir, Ghaffari Seyed H.DNA hypermethylation of tumor suppressor genes RASSF6 and RASSF10 as independent prognostic factors in adult acute lymphoblastic leukemia.Leukemia Research http://dx.doi.org/10.1016/j.leukres.2017.08.016 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
DNA hypermethylation of tumor suppressor genes RASSF6 and RASSF10 as independent prognostic factors in adult acute lymphoblastic leukemia
Running title: RASSF6 and RASSF10 hypermethylation in ALL
Samareh Younesiana,b, Sepideh Shahkaramia, c, Parisa Ghaffaria, Shaban Alizadehd, Roya Mehrasaa, Ardeshir Ghavamzadeha, Seyed H. Ghaffaria *
a
Hematology, Oncology and Stem Cell Transplantation Research Center, Shariati Hospital,
Tehran University of Medical Sciences, Tehran, Iran b
Department of Hematology, School of Allied Medical Sciences, International Campus,
Tehran University of Medical Sciences, Tehran, Iran c
Department of Medical Genetics, School of Medicine, Tehran University of Medical
Sciences, Tehran, Iran d
Department of Hematology, School of Allied Medical Sciences, Tehran University of
Medical Sciences, Tehran, Iran
Corresponding author: Seyed H. Ghaffari, Ph.D.; Hematology, Oncology and Stem Cell Transplantation Research Center, Shariati Hospital, Tehran University of Medical Sciences, Tehran, Iran Tel.: +989121157009 Fax: +982188004140 Email address: [email protected]
1
Graphical abstract
Highlights
RASSF6 and RASSF10 were frequently hypermethylated at diagnosis in adult ALL.
RASSF6 frequently methylated B-ALL; whereas, RASSF10 in T-ALL.
First to report RASSF6 methylation at a high frequency in pre-B ALL patients.
Methylation of RASSF6 was significantly associated with inferior OS in pre-B ALL.
Hypermethylation of RASSF6 can serve as a useful prognosis biomarker in pre-BALL.
Abstract Background: The Hypermethylation of Ras association domain family (RASSF) often plays a key role in malignant progression of solid tumors; however, their impact on the prognosis and survival of adult ALL patients remain elusive. Methods: The frequency of the promoter methylation pattern of RASSF6 and RASSF10 were analyzed in the peripheral blood (PB) samples taken at the time of diagnosis of 45 ALL patients. The methylation-specific PCR (MSP) assay was used to detect the DNA methylation patterns. 2
Results: RASSF6 was frequently hypermethylated in patients diagnosed with pre-B-ALL (90.9%) and B-ALL (87.5%), followed by T-ALL (66.7%); whereas, RASSF10 methylation was more confined to T-ALL (80%) as compared to B-ALL (25%) and pre-B ALL (9.1%) patients. Moreover, hypermethylation of RASSF6 was significantly associated with a poor prognosis and shorter overall survival (OS) in patients with pre-B-ALL (log-rank test; P = 0.041). Conclusion: RASSF6 and RASSF10 were frequently hypermethylated in the samples at the time of diagnosis of adult ALL patients. Our study represents the first report of methylation of RASSF6 at a high frequency in patients with pre-B ALL. Furthermore, hypermethylation of RASSF6 was significantly associated with inferior overall survival in pre-B ALL patients. It may suggest that the frequent epigenetic inactivation of RASSF6 plays an important role in the pathogenesis and progression of pre-B-ALL.
Keywords: RASSF6; RASSF10; acute lymphoblastic leukemia, DNA hypermethylation, tumor suppressor gene, prognostic
1. Introduction Acute lymphoblastic leukemia (ALL) is an aggressive malignancy that emanates in a single B- or T-lymphocyte progenitor. This disease is most common among children and comparably less diagnosed in adults, approximately comprising one-third of reported ALL cases. Aberrant epigenetic modifications and the presence of CpG methylation have both been described in ALL. The evidence demonstrates that the methylation of several tumor suppressor genes (TSGs) are involved in the pathogenesis of ALL, and the methylation of these genes were more eminent in children than adult ALL patients [1]. The DNA hypermethylation of gene promoters often leads to extinguish of TSGs, which is found to be correlated with resistance to chemotherapy in ALL patients. The treatment with demethylating agents, including decitabine or 5-azacytidine, are conducive to an increased sensitivity to chemotherapy [2]. The RASSF (Ras association domain family) family of proteins consists of 10 members, and based on the position of the RA domains in the C-terminal or N-terminal, 3
they are divided into two groups: C-terminal members (RASSF1 to RASSF6) and Nterminal members (RASSF7 to RASSF10). Many of these are TSGs that undergo loss of expression through promoter methylation in numerous types of cancers such as melanoma, breast, prostate, neck, lung, brain, colorectal and kidney cancers as well as leukemia [3-18]. In addition to their tumor suppressor function, RASSF proteins act as scaffolding agents in microtubule stability, regulate mitotic cell division, modulate apoptosis, control cell migration and cell adhesion, and modulate NF-κB activity as well as the duration of inflammation. The ubiquitous functions of these proteins highlight the importance of their role in numerous physiological pathways [19]. Certain members of the RASSF family, such as RASSF6 and RASSF10, are inactivated by promoter methylation at a high frequency in a broad range of cancers and their methylation were often related to a poor survival [3, 8, 11, 13, 20]. Evidence suggests that RASSF6 and RASSF10 like other members can stabilize p53, regulate the cell cycle, inhibit tumor growth, induce apoptosis and inhibit cell migration [4, 6, 11, 19, 21]. Additionally, RASSF6 and RASSF10 trigger the inhibition of NFκB and Wnt/bcatenin signaling pathways, respectively [12, 21]. The methylation of RASSF genes has infrequently been reported in leukemia. Recent evidence demonstrates that the epigenetic silencing in some of the RASSFs’ family may play essential roles in leukemia development [19]. The epigenetic silencing of RASSF6 and RASSF10 has been shown in chronic lymphoblastic leukemia, in addition to pediatric B- and T-acute lymphoblastic leukemia (ALL) [17, 18], and it has been suggested that the methylation of RASSF6 and RASSF10 may be a trait of blasts in the bone marrow of B- and T-ALL patients [17]. However, their role as a prognostic value in ALL patients has not yet been determined. Since the RASSF6 and RASSF10 are involved in the regulation of signaling pathways that are aberrantly activated in ALL, it’s likely that the epigenetic silencing of RASSF6 and RASSF10 should have an impact on the patient’s prognosis and survival. Therefore, their role still has to be determined as a prognostic value or therapeutic target. Here, we have investigated the frequency of RASSF6 and RASSF10 promoter methylation at the time of diagnosis and have correlated them with the clinical outcome and overall survival (OS) in adult patients with ALL. 2. Patients and methods 2.1. Ethics statement 4
The Regional Ethics Committee of Tehran University of Medical Sciences approved the study and the patients and/or their guardians provided a written informed consent. This study was carried out according to the Helsinki of Declaration 2.2. Samples from patients and controls Peripheral blood (PB) samples from 45 patients with well-defined ALL included into the Hematology, Oncology and Stem Cell Transplantation Research Center of Shariati Hospital between the years of 2015-2017 for the treatment of adult patients with ALL were analyzed prospectively. In all the patients, the diagnosis was confirmed by centrally monitored morphology and immunophenotyping. Adults diagnosed with ALL were treated with the Hyper-CVAD chemotherapy program. The PB samples of 10 healthy individuals were used as the control. 2.3. Methylation assays Mononuclear cells (MNC) were isolated from the PB by Ficoll-Hypaque (Lymphodex, Germany) density gradient centrifugation. Genomic DNA was extracted from MNC pellets by the DNA extraction mini kit (Yekta Tajhiz Azma, Iran). Bisulfite treatment was performed on 1μg of DNA using the EpiTect Fast DNA Bisulfite Kit (Qiagen, Hilden, Germany). A bisulfite solution and DNA protect reagent was added to each sample and incubated at 95°C for 5 min followed by 60°C for 20 min, 95°C for 5 min and finally 60°C for 20 min. Each sample was then desulfonated and eluted in a final volume of 15μl. The MethPrimer (http://www.urogene.org/methprimer/) was utilized to design methylation-specific polymerase chain reaction (MSP) primers (Table 1). The 25μl reaction consisted of 8μl of Taq DNA polymerase master mix red (Ampliqon), 1μl of 10μM of forward and reverse primers, 2μl of converted DNA template (containing 20 to 40 ng/μl) and 14μl of ddH2O. Thermal cycling was performed with a 5-min hot start at 95°C, followed by 35 cycles at 95°C for 25s, 60°C for 40s, 72°C for 25s and a final extension at 72°C for 10 min. All PCR amplifications were visualized on a 2% agarose gel.
3. Statistical analysis 5
The clinical and laboratory data were gathered from the patients' clinical records and this data was analyzed using SPSS software package version 21.0. The relationship of RASSF6 and RASSF10 methylation status, additional prognostic factors of interest; such as age, gender, WBC and platelet count, hemoglobin level, and ALL immunophenotypes, were determined by using the Student’s t-test and Chi-square (χ2) test. A p-value of less than 0.05 was considered to be statistically significant. The analysis of overall survival (OS) was demonstrated by using the Kaplan-Meier method with 95% confidence intervals and was compared by the log-rank test. The OS rate was considered from the date of diagnosis until the time of death or censorship of the patients’ data. A p-value of <0.05 was considered statistically significant. 4. Results 4.1.Patients The clinical-laboratory features of 45 adult patients with ALL at the time of diagnosis are summarized in Table 2. The study population consisted of 19 females and 26 males with the median age of 28 years (range: 14 to 80 years). The patients, according to the ALL immunophenotypes, were divided into three groups: pre-B-ALL, B-ALL and TALL. Additionally, the PB samples from 10 healthy individuals consisting of 7 females and 3 males with the ages ranging from 27 to 52 years were included in this study as the control. The hematologic complete remission (CR) was achieved in in 36 (80%) patients, and they were monitored for relapse and mortality for approximately 25 months (median 10; range 1–25). The total of 22 (48.9%) patients died by the end of the follow-up period; 9 (20%) patients died during the course of induction therapy and the other 13 (28.9%) died following a relapse. 4.2. Methylation status of RASSF6 and RASSF10 The methylation specific polymerase chain reaction (MSP) analysis of the methylation status of RASSF6 and RASSF10 in PB-MNC of the patients with pre-BALL, B-ALL and T-ALL are shown in Fig. 1 and 2, respectively. The vast majority of adult ALL patients (91.1%) demonstrated methylation of the promoters in either RASSF6 or RASSF10; about 26.7% had both RASSF6 and RASSF10 promoter methylation at the same time. We found RASSF6 to be methylated in 90.9% of the pre-B-ALL (20/22), 6
87.5% of the B-ALL (7/8) and 66.7% of the T-ALL (10/15) patients (Table 3). The RASSF10 promoter was methylated in 9.1% of the pre-B-ALL (2/22), 25% of the B-ALL (2/8) and 80% of the T-ALL (12/15) patients. None of the healthy controls revealed any RASSF6 or RASSF10 promoter methylation. 4.3. Correlation of RASSF6 and RASSF10 methylation with clinical parameters In this study, the patients were divided into two groups according to the methylation status of RASSF6 and RASSF10; methylated and unmethylated. Furthermore, their correlation with the clinical parameters of interest, such as age, gender, WBC and platelet count, hemoglobin level, and immunophenotypes were analyzed using the Student’s t-test and Chi-square (χ2) test (Table 3). Neither RASSF6 nor RASSF10 methylation correlated with any of the aforementioned parameters in the analyzed cohort. 4.4. Impact of RASSF6 and RASSF10 methylation status on survival As previously mentioned, 22 out of the 45 cases died by the end of the follow-up period; 9 patients deceased during the induction therapy; the remaining 13 patients who achieved complete remission (CR) died following a relapse. Interestingly, 18 of these 22 patients had RASSF6 methylation. Moreover, the Kaplan-Meier curve showed that RASSF6 methylation status was significantly associated with a worse out-come in patients with pre-B-ALL. As seen in Fig. 3, pre-B-ALL patients with methylated RASSF6 had a shorter overall survival (OS) when compared to patients without methylation (log-rank test; P = 0.041). Among the T-ALL and B-ALL patients, no significant difference was observed in the OS rates of patients with or without hypermethylation of the RASSF6 gene. Additionally, the methylation status of RASSF10 did not significantly correlate with the OS rates of patients with ALL (Fig. 4).
5. Discussion Aberrant epigenetic modifications are well-recognized drivers for oncogenesis. Acute lymphoblastic leukemia (ALL) is no exception and leukemogenesis of ALL is heavily influenced by epigenetics, particularly DNA hypermethylation. In recent years, many tumor suppressor genes (TSGs) have been found to be epigenetically inactivated in ALL [22, 23], indicating that aberrant promoter methylation and associated silencing of genes 7
are hallmarks of leukemogenesis and the probable critical factors concerning the outcome of chemotherapy. Several RASSF members, in particular RASSF6 and RASSF10 which are regarded as the putative tumor suppressors of the RASS family, play an important role in cancer, regulating several physiological processes, including cell proliferation, apoptosis and tumor development. They are frequently methylated and down regulated in a variety of solid tumors [3-16], as well as in leukemia [17, 18]. Here, we analyzed the promoter methylation status of RASSF6 and RASSF10 in newly diagnosed adult ALL patients by MSP. Our results showed very frequent hypermethylation of RASSF10, the most prominent member of the N-terminal RASSFs. In our T-ALL patients (80%); instead, a lower frequency was observed in B-ALL and pre-B ALL (25% and 9.1%, respectively). On the other hand, RASSF6, the most prominent member of the C-terminal RASSFs, exhibited significant promoter methylation in patients with pre-B-ALL and B-ALL (90.9%, 87.5%, respectively) as well as exhibiting a lesser extent in T-ALL (66.7%) patients. There is only a limited study of data on the methylation status of RASSF6 and RASSF10 in ALL patients. A recent study has reported that RASSF6 and RASSF10 genes are frequent targets of epigenetic inactivation in childhood ALL. Their analysis showed that RASSF6 (94% and 41%) and RASSF10 (16% and 88%) were hypermethylated in pediatric B-ALL and T-ALL, respectively [17]. However, no correlation of these aberrant methylation patterns with any clinical parameters or with the patient’s outcome was reported in ALL. Our data supports this finding and demonstrates that the promoter region of RASSF6 and RASSF10 are highly methylated in both B- and T-ALL patients. The frequencies of methylation in both studies were approximately similar; however, the methylation of RASSF6 in patients with T-ALL was higher in our study when compared to the previous study (66.7% vs 44%). This difference could be due to the differences in age, the number of patients in the different subgroups, ethnic diversity and the use of different methods for assessing DNA methylation. In both studies, none of the healthy controls showed promoter methylation of RASSF6 and RASSF10. The results together indicated that aberrant promoter methylation of RASSF6 and RASSF10 is a feature of blasts ALL, and could have a prognostic value in ALL.
8
In addition to previous studies, our study represents the first report of methylation of RASSF6 at a high frequency in patients with pre-B ALL. It is particularly interesting that RASSF6 methylation occurred more frequently in pre-B-ALL, followed by B-ALL; whereas, RASSF10 hypermethylation was confined to T-ALL. Furthermore, in our cohort of pre-B ALL, patients with RASSF6 methylation were significantly associated with a poor prognosis and shorter overall survival (OS) (log-rank test; P = 0.041). Hence, this finding suggests that the RASSF6 methylation status may be a poor prognostic biomarker in pre-B ALL. The frequent hypermethylation of RASSF6 in pre-B-ALL and its significant association with poor prognosis raises the question of the potential importance of epigenetic inactivation of RASSF6 in the progression of pre-B-ALL. RASSF6; the putative tumor suppressor of the C-RASSF family proteins, is frequently silenced in human cancers and the low expression correlates with an advanced stage and poor prognosis. Only RASSF6 has the PDZ-binding motif (PBM) [21], and the loss of PDZ-binding capacity might contribute to an increased Ras signaling and malignant potential [24], hence, possibly contributing to leukemogenesis [25]. RASSF6 induces apoptosis through caspasedependent and -independent pathways. [21, 26, 27]. Currently, the inhibition of NF-κB [27, 28] and MAPK [11, 29] signaling pathways are implicated in RASSF6-induced apoptosis. In this regard, studies have indicated that NF-κB complexes are constitutively activated in many ALL patients, and this activation has a critical role in the survival of ALL cells either by blocking apoptosis or by enhancing proliferation [30]. Also, it has been reported that the possible causes of resistance to therapy in pediatric pre-B ALL cases could be the frequent involvement of an increased signaling of the NF-κB survival pathway [31]. Even though the role of RASSF6 in leukemia is unknown, it seems that the frequent epigenetic inactivation of RASSF6 in ALL patients, particularly in pre-B-ALL, may play an important role in the pathogenesis and progression of ALL. Perhaps, the activation of the NF-κB survival signaling pathway in the absence of RASSF6 could be the reason for resistance to treatment and inferior survival in the RASSF6-methylated preB-ALL patients. Nevertheless, this hypothesis will require further functional investigations in the biology of ALL malignancies. Moreover, RASSF10, the most recent member of the N-terminal RASSFs, function and role in leukemia is still not clear. Studies in solid tumors suggest that RASSF10 induces apoptosis via a caspase-dependent pathway [6]. RASSF10 interacted with 9
MDM2, stabilized P53, and induced apoptosis via P53 signaling pathways [6, 32]. Similar to a previous study [17], our study shows that RASSF10 methylation is more confined to T-ALL (80% vs 9% in pre-B ALL). This may raise the question of whether RASSF10 methylation plays an important role in the progression of T-ALL. It has been reported that abnormal WNT signaling activation occurs in a significant portion of patients with TALL [33]. RASSF10 is involved in the inhibition of Wnt/b-catenin signaling pathways [12]. Based on the above findings, epigenetically, inactivation of RASSF10 may lead to the abnormal activation of WNT signaling pathways and disease progression in T-ALL patients. Thus, RASSF10 methylation may be a novel oncogenic event in T-ALL. In conclusion, our results show that RASSF6 and RASSF10 were frequently hypermethylated in the samples at the time of diagnosis of adult ALL patients. The most frequent methylation of RASSF6 was found in patients with pre-B-ALL and then B-ALL; whereas,
RASSF10
hypermethylation
was
confined
to
T-ALL.
Furthermore,
hypermethylation of RASSF6 was significantly associated with a poor prognosis and shorter overall survival in pre-B ALL patients suggesting that the frequent epigenetic inactivation of RASSF6 plays an important role in the pathogenesis and progression of pre-B-ALL. Our study shows that the frequent hypermethylation of RASSF6 can potentially serve as a useful predictive biomarker in pre-B-ALL patient prognosis.
Funding: This study was supported by Hematology, Oncology and Stem Cell Transplantation Research Center, Shariati Hospital, Tehran University of Medical Sciences, Tehran, Iran. (Grant number: 31971-36-01-95)
Conflict of Interest The authors declare that they have no conflict of interest
Acknowledgements This study was supported by Hematology, Oncology and Stem Cell Transplantation Research Center, Shariati Hospital, Tehran University of Medical Sciences, Tehran, Iran. (Grant number: 31971-36-01-95).
10
References [1] K. Kaushansky, J.T. Prchal, O.W. Press, M.A. Lichtman, M. Levi, L.J. Burns, Michael A. Caligiuri, Williams hematology, McGraw-Hill Medical2016. [2] T. Bhatla, J. Wang, D.J. Morrison, E.A. Raetz, M.J. Burke, P. Brown, W.L. Carroll, Epigenetic reprogramming reverses the relapse-specific gene expression signature and restores chemosensitivity in childhood B-lymphoblastic leukemia, Blood 119(22) (2012) 5201-5210. [3] W.-J. Xue, Y. Feng, F. Wang, P. Li, Y.-F. Liu, Y.-B. Guo, Z.-W. Wang, Q.-S. Mao, The value of serum RASSF10 hypermethylation as a diagnostic and prognostic tool for gastric cancer, Tumor Biology 37(8) (2016) 11249-11257. [4] W. Liu, J. Wang, L. Wang, C. Qian, Y. Qian, H. Xuan, W. Zhuo, X. Li, J. Yu, J. Si, Rasassociation domain family 10 acts as a novel tumor suppressor through modulating MMP2 in hepatocarcinoma, Oncogenesis 5(6) (2016) e237. [5] A.M. Richter, S.K. Walesch, R.H. Dammann, Aberrant Promoter Methylation of the Tumour Suppressor RASSF10 and Its Growth Inhibitory Function in Breast Cancer, Cancers 8(3) (2016) 26. [6] Y. Jin, B. Cao, M. Zhang, Q. Zhan, J.G. Herman, M. Yu, M. Guo, RASSF10 suppresses hepatocellular carcinoma growth by activating P53 signaling and methylation of RASSF10 is a docetaxel resistant marker, Genes & cancer 6(5-6) (2015) 231. [7] F. Wang, Y. Feng, P. Li, K. Wang, L. Feng, Y.-F. Liu, H. Huang, Y.-B. Guo, Q.-S. Mao, W.-J. Xue, RASSF10 is an epigenetically inactivated tumor suppressor and independent prognostic factor in hepatocellular carcinoma, Oncotarget 7(4) (2016) 4279. [8] W. Guo, Z. Dong, Y. Guo, S. Shen, X. Guo, G. Kuang, Z. Yang, Decreased expression and frequent promoter hypermethylation of RASSF2 and RASSF6 correlate with malignant progression and poor prognosis of gastric cardia adenocarcinoma, Molecular carcinogenesis 55(11) (2016) 16551666. [9] J. Deng, H. Liang, G. Ying, H. Li, X. Xie, J. Yu, D. Fan, X. Hao, Methylation of ras association domain protein 10 (RASSF10) promoter negative association with the survival of gastric cancer, American journal of cancer research 4(6) (2014) 916. [10] Z. Li, X. Chang, D. Dai, P. Deng, Q. Sun, RASSF10 is an epigenetically silenced tumor suppressor in gastric cancer, Oncology reports 31(4) (2014) 1661-1668. [11] J.J. Mezzanotte, V. Hill, M.L. Schmidt, T. Shinawi, S. Tommasi, D. Krex, G. Schackert, G.P. Pfeifer, F. Latif, G.J. Clark, RASSF6 exhibits promoter hypermethylation in metastatic melanoma and inhibits invasion in melanoma cells, Epigenetics 9(11) (2014) 1496-1503. [12] Z. Wei, X. Chen, J. Chen, W. Wang, X. Xu, Q. Cai, RASSF10 is epigenetically silenced and functions as a tumor suppressor in gastric cancer, Biochemical and biophysical research communications 432(4) (2013) 632-637. [13] A. Djos, T. Martinsson, P. Kogner, H. Carén, The RASSF gene family members RASSF5, RASSF6 and RASSF7 show frequent DNA methylation in neuroblastoma, Molecular cancer 11(1) (2012) 40. [14] T. Dansranjavin, F. Wagenlehner, S. Gattenloehner, K. Steger, W. Weidner, R. Dammann, U. Schagdarsurengin, Epigenetic down regulation of RASSF10 and its possible clinical implication in prostate carcinoma, The Prostate 72(14) (2012) 1550-1558. [15] V. Hill, N. Underhill-Day, D. Krex, K. Robel, C. Sangan, H. Summersgill, M. Morris, D. Gentle, A.D. Chalmers, E. Maher, Epigenetic inactivation of the RASSF10 candidate tumor suppressor gene is a frequent and an early event in gliomagenesis, Oncogene 30(8) (2011) 978. [16] U. Schagdarsurengin, A.M. Richter, C. Wöhler, R.H. Dammann, Frequent epigenetic inactivation of RASSF10 in thyroid cancer, Epigenetics 4(8) (2009) 571-576. [17] L.B. Hesson, T.L. Dunwell, W.N. Cooper, D. Catchpoole, A.T. Brini, R. Chiaramonte, M. Griffiths, A.D. Chalmers, E.R. Maher, F. Latif, The novel RASSF6 and RASSF10 candidate tumour suppressor genes are frequently epigenetically inactivated in childhood leukaemias, Molecular cancer 8(1) (2009) 42. [18] T. Shinawi, V. Hill, A. Dagklis, P. Baliakas, K. Stamatopoulos, A. Agathanggelou, T. Stankovic, E.R. Maher, P. Ghia, F. Latif, KIBRA gene methylation is associated with unfavorable biological prognostic parameters in chronic lymphocytic leukemia, Epigenetics 7(3) (2012) 211-215. 11
[19] N. Volodko, M. Gordon, M. Salla, H.A. Ghazaleh, S. Baksh, RASSF tumor suppressor gene family: biological functions and regulation, FEBS letters 588(16) (2014) 2671-2684. [20] A.M. Richter, G.P. Pfeifer, R.H. Dammann, The RASSF proteins in cancer; from epigenetic silencing to functional characterization, Biochimica et Biophysica Acta (BBA)-Reviews on Cancer 1796(2) (2009) 114-128. [21] H. Iwasa, X. Jiang, Y. Hata, RASSF6; the putative tumor suppressor of the RASSF family, Cancers 7(4) (2015) 2415-2426. [22] G. Garcia-Manero, H. Yang, S.-Q. Kuang, S. O'Brien, D. Thomas, H. Kantarjian, Epigenetics of acute lymphocytic leukemia, Seminars in hematology, Elsevier, 2009, pp. 24-32. [23] T.L. Dunwell, L.B. Hesson, T.V. Pavlova, V. Zabarovska, V.I. Kashuba, D. Catchpoole, R. Chiaramonte, A.T. Brini, M. Griffiths, E.R. Maher, Epigenetic analysis of childhood acute lymphoblastic leukemia, Epigenetics 4(3) (2009) 185-193. [24] G. Radziwill, R. Erdmann, U. Margelisch, K. Moelling, The Bcr kinase downregulates Ras signaling by phosphorylating AF-6 and binding to its PDZ domain, Molecular and cellular biology 23(13) (2003) 4663-4672. [25] P.J. Kourlas, M.P. Strout, B. Becknell, M.L. Veronese, C.M. Croce, K.S. Theil, R. Krahe, T. Ruutu, S. Knuutila, C.D. Bloomfield, Identification of a gene at 11q23 encoding a guanine nucleotide exchange factor: evidence for its fusion with MLL in acute myeloid leukemia, Proceedings of the National Academy of Sciences 97(5) (2000) 2145-2150. [26] M. Ikeda, S. Hirabayashi, N. Fujiwara, H. Mori, A. Kawata, J. Iida, Y. Bao, Y. Sato, T. Iida, H. Sugimura, Ras-association domain family protein 6 induces apoptosis via both caspase-dependent and caspase-independent pathways, Experimental cell research 313(7) (2007) 1484-1495. [27] N. Allen, H. Donninger, M. Vos, K. Eckfeld, L. Hesson, L. Gordon, M. Birrer, F. Latif, G. Clark, RASSF6 is a novel member of the RASSF family of tumor suppressors, Oncogene 26(42) (2007) 6203. [28] J.H. Kim, W.S. Kim, C. Park, Epstein–Barr virus latent membrane protein 1 increases genomic instability through Egr-1-mediated up-regulation of activation-induced cytidine deaminase in B-cell lymphoma, Leukemia & lymphoma 54(9) (2013) 2035-2040. [29] Y. Mi, D. Zhang, W. Jiang, J. Weng, C. Zhou, K. Huang, H. Tang, Y. Yu, X. Liu, W. Cui, miR181a-5p promotes the progression of gastric cancer via RASSF6-mediated MAPK signalling activation, Cancer letters 389 (2017) 11-22. [30] U. Kordes, D. Krappmann, V. Heissmeyer, W. Ludwig, C. Scheidereit, Transcription factor NF[kappa] B is constitutively activated in acute lymphoblastic leukemia cells, Leukemia 14(3) (2000) 399. [31] V.J. Weston, B. Austen, W. Wei, E. Marston, A. Alvi, S. Lawson, P.J. Darbyshire, M. Griffiths, F. Hill, J.R. Mann, Apoptotic resistance to ionizing radiation in pediatric B-precursor acute lymphoblastic leukemia frequently involves increased NF-κB survival pathway signaling, Blood 104(5) (2004) 1465-1473. [32] J. Guo, Y. Yang, Y. Yang, E. Linghu, Q. Zhan, M.V. Brock, J.G. Herman, B. Zhang, M. Guo, RASSF10 suppresses colorectal cancer growth by activating P53 signaling and sensitizes colorectal cancer cell to docetaxel, Oncotarget 6(6) (2015) 4202. [33] O. Ng, Y. Erbilgin, S. Firtina, T. Celkan, Z. Karakas, G. Aydogan, E. Turkkan, Y. Yildirmak, C. Timur, E. Zengin, Deregulated WNT signaling in childhood T-cell acute lymphoblastic leukemia, Blood cancer journal 4(3) (2014) e192.
12
Figure ligands
Fig. 1. The methylation status of RASSF6 in adult ALL: The representative MSP results of RASSF6 in the PB samples obtained at the time of diagnosis from (a) Pre-B-ALL and B-ALL patients; (b) T-ALL patients; (c) normal human PB samples. Abbreviations: M, Methylated; U, Unmethylated; P, Patient.
Fig. 2. The methylation status of RASSF10 in adult ALL: The representative MSP results of RASSF10 in the PB samples obtained at the time of diagnosis from (a) Pre-B-ALL and BALL patients; (b) T-ALL patients; (c) normal human PB samples. Abbreviations: M, Methylated; U, Unmethylated; P, Patient.
Fig. 3. The Kaplan-Meier estimate of the OS according to the methylation status of RASSF6 in adult T-ALL and Pre-B-ALL: Figure shows the OS for 45 newly diagnosed T-ALL (a) and pre-B ALL (b) patients, with respect to aberrant RASSF6 promoter methylation (log-rank test; P = 0.272 and P= 0.041, respectively).
Fig. 4. The Kaplan-Meier estimate of the OS according to the methylation status of RASSF10 in adult T-ALL and Pre-B-ALL: The OS for 45 newly diagnosed T-ALL (a) and Pre-B ALL (b) patients, with respect to aberrant RASSF10 promoter methylation (log-rank test; P = 0.912 and P = 0.937, respectively).
13
Figure 1
14
Figure 2
15
Figure 3
16
Figure 4 17
Table 1. Nucleotide sequences of the primers used for MSP-PCR.
Name
Sequences
TM
Size (bp)
RASSF6-M
F:5'TTTTAGGATCGTTGATCGCGTC3' R:5'CTACCGAACTAAAACTCCGCG3'
60 °C
143
RASSF6-U
F:5'GGTTTTAGGATTGTTGATTGTGTT3' R:5'CTCTACCAAACTAAAACTCCACA3'
60 °C
147
RASSF10-M
F: 5'GTAGAGTTAGAGCGGCGGGAGTC3' R:5'ATTCCCCCGCTACGCACCG3'
60 °C
135
RASSF10-U
F: 5'GGGTATTTTGGGTAGAGTTAGAGTG3' 60 °C R: 5'AAACAAACTAAAAAACAACTACAAC3'
126 [10]
Abbreviations: F, Forward primer; R, Reverse primer; M, Methylated-specific primer; U, Unmethylated-specific primer; bp, base pair; TM, Annealing Temperature.
18
Table 2. The demographic and clinicopathologic characteristics of newly diagnosed adult ALL patients (45 patients).
Clinical Factor Sex Male Female
Number
Age; median (range), years
28 (14-80)
Blast; median (range), % WBC; median (range), /µl Plt; median (range), /µl Hb; median (range), g/dl Time of follow-up, median (range), months Complete Remission (45 patients) Yes No Relapse (after CR, 36 patients): Yes No Mortality (22/45 patients) During induction therapy During follow-up None Immunophenotype Pre-B-ALL B-ALL T-ALL RASSF6 methylation RASSF10 methylation
81% (15-95) 19000 (600-400000) 37000 (2000-314000) 9 (4.9-13.9)
26 (57.8%) 19 (42.2%)
10 (1-25) 36 (80%) 9 (20%) 18 (50%) 18 (50%) 9 (20%) 13 (28.9%) 23 (51.1%) 22 (48.9%) 8 (17.8%) 15 (33.3%) 37 (82.2%) 16 (35.6%)
Abbreviations: WBC, white blood cell; Plt, Platelet; Hb, hemoglobin; CR, complete remission.
19
Table 3. A summary of studied clinical and laboratory data in ALL patients with and without RASSF6 and RASSF10 methylation RASSF6 methylation
p-value
RASSF10 methylation
p-value
Meth
Un-meth
Meth
Un-meth
Number
37
8
16
29
Age Gender
32.64
21.5
.057
25.37
31.52
.185
Male Female Blast (%)
21(80.8%) 16 (84.2%)
5 (19.2%) 3 (15.8%)
.766
9 (34.6%) 7 (36.8%)
17 (65.4%) 12 (63.2%)
.878
74.13
80.37
.411
77.44
74.03
.575
WBC (×10^9/Liter) Hb (g/dl)
67.54 9.04
93.59 9.18
.532 .884
88.54 8.88
63.15 9.18
.445 .695
Plt (×10^9/Liter) Relapse
58.37 13
64.87 5
.811 .714
91.94 8
41.66 10
.017 .508
Deceased Type:
18
4
1.00
7
15
.758
Pre-B-ALL B-ALL T-ALL Achieved CR:
20 (90.9%) 7 (87.5%) 10 (66.7%)
2 (9.1%) 1 (12.5%) 5 (33.3%)
2 (9.1%) 2 (25%) 12 (80%)
20 (90.9%) 6 (75%) 3 (20%)
28 (77.8%) 9 (100%)
8 (22.2%) 0 (0%)
14 (38.9%) 2 (22.2%)
22 (61.1%) 7 (77.8%)
13 (72.2%) 15 (83.3%)
5 (27.8%) 3 (16.7%)
8 (44.5%) 6 (33.3%)
10 (55.5%) 12 (66.7%)
9 (69.2%) 19 (82.6%)
4 (30.8%) 4 (17.4%)
5 (38.5%) 9 (39.1%)
8 (61.5%) 14 (60.9%)
9 (100%) 9 (69.2%) 19 (82.6%)
0 (0%) 4 (30.8%) 4 (17.4%)
2 (22.2%) 5 (38.5%) 9 (39.1%)
7 (77.8%) 8 (61.5%) 14 (60.9%)
Yes (36 patients) No (9 patients)
.152
.119
.000
.350
Relapse (after CR, 36 patients): Yes No
.376
.420
Mortality (after CR, 36 patients): Yes No
.185
.608
Mortality (45 patients): During induction therapy (9) During follow-up (13) None (23)
.090
.646
Abbreviations: WBC, white blood cell; Plt, Platelet; Hb, hemoglobin; Pre-B-ALL, Precursor-B-cell acute lymphoblastic leukemia; B-ALL, B-cell acute lymphoblastic leukemia; T-ALL, T-cell acute lymphoblastic leukemia; CR, complete remission.
20
21