DNA sequence required for efficient transcription termination in yeast

Cell, Vol. 28, 583473,

March

1982,

Copyright

0 1982

by MIT

DNA Sequence Required Termination in Yeast

for Efficient

Kenneth S. Zaret and Fred Sherman Department of Radiation Biology and Biophysics University of Rochester School of Medicine and Dentistry Rochester, New York 14642

Summary The ~~~7-572 mutation is a 38 base pair deletion in the 3’ nontranslated region of the CYC7 locus in the yeast Saccharomyces cerevisiae. The deletion occurred between two 7 bp directly repeated sequences. The ~~~7-572 mutant produces approximately 10% of the normal amount of the CYC7 gene product, iso-l-cytochrome c, and produces 5%10% of the normal steady-state amount of CYC7 mRNA. Most of the mRNAs in ~~~7-572 are longer at their 3’ ends by up to 1000 nucleotides, suggesting that the 38 bp deletion in ~~~7-572 prevents proper transcription termination. The improper transcription termination is shown to cause converging transcription between CYC7 and an adjacent gene. The fact that all of the aberrantly sized mRNAs in ~~~7-572 are polyadenylated leads us to suggest that polyadenylation may be coupled to transcription termination in yeast. We have uncovered a consensus sequence between the region deleted in ~~~7-572 and the 3’ nontranslated regions of some but not all yeast genes, and discuss the possible role of this sequence in transcription termination. Introduction The most economical use of the cellular transcription apparatus would presumably be to transcribe only those sequences required for the proper translation of a messenger RNA. Studies of the 3’ ends of transcription units in procaryotes suggest that such economy exists; that is, the 3’ end of mRNAs occur relatively close to the end of the last translated gene of an operon and the 3’ ends are determined by defined DNA sequences that cause transcription termination (see Platt, 1981, for a recent review). Most eucaryotic mRNAs possess a polyadenylated 3’ terminus that occurs approximately 20 nucleotides downstream from a sequence related to AAUAAA (Proudfoot and Brownlee, 1976). However, careful studies of SV40 late mRNA (Ford and Hsu, 1978) adenovirus 2 early regions 2 and 4 (Nevins et al., 1980) the mouse /?major globin gene (Hofer and Darnell, 1981) and the two chicken (Y globin genes (Weintraub et al., 1981) have shown that transcription proceeds beyond the poly(A) site by up to 1000 nucleotides and that an endonucleolytic cleavage and poly(A) addition probably generate the mature 3’ end of the mRNA. The biological function, if any, of transcription beyond a

Transcription

poly(A) site for a single gene transcription unit is unknown, and in such cases there is no evidence for a defined sequence of DNA causing transcription to terminate at a specific site. There are, however, eucaryotic mRNAs that are not polyadenylated. Although it is probable that some poly(A)-deficient mRNAs are generated by the degradation of poly(A) mRNA (Wilson et al., 1978) the existence of translatable mRNAs that are only found in the poly(A)-deficient fraction (Milcarek et al., 1974; Nemer et al., 1974) suggests that some mechanism other than poly(A) addition, possibly specific transcription termination, is responsible for generating the 3’ end of the message. To determine the DNA sequences that control the structure and regulation of translatable genes, our laboratory has been studying mutations of the CYC7 and CYC7 loci in the yeast Saccharomyces cerevisiae. The CYC7 and CYC7 loci code for iso-l- and iso-2cytochrome c, respectively, and these proteins comprise 95% and 5%, respectively, of the total amount of cytochrome c in aerobically grown yeast. An extensive characterization of nearly 500 CYC7 point mutants (Sherman et al., 1974, 1975; F. Sherman, unpublished results) has revealed only two mutations, cyc7-362(Stileset al., 1981)and cyc7-572(J. Kotval, K. Zaret, S. Consaul and F. Sherman, manuscript in preparation), that map outside of the translated portion of the gene. This paper describes the mutant, ~~~7-572, which arose spontaneously and which produces 5% to 10% of the normal amount of iso-l -cytochrome c (J. Kotval et al., in preparation). The genomic DNA blotting experiments and DNA sequence analysis described herein demonstrate that ~~~7-572 contains a small deletion that occurs in the 3’ nontranslated region of the CYC7 mRNA, just before the normal site of poly(A) addition. The results of transcript mapping suggest that the deletion in ~~~7-572 causes a defect in transcription termination. The effects of this mutation on CYC7 mRNA stability and translation are described, and the DNA sequence that is deleted in ~~~7-572 is compared to the 3’ nontranslated sequences of other yeast genes and to bacterial transcription terminators. In addition, the effects of transcription into a closely neighboring gene are also described. Results The ~~~7-572 Mutation Contains a 38 bp Deletion 3’ to the Translated Region of CYC7 J. Kotval et al. (manuscript in preparation) have demonstrated by deletion mapping that the ~~~7-572 mutation lies outside of the translated region of the CYC7 locus. However, the location of the cycl-5 7 2 mutation with respect to the 5’ or 3’ end of the CYC7 gene could not be assigned from the genetic results. Genomic DNA from the ~~~7-572 mutant was digested

Cell

564

with restriction endonucleases, separated on an agarose gel, transferred to nitrocellulose filters and hybridized to radioactive DNA probes from the wild-type CYC7 region as designated in Figure 1. None of the restriction fragments encompassing the CYC7 region were grossly altered in size, indicating that no large chromosomal rearrangements caused the ~~~7-572 mutation. However, a careful analysis of ~~~7-572 DNA digested with Eco RI, shown in Figure 2, left, indicated the presence of a small deletion in the fragment b-j as designated in Figure 1. Since genetic studies had shown that the ~~~7-572 mutation mapped outside of the translated region of the CYC7 locus, these genomic DNA hybridization experiments indicated that the ~~~7-572 mutant contains a small deletion that maps 3’ to the translated portion of the CYC7 gene. To analyze the ~~~7-572 mutation more extensively, Eco RI-digested ~~~7-572 DNA was cloned into the vector hgt.hB (Cameron et al., 1975). Two independent recombinant phage containing the fragment b-j were detected by the plaque hybridization technique (Benton and Davis, 1977). The b-j fragment was subcloned into the Eco RI site of plasmid pBR322 (Bolivar et al., 1977) to create a plasmid designated pAB81. When pAB81 DNA was digested with Eco RI and Hind Ill and the resulting fragments were compared with a similar digest of pABl1, a plasmid containing the b-j fragment from the CYC7+ parent of ~~~7-572 (Stiles et al., 1981), it was clear that the cyc 7-5 7 2 cloned DNA contained a deletion of approximately 30 to 40 base pairs (bp) in the fragment b-g (Figure 2, right). A more detailed restriction analysis of the ~~~7-572 cloned DNA, which was made possible by the known nucleotide sequence of pBR322 (Sutcliffe, 1978) localized the deletion to the fragment e-f as designated in Figure 1. The DNA sequences of both strands in the region e-f in ~~~7-572 were determined as shown in Figures 1 and 3 (data not shown). When compared to the published CYC7 sequence (Smith et al., 1979) as well as the CYC7 sequence of the isogenic parent of cycl572 (K. Zaret, unpublished results), the only difference was that ~~~7-572 contained a 38 bp deletion in S a

EA bc 1 kbp

Figure 1. Restriction Strategy

TATH defg

S h

A I

E I

Map of the WC7

Region

and DNA Sequencing

Cleavage sites in the cloned segments containing the CYCl region were determined by Stiles et al. (1961), Smith et al. (1979) and in this study. The sites are designated as follows. A: Ava II. E: Eco RI. H: Hind III. S: Sal I. T: Taq I. Not all Ava II and Taq I sites are shown. Solid box: Translated portion of CYCl. DNA sequencing was performed by end-labeling restriction fragments with r3’P-dATP and nick-translating with dideoxy terminators. Asterisks: Sites of labeling. Arrows: 5’ to 3’ polarity of the sequence that was determined.

the region e-f, as shown in Figure 3. The DNA sequences of one strand in the region d-e from the ~~~7-572 and CYC7 strains were determined and shown to be identical. An examination of the sequence in the deleted region indicates that the deletion occurred between two 7 bp directly repeated sequences so that one of the repeats remains in the ~~~7-572 deletion (Figure 3). The endpoints of the deletion extend from 130 to 167 bp beyond the TAA translation termination codon of the CYC7 gene. It has been shown that the 3’ terminus of the CYC7 mRNA coding sequence maps approximately 180 bp beyond the TAA codon (Boss et al., 1980). The 38 bp deletion in ~~~7-572 thus maps within the 3’ nontranslated region of CYC7, approximately 15 bp before the end of the transcribed region of the wild-type gene. The 38 bp Deletion in cyc7472 Causes a Defect In Transcription Termination Total cellular RNA was isolated from ~~~7-572 and its isogenic CYC7+ parent, fractionated on an agarose gel under denaturing conditions, transferred to a nitrocellulose filter and hybridized to radioactive DNA probes from the CYC7 region (Thomas, 1980). The first probe that was used consisted of the 600 bp bg fragment (see Figure l), which encompasses most Eco RI Digest Yeast Genomic DNA

Eco RI-Hind111 Digest Cloned Yeast DNA

- pBR322 b-j -

-9-j

-b-g

Figure

2. Restriction

Fragments

of CYCl

and cycl-512

DNA

(Left) Genomic DNA samples from CYCl+ strain D311-3A and cycl572 strain B-4060 were digested with Eco RI, subjected to electrcphoresis in 1.2% agarose, transferred to a nitrocellulose sheet and hybridized to the nick-translated CYCl fragment b-j. The autoradiogram indicates that the ~~~1-512 strain contains a small deletion in the region b-j. (Right) The plasmids pAB11, containing the b-j region from CYC7+, and pAB61, containing the b-j region from ~~~1-512, ware digested with Eco RI and Hind Ill. The resulting restriction fragments were separated by electrophoresis in a 1.35% agarose slab gel and visualized by ethidium bromide fluorescence. The standards are Hind Ill fragments of A and Hae Ill fragments of +X1 74. The data indicate that the deletion in cycl-512 maps within the fragment b-g.

Transcription 565

Figure

Termination

3. Sequence

The 3’ nontranslated CYCl (data of Smith approximate region occurs between the indicated by + and

PROBE:

b-g --II

in Yeast

of the 3’ Nontranslated

Region

of CYCl+

and cycl-512

sequence of CYC7 is shown from the TAA translation termination codon (wavy line) to beyond the transcribed region of et al., 1979). The dots beneath the sequence mark 10 bp intervals after TAA. The asterisks above the Sequence indicate the where the 3’ end of CYC7 mRNA is polyadenylated (Boss et al., 1960). The mutant, ~~~7-572, contains a 36 bp deletion that two 7 bp repeated sequences marked by vertical lines. Just before the ~~~1-572 deletion is a region of dyad symmetry, - between the strands, that could form a stem and loop structure with a AG value of -7.6 kcal.

g-h

h-i

i-j

-2400 -2000 - 1650 11450 1350

1450

-1050 650 630

Figure 4. Mapping CYCl-512

the Endpoints

of Transcripts

from

CYCl+

and

Total RNA from CYC7+ and cycl-512 was fractionated by electrophoresis in a 1.5% agarose slab gel under denaturing conditions and transferred to a nitrocellulose filter, as described in Experimental Procedures. The filter was cut into four strips, each strip was hybridized to a different radiolabeled, double-stranded DNA probe as designated in the figure and the strips were autoradiographed together. Numbers: Length of the transcripts in nucleottdes. The results of the transcript mapping are diagrammatically shown in Figure 6.

of the translated portion of CYC7. As shown in Figure 4, the double-stranded b-g probe hybridizes to a relatively abundant RNA of approximately 630 nucleotides and hybridizes weakly to an RNA of 1450 nucleotides in the wild-type strain. In contrast, fragment b-g hybridizes to a 630 nucleotide transcript of much lower abundance in cyc l-5 12, and also hybridizes to transcripts of 850, 1350, 1450, 1650, 2000 and heterogeneously sized transcripts of approximately 2400 nucleotides. Different radiolabeled DNA fragments were subsequently used as probes to determine whether the large transcripts observed in CYC7 and ~~1-512 were derived from regions of the genome that were either 5’ or 3’ to CYC7 in the b-g fragment. While the 630 nucleotide transcript from CYC7 weakly hybridized to a double-stranded probe for the region immediately 5’ to the b-g fragment, none of the large transcripts (>630 nucleotides) from either strain hy-

bridized to the 5’ probe a-b. However, a doublestranded probe consisting of the 200 bp fragment gh, which is immediately 3’ to the b-g region, hybridized to all of the large transcripts in CYC7 and cycl572, but not to the 630 nucleotide transcript (Figure 4). Thus the 630 nucleotide transcript encompasses the translated portion of CYC7 and has one endpoint within the region b-g, whereas all of the large transcripts from both strains that hybridize to the b-g probe are homologous to the region 3’ to the CYCl locus. Two probes that extend beyond the g-h fragment were used to determine the endpoints of the large transcripts; one probe was the 300 bp h-i fragment and the other was the 1400 bp i-j fragment. As can be seen in Figure 4, the 850, 1350, 1450 and 1650 nucleotide transcripts in ~~~7-572 appeared to diminish in ability to hybridize to the distal probes; in contrast, the 1450 nucleotide transcript in CYC7 clearly increased in its ability to hybridize to the distal probes. These data suggest that the 850,1350,1450 and 1650 nucleotide transcripts in ~~~7-572 are mostly homologous to the b-i region shown in Figure 1 and that the 1450 nucleotide transcript in CYC7 is mostly homologous to the g-j region. The 2000 nucleotide transcript in cyc 7-5 7 2 is equally homologous to the regions b-i and g-j. The direction of transcription of the various RNAs in CYCl and cyc l-5 12 was determined by constructing strand-specific radioactive probes, as described in Experimental Procedures. The “sense-strand” probe refers to single-stranded DNA that can hybridize to CYC7 mRNA or to RNA of the same polarity with respect to the CYC7 locus in the region shown in Figure 1. The “antisense-strand” probe refers to single-stranded DNA that can hybridize to any RNA of the opposite polarity of the CYC7 locus. As shown in Figure 5, the only wild-type RNA that hybridizes to the sense-strand probe b-g is the abundant transcript of approximately 630 nucleotides. This experiment unambiguously identifies the 630 nucleotide transcript as the CYC7 mRNA, because it possesses the proper polarity and, as described above, because it encompasses the translated region of CYC7 . No larger CYC7 transcripts have been detected in wild-type cells, even after enrichment (see below). The 1050 nucleotide transcript that hybridizes to the sense-strand probe g-j (Figure 5) is not derived from the CYC7 locus, since it hybridizes to the distal frag-

Cell 566

PROBE:

Sense Strand

b-g ---I

g-j

Antisense

Strand

b-g

g-j

a +p

Figure

Figure 512

5. Direction

of Transcription

of RNAs from CYC7+

and cycl-

Total RNA from CYC7+ and ~~~1-572 was size-fractionated and hybridized to radiolabeled. single-stranded DNA probes, as described in Experimental Procedures and Figure 4. The single-stranded probes were prepared by nick-translating the designated restriction fragments, ligating to seal the nicks and separating the strands on an agarose gel as described in Experimental Procedures. The “sensestrand” probes hybridize to RNA with the same polarity as the CYCl locus; the “antisense-strand” probes hybridize to RNA of the opposite. polarity. Incompletely ligated fragments of the sense strand b-g slightly contaminated the faster-migrating antisense probe b-g; thus the apparent hybridization of CYCi mRNA to the antisense probe is an artifact due to the cross-contamination of the probes.

ment i-j but not to fragments in the region b-i (Figure 4). This transcript probably starts in the region i-j and extends beyond site j. Note that the 1050 nucleotide transcript appears to be relatively unaffected by the ~~~7-572 mutation, although in certain experiments it appears to be slightly decreased in amount. Occasionally, a transcript of 1000 nucleotides hybridizes to the 600 bp fragment b-g (see Figures 4 and 71, but does not hybridize to adjacent fragments. Long exposures of autoradiographs (not shown) have demonstrated that this transcript hybridizes to the antisense-strand probe b-g. This 1000 nucleotide transcript is therefore not derived from the CYC7 locus and probably represents cross-hybridization of the bg fragment with a transcript from elsewhere in the yeast genome. Thus the longest WC7 transcript that has been observed in wild-type cells is approximately 630 nucleotides in length. A distinct minor WC7 transcript of 540 nucleotides can also be detected after long exposures (see Figures 4 and 5). The 630, 650, 1350, 1450, 1650 and heterogeneously sized RNAs of approximately 2400 nucleotides in cyc 7-5 7 2 all hybridize only to the sense-strand

6. Transcription

”I 9 P

Cycl-572

1450 zoo0

Ii } cyc7+ ) ~~~1-512

Map of CYCl + and ~~~1-572

The horizontal double line in the center of the diagram represents DNA from the CYCl region; the designated restriction sites are from Figure 1. Solid box: Translated region of CYC7. Vertical double lines: Position of the 38 bp deletion in ~~~7-512. Heavy arrows: transcripts from CYCl+ strains: thin arrows: transcripts from cycl-572. The transcripts shown above the restriction map are from the CYC7 gene, whereas the transcripts shown beneath arise off the opposite strand from a gene adjacent to CYCI. Dots at end of arrow representing the 2400 nucleotide transcript: region where transcription terminates heterogeneously. Sizes of transcripts are shown in nucleotides.

probe from b-g (Figure 5). As expected, the larger transcripts (>630 nucleotides) also hybridize only to the sense-strand probe from g-j. These results, in conjunction with the double-stranded probe analysis presented above, are consistent with the interpretation shown in Figure 6, where the 630, 850, 1350, 1450, 1650 and 2400 nucleotide transcript8 are all derived from the WC7 locus in cyc 7-5 7 2. It appears that the 38 bp deletion in ~~~7-572 reduces the amount of mRNA terminating at the wild-type site (the 630 nucleotide transcript). Transcription proceeds through this site and term~iriation occurs weakly at a number of discrete downstream sites (850, 1350, 1450 and 1650 nucleotide transcripts). Finally, all transcription ends in a region 2000 bp downstream from the WC7 locus (2400 nucleotide transcripts). The total amount of the variously sized CYC7 transcripts in ~~~7-572 is approximately 10% of the amount of the 630 nucleotide CYC7 transcript in the wild-type parent of cyc 7 -5 72. The decreased steadystate amount of all of the CYC7 mRNAs in ~~~7-572 may be due to the inherent instability of the mRNAs because of their length (see Discussion), improper polyadenylation (see below) or other factors. Clearly, normal termination of CYC7 transcripts is required for proper gene expression. Deletion of the Termination Signal Causes Overlapping Transcription As discussed above, the normal CYC7+ strain produces a 1450 nucleotide transcript that weakly hy-

Transcription 567

(

Termination

in Yeast

bridizes to the double-stranded probe b-g and strongly hybridizes to the downstream doublestranded probes of the region g-j (Figure 4). Since the 1450 nucleotide transcript hybridizes to the antisense-strand probes (Figure 5) it must be transcribed in the opposite direction as the CYC7 transcript. These data are consistent with the interpretation that in the CYC7+ strain there is a gene immediately adjacent to CYC7. This gene produces a 1450 nucleotide transcript that starts in the region i-j and is transcribed toward the CYC7 locus, terminating just to the left of site g (Figure 6). Surprisingly, the 1450 nucleotide “antisense” transcript is absent in cycl-57 2 and is replaced by an “antisense” transcript of 2000 nucleotides (Figure 5). The 1450 nucleotide transcript that is present in cycl5 7 2 hybridizes to sense-strand probes and therefore originates from the CYC7 locus. The 2000 nucleotide transcript in ~~~7-572 hybridizes as strongly to the bg probe (Figures 4 and 5) as it does to the downstream probes g-h, h-i (Figure 4) and g-j (Figure 5). These results suggest that the deletion in ~~~7-572 prevents normal transcription termination of the gene adjacent to CYC7. Transcription from the adjacent gene now occurs through the WC7 locus (region b-g) and terminates in the 5’ region of WC7 (Figure 6). In the same way that the CYC7 transcripts in cycl5 72 are reduced in overall amount relative to the wildtype, the 2000 nucleotide transcript is also decreased in amount in cyc 7-5 7 2 relative to the 1450 nucleotide transcript in the wild-type (see Figure 4, probe i-j). Because the transcripts in the CYC7 region b-g and the adjacent gene region j-g converge, it is possible that the overlapping transcription in the ~~~7-572 mutant is interfering with the transcription process and neither gene is fully transcribed. All of the Aberrantly Sized RNAs in ~~~7-572 Are Polyadenylated Total cellular RNA from CYC7+ and cycl-5 7 2 was subjected to poly(U)-Sepharose chromatography (Palatnik et al., 1979) to separate the poly(A) and poly(A)deficient fraction. The poly(A) and poly(A)-deficient fractions were then compared with total cellular RNA by the hybridization technique described above, using the double-stranded fragment b-g as a probe, as shown in Figure 7. In the normal strain, a small amount of 630 nucleotide CYC7 RNA can be detected in the poly(A)-deficient fraction, suggesting either that these CYC7 transcripts are not polyadenylated or that they possess poly(A) termini too short to stably bind to the poly(U) column. The poly(A) RNA, however, represents a substantial enrichment for CYC7 mRNA, since 10 pg of poly(A) RNA contains approximately 20-fold more of the 630 nucleotide wild-type transcript than 20 pg of total RNA. These numbers are compatible with the findings of McLaughlin et al. (1973) who

TOTAL RNA Ini

POLY(A) - POLY(A) + RNA RNA

‘4’

-2400 -2000 ‘:, g

- 1650 - 1450 - 1350

*

-650 630-

Figure

-630

7. Polyadenylation

of Transcripts

in CYCl + and cyc l-5 72

Total RNA from CYCl+ and cycl-512 was separated into poly(A)containing and poly(A)-deficient fractions by poly(U>Sepharose chromatography, as described in Experimental Procedures. The RNAs were size-fractionated and hybridized to the double-stranded DNA probe b-g. Each track was loaded either with 20 pg of total RNA or poly(Atdeficient RNA or with 10 pg of poly(A) RNA.

found that poly(A) RNA constitutes approximately 2.5% of total yeast RNA. The 1450 nucleotide transcript from the gene adjacent to CYC7 is also polyadenylated, and again, is highly enriched in the poly(A) fraction. Note that although there is an approximately 40-fold enrichment for CYC7 RNA in the poly(A) fraction and that the poly(A) track in Figure 7 is overloaded, even a trace of wild-type CYC7 transcripts that are larger than 630 nucleotides cannot be detected. Like the normal CYC7 strain, the poly(A) fraction clearly represents an enrichment for the RNAs in ~~~7-572 that hybridize to the double-stranded b-g probe (Figure 7). Although very small amounts of hybridizing ~~~7-572 RNA are found in the poly(A)deficient fraction, it appears to be decreased relative to the total ~~~7-572 RNA fraction in the same proportions as is CYC7+ RNA. Similarly, ~~~7-572 RNA in the poly(A) fraction that hybridizes to the b-g probe is increased in abundance relative to total ~~~7-572 RNA in the same proportions as is CYC7 RNA. The sites of termination of the mRNAs in ~~~7-572 therefore represent sites of poly(A) addition. It is interesting to note that even the extremely long CYC7 transcripts in cyc 7-5 7 2 that terminate heterogeneously (2400 nucleotide transcripts) are in the poly(A) fraction.

Cdl 568

Discussion The Deletion in ~~~7-512 Occurs between Two 7 bp Direct Repeats Genomic DNA blotting experiments and DNA sequencing of cloned DNA indicate that the only difference between CYC 1 + and cyc l-5 12 is that cyc 1-5 12 contains a 38 bp deletion. The deletion begins 130 bp beyond the translation termination codon of CYCl and ends approximately 15 bp before the end of the transcribed region. The sequence TATTTAT is found at both ends of the deleted region in CYCI, leaving only one TATTTAT sequence in cyc l-5 12. The existence of repeated sequences at the sites of deletions that cause frameshift mutations led Streisinger et al. (1966) to propose the following mechanism for their origin. A gap in one of the two strands of DNA allows the free end of one strand to mispair with the other strand at a sequence of repeated bases. DNA synthesis that fill8 the gap will result in the deletion that causes the mutation. Spontaneous deletions occurring between repeated sequences have been observed in mutants of bacteriophage T4 (Okada et al., 19721, E. coli (Farabaugh and Miller, 19781, Salmonella (Yourno and Heath, 1969). yeast (Stewart and Sherman, 1974) and mammal’s (Efstratiadis’ et al., 1980). In all of these cases the repeated sequences that flank the deleted region range from 3 to 6 bp, which is probably too small to account for deletion by intrastrand crossing over or unequal interstrand crossing over. This suggests that the cycl-512 mutation arose by an error during replication. Effect of Additional 3’ Sequences on the Translation and Stability of WC7 mRNA Wild-type yeast cells produce a CYC7 mRNA that is approximately 630 nucleotides long including the poly(A) tail. The CYC7 message appears as a discrete but broad band on autoradiographs of RNA blots; the breadth of this band is probably due to length heterogeneity of the poly(A) tail (Groner et al., 1974). Since the average poly(A) tail length of yeast mRNA is 50 nucleotides (McLaughlin et al., 19731, the transcribed region of CYCl is approximately 580 nucleotides long. This number agrees well with Sl -nuclease mapping of the 5’ (Faye et al., 1981) and 3’ (Boss et al., 1980) ends of the CYC7 mRNA, which predicts a transcribed region of approximately 560 nucleotides. The breadth of the CYCl mRNA band can also be explained by the heterogeneous start sites that have been reported to be at the 5’ end of the CYCl message (Faye et al., 1981). Additionally, a minor CYCl transcript of 540 nucleotides can be observed; the origin of this transcript is discussed below. The mutant, cycl-5 12, produces discretely sized CYC7 mRNAs of 630, 850, 1350, 1450, 1650 and heterogeneously sized transcripts of about 2400 nu-

cleotides. The combined steady-state levels of all of these cycl-512 mRNAs are approximately 10% of the normal amount of 630 nucleotide CYC7+ mRNA. Since ~~~7-512 strains produce 10% of the wild-type amount of iso-1-cytochrome c, it appears that the aberrantly 8iZed mRNAs are probably translated normally. Consistent with this notion are the results of the mouse dihydrofolate reductase gene (Setzer et al., 19801, which produces mRNAs of different sizes due to the use of different poly(A) sites at the 3’ end. Since all four of the different sized dihydrofolate reductase mRNAs could be isolated from polysomes and were able to be translated in vitro, it was concluded that the presence of up to 930 nucleotides in the 3’ nontranslated region would not affect the translation of an mRNA. Because the deficiencies in the ~~~1-572 mRNAs and ~~~1-512 iso-l cytochrome c are approximately the same, it appears that the addition of sequences to the 3’ end of a message may have little effect on translation in yeast. In contrast, since the steady-state levels of CYC7 mRNA are reduced by an order of magnitude in cyc l512, the addition of sequences 3’ to the mRNA may have an effect upon the stability of the message. While other factors may be involved (see below), there is no evidence to suggest that ~~~1-512 contains a lesion 5’ to the gene that would reduce its rate of transcription. The ~~~7-512 mutation completely recombines with deletions that extend into the 5’ noncoding region of CYCI (J. Kotval et al., in preparation), and the genomic DNA restriction map 5’ to the gene is normal. Since the longest of the four dihydrofolate reductase mRNAs discussed above is the most abundant, the mere presence of lengthy 3’ nontranslated sequences is not enough to impart instability to an mRNA. However, it is possible that there is a specific sequence downstream of the normal 3’ end of CYC7 mRNA that causes the message to be unstable. Overlapping Transcription Reduces Gene Expresslon It has been shown that there is a transcript of a gene adjacent to the CYCI locus that is transcribed from the opposite strand and terminates near the 3’ end of CYC7 (see Figure 6). This gene might be OSM7. which was suggested to be immediately 3’ to CYCl on the basis of genetic analysis (Singh and Sherman, 1978). This gene normally produces a 1450 nucleotide transcript, but in cyc l-5 7 2 the transcript is absent and is replaced by a 2000 nucleotide transcript. The simplest interpretation of these results is that the deletion in ~~~1-512 affects the 3’ end of the adjacent gene transcript as well as that of CYC 1. The net result is that the transcription of both genes is now overlapping. A similar situation has been described for a series of htrp transducing phages where the trp promoter

Transcription 569

Termination

in Yeast

was opposed to the lambda PL promoter (Hopkins et al., 1976). Converging transcription reduced gene expression in this system and it was shown that this effect was dependent upon the strength of the promoters involved (Ward and Murray, 1979). The authors proposed that colliding RNA polymerase molecules caused transcription in both directions to cease. The steady-state amount of the transcript adjacent to CYC7 is reduced by a factor of about five in cycl572 (see Figures 4 and 5, probes g-j). In addition to the potential instability that extra 3’ nontranslated sequences may impose upon a message, it is possible that overlapping transcription of CYC7 and the adjacent gene contributes to the decreased amount of their steady-state transcripts in ~~~7-572. The decreased amount of transcripts could be caused by colliding RNA polymerase molecules as described above, or perhaps by an altered chromatin structure that causes the polymerases to fall off the template when both strands are transcribed. Note too that the 3’ end of the 2000 nucleotide opposing transcript maps in the region of the CYC7 promotor, which might have an effect on the initiation of CYC7 messages in ~~~7-572. Coupling of Polyadenylation and Transcription Termination in Yeast All of the aberrantly sized mRNAs in cycl-57 2 are polyadenylated, which implies that there are no sites where transcription terminates without the addition of poly(A), at least at the level of detection in this system. These studies have utilized steady-state message populations, and transcription beyond the normal poly(A) site of CYC7 might be detected with pulsechase experiments. However, it is not clear that yeast even has poly(A)-deficient mRNA that is not derived from poly(A) mRNA. It was estimated that if a high complexity poly(A)-deficient fraction exists in yeast, then it is present in no greater than one copy per 100 cells (Hereford and Rosbash, 1977). Yeast histone mRNA is polyadenylated (Fahrner et al., 19801, in contrast to the predominant situation in higher eucaryotes (for example, see Adesnik and Darnell, 1972). The extremely high molecular weight CYC7 transcripts in ~~~7-572 (-2400 nucleotides) are heterogeneous in size, indicating a nonspecific block in transcription perhaps imposed by chromatin structure. These transcripts contain poly(A). Thus all or nearly all mRNAs become polyadenylated in yeast. It is therefore reasonable to suppose that polyadenylation may be coupled to transcription termination by some component of RNA polymerase II. Transcription Termination Signals Deletion mutants of AAUAAA have shown that this sequence is necessary for polyadenylation of late SV40 mRNAs (Fitzgerald and Shenk, 1981). Sequences 5’ to AAUAAA are also important in poly(A)

site selection (Fitzgerald and Shenk,, 1981) and DNA sequence homologies 3’ to AAUAAA have been found (Benoist et al., 1980). In addition, some 3’ regions of mRNAs contain the AAUAAA sequence but are not polyadenylated near that site (Tosi et al., 1981). An examination of the DNA sequence of the 3’ nontranslated region of CYC7 reveals that no sequence related to AAUAAA would be found in the wild-type 630 nucleotide CYC7 mRNA (Figure 3). A survey of a number of other yeast genes that code for mRNAs, listed and referenced in Table 1, indicates that only actin, glyceraldehyde-3-phosphate dehydrogenase gene-491, MATa and ribosomal protein-51 contain the hexanucleotide AAUAAA in what could potentially be the region of polyadenylation. Glyceraldehyde-3phosphate dehydrogenase gene-63, enolase gene-8 and enolase gene-46 contain the related sequence AAUAA in their 3’ nontranslated regions. However, CYC7, TRP7, histone H2A2, MATal, MATa2, HIS4 and WA3 do not contain an AAUAAA-type sequence in the appropriate region. Since the 3’ nontranslated regions of yeast genes are extremely AT-rich, it is expected that sequences related to AAUAAA should frequently occur by chance alone. Alternatively, the enzyme responsible for polyadenylation in yeast might recognize a sequence like AAUAAA, but have a much lower sequence specificity than the same enzyme in higher eucaryotes. Either case would suggest that, as in higher eucaryotes, sequences other than AAUAAA might be required for determining the polyadenylated terminus of an mRNA in yeast. Since the 38 bp region that is deleted in ~~~7-572 has been shown to be functionally important, it is likely that the deletion encompasses specific sequences that are important for transcription termination and polyadenylation. The 38 bp sequence and its immediately adjacent CYC7 sequences were compared with the 3’ nontranslated regions of the 14 other yeast genes mentioned above. The sequences TAGT or TATGT, which occur in the center of the 38 bp sequence, showed homology to all of the yeast genes except URA3 (Table 1). For those genes whose mRNAs had been mapped, this homologous sequence was from 10 to 40 bp before the first known poly(A) site, except for ribosomal protein-51 (RP-51) where the homologous sequence is after the poly(A) site. Interestingly, an upstream sequence, TAG, and a downstream sequence, TTT, were often seen, suggesting a tripartite structure for this potential sequence homology. Since the 3’ nontranslated regions of yeast genes are highly AT-rich, this tripartite sequence could have occurred by chance. Thus a computer search for homology and a computer analysis for statistical significance was performed. The entire 200 bp sequence of the 3’ nontranslated end of CYC7 was compared with the 3’ nontranslated ends of 14 other yeast genes. Although no statistically significant homologies between all of the genes were detected,

Cell 570

Table 1. DNA Sequence

Homology

between

the Region

Deleted

in ~~~7-572

and the 3’ Nontranslated

cycI-512 CYCl MATS1 BITa 8154 U4TUl Actin tiistone Enolase Enolase

MA2 gene-8 gene-46 CYC7 TRPl

G3PDH gene-491 G3PDH gene-63 URAJ RP-51

CONSENSUS SEQUENCE:

deletion

Region

of Other

Yeast

Genes

I

I I I ATTTATTTTTTTATAGTTATGTTAGTATTAAGAACGTTATTTATATTTCAAAtTTT I-TAACAATTTGTAGTTCATAAATAAACGTATGAGATCTAAATAAATTCGTTTTCAATGATTA..tt..+ -

T.44..122..

TGAGCCCGAAAAACAAATATGTATATATCTGTGTAGAATATATATATATATATTTCGCA~ATACA.“6”+ TAG...75..GTCTTGAATGAATAGAGATACACTATGTAATGAATGGSAAATTGTAATTT TAG..135..TACTTGCCTCTTTTGTTTATGTCTATGTATTTGTATAAAATATGA~ACTCAGAC+ -TAPTCTCTGCTTTTGTGCGCGTATGTTTATGTATGTACCTCTCT~TCTATTTCTATTTTTA~CC TAA...43..ATTTGGGGTTTTAAAGTAGGTCATATGAGGAAGACTGGTATGTCTTTTATCTAACAG -TAA...58..ACACTTTATATTAACGAATAGTTTATGAATCTATTTGGTTTAAATTGATCGTTTTAT -TAA...43..TCATTTATTTCATTTTCTTAGAATAGTTTAGTTTATTCATTTTATAGTCACGAATGT -TAG...27..ACTTTTATTATTCTAGTTTTTTACAGTTATTTATTAATTAATTATTTTTATATGCAT T~GGTTATTACTGAGTAGTATTTATTTAAGTATTGTTTGTGCACTTGCC TAA...35..TTCTTTtTTATAGCTTTATGACTTAGTTTCAATTATATACTATTTTAATGACATTTT T~ATTTAACTCCTTAAGTTACTTTAATGATTTTTTCATGCTCATGACA T/IA...43..TTAGAGCTTCAATTTAATTATATCAGTTATTACCCGGGAATCTCGGTCGT~TGATT TAA..125.~CTAATTAAGCGAAGCGTTTTATGTAGCTCCTTGGCCATACATACATTGCGCGC~TG TAA TM*.l-l40.*.(T TCA

rich)*.TAG******.TATGT

TACT

--(A-T

rich)..TTT............’

The translation termination codons for each of the genes are in italics, and in some cases are followed by a number designating the number of base pairs between the termination codon and the remaining sequence shown. The 38 bp that is deleted in cyci-512 is shown at the top of the table: the deletion occurred between the 7 bp repeated sequences marked by the vertical lines. Sequences homologous to the region deleted in ~~~7-572 are underlined. A number of genes had several regions homologous to the deleted sequence: in these cases the first homologous sequence was chosen. Arrows: Approximate position of first known site of poly(A) addition: most of the genes examined have several such sites. Sources of DNA sequences for the genes are: MATal. MATal and MATa2. Astell et al. (1981); HIS4. T. Donahue and G. Fink (personal communication): actin. Ng and Abelson (1980); histone H2A2. D. Kolodrubetz, J. Choe and M. Grunstein (personal communication); enolase gene-8 and enolase gene-46. Holland et al. (1981); CYC7. Montgomery et al. (1980); TRPI. Tschumper and Carbon (1980); glyceraldehyde-3phosphate dehydrogenase (G3PDH) gene-491, Holland and Holland (1979): G2PDH gene-63. Holland and Holland (1980); UQAS. M. Rose and D. Botstein. (personal communication): ribosomal protein-51 (RP-51) J. Teem and M. Rosbash (personal communication).

the most frequently occurring region of homology between CYCl and the other genes was in the region of the 38 bp deletion in ~~~1-512; in particular, the region encompassing the sequences TAGT and TATGT. We therefore suggest that the sequences TAGT or TATGT, and perhaps the entire structures TAG... TAGT. . .TTT or TAG . . .TATGT.. .TTT, may have a role in transcription termination and polyadenylation in some but not all genes of yeast. The tripartite sequence does not occur in the bottom strand of the ~~~1-512 deleted region even though this region is the site of termination of the adjacent transcript (Figure 3). However, the bottom strand does contain an AATAAA sequence that is deleted in cyc l512. The related sequences AATATA, TATAAA and AAGAA that remain in the bottom strand in the cycl572 deletion clearly have no function there since no termination or polyadenylation of the adjacent transcript occurs at this site. It remains to be seen if AATAAA or other related sequences have a role in transcription termination or polyadenylation in yeast and if these sequences function only in conjunction

with other sequences, such as the tripartite sequence described here. The possible signal for termination and polyadenylation, or the entire sequence deleted in cycl-5 12 and its immediately adjacent sequences, bear little resemblance to the typical bacterial terminator. Most bacterial terminators can function independently of the protein factor rho and consist of a GC-rich region of dyad symmetry followed by a series of six to eight T residues (Rosenberg and Court, 1979). A computer search for dyad symmetries in the 3’ nontranslated regions of the yeast genes shown in Table 1 revealed only AT-rich symmetries, which were found in most of the genes. Although it is possible that most of these yeast dyad symmetries were due to chance, the terminator structure in yeast may be analogous to certain terminators in bacteria. Terminators that are completely dependent upon the presence of rho contain dyad symmetries that are AT-rich and are not followed by a string of T residues (Kupper et al., 1978; Rosenberg et al., 1978; Calva and Burgess, 1980; Wu et al., 1981). In addition, termination occurs heteroge-

Transcription 571

Termination

in Yeast

neously in an AT-rich region. An analysis of the 3’ termini of the four poly(A) transcripts from the MAT locus in yeast has revealed a local heterogeneity in the sites of polyadenylation (Nasmyth et al., 1981). Thus the region deleted in cycl-5 12 may represent a eucaryotic counterpart to the completely rho-dependent bacterial terminator. Slight deviations from the consensus sequence described above provide a possible explanation for the presence of weak transcription termination sites in CYC7. Wild-type cells produce a minor transcript of 540 nucleotides, which can also be seen in the poly(A) fraction in ~~~7-572. This transcript terminates just downstream from the sequence TAGTTATGT.. .TT. The mutant, ~~~7-572, produces a minor transcript of approximately 630 nucleotides that terminates just beyond the deleted region. If the sequence created by the junction point of the deletion is examined, TAG. . .TAGGT. - .TTT is found. Perhaps these sequences, which resemble the consensus sequence, TAG.. . TATGT, . .TTT, can function as weak terminators. The proper base pair changes might enhance termination at these sites. A study of ~~~7-572 revertants with higher levels of iso-1-cytochrome c may reveal the creation of stronger termination signals and may provide more direct proof for transcription termination by the suggested consensus sequence. It is clear, however, that the deletion in ~~~7-572 has caused a defect in termination of transcription and that this defect may alter mRNA stability and can cause overlapping transcription of adjacent genes. Experimental

Procedures

Preparation of DNA Yeast DNA was prepared by a mini-prep procedure obtained from G. S. Roeder (unpublished results). DNA used for cloning was further purified by equilibrium density centrifugation in C&Cl. The A DNA was prepared by a method similar to that described by Davis et al. (1980) and was grown in E. coli strain HBlOl on LB plates (pH 8.0) containing 5 mM MgCb and 1 pg/ml thiamine. Plasmid DNA was prepared from transformant colonies by a modified method of Barnes (1977). Large amounts of E. coli containing plasmids were grown by the method of Norgard et al. (1979) and the plasmids were isolated by the cleared lysate method of Clewell and Helinski (1970). Analysis of Restriction Fragments Restriction endonucleases were purchased from New England Biolabs and were used in the recommended buffers. Restriction fragments were separated by electrophoresis in agarose slab gels containing 1 x TA (40 mM Tris [pH 7.91, 5 mM sodium acetate and 1 mM EDTA); the electrophoresis was carried out for approximately 20 hr at 1 V/cm. The gels were soaked in 5 pg/ml ethidium bromide for 30 min and then destained in deionized Hz0 for 30 min. The restriction fragments were visualized by excitation with a short-wave ultraviolet lamp and photographed with Polaroid Type 57 film. DNA fragments were transfsrred from the gels to nitrocellulose sheets (Millipore) by the procedure of Southern (1975). Radioactive probes were hybridized to nitrocellulose sheets at 65’C for 20 hr in heat-sealed plastic bags containing 3 x SSC. 1% SDS and 200 pg of denatured, sonicated calf thymus DNA in a total volume of 1.5 ml. After hybridization, the filters were washed at 45’C for 1 hr in 500 ml of a solution containing 3 X SSC and 0.5% SDS. then washed twice in 250 ml of 3 x SSC at room temperature for 10 min each. The filters were dried

and autoradiographed at -7O’C fying screens and flash-activated

with use of Kodak Kodak XR film.

regular

intensi-

Preparation of Radioactive Probes All probes used in this study consisted of isolated DNA fragments from the CYCl region as shown in Figure 1. DNA fragments were separated by electrophoresis and were cut out of an agarose gel. The gel piece was placed in a 32 mm wide, ESA-treated dialysis bag (Spectrapor) containing 0.5 ml of 05x TA, the bag was sealed and the fragments were electroeluted out of the gel in 0.5~ TA at 100 V for 1 hr. The gel piece was carefully removed from the bag with tweezers, discarded, and the solution in the bag was vigorously mixed by repeated pipetting with a silanized Pasteur pipette. The solution containing the DNA was removed and saved. The bag was rinsed with 0.3 ml of a solution containing TE (10 mM Tris [pH 7.91 and 1 mM EDTA): the wash was combined with the original solution of DNA. The DNA was precipitated from the solution with the addition of 80 pl of 3 M sodium acetate and 2 ml ethanol and an overnight incubation at -2OOC. The mixture was spun at 10,000 rpm. 4°C for 30 min and decanted. The pellet was dried under vacuum, resuspended into 25 81 TE and transferred into a microfuge tube. The DNA solution was then spun in a microfuge for 1 min to remove contaminating agarose. The supernatant was removed with a drawn-out capillary pipette and saved. DNA fragments were made radioactive by nick translation according to Rigby et al. (1977). with use of a-32P-dCTP (400 Ci/ mmole). The specific activities of the radioactive fragments were between 0.2-l .O X 1 O7 cpm/pg DNA. A total of 1 O5 cpm was used for Southern blots and plaque lifts: 10’ cpm were used for each RNA filter. Single-stranded DNA probes were prepared by nick-translating a double-stranded fragment, ligating to seal the nicks, denaturing the DNA in 0.1 N NaOH for 10 min at room temperature, then separating the strands by electrophoresis at 25 V and 20 mA for 22 hr in a 1.75% agarose slab gel run in nondenaturing TA buffer. Strands of fragments from 0.6 to 2.2 kb have been separated in this manner. The slower migrating strand of the fragment b-g (see Figure 2) is the sense-strand probe in Figure 5. while the faster migrating strand of the fragment g-j is the sense-strand probe. Approximately 5 x 1O4 cpm of each of the probes were used for the hybridizations shown in Figure 5. Cloning the cycl-512 Gene The EGO RI fragment b-j was cloned from the yeast strain B-4060 (cycl-512) into Agt.xB (Cameron et al., 1975) with the use of techniques described by Davis et al. (1980). Nonirradiated strains BHB2688 and BHB2690 were used for in vitro packaging (Hahn and Murray, 1977); 2.7 X lo5 pfu were obtained per microgram of recombinant phage. By using the plaque hybridization technique (Benton and Davis, 1977) and the previously cloned CYCl+ gene (Stiles et al., 1981), two positive plaques were identified from approximately 13,000 plaques screened. Both phage contained the fragment b-j, which was subsequently cloned into plasmid pBR322 (Bolivar et al., 1977). Sequencing the cycl-512 Mutation The DNA sequence of the ~~~7-572 mutation was determined by the strategy outlined in Figure 1. The sequencing was performed by the nick translation method with dideoxy terminators (Maat and Smith, 1978) with the modifications of Seif et al. (1980) and B. S. Zain (personal communication). The details of the methods and other pertinent techniques are described by Ernst et al. (1981). DNA Sequence Analysis by Computer DNA sequences were analyzed by using the SEC&Sequence Analysis System of the Stanford Molgen Project at the NIH SUMEX-AIM facility. Preparation of RNA RNA was isolated according to Broach et al. (1979). except that the cells were disrupted by vortexing with silanized glass beads for four 15 set intervals. Poly(A)-containing and poly(A)aeficient RNAs were fractionated according to Palatnik et al. (1979) on a polyW>Sepha-

Cdl 572

rose column (Pharmacia), except that the poly(A) RNA was eluted from the column at room temperature in a 90% formamide solution containing 10 mM potassium phosphate (pH 7.5) 10 mM EDTA and 0.2% Sarkosyl. Poly(A) RNA prepared by this procedure represented 3% of the total RNA. Analysir of RNA Twenty microgram samples of RNA (unless specified otherwise) in l2 FI of deionized water were added to 20 pl of a solution containing 8% formaldehyde, 50% formamide. 20 mM borate (pH 8.3) 1 mM EDTA. 5% glycerol and 0.2% bromophenol blue and xylene cyanol FF and were denatured at 85°C for 5 min. The RNA was then cooled to room temperature and loaded onto a 1.5% agarose slab gel containing 3% formaldehyde, 20 mM borate (pH 8.3) and 1 mM EDTA. The gels were run in a circulating buffer of 1.85% formaldehyde, 20 mM borate (pH 8.3) and 1 mM EDTA at 90 V for 8 hr under a hood. Molecular weight standards consisted of 1.5 cg of +X174 Hae Ill fragments and 1 pg of X Hind Ill fragments that were denatured similar to the RNA except that 2 r.rl of 0.5 M EDTA were added to prevent degradation. After running the gel. the standard tracks were cut out and soaked in 5 fig/ml acridine orange for 30 min, washed, destained overnight in deionized Hz0 at 4’C and photographed under ultraviolet light. Transfer of the RNA to nitrocellulose filters and hybridization to DNA probes were exactly as described by Thomas (I 980). The details of the hybridization procedure were from Wahl et al. (I 979). Acknowledgments We thank Dr. B. S. Zain and Ms. Elizabeth Lee (Department of Microbiology, University of Rochester Medical School) for advice and instructions in DNA sequencing techniques and Dr. Linda Walling for the protocol on the RNA gels. We acknowledge useful discussions with our colleagues Dr. Jeroo Kotval. Dr. John Stiles. Dr. Gary McKnight, Steven Bairn. Thomas Cardillo and Dr. Beverly Errede. We especially thank the following people for providing DNA sequences prior to publication: D. Botstein, T. Donahue, G. Fink, hf. Grunstein, D. Kolodrubetz. M. Rosbash, M. Rose and J. Teem. This investigation was supported in part by a Genetics and Regulation Training Grant from the National Institutes of Health to K. S. 2.. in part by a U. S. Public Health Service Research Grant from the National Institutes of Health and in part by a U. S. Department of Energy contract to the University of Rochester, Department of Radiation Biology and Biophysics. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “adverfisemenf” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. Received

October

28. 1981:

revised

December

7. 1981

Boss, J. M.. Darrow, M. D. andzitomer. R. S. (1980). Characterization of yeast iso-l-cytochrome c mRNA. J. Biol. Chem. 255, 8823-8828. Broach, J. R.. Atkins, J. F.. McGill, C. and Chow, L. (1979). Identification and mapping of the transcriptional and translational products of the yeast plasmid. 2F circle. Cell 18, 827-839. Calva. E. and Burgess. Ft. R. (1980). Characterization of a p-dependent termination site within the cro gene of bacteriophage X. J. Biol. Chem. 255, 11017-l 1022. Cameron, J. R., Panasenko, S. M., Lehman, I. R. and Davis, R. W. (I 975). In vitro construction of bacteriophage h carrying segments of the Escherichia co/i chromosome: selection of hybrids containing the gene for DNA ligase. Proc. Nat. Acad. Sci. USA 72, 3418-3420. Clewell. 0. B. and Helinski. D. R. (I 970). deoxyribonucleic acid-protein relaxation ficity of the relaxation event. Biochemistry

Properties of a supercoiled complex and strand speci9. 4428-4440.

Davis, R. W., Botstein, D. and Roth, J. R. (1980). Advanced Genetics. (New York: Cold Spring Harbor Laboratory.)

Bacterial

Efstratiadis. A., Posakony. J. W., Maniatis, T., Lawn, R. M.. O’Connell, C., Spritz, R. A., DeRiel, J. K.. Forget, B. G.. Weissman. S. M.. Slightom, J. L., Blechl, A. E.. Smithies, 0.. Baralle. F. E.. Shoulders, C. C. and Proudfoot, N. J. (1980). The structure and evolution of the human B-globin gene family. Cell 21, 853-888. Ernst, J. F.. Stewart, J. W. and Sherman, F. (1981). The cycl-77 mutation in yeast reverts by recombination with a nonallelic gene: composite genes determining the iso-cytochromesc. Proc. Nat. Acad. Sci. USA 78, 8334-8338. Fahrner. K.. Yarger, J. and Hereford, L. (1980). Yeast histone is polyadenylated. Nucl. Acids Res. 8. 5725-5737.

mRNA

Farabaugh. P. J. and Miller, J. H. (1978). Genetic studies of the lac repressor. VII. On the molecular nature of spontaneous hotspots in the lacl gene of fscherichia co/i. J. Mol. Biol. 728, 847-883. Faye. G., Leung. D., Tatchell. K., Hall, B. D. and Smith, M. (1981). Deletion mapping of sequences essential for in vivo transcription of the iso-l-cytochrome c gene. Proc. Nat. Acad. Sci. USA 78, 22582282. Fitzgerald, M. and Shenk, T. (1981). The sequence forms part of the recognition site for polyadenylation mRNAs. Cell 24, 251-280.

5’-AAUAAA-3’ of late SV40

Ford, J. P. and Hsu, M.-T. (1978). Transcription pattern labeled late simian virus 40 RNA: equimolar transcription mRNA 3’ terminus. J. Virology 28, 795-801.

of in vivobeyond the

Groner. B., Hynes. N. and Phillips, S. (I 974). Length heterogeneity in the polyadenylic acid region of yeast messenger ribonucleic acid. Biochemistry 13, 53784383. Hereford, L. hf. and Rosbash. M. (I 977). polyadenylated RNA sequences in yeast.

Number and distribution Cell 70, 453-482.

References

Hofer, E. and Darnell, of the mouse &major

Adesnik. M. and Darnell, J. E., Jr. (1972). Biogenesis and characterization of histone mRNA in HeLa cells. J. Mol. Biol. 87, 397-408.

Hohn. B. and Murray, K. (1977). Packaging recombinant DNA molecules into bacteriophage particles in vitro. Proc. Nat. Acad. Sci. USA 74, 3259-3283.

Astell. C. R., Ahlstrom-Jonasson, L., Smith, M., Tatchell. K., Nasmyth. K. A. and Hall, B. D. (1981). The sequence of the DNAs coding for the mating-type genes of Saccharomyces cerevisiae. Cell 27, 15-23.

Holland, J. P. and Holland, M. J. (1979). The primary structure of a glyceraldehyde-3-phosphate dehydrogenase gene from Saccharomyces cerevisiae. J. Biol. Chem. 254, 9839-9845.

Barnes, lysates.

Holland, J. P. and Holland, M. J. (1980). Structural comparison of two nontandemly repeated yeast glyceraldehyde-3-phosphate dehydrogenase genes. J. Biol. Chem. 255, 2598-2805.

W. M. (1977). Plasmid Science 195. 393-394.

detection

and sizing

in single

colony

Benoist, C.. O’Hare, K., Breathnach, R. and Chambon. P. (1980). The ovalbumln gene-seouence of putative control regions. Nucl. Acids Res. 8, 127-I 42. Benton, W. D. and Davis, R. W. (1977). Screening hgt recombinant clones by hybridization to single plagues in situ. Science 798, 180182. Bolivar. R., Rodriquez. R. L.. Green, P. J., Betlach, M. C.. Heynecker. H. L. and Boyer, H. W. (1977). Constructlon and characterization of new cloning vehicles. H. A multipurpose cloning system. Gene 2, 95113.

J. E., Jr. (1981). The primary transcription globin gene. Cell 23, 585-593.

of unit

Holland, M. J., Holland, The primary structures 256, 1385-l 395.

J. P. Thill. G. P. and Jackson, K. A. (1981). of two yeast enolase genes. J. Biol. Chem.

Hopkins, A. S.. Murray, ization of )&p-transducing 107.549-589.

N. E. and Brammar, W. J. (1978). Characterbacteriophages made in vitro. J. Mol. Biol.

Kiipper. H.. Sekiya. T.. Rosenberg, M.. Egan, J. and Landy. A. (1978). A A-dependent termination site in the gene coding for tyrosine tRNA sus of Escherichia co/i. Nature 272, 423-428.

Transcription 573

Termination

in Yeast

Maat. J. and Smith, A. J. H. (1978). A method for sequencing restriction fragments with dideoxynucleoside triphosphates. Nucl. Acids Res. 5, 4537-4546.

Smith, M., Leung, D. W., Gillam. S., Astell. C. R.. Montgomery, D. L. and Hall, B. D. (1979). Sequence of the gene for iso-l -cytochrome c in Saccharomyces cerevisiae. Cell 76, 753-761.

McLaughlin, C. S., Warner, J. Ft.. Edmonds, M., Nakazato, H. and Vaughan, M. H. (1973). Polyadenylic acid sequences in yeast messenger r&nucleic acid. J. Biol. Chem. 248, 1466-1471.

Southern, fragments 517.

Milcarek. C., Price, Ft. and Penman, S. (1974). The metabolism poly(A) minus mRNA fraction in HeLa cells. Cell 3, l-l 0.

Stewart, J. W. and Sherman, F. (1974). Yeast frameshifl mutations identified by sequence changes in iso-l -cytochrome c. Molecular and Environmental Aspects of Mutagenesis, L. Prakash, F. Sherman, M. W. Miller, C. W. Lawrence and H. W. Taber. eds. (Springfield. Illinois: Charles C. Thomas), pp. 102-l 27.

of a

Montgomery, D. L.. Leung, D. W.. Smith, M., Shalit, P., Faye, G. and Hall, B. D. (1960). Isolation and sequence of the gene for iso-2cytochrome c in Saccheromyces cerevisiae. Proc. Nat. Acad. Sci. USA 77, 541-545. Nasmyth. K. A. Tatchell, K., Hall, B. D., Astell. C. and Smith, M. (1961). A position effect in the control of transcription at yeast mating type loci. Nature 289, 244-250. Nemer, M.. Graham, M. and Dubroff. L. M. (1974). Co-existence of non-histone messenger RNA species lacking and containing polyadenylic acid in sea urchin embryos. J. Mol. Biol. 89, 435-454. Nevins. J. R.. Blanchard. J.-M. and Darnell, J. E.. Jr. (1980). Transcription units of adenovirus type 2: termination of transcription beyond the poly(A) addition site in early regions 2 and 4. J. Mol. Biol. 144, 377-386. Ng, R. and Abelson, J. (1980). Isolation and sequence for actin in Saccharomyces cerevisiae. Proc. Nat. Acad. 3912-3916.

of the gene Sci. USA 77,

Norgard, M. V.. Emigholz, K. and Monahan, J. J. (1979). Increased amplification of pER322 plasmid deoxyribonucleic acid in Escherichia co/i K-12 strains RR1 and x1776 grown in the presence of high concentrations of nuclaoside. J. Bacterial. 738, 270-272. Okada, Y.. Streisinger, M. (1972). Molecular gene of bacteriophage

G.. Owen, J.. Newton, J. Tsugita. A., Inouye. basis of a mutational hot spot in the lysozyme T4. Nature 238, 336-341.

Palatnik, C. M., Storti, R. V. and Jacobson, and functional analysis of newly synthesized RNAs from vegetative cells of Dictyostelium 128, 371-395.

A. (1979). Fractionation and decaying messenger discoideum. J. Mol. Biol.

Platt, T. (1961). Termination of transcription and its regulation tryptophan operon of E. coli. Cell 24, 1 O-23. Proudfoot. sequences

in the

N. J. and Brownlee, G. G. (1976). S’non-coding region in eukaryotic messenger RNA. Nature, 263, 21 l-21 4.

E. M. (1975). Detection of specific separated by gel electrophoresis.

sequences among DNA J. Mol. Biol. 98, 503-

Stiles, J. I.. Szostak, J. W.. Young, A. T.. Wu, R., Consaul, S. and Sherman, F. (1981). DNA sequence of a mutation in the leader region of the yeast iso-l-cytochrome c mRNA. Cell 25. 277-284. Streisinger. G.. Okada, Y.. Emrich. J., Newton, J.. Tsugita. A., Terzaghi. E. and Inouye. M. (1966). Frameshift mutations and the genetic code. Cold Spring Harbor Symp. Quant. Biol. 31, 77-84. Sutcliffe. J. G. (1978). Complete nucleotide sequence of the Escherichia co/i plasmid pBR322. Cold Spring Harbor Symp. Ouant. Biol. 43, 77-90. Thomas, P. S. (1980). Hybridization of denatured DNA fragments transferred to nitrocellulose. Proc. USA 77. 5201-5205.

RNA and small Nat. Acad. Sci.

Tosi. M.. Young, R. A., Hagenbtichle, 0. and Schibler, U. (1961). Multiple polyadenylation sites in a mouse a-amylase gene. Nucl. Acids Res. 9, 2313-2323. Tschumper, G. and Carbon, J. (1980). Sequence of a yeast DNA fragment containing a chromosomal replicator and the TRPl gene. Gene 10, 157-l 66. Wahl, G. M.. Stern, M. and Stark, G. R. (1979). Efficient transfer of large DNA fragments from agarose gels to diazobenzyloxymethylpaper and rapid hybridization by using dextran sulfate. Proc. Nat. Acad. Sci. USA 76, 3683-3687. Ward, D. F. and Murray, N. E. (1979). Convergent transcription in bacteriophage A: interference with gene expression. J. Mol. Biol. 133, 249-266. Weintraub. H., Larsen, A. and Groudine. M. (1981). crglobin-gene switching during the development of chicken embryos: expression and chromosome structure. Cell 24, 333-344.

Rigby. P. W. J.. Dieckmann. M. Rhodes, C. and Berg, P. (1977). Labeling deoxyribonucleic acid to high specific activity in vitro by nick translation with DNA polymerase I. J. Mol. Biol. 7 13, 237-251.

Wilson, M. C.. Sawicki, S. G.. White, P. A. and Darnell, J. E. (1978). A correlation between the rate of poly(A) shortening and half-life of messenger RNA in adenovirus transformed cells. J. Mol. Biol. 726, 23-36.

Rosenberg, M. and Court, D. (1979). Regulatory sequences involved in the promotion and termination of RNA transcription. Ann. Rev. Genet. 73. 319-353.

Wu. A. M.. Christie, G. E. and Platt, T. (1981). Tandem termination sites in the tryptophan operon of Escherichia co/i. Proc. Nat. Acad. Sci. USA 78, 2913-2917.

Rosenberg, M.. Court, D.. Shimatake. H.. Brady, C. and Wulff. D. L. (1976). The relationship between function and DNA sequence in an intercistronic regulatory region in phage h. Nature 2 72, 414-423.

Yourno. J. and Heath, mutation in Salmonella

Seif. I., Khoury, G. and Dhar. R. (1980). A rapid enzymatic DNA sequencing technique: determination of sequence alterations in early simian virus 40 temperature sensitive and deletion mutants. Nucl. Acids. Res. 8, 2225-2240. Setrer, D. R., McGrogan, M., Nunberg, J. H and Schimke. R. T. (1980). Size heterogeneity in the 3’ end of dihydrofolate reductase messenger RNAs in mouse cells. Cell 22, 361-370. Sherman, F., Stewart, J. W., Jackson, M., Gilmore, R. A. and Parker, J. H. (1974). Mutants of yeast defective in iso-l-cytochrome c. Genetics 77, 225-264. Sherman, F.. Jackson, M.. Liebman. S. W.. Schweingruber. A. W. and Stewart, J. W. (1975). A deletion map of cycl mutants and its correspondence to mutationally altered iso-lcytochrome c of yeast. Genetics 81, 51-73. Singh. A. and Sherman, F. (1978). Deletions of the No-1 -cytochrome c and adjacent genes of yeast: discovery of the OSMl gene controlling osmotic sensitivity. Genetics 89, 653-665.

S. (1969). Nature of the hisD3018 frameshift typhimurium. J. Bact. 700, 460-468.