DNA sequence variation and interrelationships among Colletotrichum species causing strawberry anthracnose

265

Physiological and Molecular Plant Pathology (1992) 41, 265-281

DNA sequence variation and interrelationships among Colletotrichum species causing strawberry anthracnose S . SREENIVASAPRASAD * , AVERIL

E.

BROWN *

t,+ and P . R .

MILLS * t

* Department of Applied Plant Science, The Queen's University of Belfast and T Plant Pathology Research Division, Department of Agriculture for Northern Ireland, Veuforge Lane, Belfast BT9 5PX, U.K . (Accepted .for publication October 1992)

Restriction fragment length polymorphisms (RFLPs) of the ribosomal DNA (rDNA) and mitochondrial DNA (mtDNA) of isolates of the strawberry anthracnose pathogens Colletotrichurn acutatum, C. fragariae and C. gloeosporioides were analysed using rDNA from Saccharomy(es carlsbergensis and mtDNA extracted from C. acutatum, Ce fragariae and C. gloeosporioides as probes . These analyses revealed considerable heterogeneity within C . acutatum from diverse hosts . The European strawberry isolates formed a discrete group while the American strawberry isolates fell into a broad group which included isolates from other hosts . No polymorphisms in either rDNA or mtDNA were observed among C. gloeosporioides isolates from strawberry. C. fragariae isolates divided into two groups with distinct rDNA and mtDNA patterns . Random amplified polymorphic DNA (RAPD) analysis grouped isolates in a similar manner to the mtDNA RFLP analysis . From sequencing data, the internally transcribed spacer (ITS)1 region of the rDNA repeat unit of C. gloeosporioides, C. fragariae and C . acutatum was shown to be 171, 171 or 172 and 180 or 181 bases, respectively . C. gloeosporioides and C. fragariae differed from one another by only three to seven bases compared with C. acutatum which differed from C. gloeosporioides and C. fragariae by approx . 36-37 bases . ITS I data for C. acutatum generally support RFLP and RAPD taxonomies ; differences of eight-eleven bases between European strawberry isolates and all other isolates studied being the greatest .

INTRODUCTION Colletotrichum spp . cause anthracnose of strawberry which includes diseases of crowns, leaves, petioles, stolons, peduncles, pedicels and fruits . Anthracnose has been reported from the U .S .A ., Argentina, Brazil, Mexico, India and Australia [20, 30] and Europe [7, 17] . The major strawberry anthracnose pathogens are C. acutatum Simmonds, C . gloeosporioides (Penz .) Penz . & Sacc . and C . fragariae Brooks ( = C . gloeosporioides ?), of which C . acutatum and C. gloeosporioides are ubiquitous and polyphagous [43, 47] . Anthracnose on strawberries in nurseries can result in death of up to 80 1 % of plants and yield losses greater than 50o , have been recorded in the U .S .A . [20, 50] . In the U .K ., where C. acutatum alone has been recorded, anthracnose (black spot) is regarded as a potential threat to the strawberry industry and detection of the disease results in the compulsory destruction of a crop [I] . The often overlapping symptoms caused by Abbreviations used in text : ITS, internally transcribed spacer ; mtDNA, mitochondrial DNA : rDNA, ribosomal DNA : RAPD, random amplified polymorphic DNA ; RFLP, restriction fragment length polymorphism . +To whom correspondence should he addressed . 0885-5765/92/100265 + 17 $08 .00/0

© 1992 Academic Press Limited



266 S . Sreenivasaprasad et al . the anthracnose fungi and the lack of'distinguishable characters between C . ,for spurioidcr and (, f- agauae have led to considerable uncertainty regarding the causal agent of various forms of strawberry anthracnose . With fusiform conidia and sparse, obovate and rarely lobed appressoria, C . acutatum is well recognized as a distinct species [43] . However, the taxonomic status of C . fragariae remains debatable [20, 30, 42] . The strawberry anthracnose fungus in the U .S .A . was reported as C.e fragariae in 1931 [5] . Von Arx [46] and Lenné [28] are of the opinion that Ce fragariae may be included under C . gloeosporioides but subsequent reports froth the U .S .A . retained C . fragariae as a separate species, despite a lack of apparent differences with C. gloeosporioides [2, 21, 30, 42] . Both C. gloeosporioides' and C . fagariae have cylindrical spores and similar appressoria that are slightly lobed and clay ate [42] . Criteria such as the presence or absence of setae, and a perithecial state as well as virulence on selected hosts and isozyme comparison were employed in attempts to distinguish these two species [2, 21, 30, 42] . Wide variation in conidium shape and size and appressorium morphology is known in isolates of C . gloeosporioides and related species [25] . Sutton [43] treated C . glo eospo rio ides as a group species because subspecific elements could not be satisfactorily delineated by classical taxonomic criteria . Pathological variation has been reported among isolates of C. acutatum, C . gloeosporioides, C . fragariae and Glomerella cingulata infecting strawberry . Moreover, isolates of Colletotrichum and Glomerella spp . from other hosts and sector subcultures of some less virulent strawberry isolates were as virulent as aggressive Ce fragariae isolates on strawberry [30, 42] . These observations reflect the variability likely to be encountered in the strawberry anthracnose-causing fungi . In recent years, RFLP analysis [11], polymerase chain reaction (PCR) based methods [9], chromosomal karyotyping [32] and sequencing of the ribosomal RNA genes [15,23] have been employed to study the phylogenetic relationships of phytopathogenic fungi . Manners and co-workers [3,32] used these techniques to determine the molecular variation of C. gloeosporioides populations causing anthracnose on Stvlosanthes spp . in Australia . In the present investigation, we have undertaken RFLP analysis of the ribosomal and mitochondrial DNA, RAPD analysis of the genomic DNA and sequencing of the variable internally transcribed spacer (ITS)1 region of the ribosomal DNA (rDNA) repeat unit to elucidate the molecular variation of the strawberry anthracnose fungi and to determine the interrelationship between C . gloeosporioides and C . fragariae .

MATERIALS AND METHODS Fungal isolates and growth conditions Isolates of C . acutatum, C . gloeosporioides

and Ce fragariae used in this study were acquired from various sources shown in Tables 1 and 2 . These isolates were obtained from Fragaria x ananassa Duch . (strawberry), Cyclamen sp ., Anemone sp ., Chrysanthemum sp ., Phlox sp ., Statice sp ., ,Vandina domestica Thumb ., Magnolia sp ., Photinia x Fraseri Dress, Liriodendron tulipifera L . (tulip tree) and Persea americana Mill . (avocado) . Monoconidial cultures were produced for each isolate and maintained on potato dextrose agar (PDA, Oxoid) .

267

DNA sequence variation and interrelationships TABLE I

Host, source and rDNA, mtDAA and RAPD groupings of' isolates of Colletotrichum acutatum mtDNA° grouping Isolate no .

Host

N 190 N191 PD88/566 PD88/858 561 382 394 397 PD89/582 PD88/673 PD85/694 PD90/443 287 302a 318 455 473 1073

Strawberry Strawberry Strawberry Strawberry Strawberry Strawberry Strawberry Strawberry Cyclamen Anemone Chrysanthemum Phlox Statice Nandina Magnolia Photinia Tulip tree Avocado

Source'

rDNA° grouping

EcoRI

HindIIl

RAPD' grouping

U .K .° U. K .° NL`' NL`' CRd U .S .A .' U . S . A .' U .S .A .' NL' NL' NL' NU U .K d U .K .' U .K .' U . K .' U .K d NZ'

1 I 1 I 3 3 3 3 3 3 4 2 2 2 2 3 3 2

I 1 1 1 3a 3a 3a 3a 3b 3a 4 3b 3b 2 2 3a 2 2

1 1 1 1 3b 3h 3a 3a 3h 3h 4 31) 3c 2a 2a 3b 2b 2a

1 1 1 1 3b 3a 3a 3a 3b 2b 4b 4a 4a 2a 2a 3b 3h 2a

'Source from which isolates were obtained but not necessarily the country of origin of host plants (NL, The Netherlands ; CR, Costa Rica ; NZ, New Zealand) . ° Isolated from anthracnosed strawberry fruits in Northern Ireland . `From culture collection at Plantenziektenkundige Dienst, Wageningen . 'From culture collection at MAFF Plant Pathology Laboratory, Harpenden, U .K. 'From Institute of Food and Agricultural Sciences, University of Florida, U .S .A . 'From culture collection at DSIR, Mt. Albert Research Centre, Auckland, New Zealand . sRelates to Fig . 1 . 'Relates to Fig . 2(a) and Tables 3 and 4 . 'Relates to Fig . 3 and Table 5 .

All monoconidial isolates were grown for 3 days at 25 °C in an orbital incubator (120 rpm) in Erlenmeyer flasks (250 ml) containing 100 ml liquid medium (I 1 contained glucose, 15 . 0 g ; KH 2PO 4 , 1 . 0 g ; MgSO 41 0 . 5 g ; casein hydrolysate (BDH), 4 . 6 g and 2 ml trace element solution in distilled water) . The stock trace element solution contained FeS04 . 7H 2 0, 26 mg ; CuSO 4 . 5H 2 0, 4 mg ; ZnS0 4 . 7H 2 0, 22 mg and MnS0 4 .4H 2 O, 2 mg in 100 ml distilled water . The inoculum comprised eight agar discs per flask (4 mm diameter) cut from the leading edge of actively growing cultures on PDA . Mycelium was harvested by filtration through Whatman No . 3 filter paper and immediately frozen in liquid nitrogen . The frozen mycelium was pulverized, freeze dried, ground to a fine powder and stored at -70 °C . DNA extraction

Total DNA was extracted by the method of Raeder and Broda [39] modified as follows . Freeze dried mycelial powder (300 mg) was extracted in 3 ml extraction buffer and 3 ml phenol-chloroform (2 . 1/0 . 9 ml) . After the RNase treatment, two phenol-

268

S . Sreenivasaprasad et al.

TABLE

Soarce

and

rD .Vrl, nztDXI

and

2 ILJPD gioapin,gs

glocosporioides Isolate no .

Source

of strao'berr_v isolateo

and C . f

of

('.olletot, chum

agariac

rDNA` grouping

nitDNAe grouping

RAPD' grouping

1 1 1 1 2 I 1 1 2 2

1 1 1 1 2 1 1 1 2 2

1 1 1 1 2 1 1 1

C. gloeosporioides'

231 254 311 315 386

U .S .A . Florida L' Canada (Ontario)' U .S .A ." U .S .A ." U .S .A .')

C . fragariae

CF card-IA CF card-1B 63-1 163-1 291 326 1 383 376 384 406

U .S .A . (Mississippi)' U .S .A . (Mississippi)' U .S .A . (Mississippi)'' U .S .A . (Florida)' U .S .A. (Michigan)" U .S .A . (Florida)' U .S .A . (Florida U .S .A . h U .S .A ." U .S .A ."

'From culture collection at MAFF Plant Pathology Laboratory, Harpenden, U .K . 'From Institute of Food and Agricultural Sciences, University of Florida, U .S .A . "All isolates showed identical patterns with each of the analyses . 'Relates to Fig . 1 . 'Relates to Fig . 2(b) . 'Relates to Fig . 3 .

chloroform extractions were carried out in order to improve the quality of the DNA preparation . The DNA pellet was dissolved in an appropriate volume (usually 700 µl) of 10 mm Tris HCl and 1 mm EDTA solution, pH 8 (TE) .

Isolation of mitochondrial DNA

Total DNA was extracted from 6 g of mycelial powder by the method of Raeder and Broda [39] and dissolved in 10 ml TE . Mitochondrial DNA was fractionated by centrifugation in a caesium chloride (CsCl)/bis-benzimide gradient [13] . CsCl (11 . 308 g) was dissolved in the 10 ml DNA solution . Bis-benzimide was added to give a final concentration of 120 .tg ml -' and the volume was adjusted with TE to fill 12 ml quickseal tubes (Beckman) . Gradients were formed by centrifugation (Beckman Ti 70 rotor) at 40000 rpm for 48 h . Bands visualized under ultraviolet light (375 nm) were removed and fractions containing DNA were again centrifuged as above in separate CsCI gradients . Following fractionation, bis-benzimide was removed from DNA fractions by five extractions with isopropanol saturated with 20 x SSC (3 M NaCl, 0 . 3 M trisodium citrate, pH 7 . 0) . DNA was precipitated with 2 vol of ethanol following the addition of 2 M ammonium acetate (final concentration) and the pellet dissolved in 100 pl TE .



DNA sequence variation and interrelationships

269

DNA digestion and Southern blotting

Genomic DNA (1-3 lag) was digested with 25 U of the appropriate restriction enzyme for 16 h at 37 °C according to the manufacturer's instructions ; hexameric restriction endonucleases Clal, EcoRI, HindIll, Sacl and Smal (Promega) were used . Digested DNA was electrophoresed on 0 . 8 °- 0 w/v agarose gels for 13 h at 60 V in TBE (89 mm Tris, 89 mm boric acid, 2 mm EDTA) and transferred to a nylon membrane (Hybond N, Amersham) by capillary transfer . DNA was immobilized on the membrane by baking at 80 ° C for 90 min [40] . HindIIl-digested lambda DNA and digested pGEM (Promega) were used as molecular size markers . RFLP analysis, hvbridr ation and autoradiographv For probing the rDNA, plasmid MY60 (pMY60) containing a complete rDNA unit from Saccharomvces carlsbergensis Hansen [45] was used . For the mitochondrial genome analysis, mtDNA isolated from C. acutaturn (isolate 1073), C. gloeosporioides (isolate 311) and C . fragariae (isolate 63-1) were used as probes . Probes were labelled with [a-32pJ deoxyadenosine 5' triphosphate (Amersham) using the Prime-a-Gene labelling system (Promega) . Specific activity of the probes was approx . 10 9 dpm pg DNA- ' . Hybridization reactions were carried out in a hybridization oven (Hybaid) at 65 °C following the procedure described by Sambrook et al . [40] . Prehybridization was for 3 h and hybridization was for 12-16 h . Stringency washes were as follows : three washes for 30 min each in 2 x SSC (300 mm NaCl, 30 mm trisodium citrate, pH 7 . 0) and 0. 1 ° 0, SDS and three washes for 30 min each in 0 . 1 x SSC and 0 . 1 °-,, SDS . The membranes were wrapped with cling film and exposed to Hyperfilm ß-max (Amersham) at - 70 °O using intensifying screens . Probes for

PCR amplification

PCR amplification of the ITS 1 region of rDNA was carried out using the biotinylated ITSI and ITS2 primers [48] supplied by Operon Technologies Inc ., California . Two 100 pl reactions were set up for each isolate using either biotinylated ITS1 or biotinylated ITS2 with the appropriate non-biotinylated primer . Each 100 pl reaction contained 10 pl genomic DNA (50-100 ng), 10 p1 10 x Taq Buffer, 0 . 5 pl (2 . 5 U) Taq DNA polymerase (Promega), 200 pm each of dATP, dCTP, dGTP and dTTP (16 pl), 1 gm each of primer 1 and primer 2 (5 p1 each) and 53 . 5 pl of sterile distilled water . PCR mixtures were subjected to 30 cycles of 1 . 5 min at 94 ° C, 2 min at 45 ° C and 3 min at 72 °C on a Thermal Cycler (Hybaid) . For RAPD analysis [49], a 10 base primer B6 ( 5 TGCTCTGCCC 3 ) supplied by Operon was used . Each 100 pl reaction contained 10 pl genomic DNA (50-100 ng) and 10 VI of the single primer (15 pg ml - ') . The PCR mixtures were subjected to 45 cycles of 1 . 5 min at 94 °C, 2 min at 30 °C and 3 min at 72 ° C, preceded by a 7 min denaturation at 94 °C and followed by a 7 min extension at 72 °C . PCR products (10- 15 p1) were checked on 1 . 4°-0 w/v agarose gels containing ethidium bromide (0 . 4 pg ml -1 .) . Solid phase sequencing

Direct solid phase sequencing of PCR products [22] was done with Dynabeads (Dynal, Norway) according to the manufacturer's instructions . Biotin end-labelled DNA from



270

S . Sreenivasaprasad et al. a sample immobilized using 100 µl of prewashed beads, was suspended in 7 pI of sterile distilled water and used for sequencing by the chain-termination method [41 1 . Nonbiotinylated primers were used as sequencing primers with the T7 DNA polymerase sequencing kit (Promega) . Sequencing reactions and electrophoresis were carried out as described by Gyllensten and Erlich [16 ] . Data analysis The proportion °()) of shared restriction endonuclease fragments (F) and the nucleotide sequence divergence estimates (p) between various RFLP groups were calculated from the formulae : F = (2 .Nzy)/JV1 +X,, and p= (-InF)/r, where Vrxy is the number of shared fragments between two samplings, .N. and .)V are total number of fragments in each of the samples and r is the number of nucleotide bases for the restriction enzyme [36, 37] . F (°-O values for the RAPD groups were also calculated as above . The sequence data were aligned and analysed for distance matrix values using the CLUSTAL V package [18] . The phylogenetic tree was constructed using the PILEUP package [10] . RESULTS

Variation in the rDJVA of C . acutatum, C . gloeosporioides and C . fragariae Ribosomal DNA restriction patterns of EcoRI digested genomic DNA generated with a yeast rDNA probe (Fig . 1) indicate that C . acutatum isolate could be placed into four groups (Table 1) . Two bands of approx . 0. 76 and 2 . 45 kb were common to all isolates except PD 85/694 which shared only the 2 . 45 kb band . A third band was between approx . 3 . 75 and 5 . 7 kb in different isolates . Four strawberry isolates, two each from Northern Ireland and the Netherlands were clustered together (group 1), while the three strawberry isolates from the U .S .A . were in a broad group which included isolates from various hosts (group 3) . Group 2 also contained isolates from diverse hosts . Restriction analysis with Clal (Fig . 1), Smal and SacI (data not presented) confirmed the EcoRI groupings of C. acutatum . All the C . gloeosporioides isolates gave an identical pattern with each of the four restriction enzymes used (e .g . Fig . 1), whereas the Ce fragariae isolates were separated into two groups (Table 2) with distinct restriction patterns (e .g . Fig . 1 ; data for Smal and Sacl not presented) . With Clal and Smal digestion, certain isolates of C . acutatum, Ce f agariae and C . gloeosporioides revealed a co-migrating band (e .g . Fig . 1 ; data for Smal not shown, ; with EcoRl digestion one common band was observed between the C . fragariae group 1 isolates and C . gloeosporioides isolates (Fig . 1) . SacI digestion yielded a sing] e band between 10 and 11 kb with C. gloeosporioides and C. fragariae, and 2 or 3 bands between 2 . 2 and 6 . 7 kb with C . acutatum isolates (data not shown) . The approx . size of the rDNA unit calculated from EcoRI digests ranged from 7 . 4 to 8 . 9 kb for C . acutatum, 8 . 7 kb for C. gloeosporioides and from 9 . 1 to 9 . 8 kb for C . fragariae . Variation in the m tD .NA of C . acutatum MtDNA from isolate 1073 fractionated on a CsCl gradient was used to probe EcoRI and HindIIl digests of the genomic DNA of the 17 C. acutatum isolates . Based on the RFLPs observed with EcoRI, five groups could be distinguished (Table 1) allowing for minor variation within a group . A major band of approx . 7 . 7 kb and four smaller bands



DNA sequence variation and interrelationships

Û r

kb 9 -46-6-

Û U I r- 1 n I

271

Û

U Û I I-1 n

K' "n -t C) O' 00 o0 .-, .r O, 00 00 W) 00 z Q a â aQ K Z PQ. a~ â

N

_ r

kb

- 9-4 ++ -6 . 6

4-4-

-4-4

2 .3-

-2 . 3

2 . 0-

-2-0

-0 .6

0-6I II I C1aI

EcoRI

FIG . 1 . RFLP patterns of DNA from various isolates of C . acutatum (CA), C. gloeosporioides (CG) and C. fragariae (CF) digested with Clal and EcoRI and hybridized with the yeast rDNA probe pMY60 (CA and CF group nos . are in parentheses ; isolates in each group are given in Tables 1 and 2) .

of 2 . 5, 2 . 3, 2 . 1 and 1 . 85 kb were common to all isolates, while other bands were polymorphic . Restriction patterns of representative isolates of the five groups are shown in Fig . 2(a) and the proportion (%) of shared fragments (F) and nucleotide sequence divergence estimate (p) are presented in Table 3 . Group 4 isolate PD85/694 showed low F values (42-48 %) particularly with groups 1 and 2 . Isolates of groups 3a and 3b with a high F value of 90 % exhibited a considerable degree of relatedness . The size of the mitochondrial genome of C . acutatum was estimated to be approx . 30-33 kb, by summation of fragment sizes on ethidium bromide-stained agarose gels for isolate 1073 and on autoradiograms for the other isolates . The 1073 probe gave the same pattern probing 1073 blots as ethidium bromide-stained mtDNA digests . Digestion with Hindlil grouped the C. acutatum isolates in a broadly similar way to EcoRI groupings, but with EcoRI group 2 isolates subgrouped into 2a and 2b (F value, 78 0 ,/o ) and the EcoRI group 3b isolates separated into groups 3b and 3c (F value, 80 % ; Table 1) . The restriction patterns of representative isolates and the F and p values between different groups are shown in Fig . 2 (a) and Table 4, respectively . C. acutatum isolates were also analysed with heterologous C . gloeosporioides and C . fragariae mtDNA probes . The banding patterns were basically similar to the homologous



272

S . Sreenivasaprasad (a)

et al .

(b) CA

I

CG

w

I

w

CF

CG

CF

r---l l

f l I

1

w 0

 v

00

ro M

O ti

N

O

00

N M

M1.

Z

M

00 N

cC O M

r

V

Op

Q W 0. M

M

M en 00 O en N en en M d' O N en °

M

en

kb -9-4 -6-6 -4-4

-2 . 3 -2 .0

I

II t EcoRI

Hind III

EcoRI

HindIII

2 . (a) RFLP patterns of genomic DNA from isolates of C . acutatum digested with EcoRl and HindIII and probed with mtDNA from C. acutatum (group nos . are in parentheses : isolates in each group are given in Table 1) . (b) RFLP patterns of genomic DNA from isolates of C . gloeosporioides (CG) and C. fragariae (CF) digested with EcoRI and HindIII and probed with mtDNA from C. gloeosporioides (CF groups are in parentheses : isolates in each group are given in "Fable 2) . FIG .

Proportion

TABLE 3 (F) and nucleotide sequence divergence estimates (p) of mtD.NA RFLP groups (EcoRI digests) of Colletotrichum acutatum

( 0-0 ) of sharedfragments

Groups 1 2 3a 36 4

1

2 64

0075 0 . 053 0. 075 0 . 122

0 . 045 0026 0 . 145

3a 73 76 0018 0 . 060

3b 64 86 90

4 48 42 70 61

0 .083

F values are given in upper matrix . p values are given in lower matrix .

(C . acutatum probe) reaction but the band intensities varied markedly and only three to four bands gave strong signals . With both the heterologous probes, at least three bands totalling approx . 19 kb hybridized weakly in most C . acutatum isolates, presumably due to poor sequence homology (data not shown) .



DNA sequence variation and interrelationships

273

TABLE 4 Proportion (1 11,) of sharedfragments (F) and nucleotide sequence divergence estimates ( p) of mtDJvA RhLP groups (HindIII digests) of Colletotrichum acutatum

Groups 1 2a 2h 3a 3b 3c 4

1

2a 36

0. 0. 0. 0. 0. 0.

169 161 135 126 135 144

0. 041 0. 085 0. 107 0. 153 0. 124

2b 38 78 0. 0. 0. 0.

31) 44 60 42

144 135 144 153

0011 0 . 048 0 . 058

47 53 44 93

3c 44 40 42 75 80

0 .037 0048

4 42 48 40 71 75 71

0 . 058

F values are given in upper matrix . p values are given in lower matrix .

Variation in mtDNA of C . gloeosporioides and C . fragariae With the homologous probe, all the C. gloeosporioides isolates gave an identical pattern with each of the restriction enzymes used [Fig . 2(b)] . Bands ranging from approx . 1 . 67 to 10 . 8 kb and 0. 99 to 8 . 5 kb were observed following digestion with EcoRI and HindIII, respectively [Fig . 2(b)] . The size of the C. gloeosporioides mitochondrial genome was approx . 45 kb . With the heterologous C. fragariae probe, banding patterns and signal intensities of the C. gloeosporioides isolates were similar (data not shown) to the homologous reaction . Restriction analysis of Ce fragariae isolates with the C. gloeosporioides mtDNA probe revealed two distinct patterns which divided the 10 isolates into two groups [Fig . 2(b)] . The same restriction patterns were observed when Ce fragariae isolates were probed with C . gloeosporioides mtDNA (data not shown) . No co-migrating bands were observed between the two groups with both of the restriction enzymes indicating considerable difference in the mtDNA of these isolates . However, C fragariaee group 2 isolates and the C . gloeosporioides isolates shared several bands with F values of 53-60 °:() . The C . acutatum mtDNA probe reacted weakly with both C . gloeosporioides and C. fragariae isolates ; three-four bands hybridized well but most of the major bands could be clearly observed only on prolonged exposure ( > 72 h) of the autoradiographs (data not shown) . Detection of genetic variability using RAPD primers The potential of random primers to detect genetic diversity in C. acutatum, C. gloeosporioides and C. fragariae was assessed using primer B6 . Amplification products ranged from approx . 300 to 1550 by and the RAPD patterns, with varying degrees of similarity, suggested that the C. acutatum isolates could be placed into seven groups (Table 1) with minor variation within a group . As with RFLP analyses, the European strawberry isolates had an identical RAPD pattern (group 1) . The American strawberry isolates were closely related to each other with an F value of 92 o,, (groups 3a and 3b), but were not closely related to the European strawberry isolates (F values, 0-20°-~) . Banding patterns of representative isolates, and the proportion (F°,),) of shared fragments between various groups are shown in Fig . 3 and Table 5, respectively . With C. gloeosporioides isolates, a single fragment of approx . 950 by was amplified . With



274

S . Sreenivasaprasad CF

CA

I

1

z

V

N

r

N

00 NN

O M

CG

1

r

et al.

t

1

cli

N

X

O

N N

fn

N

M

kb -2 .6 -1-6 -1 .2

-0-67 - 0-52 -0-39 -0-22

3 . R .Al'1) pattern, of 3(0010)1 I)1 .-A from isolates otCo aeatatunn iCC . /rn~nriae i(1FI and iCG , C .A and Ct group no s . arc in parentheses : isolates in each group an . given in 'Fable, 1 and 2' . l'IC .

C . ,lotna/uuiohI

I 'ABLE ho/)n1/Ion

of

hol cd /ragmrIII, ~ I

Groups 1

) 1) 3a 36 ka

I

hehceen

2a 25 73

10)10)0

R .I

3)011/0

u/ Collctotriehum acti tat lint

3a

31)

la

+b

20 62 50

n 67 )A 92

25 36 11) 33 36

0 18 40 7 50

to

the ( " . fragariae isolates two amplification types were observed and isolates from RFLP group 1 showed two fragments of approx . 680 and 1 100 by while group 2 isolates revealed one major fragment of approx . 950 by )Fig . 3) .

of C . acutatum, G . gloeosporioides and C . fragariae The ITS I region of C . acatatuna was shown to be 180-181 bp . Variation was observed in the nucleotide sequence of the C'C acutatuta isolates (Fig . 4) and homology ranged between 94-100° (, ,Table 6) . European strawberry isolates N190, PD88/566 and PD88/858 ! RFLP group 1) had an identical sequence . Isolates from the RFLP groups 2-4 had 99--100° )) sequence homology . Isolates of the RFLP group 1 and the RFLP groups 2, 3 and 4 had 94-96°,, homology . The ITS 1 region of C . gloeosporioides and C . fragariae was shown to be 171--172 by and all four C . gloeoporioides isolates analysed had an identical sequence (Fig . 4) Segaencin ; o/ the ITS 1 region



275

DNA sequence variation and interrelationships TABLE 6 Distance matrix and percent homnlogv between the ITS/ sequence o` Colletotrichum acutatum ; C . glocosporioides and C . liagariac

Isolate groups

Cal

( :a 1

Ca2 ( :a3 (: 4 Ca 5 Cg ( :11 (112

95 94 95 96 84 85 86

Ca2

( :a3

Ca4

Cas

Cg

CH

(Y2

0-050

0'056 0-006

0'050 0 .006 0-006

0044 0-006 0011 0006

0 . 156 0 . 137 0143 0' 1 ,38 0-144

0-149 0 . 154 0160 0 . 155 0-149 0 . 035

0-1 ,14 0-149 0'155 0 - 150 0 . 144 0 .018 0-018

99 99 99 86 85 85

99 99 86 84 85

99 86 85 85

86 85 86

97 98

98

Isolate groupings : C. aculatum Cal = N190, PD88/566, PD88/858 ; Ca2 = 397, 561 ; CA = 302x, 473, 1073 ; CA = PD89/582, PD88/673, PD85/694 ; Cas = PD90/443 . C. gloeosporioides Cg = 231, 254, 311, 315 ; C . fragariae Cil = CF card-IA, 163--1 ; Cf2 = 291, 384, 406 . Distance matrix is given above diagonal ; percent homology is given below diagonal .

N190 PD88/566 PD88/958 397 561 3024 473 1073 PD89/582 P085/694 P085/694 P590/443 231 C7 254 CJ 311 315 'CF c a rd-IA 163-1 291 CJ 384 406

a0 90 60 7o 20 30 40 50 1 10 CTGAGTTACCGCTCTACAACCCTTTGTGAACATACCTA* *ACCGTTGCTTCGGCGGGCAGGGGAAGCCTCTCGTGGGCGG ACCCTCCCGGCG ** ** C ---- CTC ** T C____CTC T + G ** C---- CTC T ---------------C____ ---------------- T G ** C---- CTC T G ** C------------------CTC ** ---------------- T C__-_CTC * ---------------- T C---- CT T ---------------C---- CTC TA__T T---- *x * -T C_A***-x C TA T TA__T T____*x * *T___*__C_A-**** TA T TA-_T T__ __* *x*T___*__C_A*u* * C TA T TA___T TA__T T__ __ **xxT___x__C_A**** * C CA__T T ** *T_C_* ---- A***** C TA CA__T T---- *xx*T_C_* ---- A***** C TA TA__T T---- ***T___*---- A***** C TA TA__T T---- ** **T___A*x*** C TA TA__T T **T--_A***** C TA

100 130 140 150 110 120 CCGGCCCC*GTCACGGGGGCGGAGCGCCCGCCGGAGGA*AACCAAACTCTATTTACACGACGTCTCT :CTGAGT000ACAAGCAAATAAT :'A Z90 * P088/566 * * * P 3 D88/858 97 CAC A___G 561 CAC A-__G 4 302a CAC A___G U 473 CAC A-__G A___G 1073 CAC P D89/582 *AC A___G * PD88/673 *AC A___G PD85/694 *AC A___G * PO90/443 *AC A___G * T-**--G-CTC-G*__C__GTCG T GA__TA T T '231 c7 254 T-**--G-CTC_G*__C__GTCG T GA__TA T U 31'_ T-**--G-CTC-G*--C--GTCG T GA__TA T T 315 T-**--G-CTC_G*__C__GTCG T GA__TA T T T T 2F card-1A T-**--G-CCC_C___C__GTCG T GA__TA T -** --G-CCC-C---C--GTCG T GA__TA T T u- 163-1 T GA__TA T U 29 1 T-**--G-CCC-G*__C_-GTCG T-**-_G-CCC-G*_-C--GTCG T GA__TA T T 394 GA__TA T-**--G-000-G*--C--GTCG T T T 406

Fia . 4 . Nucleotide sequence of the ITS I region of C . acs/atum (CA :, C . gloeosporioides CG) and ( .,fragariae jCFj .

19

\I PP 41



276 S . Sreenivasaprasad et al. five C . /iagariae isoliUcs tested clustered into two groups, s-Within syhich there wen identical sequences Fig . 4 ;, with 98",, homology bets-ucn then . 'I he group 1 isola us ( ;F card-IA and 163-1 showed 97" ' , homology to ( ., loeaaporioide) while group 2 isolates 291 . 384 and 406 showed 98°„ homology . C, aaula/nm showed only 84 86" hornologv to C. gloeosporioides and C. /ragmriae . The infra- and inter-specific matrix values arc shown in Table 6 .

DISCUSSION Results of the rDNA and mtDNA RFLP analyses indicate the varying levels of' molecular diversity within and between C . acutatum, C . gloeosporioides and C . fragariae . C . acutatum isolates from various hosts revealed heterogenity in rDNA . with European and American strawberry isolates falling into two different groups . C. fragariae had two distinct rDNA patterns indicative of genetic variation while the C. gloeosporioides isolates from strawberry were identical to each other . Different levels ofintra- and inter-specific variation have been reported in rDNA of fungi . For example, in Coprinus cinereus Schaeff Cke . Cke . [51] and Fusarium oxtsporum Schlecht . ex Fries, amend . Snyder & Hansen [27] very little or no variation was observed in the rDNA while polymorphisms were recorded in other fungi, e .g . C. gloeosporioides [4, 19], Aspergillus spp . [351 and Leptosphaeria maculam (Desm .) Ces . & deNot . [26] . Variation in the size of the rDNA repeat unit between C . gloeosporioides (8 . 7 kb) and C . fragariae (9 . 1-9 . 8 kb ; should be viewed in the context of the range 7 . 0-11 . 0 kb) reported for C. gloeosporioides from other hosts [4, 19, 29] . In C. gloeospo rio ides, polymorphisms in rDNA have been linked to host source [4] whereas polymorphisms in C. acutatum and Ce fragariae revealed little correlation to other criteria and appear to be the result of overall genetic divergence . As with rDNA, the C. gloeosporioides isolates from strawberry did not show any variation in mtDNA, whereas C . acutatum and C . fragariae revealed varying degrees of diversity . Intra-specific variation in mtDNA has been reported in various fungi [1/ . 31, 351 and insertions or deletions, base substitutions and presence or absence of optional introns, have been implicated [8, 44] . In C. acutatum, the magnitude of polymorphisms was greater in mtDNA five to seven groups of isolates) than in rDNA four groups) ; the rate of evolution of mtDNA is believed to be faster than the nuclear ribosomal DNA [44] . MtDNA polymorphisms F values, 36-100('-) reflected the genetic heterogeneity of the C. acutatum isolates, but, with the exception of European strawberry isolates, did not reveal any specific correlation with their host source or geographic location . The heterogeneity of C. acutatum within a country could he due to either rapid evolution of the species or introduction of isolates through exchange of plant material . We have used mtDNA from one isolate of each species as a probe for genomic digests, which detects polymorphisms and gives an approximate estimate depending on the level of homology) of the mitochondrial genome size . This approach enables more rapid analysis of a large number of isolates of a species than extraction of mtDNA from every isolate [6] or using mtDNA clones as probes [111 . Recently, RAPD analysis using single primers of arbitrary nucleotide sequences has been shown to detect polymorphisms in DNA from various sources ; both single-copy



DNA sequence variation and interrelationships 277 and low- to high-copy elements are amplified [9, 49] . In this investigation, RAPD analysis proved reliable in detecting molecular variation in C . acutatum and C . fragariae . RAPD grouping of the various isolates was similar to the mtDNA RFLP grouping, with the exception of C . acutatum isolates 287 and PD 90/443 which revealed additional polymorphisms . In Ce fragariae group 2 isolates and C . gloeosporioides one major fragment of approx . 950 by was amplified by primer B6 indicating their relatedness as observed in the mtDNA RFLP analysis . Extensive variation was recorded in 40 C. gloeosporioides isolates from different hosts which were clustered into several groups by RAPI) analysis with six random primers including B6 (P . R . Mills, unpublished), . Bonde et al . [2], based on isozyme comparisons . suggested that C.e f agariae and C. gloeosporioides are distinct species and that C . gloeosporioides is more closely related to C . acutatum than to C . fragariae . This is contrary to the recognition of C . acutatrmr as a species distinct from the closely related C . gloeosporioides and C . fragariae [42, 43] . DNA analyses are expected to reflect the genetic composition of a species more accurately than protein analyses [12] and RFLPs have been shown to be useful in investigating phylogenetic relationships [33] . In the present study, RFLP analyses of the rDNA and mtDNA indicated the relatedness of C . fragariae group 1 and group 2 isolates to C. gloeosporioides . RAPD analysis also suggested the relatedness of C . fragariae group 2 isolates and C . gloeosporioides . Heterologous probing of C . gloeosporioides isolates with C. fragariae mtDNA and i'ice versa also highlighted the close relationship between these species, whereas C . acutatum mtDNA had low homology to C . gloeosporioides and Ce fragariae mtDNA . Considerable variability was observed in the mtDNA of C . gloeosporioides isolates from various hosts, with F values ranging from 0-50",, within groups of isolates from one host [3, 19] and also in C . acutatum isolates in this study . Similarly, significant intra-specific variation was reported in the mtDNA of Phvtophthora capoci ( Lconian Tsao and Alizadeh (0 . 6-i •0 genetic similarity = h' values . 60-100" ( ,), P . citricola F values, < 50-1000 ) and Laccaria bicolor (Maire) Ort . F values, 0-100",, [11, 14] . Jacobson and Gordon [24] reported variation in mtDNA (Fvalues . 48-100°„) within F. oxysporum f. sp . melonis (Leach & Currence) Snvd . & Hans . In view of the above reports on intra- and inter-specific heterogeneity, the low level of similarity observed in the mtDNA restriction patterns between Ce fragariae and C . gloeosporioides could he interpreted in the context of the extreme variation known to exist in C. gloeosporioides [19] rather than as species delimiting . Functionally and evolutionarily conserved rRNA genes reveal an interspersion of highly-, semi- and non-conserved regions [38] and various workers have sequenced the conserved regions to infer broad phylogenetic relationships [12, 23] . To compare closely related forms, the non-conserved regions displaying a high rate of drift may be more suitable [23] . Sequencing of the variable ITS1 region of the rDNA repeat unit served as a useful measure of the degree of variation in C . acutatum, C . gloeosporioides and C . fragariae, and their inter-relationships . The phylogenetic tree based on sequence alignment appears to reflect the molecular divergence of the various isolates in relation to other criteria better than either RFLP or RAPD analyses . For example, of the six C . acutatum isolates from the Netherlands, the two strawberry isolates were grouped together, while the other isolates from diverse hosts fell into a cluster with PD 90/443 (Fig . 51, an isolate with reddish pink colony morphology, as a variant . Of the isolates



278

S . Sreenivasaprasad et al. < F card-lA I63-I

'91 314 406

2$! 2 54 311 31 ;

N119(1 PD88/566 PD88/858 302a 47 1(173 397 561 PD89/582 PD 881673 PD (5/694 _ PD9O/443 Ft(; . 5 . Phvlo,genetic tree of C. suutatimr, C. gloeosporioides and Ce fragariae isolates based on the I'lSI sequence of the rDNA repeat unit . For °„ homology between isolates, see Table 6 .j

acquired from within the U .K ., the strawberry isolate N190 showed 100" 0 homology to the strawberry isolates 'PD 88/566 and PD 88/858) from the Netherlands, while isolates 302a and 473 from other hosts seemed to he closely related (99 0 , homology) to the strawberry isolates from the U .S .A . These observations indicate that C. acutatum isolates may he recent introductions into the U .K . probably on imported plant material . The distance matrix value, which reflects the divergence (distance matrix x 100) in the ITS! sequence, was identical '0 . 0181 between the Ce fragariae groups 1 and 2, and the Ce fiagariae group 2 and C. gloeosporioides . The distance between C. fagariae group I and C gloeosporioidess was 0 . 035 . This falls well within the distance matrix value of 0 . 05 finmd between isolates of C . gloeosporioides from other hosts [34] . A similar level of internal divergence '0 . 0561 was also observed among C . acutatum isolates . Intra- and inter-specific divergence of 2-5 1 has previously been reported in Fusarium and Laccaria spp . [14, 15 J but the divergence values generated in the present study are from a highly variable region . To establish a species delimiting divergence threshold the extent of' intra-specific variation within a genus and the validity of species assignment based on morphotaxonomv need to he taken into account [15 J . From the greater distance matrix



DNA sequence variation and interrelationships

279

values between C . acutatum and C. gloeosporioides (0 . 137-0 . 156) and C . acutatum and C . (0 . 144-0 . 160) it is evident that C . acutatum is a distinct species genetically well separated (approx . 14-16 % divergence) from C . gloeosporioides and C. fragariae . This is in agreement with morphotaxonomic observations [42, 43] . Of the three techniques used in this study we believe that analysis of DNA sequence data provides the most reliable means for assessing intra and interspecific variation among fungi . Results reported here confirmed the close molecular relationship of the morphologically indistinguishable C . gloeosporioides and Ce fragariae isolates which appears to be analogous to the existence of genetically distinct C . gloeosporioides Types A and B infecting Stylosanthes s pp . in Australia [34] . In view of the extensive phenotypic and genotypic variation now known to occur in C . gloeosporioides, it may be suggested that the isolates described as C . fragariae would fit within the group species concept of C .

fragariae

gloeosporioides .

The authors thank Drs I . Barker and R . Cook (MAFF, Harpenden), Dr M . E . Noordeloos (Wageningen), Professor C . Howard and A . J . Whidden (U .S .A .) and Dr R . Beever (New Zealand) for fungal material and A . D . K . McReynolds and R . D . McCall for technical assistance . S . S . P . thanks the Governments of India and the U .K . for the award of the Nehru Centenary British Post-Doctoral Fellowship administered by The British Council . REFERENCES 1 . Anon . 1987 . Plant Health Order (Gt Britain) . 2 . Bonde MR, Peterson GL, Maas JL . 1991 . Isozyme comparisons for identification of Colletotrichum species pathogenic to strawberry . Phytopathology 81 : 1523-1528 . 3 . Braithwaite KS, Irwin JAG, Manners JM . 1990 . Restriction fragment length polymorphisms in Colletotrichum gloeosporioides infecting Stylosanthes s pp . in Australia . Mycological Research 94 : 1129-1137 . 4 . Braithwaite KS, Irwin JAG, Manners JM . 1990 . Ribosomal DNA as a molecular taxonomic marker for the group species Colletotrichum gloeosporioides . Australian Systematic Botany 3 : 733-738 . 5 . Brooks AN . 1931 . Anthracnose of strawberry caused by Colletotrichum fragariae, N . Sp . Phytopathology, 21 : 739-744. 6 . Carter DA, Archer SA, Buck KW, Shaw DS, Shattock RC . 1990 . Restriction fragment length polymorphisms of mitochondrial DNA of Phytophthora infestans . Mycological Research 94 : 1123-1128 . 7 . Cook RTA, Popple SC . 1984 . Strawberry black spot caused by Colletotrichum sp . (Abstract) . Agricultural Division Advisory Service Plant Pathology Technical Conference, Harrogate, England . 8 . Croft JH. 1987 . Genetic variation and evolution in Aspergillus . In : Rayner ADM, Brasier CM, Moore DD, eds . Evolutionary Biology of the Fungi . (Symposium of the British Mycological Society 1986), Cambridge : Cambridge University Press, 311-323 . 9 . Crowhurst RN, Hawthorne BT, Rikkerink EHA, Templeton MD . 1991 . Differentiation of Fusarium solani f. sp . cucurbitae races I and 2 by random amplification of polymorphic DNA . Current Genetics 20 : 391-396. 10 . Feng D-F, Doolittle RF . 1987 . Progressive sequence alignment as a prerequisite to correct phylogenetic trees . Journal of Molecular Evolution 25 : 351--360 . 11 . Förster H, Oudemans P, Coffey MD . 1990 . Mitochondrial and nuclear DNA diversity within six species of Phytophthora . Experimental Mycology 14 : 18-31 . 12 . Förster H, Coffey MD, Elwood H, Sogin ML. 1990. Sequence analysis of the small subunit ribosomal RNAs of three zoosporic fungi and implications for fungal evolution . Mycologia 82 : 306-312 . 13 . Garber, RC, Yoder OC . 1983 . Isolation of DNA from filamentous fungi and separation into nuclear, mitochondrial, ribosomal and plasmid components . Analytical Biochemistry 135 : 416-422. 14 . Gardes M, Mueller GM, Fortin JA, Kropp BR. 1991 . Mitochondrial DNA polymorphisms in Laccaria bicolor, L. laccata, L . proxima and L . amethystina . Mycological Research 95 : 206-216 . 15 . Guadet J, Julien J, Lafay JF, Brygoo Y . 1989 . Phylogeny of some Fusarium species, as determined by large-suhunit rRNA sequence comparison . Molecular Biology Evolution 6 : 227-242 .



280

S . Sreenivasaprasad et al. lli . Gyllensten UB, Erlich HA . 1988 . Generation of single-stranded DNA by the pilymcrasc chain reaction and its application to direct sequcucing of the /11 .1-D ),1 locus . Proceedings of ,A3ttional Acrtdemr of Si ientes of the Z' . .S' . .1 . 85 : 7652 7656 . 17 . Harris D . 1992 . A matter of good breeding . The Gtozser March 5 : 27-33 . 18 . Higgins DG, Bleasby AJ, Fuchs R . 1992 . CLUSTAL V : improved softesare for multiple sequence alignment . CABIOS 8 : 189- 191 . 19 . Hodson A, Mills PR, Brown AE . 1992 . Ribosomal and mitochondrial DNA pol morphisms in Colletotrichton gloeosporioides isolated from tropical fruits . .fItcological Research in press) . 20 . Howard CM, Albregts EE . 1983 . Black leaf spot phase of strawberry anthracnose caused by Colletotrichunt gloeosporioides C. fiagariaei . Plant Disease 67 : 1144-1146 . 21 . Howard CM, Albregts EE . 1984 . Anthracnose of strawberry fruit caused by Glonterella cirtgulata in Florida . Plant Disease 68 : 824-825 . 22 . Hultman T, Stahl S, Hornes E, Uhlén M . 1989 . Direct solid phase sequencing of genomic and plasmid DNA using magnetic beads as solid support . ,.Vueleir Acids Research 17 : 4937-4946 . 23 . Illingworth CA, Andrews JH, Bibeau C, Sogin ML . 1991 . Phylogenetic placement of Athelia botnbacitta, .-l ureobasidiom pullulans and C.blletotrichum gloeosporioides inferred from sequence comparisons of' small-subunit ribosomal RNAs . Fspenntental lvcology 15 : 65 75 . 24. Jacobson DJ, Gordon TR . 1990 . Variabilite of mitochondrial DNA as an indicator of relationships between populations of Fusatiurn oxysporunt f. sp . tnelonis. Mycological Research 94 : 734-744 . 25 . Jeffries P, Dodd JC, Jeger MJ, Plumbley RA . 1990 . The biology and control of Colletotrirhunt species on tropical fruit crops . Plant Pathology 39 : 343--366 . 26 . Johnson RD, Lewis BG . 1990 . DNA poly morphisms in Leptosphaeria maculant . Ph_vsiologiral and,flolecular Plant Pathology 37 : 417 424 . 27 . Kistler HC, Bosland PW, Benny V, Leong S, Williams PH . 1987 . Relatedness of strains of Fusariunt ory.sporum from crucifers measured by examination ofmitochondrial and ribosomal DNA . Phytopathologr 71 : 1289--1293 . 28 . Lenné, JM. 1977 . A study of the biology and taxonomy of the genus Colletotrichum . Ph .D . thesis, University of Melbourne, Australia . 234 pp . 29 . Liyanage HD, McMillan Jr RT, Kistler HC . 1991 . Ribosomal DNA irDNAI polymorphisms in Colletoto('hum ,loeosporioides isolates causing post bloom fruit drop of citrus . t Abstract) Phytopathologv 81 : 1161 . 30 . Maas JL, Howard CM . 1985 . Variation of several anthracnose fungi in virulence to strawberr and apple . Plant Disease 69 : 164-166 . 31 . Martin FN, Kistler HC . 1990 . Species-specific banding patterns of restriction endonuclease-digested mitochondrial DNA from the genus Pythium . Experimental Mycology 14 : 32-46 . 32 . Masel A, Braithwaite K, Irwin JAG, Manners JM . 1990 . Highly variable molecular karyotypee in the plant pathogen Colletotrichum gloeosporioides . Current Genetics 18 : 81-86 . 33 . Michelmore RW, Hulbert SH. 1987 . Molecular markers for genetic analysis of phytopathogenic fungi . Annual Reviere' of Phvtopathology . 25 : 383 404. 34 . Mills PR, Hodson A, Brown AE . 1992 . Molecular differentiation of Collelotrichmn gloeosporioides isolates infecting tropical fruits . In : Bailey JA, Jeger MJ, eds . Colletotrichum Biology, Pathology and Control, VV'allingford : CAB International, 269-288 . 35 . Moody SF, Taylor BM . 1990. Restriction enzyme analysis ofmitochondrial DNA of the Aspergillusflatus group : ,1 . flatus, .1 . parasiticus and .1 . nomias . Applied and Environmental Microbiology 56 : 2441 2452 . 36 . Nei M, Li WH . 1979 . Mathematical model for studying genetic variation in terms of restriction endonucleases . Proceedings of .Vâtional Academy of Sciences of the I".S.A . 76 : 5269-5273 . 37 . Nei M, Tajima F . 1983 . Maximum likelihood estimation of the number of nucleotide substitutions from restriction sites data. Genetics 105 : 207-217 . 38 . Olsen GJ, Lane DJ, Giovannoni SJ, Pace NR. 1986 . Microbial ecology and evolution : a ribosomal RNA approach . Annual Review' of Microbiology 40 : 337 365 . 39 . Raeder U, Broda P . 1985 . Rapid preparation of DNA from filamentous fungi . Letters in Applied .tlicrobiologr 1 : 17 20 . 40 . Sambrook J, Fritsch EF, Maniatis T . 1989 . _tlolecular Clotting : A Laboratory Manual, 2nd edn . New York : Cold Spring Harbor Laboratory . 41 . Sanger FS, Nicklen S, Coulson AR . 1977 . DNA sequencing with chain-terminating inhibitors . Proceedings of ..V âtional Academy of Sciences of the U.S.A . 74 : 5463-5467 . 42 . Smith BJ, Black LL . 1990 . Morphological, cultural and pathogenic variation among Colletotrichum species isolated from strawberry . Plant Disease 74 : 69- 76 . 43 . Sutton BC . 1992 . The genus Glotnerella and its anamorph Colletntrichum . In : Bailey JA, Jeger MJ, eds . Coltetotrirlutnr -- Biology, Pathology and Control, Wallingford : CAB International, 1 26 .



DNA sequence variation and interrelationships

281

44 . Taylor JW. 1986 . Fungal evolutionary biology and mitochondrial DNA . Experimental .llrro/q,r 10 : 259-269 . 45 . Verbeet MP, Klootwijk J, Heerikhuizen H, Fontijn R, Vreugdenhil E, Planta RJ . 1983 . Molecular cloning of the rDNA of Saccharomyce .t rosei and comparison of its transcription initiation region with that of Saccharomyces carlsbergensis . Gene 23 :53 63 . 46 . Von Arx JA. 1970 . A revision of the fungi classified as Gloeospainm . Bib/iotheen tltrologira 24 : I 203 . 47 . Walker J, Nikandrow A, Millar GD . 1991 . Species of Co/letotrichum on Xanthian+ Astcraceac' kith comments on some taxonomic and nomenclatural problems in (:olletotehloon . 1/yeo/o,irn/ Reseorc/r 95 : 1175--1193 . 48 . White TJ, Bruns T, Lee S, Taylor J . 1990 . Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics . In : Innis MA, Gelfand DH, Sninsks JJ, White fJ, cds . PCR Protocol, . .1 Guide to Methods and Applications . San Diego : Academic Press. 315 -322 . 49 . Williams JGK, Kubelik AR, Livak KJ, Rafalski JA, Tingey SV . 1990 . DNA pol nsorphi,vm amplified by arbitrary primers are useful as genetic markers . . A'ucleu .leid, Research 18 : 6531 6535 . 50 . Wilson LL, Madden LV, Ellis MA . 1990 . Influence of temperature and v,,mess duration oil infection of immature and mature strawberry fruit by Colletoteirhum aratahun . Pbetopathologr 80 : 111 116 . 51 . Wu MMJ, Rhodes-Cassidy J, Pukkila PJ . 1983 . Polymorpltisrns in DNA of Coprinu, cinereus . Canvnt Genetics 7 : 385-392 .