DNA Polymerase X of African Swine Fever Virus: Insertion Fidelity on Gapped DNA substrates and AP lyase Activity Support a Role in Base Excision Repair of Viral DNA

doi:10.1016/S0022-2836(03)00019-6

J. Mol. Biol. (2003) 326, 1403–1412

DNA Polymerase X of African Swine Fever Virus: Insertion Fidelity on Gapped DNA substrates and AP lyase Activity Support a Role in Base Excision Repair of Viral DNA Ramo´n Garcı´a-Escudero, Miguel Garcı´a-Dı´az, Marı´a L. Salas, Luis Blanco and Jose´ Salas* Centro de Biologı´a Molecular “Severo Ochoa” (Consejo Superior de Investigaciones Cientı´ficas-Universidad Auto´noma de Madrid) Facultad de Ciencias Universidad Auto´noma de Madrid, Cantoblanco, 28049 Madrid, Spain

DNA polymerase X (pol X) from African swine fever virus (ASFV) is the smallest naturally ocurring DNA-directed DNA polymerase (174 amino acid residues) described so far. Previous biochemical analysis has shown that ASFV pol X is a highly distributive, monomeric enzyme, lacking a proofreading 30 – 50 exonuclease. Also, ASFV pol X binds intermediates of the single-nucleotide base excision repair (BER) process, and is able to efficiently repair single-nucleotide gapped DNA. In this work, we perform an extensive kinetic analysis of single correct and incorrect nucleotide insertions by ASFV pol X using different DNA substrates: (i) a primer/template DNA; (ii) a 1 nt gapped DNA; (iii) a 50 -phosphorylated 1 nt gapped DNA. The results obtained indicate that ASFV pol X exhibits a general preference for insertion of purine deoxynucleotides, especially dGTP opposite template C. Moreover, ASFV pol X shows higher catalytic efficiencies when filling in gapped substrates, which are increased when a phosphate group is present at the 50 -margin of the gap. Interestingly, ASFV pol X misinserts nucleotides with frequencies from 1024 to 1025, and the insertion fidelity varies depending on the substrate, being more faithful on a phosphorylated 1 nt gapped substrate. We have analyzed the capacity of ASFV pol X to act on intermediates of BER repair. Although no lyase activity could be detected on preincised 50 -deoxyribose phosphate termini, ASFV pol X has lyase activity on unincised abasic sites. Altogether, the results support a role for ASFV pol X in reparative BER of damaged viral DNA during ASFV infection. q 2003 Elsevier Science Ltd. All rights reserved

*Corresponding author

Keywords: African swine fever virus; DNA polymerase X; gap-filling fidelity; AP lyase; base excision repair

Introduction African swine fever virus (ASFV) is responsible for a highly lethal disease of domestic pigs.1 The viral genome is a double-stranded Present address: R. Garcı´a-Escudero, Cancer Research UK, Skin Tumour Laboratory, 2 Newark Street, London E1 2AT, UK. Abbreviations used: ASFV, African swine fever virus; pol, DNA polymerase; BER, base excision repair; TdT, terminal deoxynucleotidyl transferase; dRP, 50 deoxyribose phosphate; AP, apurinic/apyrimidinic; hUDG, human uracil DNA glycosylase; hAPE, human AP endonuclease; ROS, reactive oxygen species. E-mail address of the corresponding author: [email protected]

DNA molecule of 170 – 190 kb that encodes more than 150 polypeptides, including a variety of enzymes involved in gene transcription, protein modification, and DNA replication and repair.2 ASFV encodes two types of DNA polymerase: one is a eukaryotic-type (family B) DNA polymerase involved in viral DNA replication3 and the other one belongs to the family X of DNA polymerases, and has been designated ASFV pol X.4 The members of this latter family are monomeric enzymes with different and specialized functions. One of these enzymes is the terminal deoxynucleotidyl transferase (TdT), which adds nucleotides at the junctions of rearranged Ig genes in a template-independent manner.5 Other members

0022-2836/03/$ - see front matter q 2003 Elsevier Science Ltd. All rights reserved

1404 are the yeast pol IV,6,7 and the more recently characterized pol s,8,9 pol m10 and pol l.11 A well-known enzyme of this family is mammalian pol b, which has been studied extensively and is believed to be a DNA repair enzyme.12 Due to its ability to fill in short gaps in DNA and to its dRP lyase activity, pol b plays an essential role in base excision repair (BER) of damaged DNA.13 Previous biochemical analysis showed that ASFV pol X is a monomeric DNA-directed DNA polymerase, highly distributive, and lacking a proofreading 30 –50 exonuclease.4 ASFV pol X is able to fill in short gaps in DNA, and to catalyze a single-nucleotide gap repair reaction. Binding assays using BER substrates of different structure have shown that ASFV pol X interacts efficiently with DNA strand-break intermediates in singlenucleotide BER, but does not avidly bind stranddisplacement intermediates.14 These features support the hypothesis that ASFV pol X could fill in short gaps during viral BER. Moreover, ASFV codes for other enzymes of the BER pathway, such as a class II apurinic/apyrimidinic (AP) endonuclease (pE269R) and a DNA ligase (pNP419L), which reinforces the idea that a BER-like pathway is acting in ASFV-infected cells.2,4 The three-dimensional structure of ASFV pol X has been determined by multidimensional NMR spectroscopy.14,15 Unlike other DNA polymerases, ASFV pol X is formed by only a palm and a Cterminal subdomain. The N-teminal palm domain is constituted by a five-stranded b-sheet (b4, b6, b10, b9 and b8 strands), with a divalent metal-ion coordination site, a three-stranded b-sheet (b7, b2 and b3 strands), a two-stranded b-sheet (b1 and b5 strands), and three a-helices (aA, aB and aC helices). Interestingly, the aC helix is unique to ASFV pol X, and contributes to single-nucleotide gap DNA binding through positioning several Lys residues for electrostatic interactions with DNA. The C-terminal subdomain is formed by three ahelices (aD, aE, aF and C-terminal-310-helices) and a three-stranded b-sheet, and functions in DNA and dNTP-Mg2þ binding. To further characterize ASFV pol X in relation to its possible role in BER, a detailed kinetic analysis of single-nucleotide insertions by ASFV pol X using three different DNA substrates has been performed. For this purpose, Km and kcat values for all four possible correct insertions were determined using: (i) a primer/template DNA; (ii) a 1 nt gapped DNA; and (iii) a 1 nt gapped 50 -phosphorylated DNA. Furthermore, the kinetic parameters and the misincorporation frequencies for incorrect insertion on templates G and C on the same three DNA substrates were obtained. On the other hand, the presence of intrinsic 50 -deoxyribose phosphate (dRP) lyase and AP lyase activities in ASFV pol X has been investigated. The results are discussed in the context of the ASFV infection of the host cellular target, the pig macrophage, a highly oxidative and potentially mutagenic environment.

Fidelity of ASFV pX

Results ASFV pol X kinetic parameters for single nucleotide additions on a recessed substrate Previously, we have demonstrated that ASFV pol X is a primer template-dependent DNA polymerase that catalyzes the addition of nucleotides to the 30 -end of the primer in a distributive and template-directed manner.4 To determine the ASFV pol X catalytic efficiencies of insertion for all four dNTPs, we performed steady-state kinetics of single nucleotide additions on a recessed substrate. For this, primer 15-mer was hybridized independently to four templates differing in the N-18 residue (see Materials and Methods). As an example, Figure 1(a) shows the kinetics of insertion of dTTP with a template containing an A residue at that position. The results are summarized in Table 1. Km values are higher for pyrimidine nucleotides than for purine substrates, being the Km for the incorporation of dGTP opposite template dCMP (C·G) the lowest value (34.5 mM). The rate of nucleotide incorporation varies from 0.021 min21 for an A·T base-pair to 0.012 min21 for C·G pairing. The catalytic efficiency of ASFV pol X is higher for the addition of purine residues, mainly due to the lower Km values for these residues. Importantly, the Km values obtained are higher than those described for replicative DNA polymerases on similar substrates in steady-state conditions.16 – 19 The overall low affinity of ASFV pol X for dNTPs when elongating the recessed complex suggested that this DNA is a relatively poor substrate. Similar Km values were obtained with pol b, the main polymerase acting in mammalian BER, using primer/template complexes.20,21 Comparison of ASFV pol X catalytic efficiency on gapped versus recessed substrates ASFV pol X was shown to be able to catalyze polymerization on a minimal (1 nt) gapped substrate.4 Moreover, when bacteriophage T4 DNA ligase was added after the polymerization reaction, the gap was repaired efficiently. The capability of ASFV pol X to repair a single-nucleotide gap, the substrate of the short-patch main pathway of BER, allows us to ascertain the polymerase kinetic parameters on such a type of substrate. Therefore, using the gapped complexes described in Materials and Methods, we performed steady-state kinetic analysis of single-nucleotide additions (Figure 1(b) and (c)). The results are summarized in Table 1. The affinity of the polymerase for the different dNTPs is generally higher with gapped substrates. Thus, the Km values are in the range 24 –78 mM for 1 ntgap and 4 – 86 mM for 1 nt-gap(P). Interestingly, and as found for the recessed substrate, ASFV pol X normally exhibits higher affinities when inserting purine nucleotides. On the other hand, rate values were very different when comparing

1405

Fidelity of ASFV pX

Figure 1. Kinetics of correct nucleotide insertions by ASFV pol X. Incorporation of dTTP opposite template A residue using the (a) recessed, (b) 1 nt-gap or (c) 1 nt-gap(P) DNA substrates. Kinetic analysis was performed with ASFV pol X and increasing concentrations of the nucleotide under steady-state conditions, as described in Materials and Methods, using 3, 10, and 2 nM pol X for templates (a), (b) and (c), respectively, and 20 minutes of incubation time. Reaction aliquots were run on denaturing PAGE to resolve DNA products, which were visualized by autoradiography. Positions of (50 -32P)-labeled 15-mer primer substrate and 16-mer elongated product are indicated. Quantification of the gel bands was performed. The observed rate of nucleotide incorporation as a function of dTTP concentration is represented below each electrophoresis. The data were fit using equation (1) (see Materials and Methods) and the resulting Km and kcat parameters are given in Table 1.

recessed and gapped DNA substrates. Thus, the overall kcat for 1 nt-gap is four times lower than that for the recessed or 1 nt-gap(P) complexes. The presence of the phosphate moiety in the gapped DNA allows the polymerase to have an overall kcat similar to that found for the recessed complex.

Table 1. Kinetic parameters for single-base correct insertion by ASFV polX Substrate

Km (mM)

kcat (103 min21)

kcat /Km (M min)21

T·A G·C C·G A·T

95.5 ^ 0.7 230.7 ^ 35.0 34.5 ^ 4.5 254.5 ^ 12.0

18.1 ^ 1.2 15.7 ^ 2.4 12.0 ^ 2.3 21.5 ^ 9.7

190.2 68.0 357.0 83.6

T·A G·C C·G A·T

52.3 ^ 9.0 45.5 ^ 2.1 24.3 ^ 7.6 78.5 ^ 20.5

4.31 ^ 1.37 3.12 ^ 1.59 3.58 ^ 0.54 4.56 ^ 0.26

81.0 67.9 152.7 59.7

T·A G·C C·G A·T

16.4 ^ 3.6 86.0 ^ 16.9 3.56 ^ 1.22 71.5 ^ 2.1

11.7 ^ 3.1 30.1 ^ 1.3 8.23 ^ 2.77 19.5 ^ 0.1

758.5 356.5 2313.2 273.2

Basepaira

Recessed

1-Gap

1-Gap-P

a In the base-pair notation X·Y, X is the templating base and Y is the incoming nucleotide.

In general, the efficiency of ASFV pol X to catalyze a 1 nt addition on primer/template substrates is higher when the substrate has a 1 nt gap with a 50 -PO4 in the downstream primer. Moreover, the preference for the phosphorylated DNA is due either to lower Km values (compared to recessed DNA) or to higher rates of nucleotide insertion (compared with 1 nt-gap DNA). Finally, the highest catalytic efficiencies are obtained for the incorporation of purine residues, especially for the C·G base-pair formation. ASFV pol X fidelity on the recessed and gapped DNA substrates It is well established that the fidelity of a DNA polymerase for a particular mismatch insertion can be determined by calculating the ratio between the catalytic efficiency of the correct base-pair and the incorrect base-pair.16 To determine ASFV pol X fidelity, we performed kinetics measurements of incorrect base insertions using the DNA complexes described above. The frequencies of nucleotide misinsertions opposite template G18 and C18 residues were measured for all possible mispairs (Figure 2 and Table 2). Taking these results into account, the overall ASFV pol X fidelity appears to be contributed mainly by a difference between correct and incorrect insertion rate values, rather than by the differential values in Km for correct versus incorrect

1406

Fidelity of ASFV pX

Figure 2. Kinetics of incorrect nucleotide insertions by ASFV pol X. Incorporation of dATP opposite template G residue using the (a) recessed, (b) 1 nt-gap or (c) 1 nt-gap(P) DNA substrates. Kinetic analysis was performed as for Figure 1,but with a higher concentration (400 nM) of ASFV pol X and longer incubation times (60 minutes). DNA products were resolved on denaturing PAGE, visualized by autoradiography, and quantified. Positions of (50 -32P)-labeled 15-mer primer substrate and 16-mer product are indicated. The observed rate of dATP incorporation was represented as a function of dATP concentration. The data were fit using equation (1) and the resulting Km and kcat parameters are given in Table 2.

dNTPs. The rate of mispair insertion is lower for the 1 nt-gap complex, as described for correct additions (see Table 1). The average discrimination efficiencies are higher when ASFV pol X fills in the 1 nt-gap(P) complex compared with recessed or 1 nt-gap DNAs. Thus, misinsertion frequencies

are in the range 1.8 £ 1023 –1.3 £ 1025 for recessed and 1 nt-gap substrates and 2.4 £ 1024 –3.3 £ 1026 for 1 nt-gap(P) DNA. The fidelity exhibited by the phosphorylated gapped substrate is higher with template C due to a better discrimination between correct versus incorrect nucleotides.

Table 2. Kinetic parameters for single-base incorrect insertion by ASFV polX Substrate

Base-paira

Km (mM)

kcat (103 min21)

kcat /Km (M min)21

Misinsertion frequency finsb

G·A G·G G·T C·A C·C C·T

71.5 ^ 7.7 509 ^ 122 855 ^ 183 48.5 ^ 7.2 271 ^ 31 250 ^ 15

0.0088 ^ 0.0020 0.032 ^ 0.011 0.025 ^ 0.001 0.0076 ^ 0.0015 0.0010 ^ 0.0003 0.0080 ^ 0.0005

0.1266 0.0614 0.0301 0.1587 0.0038 0.0391

1.8 £ 1023 9.0 £ 1024 4.4 £ 1024 4.4 £ 1024 1.0 £ 1025 1.0 £ 1024

G·A G·G G·T C·A C·C C·T

387 ^ 37 1002 ^ 50 972 ^ 207 92.7 ^ 5.3 396 ^ 45 325 ^ 72

0.0056 ^ 0.0012 0.0723 ^ 0.0051 0.0128 ^ 0.0024 0.0049 ^ 0.0003 0.0008 ^ 0.0001 0.0113 ^ 0.0005

0.0144 0.0678 0.0138 0.0538 0.0021 0.0359

2.1 £ 1024 9.9 £ 1024 2.0 £ 1024 3.5 £ 1024 1.3 £ 1025 2.3 £ 1024

G·A G·G G·T C·A C·C C·T

270 ^ 43 777 ^ 50 466 ^ 16 152 ^ 31 123 ^ 20 412 ^ 57

0.0059 ^ 0.0003 0.1964 ^ 0.0092 0.0412 ^ 0.0048 0.0206 ^ 0.0019 0.0009 ^ 0.0001 0.0407 ^ 0.0085

0.0221 0.2550 0.0883 0.1398 0.0077 0.0985

6.1 £ 1025 7.1 £ 1024 2.4 £ 1024 6.0 £ 1025 3.3 £ 1026 4.2 £ 1025

Recessed

1-Gap

1-Gap-P

a b

In the base-pair notation X·Y, X is the templating base and Y is the incoming nucleotide. fins ¼ [kcat(incorrect)/Km(incorrect)]/[kcat(correct)/Km(correct)]. See Table 1 for kinetic values of correct insertions.

1407

Fidelity of ASFV pX

ASFV pol X exhibits AP lyase activity

Figure 3. dRP lyase activity. (a) Representation of dRP lyase reaction. A dsDNA substrate containing a uracil residue is treated with hUDG and hAPE to release a dRP-containing substrate. This dRP moiety will be cleaved by a dRP lyase activity. (b) Autoradiogram showing dRP lyase activity; 30 nM 35-mer DNA substrate was incubated with different quantities of either pol b or ASFV pol X protein for ten or 20 minutes (left or right lanes, respectively) as described in Materials and Methods. Positions of substrate and product are indicated.

Mammalian BER is a multistep DNA repair process in which different enzymatic activities should act in an ordered and concerted manner to achieve the final repaired DNA product.22 Pol b plays a central role in BER since, in addition to catalyzing the DNA polymerization step, it exhibits dRP lyase activity on preincised AP sites.23,24 To test whether ASFV pol X has dRP lyase activity, we generated in vitro a dRP substrate using a 34-mer double-stranded oligonucleotide containing a uracil (U) residue at position 16. As described in Materials and Methods, this dsDNA was incubated with human uracil DNA glycosylase (hUDG) to remove the U residue, thus generating an AP site, and subsequently treated with human AP endonuclease (hAPE1) to release a dRP containing substrate (see the scheme in Figure 3(a)). This substrate was incubated in the absence (control) or in the presence of either pol b or ASFV pol X. The excision of the dRP group from the incised oligonucleotide can be detected in denaturing PAGE by the reduction in size of the 30 -end-labeled oligonucleotide. In contrast to pol b, no dRP lyase activity was detected in ASFV pol X reactions, even when large quantities of the enzyme were analyzed (Figure 3(b)). Therefore, we decided to test whether ASFV pol X contains lyase activity on unincised AP substrates using the DNA complex described above. Such an activity, named AP lyase, has been described for human pol b.24,25 After treatment of the uracil-containing DNA with the hUDG, the AP-containing substrate was incubated immediately with either pol b or ASFV pol X (Figure 4(a)). Direct incision on the DNA can be detected by the reduction in size of the 30 -end-labeled

Figure 4. AP lyase activity. (a) Representation of the AP lyase reaction. The uracil-containing substrate is treated with hUDG, leaving an intact AP site. The substrate will be cleaved 30 with respect to the AP site by the AP lyase activity. (b) AP lyase activity of ASFV pol X. The ten and 20 minute reactions (left and right lanes, respectively) were carried out with 30 nM 35-mer DNA substrate, as described in Materials and Methods, using different concentrations of pol b or ASFV pol X. Positions of substrate and product are indicated.

1408

Figure 5. Trapping of the ASFV pol X-DNA complex. SDS/polyacrylamide gels of polymerase – DNA trapping complexes using sodium borohydride. Reactions were performed as described in Materials and Methods, using a preincised AP substrate (dRP lyase trapping) or a non-incised AP substrate (AP lyase trapping), in the presence of either 20 mM NaBH4 or NaCl (as indicated). For dRP lyase trapping, 500 nM pol b was assayed. For AP lyase trapping, reactions were performed using 5 mM pol b, and either 1 or 2 mM ASFV pol X.

oligonucleotide (containing the AP site) from 35mer to 19-mer. As shown in Figure 4(b), ASFV pol X exhibits an intrinsic lyase activity on the AP substrate, comparable to that of human pol b.24,25 It is well known that the enzymatic reaction of both dRP and AP lyases proceeds through a belimination catalysis, where a Schiff base intermediate is generated and can thus be trapped with NaBH4. This allows the enzyme –DNA intermediate to be linked covalently and detectable by PAGE.25,26 To determine whether this is the case for ASFV pol X, an AP lyase trapping assay was performed using the same 35-mer DNA substrate and adding NaBH4 to the mixture. Again, pol b was used as a control enzyme. Covalently linked protein– DNA complexes were trapped efficiently and detected by SDS-PAGE either in pol b-catalyzed or in ASFV pol X-catalyzed reactions (Figure 5). Labeled bands corresponding to the trapped complexes and with different mobilities for each polymerase– DNA complex can be seen clearly. The appearance of these bands was dependent on the presence of both enzymes (pol b or ASFV pol X) and NaBH4. As a control, a trapping analysis of a preincised AP substrate incubated with pol b is shown (Figure 5). In conclusion, the in vitro analysis of lyase activities on abasic sites shows clearly that pol X exhibits an intrinsic AP lyase activity similar to that described for pol b.

Discussion ASFV host cell is the swine macrophage, a cell type that produces and releases reactive oxygen species (ROS) in response to phagocytosis or

Fidelity of ASFV pX

stimulation with various agents.27 ROS produce a wide spectrum of damage in different cellular compounds, which can be deleterious for the cell. ROSinduced DNA lesions, such as oxidized purines, oxidized pyrimidines, ethenobases, hypoxantine and abasic sites,28,29 have either miscoding properties or are blocks for DNA and RNA polymerases during replication and transcription. The majority of the lesions induced by ROS are repaired via the BER pathway. Thus, a BER system encoded by ASFV could have emerged as an adaptive response to a genotoxic environment within the macrophage. The kinetic study of single-nucleotide additions by ASFV pol X has shown that the preferred substrate for nucleotide incorporation is a 50 -phosphorylated 1 nt gapped DNA, as would be expected if ASFV pol X plays a role in short-patch BER. On the other hand, ASFV pol X exhibits a preferential use of purine versus pyrimidine nucleotides on various DNA substrates. This particular feature could be an adaptive consequence of possible differences in purine/pyrimidine nucleotide pool levels in the cytoplasm of the infected cell. However, the preferential use of purines by ASFV pol X could be due to a more frequent repair of DNA damage in purine residues than in pyrimidine residues. In fact, the most important ROSinduced lesion is the oxidation of dGMP in the DNA to 8-oxo-7,8-dihydro-20 -dGMP (8-oxo-G). If 8-oxo-G is present in the DNA and paired to C, its proper repair via BER will initially leave an abasic site that would be further replaced (by the DNA polymerase) by inserting a new dGTP residue. Interestingly, ASFV pol X inserts dGTP opposite template C with the highest efficiency of all four correct base pairs on the three different DNA substrates analyzed (Table 1). A similar result was obtained previously using displacement titration of TNP-ATP in the presence of ASFV pol X, where dGTP-Mg2þ, of all four nucleotides, exhibited the maximal affinity for ASFV pol X in the absence of DNA.14 Therefore, we suggest that ASFV pol X could exhibit this preference because AP sites with templating C (intermediates in the BERrepairing of 8-oxo-G·C mispairs) are frequent damages to be repaired in the physiological conditions of ASFV infection. In relation to this, it has been argued that the relatively high affinity of mammalian pol b for dCTP opposite template G is because its most important function is the replacement of G·T and G·U mispairs before they give rise to transversions in the genome.21 ASFV pol X fidelity Because ASFV pol X lacks a proofreading 30 –50 exonuclease activity, its fidelity during BER will depend on only the efficiency for inserting wrong nucleotides or elongating mistmatches. Steadystate analysis of misinsertion showed that ASFV pol X prefers the 1 nt-gap(P) complex to insert correct nucleotides, and exhibits the higher discrimination of correct versus incorrect nucleotides (Table 2)

1409

Fidelity of ASFV pX

when filling in this complex. The major differences observed are in the case of C·A and G·A mispairs, with 7.4 and 29.5-fold increases in fidelity, respectively, when compared with the recessed substrate. This overall increment in fidelity with the 1 nt-gap(P) DNA is mainly due to a better discrimination at the binding step rather than in the catalytic rate of insertion of right versus wrong nucleotides. Thus, the values of kcat(correct)/kcat(incorrect) for the recessed DNA varied from 490 to 12,000, while those for the 1 nt-gap(P) DNA varied from 153 to 9144. In contrast, the values for Km(incorrect)/Km(correct) for the recessed DNA ranged from 0.3 to 7.8, while those for the 1-gap(P) DNA were higher, varying from 3.1 to 115 (Table 2). Probably, the differences observed in Km for nucleotides are related to differential affinities of ASFV pol X for various DNA substrates. Preliminary analysis has shown that ASFV pol X binds to 1 nt-gap(P) with higher affinity when compared to the other DNA substrates (unpublished results). In relation to this, it has been determined by NMR chemical shift mapping that ASFV pol X helices aC and aE form part of the interaction surface for single-nucleotide gap DNA binding.14 After binding, ASFV pol X positions several Lys residues (Lys131 and Lys132) of aE (a helix that is not present in pol b) near the gapped DNA, probably allowing electrostatic interactions with the 50 -phosphate moiety and increasing binding affinity. These contacts with the phosphate group at the 50 margin of the 1 ntgap(P) might allow the ASFV pol X to increase the affinity for incoming nucleotides. ASFV pol X misinsertion frequencies when filling in the BER substrate 1 nt-gap(P) are in the range of 0.33 £ 1025 –24 £ 1025. These values resemble those described for pol b with similar DNA substrates.20,30 It has been argued that the discrimination rates of pol b are not accurate enough for an errorless repair of all the damaged nucleotides generated spontaneously per human cell per day.31 We do not know at present whether similar rates in ASFV pol X will allow the virus to repair all the damage in its DNA during the infection. It should be noted that the extent of DNA that ASFV pol X must repair is probably smaller than that handled by pol b (a 170 kb genome versus the complete mammalian genome). Also, the possibility cannot be discarded that other proteins of the viral BER can interact with ASFV pol X and increase its in vivo fidelity. Alternatively, it is possible that other enzymatic activities of the repair pathway contribute to augment the overall BER fidelity. In this sense, it has been described recently that hAPE displays an exonucleolytic activity on 30 mispaired DNA that can contribute to increase mammalian BER fidelity.32 The viral AP endonuclease, which belongs to the same class as the hAPE, might exhibit a similar activity that would contribute to maintain viral DNA integrity. A pre-steady-state kinetic analysis of singlenucleotide insertions of correct and incorrect

nucleotides by ASFV pol X has been reported.33 In that study, in which a different template sequence and a higher pH were used, the fidelity values obtained were from 40 to 700 times lower than those reported here. However, these differences in the experimental conditions used do not appear to account for the discrepancy in the fidelity values, as we have obtained essentially the same values irrespective of the sequence and/or pH (not shown). In particular, no important differences were found in the kinetic parameters for insertion of G opposite template G (G:G), thus confirming our finding that ASFV pol X misinserts G opposite template G with an efficiency about 1000 times lower than that for the correct insertion of C opposite G. This result is not in agreement with the proposal by Showalter & Tsai33 that the insertion efficiency of ASFV pol X for the G:G mismatch is similar to the efficiency for the four Watson–Crick base-pairs. The reasons for the discrepancy between the studies are therefore not clear at present, and other approaches, such as in vivo experiments should be carried out to understand the functional relevance of the ASFV BER pathway. Thus, analysis of the consequences of deleting BER genes on the viral DNA integrity and virus viability would determine whether viral BER plays a mutagenic role, as has been proposed,33 or is essential for ASFV maintenance in a potentially genotoxic environment (the pig macrophage), as our results suggest. In relation to this, preliminary results obtained in our laboratory suggest that the E296R gene (the hAPE viral homologue) is needed for ASFV viability when infecting porcine macrophages. Moreover, repetitive nucleotide sequencing of a dispensable genomic segment of a clonal population of ASFV was carried out to estimate the mutant frequency to neutral alleles when infecting VERO cells. Since no mutation was detected in a total of 54026 nucleotides screened,34 the existence of hypermutational events during ASFV DNA replication, which has been suggested,33 is very unlikely, at least under standard growth conditions.

Viral BER pathway Two main pathways can be distinguished in mammalian BER, involving the replacement of either a single nucleotide (short-patch) or up to ten nucleotides (long-patch). A number of data suggest indirectly that ASFV pol X acts during a short-patch BER of damaged DNA: (i) ASFV pol X is able to fill in a single nucleotide gap;4 (ii) ASFV pol X exhibits higher catalytic efficiencies with “reparative” 1 nt gapped substrates compared to a “replicative” primer/template recessed DNA (this work); (iii) ASFV pol X binds in vitro to DNA intermediates of the short-patch route; and (iv) does not bind to a long-patch intermediate;14 (v) ASFV pol X is a highly distributive enzyme that is very inefficient when elongating DNA gaps longer that 1 nt4

1410

(unpublished results); (vi) ASFV pol X fidelity is higher on a gapped DNA (this work). The short-patch pathway of BER starts with a monofunctional DNA glycosylase that excises the damaged base, generating an abasic substrate that is subsequently incised in the 50 -side of the lesion by APE, leaving a dRP moiety 30 to the gap. The dRP group is eliminated by the dRP lyase activity of pol b after the gap fill in step.35 It is not known whether a similar ordered pathway is operating during ASFV infection. If this were the case, excision of the dRP moiety should be carried out by a protein other than ASFV pol X, since it lacks dRP lyase activity, as shown here. Alternatively, our findings of an intrinsic AP lyase activity in ASFV pol X suggest that this activity could act on unincised AP sites in the viral DNA, as has been proposed for the bifunctional DNA glycosylases/AP lyases.36,37 The 30 -terminal, unsaturated, ringopened aldehyde produced after AP lyase cleavage could be excised by 30 -phosphodiesterase and 30 phosphatase activities of viral APE, allowing the pol X to fill in the gap. In conclusion, an extensive analysis of ASFV pol X kinetics of single insertion of wrong versus right nucleotides in synthetic DNA complexes, together with the finding that the viral enzyme can incise DNA in abasic sites, suggests that ASFV pol X would be acting in a viral BER process to maintain viral genomic integrity during infection. Confirmation of this possible function of ASFV pol X in BER awaits further studies.

Materials and Methods ASFV pol X purification procedure Purification of ASFV pol X was performed as described,4 but with several modifications. Briefly, NiNTA agarose beads (Qiagen) equilibrated in binding buffer (50 mM phosphate buffer (pH 7.5), 500 mM NaCl, 20 mM imidazole, 20 mM b-mercaptoethanol, 5% (v/v) glycerol) were incubated with the soluble bacterial fraction as described.4 After stirring for two hours at 4 8C, the resin was washed extensively with binding buffer, and loaded into a column. The recombinant ASFV pol X was eluted from the column with 500 mM imidazole, and the eluate was concentrated using Microcon Y-10 filters (Amicon). ASFV pol X was stored in 50 mM Tris – HCl (pH 7.5), 20 mM ammonium sulfate, 180 mM NaCl, 1 mM EDTA, 7 mM b-mercaptoethanol, 50% glycerol, at 2 80 8C. Purity of the preparation was estimated to be greater than 98% based on Coomassie-stained SDS/polyacrylamide gels. No exonuclease activity was detected even in prolonged reactions with primer/template complexes and excess amount of the purified ASFV pol X fraction.

Nucleotides and enzymes Ultrapure dNTPs were purchased from Pharmacia. [a-32P]ddATP and [g-32P]ATP (3000 Ci/mmol) were obtained from Amersham International Plc. Phage T4

Fidelity of ASFV pX

polynucleotide kinase was from Gibco-BRL. TdT was from Promega. DNA substrates for kinetic analysis Three different synthetic DNA complexes were constructed to analyze ASFV pol X activity. These DNAs are primer/template-based structures where the same 15-mer oligonucleotide (50 GATCACAGTGAGTAC) was hybridized to a 33-mer differing in the N-18 residue (50 ACTGGCCGTCGTTCTATNGTACTCACTGTGATC). The 15-mer hybridized to template residues 19 – 33, placing the primer 30 -OH terminus such that insertion of the first dNTP occurs opposite template N-18. Any nucleotide addition can be detected by PAGE analysis and autoradiography by the different mobilities observed between the (50 -32P)-labeled primer substrate and the extension products. The simplest complex (15-mer hybridized to 33-mer) has a “recessed” primer that leaves a downstream single-stranded DNA template of 18 nucleotides. Two different gapped complexes were constructed. Both contained a second 17-mer downstream oligonucleotide (50 ATAGAACGACGGCCAGT), thereby originating a primer-template with a 1 nt gap immediately downstream from the radiolabeled primer, but one of them was constructed containing a PO4 moiety at the 50 margin of the gap (1 nt-gap(P)) by using a 50 -phosphorylated downstream oligomer. Prior to use, the oligonucleotides were purified by electrophoresis in 7 M urea/20% polyacrylamide gels. The 15-mer primer was 50 -end-labeled with T4 polynucleotide kinase and [g-32P]ATP, and the 50 -radiolabeled oligonucleotide was separated from unreacted [g-32P]ATP with a G50 microspin column. Hybridizations were done by mixing the labeled oligonucleotide (primer) with one (template) or two different (template and downstream primer) oligonucleotides in 60 mM Tris – HCl (pH 7.5), 0.2 M NaCl. Mixtures were heated at 95 8C for two minutes, cooled slowly, and kept at room temperature for 30 minutes. To ensure maximal annealing efficiencies, mixtures were performed with 2.5 molar excess of template or downstream oligonucleotides relative to labeled primer. More than 95% of radiolabeled primer was annealed, as evidenced by mobility shifts on non-denaturing PAGE and by the proportion of (50 -32P)-labeled primers extended in prolonged incubations with excess ASFV pol X and saturating concentrations of dNTPs. DNA polymerization reactions The kinetics of dNMP insertion were determined in polymerization reactions (10 ml) containing 1 – 12 nM (for correct insertions) or up to 2 mM ASFV pol X (for incorrect insertions), 12 nM primer, and 0 – 2 mM (for correct insertions) or 0 – 5 mM (for incorrect insertions) of a single dNTP in 50 mM Tris –HCl (pH 7.5), 10 mM MgCl2, 1 mM DTT, 4% glycerol, and 0.1 mg/ml of bovine serum albumin (BSA). DNA complexes were first incubated with ASFV pol X for five minutes at 37 8C in the absence of dNTPs, and then polymerization reactions were initiated by addition of a single dNTP (at ten different concentrations). After continued incubation at 37 8C, reactions were terminated after 20 minutes (up to 120 minutes for incorrect insertions) by adding an equal volume of loading dye (90% (v/v) formamide, 20 mM EDTA, 0.05% (w/v) bromophenol blue, 0.05% (w/v) xylene cyanol). Products were resolved by PAGE (7 M

1411

Fidelity of ASFV pX

urea, 20% (w/v) polyacrylamide) and detected by autoradiography. Quantification was done by densitometric analysis of two or three different expositions of the same gel, using a GS scanner and Quantity One Software (BIORAD). Six mass quantity standards covering 2 log units were loaded in every gel to obtain accurate extrapolation of product and substrate mass quantities. Steady-state polymerization kinetics Standing-start reactions of single-nucleotide insertions were performed for the three substrates indicated above, using either right or wrong nucleotides, as described.16,38 Reaction times and enzyme concentration were adjusted for each complex to optimize product detection while ensuring that all reactions were conducted in the steady state. Only those reactions that fell within the linear range of substrate utilization (, 20% primer extension) were used for analysis. Steady-state kinetic analysis was based on the Michaelis – Menten equation: vobs ¼ ðvmax ½dNTPÞ=Km þ ½dNTPÞ

ð1Þ

The measured enzyme velocity (vobs) was plotted as a function of nucleotide concentration, and fitted by a non-linear regression curve to equation (1) using the KaleidaGraph software (Synergy Software). Apparent Km and vmax values were determined from the fitted curves. The frequencies of misincorporation were calculated as described.16,38 To detect extension products resulting from dNMP misincorporation it was often necessary to increase ASFV pol X concentrations and/or incubation times. As expected in steady state, vmax values were directly proportional to enzyme concentration. dRP lyase and AP lyase activity assays Determination of dRP and AP lyase activities of ASFV pol X was performed as described.39 The substrate for both assays was obtained by annealing a 34-mer oligonucleotide containing uracil at position 16 (P6: 50 -CTGC AGCTGATGCGCUGTACGGATCCCCGGGTAC) with its complementary oligonucleotide (T4: 50 -GTACCCGGGG ATCCGTACGGCGCATCAGCTGCAG). The uracil-containing oligomer was previously labeled at the 30 -end using TdT and [a-32P]ddATP following the manufacturer’s protocol. This labeled double-stranded substrate (300 nM) was treated with 100 nM hUDG for 20 minutes at 37 8C in 20 ml of 50 mM Hepes (pH 7.5), 20 mM KCl, 2 mM DTT to remove the uracil. After incubation, the mixture was supplemented with 10 mM MgCl2 and 40 nM hAPE, thus generating the substrate for dRP lyase activity (Figure 3(a)). The dRP lyase reaction was initiated in reaction buffer (50 mM Hepes (pH 7.5), 10 mM MgCl2, 20 mM KCl, 2 mM DTT) containing the substrate at a concentration of 30 nM by adding different amounts of pol b or ASFV pol X and incubating at 37 8C as indicated. After incubation, NaBH4 was added to a final concentration of 340 mM, and the reactions were kept on ice. Stabilized (reduced) DNA products were ethanol-precipitated in the presence of 0.1 mg/ml of tRNA, resuspended in water, and analyzed by electrophoresis in a 7 M urea/16% polyacrylamide gel and visualized by autoradiography. Reaction mixtures for AP lyase activity were essentially as described for dRP lyase activity assays, but using a substrate that had not been preincised by hAPE. After incubation, the samples were processed and analyzed as described above.

NaBH4 trapping assay Reactions containing the AP labeled substrates (100 nM), either preincised or not with hAPE, were initiated in 50 mM Hepes (pH 7.5), 10 mM MgCl2, 20 mM KCl, 2 mM DTT by adding the indicated amounts of pol b and ASFV pol X, and either 20 mM NaBH4 or 20 mM NaCl. After 30 minutes on ice, reactions were run on an SDS/10% polyacrylamide gel, and the trapped polymerase·DNA complexes were visualized by autoradiography.

Acknowledgements We thank Drs Samuel Wilson and Rajendra Prasad for providing human BER enzymes. We are grateful to Drs.Luis Mene´ndez Arias and Catalina Ribas for critical reading of the manuscript. This study was supported by grants from the Direccio´n General de Investigacio´n Cientı´fica y Te´cnica (BMC 2000-1485; BMC 2000-1138), the European Community (FAIR-CT97-3441), and the Ministerio de Educacio´n y Cultura (AGF98-1352CE) and by an institutional grant from the Fundacio´n Ramo´n Areces.

References 1. Vin˜uela, E. (1987). African swine fever virus. In African Swine Fever (Becker, Y., ed.), pp. 31 – 49, Martinus Nijhoff, Boston. 2. Ya´n˜ez, R. J., Rodrı´guez, J. M., Nogal, M. L., Yuste, L., Enrı´quez, C., Rodrı´guez, J. F. & Vin˜uela, E. (1995). Analysis of the complete sequence of African swine fever virus. Virology, 208, 249– 278. 3. Rodrı´guez, J. M., Ya´n˜ez, R. J., Rodrı´guez, J. F., Vin˜uela, E. & Salas, M. L. (1993). The DNA polymerase-encoding gene of African swine fever virus: sequence and transcriptional analysis. Gene, 136, 103 –110. 4. Oliveros, M., Yan˜ez, R. J., Salas, M. L., Salas, J., Vin˜uela, E. & Blanco, L. (1997). Characterization of an African swine fever virus 20-kDa DNA polymerase involved in DNA repair. J. Biol. Chem. 272, 30899 – 30910. 5. Benedict, C. L., Gilfillan, S., Thai, T. H. & Kearney, J. F. (2000). Terminal deoxynucleotidyl transferase and repertoire development. Immunol. Rev. 175, 150 –157. 6. Prasad, R., Widen, S. G., Singhal, R. K., Watkins, J., Prakash, L. & Wilson, S. H. (1993). Yeast open reading frame YCR14C encodes a DNA beta-polymerase-like enzyme. Nucl. Acids Res. 21, 5301– 5307. 7. Shimizu, K., Santocanale, C., Ropp, P. A., Longhese, M. P., Plevani, P., Lucchini, G. & Sugino, A. (1993). Purification and characterization of a new DNA polymerase from budding yeast Saccharomyces cerevisiae. A probable homolog of mammalian DNA polymerase beta. J. Biol. Chem. 268, 27148– 27153. 8. Wang, Z., Catano, I. B., De Las Pen˜as, A., Adams, C. & Christman, M. F. (2000). Pol kappa: A DNA polymerase required for sister chromatid cohesion. Science, 289, 774– 779.

1412

Fidelity of ASFV pX

9. Burgers, P. M. et al. (2001). Eukaryotic DNA polymerases: proposal for a revised nomenclature. J. Biol. Chem. 276, 43487– 43490. 10. Domı´nguez, O., Ruiz, J. F., Lain de Lera, T., Garcı´aDı´az, M., Gonza´lez, M. A., Kirchhoff, T. et al. (2000). DNA polymerase mu (Pol mu), homologous to TdT, could act as a DNA mutator in eukaryotic cells. EMBO J. 19, 1731– 1742. 11. Garcı´a-Dı´az, M., Bebenek, K., Sabariegos, R., Domı´nguez, O., Rodrı´guez, J., Kirchhoff, T. et al. (2002). DNA polymerase lambda, a novel DNA repair enzyme in human cells. J. Biol. Chem. 277, 13184 –13191. 12. Beard, W. A. & Wilson, S. H. (2000). Structural design of a eukaryotic DNA repair polymerase: DNA polymerase beta. Mutat. Res. 460, 231– 244. 13. Lindahl, T. & Wood, R. (1998). Quality control by DNA repair. Science, 286, 1897– 1905. 14. Maciejewski, M. W., Shin, R., Pan, B., Marintchev, A., Denninger, A., Mullen, M. A. et al. (2001). Solution structure of a viral DNA repair polymerase. Nature Struct. Biol. 8, 936– 941. 15. Showalter, A. K., Byeon, I.-J. L., Su, M.-I. & Tsai, M. D. (2001). Solution structure of a viral DNA polymerase X and evidence for a mutagenic function. Nature Struct. Biol. 8, 942– 946. 16. Goodman, M. F., Creighton, S., Bloom, L. B. & Petruska, J. (1993). Biochemical basis of DNA replication fidelity. Crit. Rev. Biochem. Mol. Biol. 28, 83 – 126. 17. Preston, B. D., Poiesz, B. J. & Loeb, L. A. (1988). Fidelity of HIV-1 reverse transcriptase. Science, 242, 1168 –1171. 18. Boosalis, M. S., Mosbaugh, D. W., Hamatake, R., Sugino, A., Kunkel, T. A. & Goodman, M. F. (1989). Kinetic analysis of base substitution mutagenesis by transient misalignment of DNA and by miscoding. J. Biol. Chem. 264, 11360– 11366. 19. Johnson, A. A. & Johnson, K. A. (2001). Fidelity of nucleotide incorporation by human mitochondrial DNA polymerase. J. Biol. Chem. 276, 38090– 38096. 20. Chagovetz, A. M., Sweasy, J. B. & Preston, B. D. (1997). Increased activity and fidelity of DNA polymerase beta on single-nucleotide gapped DNA. J. Biol. Chem. 272, 27501 –27504. 21. Ahn, J., Werneburg, B. G. & Tsai, M.-D. (1997). DNA polymerase beta: structure-fidelity relationship from pre-steady-state kinetic analyses of all possible correct and incorrect base pairs for wild type and R283A mutant. Biochemistry, 36, 1100– 1107. 22. Parikh, S. S., Mol, C. D., Hosfield, D. J. & Tainer, J. A. (1999). Envisioning the molecular choreography of DNA base excision repair. Curr. Opin. Struct. Biol. 9, 37 –47. 23. Matsumoto, Y. & Kim, K. (1995). Excision of deoxyribose phosphate residues by DNA polymerase beta during DNA repair. Science, 269, 699– 702.

24. Prasad, R., Beard, W. A., Strauss, P. R. & Wilson, S. H. (1998). Human DNA polymerase beta deoxyribose phosphate lyase. Substrate specificity and catalytic mechanism. J. Biol. Chem. 273, 15263– 15270. 25. Piersen, C. E., McCullough, A. K. & Lloyd, R. S. (2000). AP lyases and dRPases: commonality of mechanism. Mut. Res. 459, 43 – 53. 26. Piersen, C. E., Prasad, R., Wilson, S. H. & Lloyd, R. S. (1996). Evidence for an imino intermediate in the DNA polymerase beta deoxyribose phosphate excision reaction. J. Biol. Chem. 271, 17811 – 17815. 27. Forman, H. J. & Torre, M. (2001). Redox signaling in macrophages. Mol. Asp. Med. 22, 189– 216. 28. Beckman, K. B. & Ames, B. N. (1997). Oxidative decay of DNA. J. Biol. Chem. 272, 19633– 19636. 29. Lindahl, T. (1993). Instability and decay of the primary structure of DNA. Nature, 362, 709– 715. 30. Ahn, J., Kraynov, V. S., Zhong, X., Werneburg, B. G. & Tsai, M.-D. (1998). DNA polymerase beta: effects of gapped DNA substrates on dNTP specificity, fidelity, processivity and conformational changes. Biochem. J. 331, 79 – 87. 31. Kunkel, T. A. & Bebenek, K. (2000). DNA replication fidelity. Annu. Rev. Biochem. 69, 497– 529. 32. Chou, K.-M. & Cheng, Y.-C. (2002). An exonucleolytic activity of human apurinic/apyrimidinic endonuclease on 30 mispaired DNA. Nature, 415, 655– 659. 33. Showalter, A. K. & Tsai, M.-D. (2001). A DNA polymerase with specificity for five base pairs. J. Am. Chem. Soc. 123, 1776– 1777. 34. Ya´n˜ez, R. J., Moya, A., Vin˜uela, E. & Domingo, E. (1991). Repetitive nucleotide sequencing of a dispensable DNA segment in a clonal population of African swine fever virus. Virus Res. 20, 265–272. 35. Srivastava, D. K., Vande Berg, B. J., Prasad, R., Molina, J. T., Beard, W. A., Tomkinson, A. E. & Wilson, S. H. (1998). Mammalian abasic site base excision repair. Identification of the reaction sequence and rate-determining steps. J. Biol. Chem. 273, 21203– 21209. 36. McCullough, A. K., Dodson, M. L. & Lloyd, R. S. (1999). Initiation of base excision repair: glycosylase mechanisms and structures. Annu. Rev. Biochem. 68, 255– 285. 37. Lindahl, T. (2000). Suppression of spontaneous mutagenesis in human cells by DNA base excision-repair. Mutat. Res. 462, 129– 135. 38. Boosalis, M. S., Petruska, J. & Goodman, M. F. (1987). DNA polymerase insertion fidelity. Gel assay for sitespecific kinetics. J. Biol. Chem. 262, 14689– 14696. 39. Garcı´a-Dı´az, M., Bebenek, K., Kunkel, T. A. & Blanco, L. (2001). Identification of an intrinsic 50 -deoxyribose5-phosphate lyase activity in human DNA polymerase lambda: a possible role in base excision repair. J. Biol. Chem. 276, 34659– 34663.

Edited by M. Yaniv (Received 25 July 2002; received in revised form 12 November 2002; accepted 16 December 2002)