DNase I footprinting of cis- or trans-Diamminedichloroplatinum(II)-modified DNA

DNase I Footprinting of cis- or transDiamminedichloroplatinum(II)-modified DNA A. Schwartz and M. Leng

I)Sase I has been used as an enzymatic prohe to visualize the conformational alteration induced in DS.4 by the binding of either the antitumor drug cis-platinum (cis-f>DP) or the therapeutically inactive derivatives, trot?+platinum (fmnx-DDP) and chlorodiethylenetriamine~~latinum(IT) (dien-Pt). M’e have constructed double-stranded oligonucleotides (:i%-mer) conta’ining a single aclduct either at t.he d(M) site (cis-f)DP intrastrand cross-link) or at the d(CX’/CX’) site (ris-DDP interstrand cross-link) or at the d(G/C’) site (trrcns-Df)P interstrand cross-link) or at the d(G) site ([lien-Pt aclduct). The platinated oligonucleotides ark differently recognized h? DBase I. As judged by DBase 1. the distortions induced in the 1)X;\ double helix hy the rts-DDP and trans-I)DP interst,rand cross-links spread over more base-pairs than that induced by the cis-f)DP intrastrancl cross-link. Kvyw0rd.s:

oligonucleotides:

platinum(I1)

tlic~l~lolo~~latinui~~(TI): t~ia~n~iii~~r-~~l~~tillum(TI).

dirri-Pt.

DSase

I

Initially. our purpose was to gain further insight into the distortions indurecl in DNA by the interstrand cross-links by means of DNa.se I. The interstrand cross-links are preferentially formed between two G residues on the opposite strands at the d(CX”/CK’) sites (Hopkins et nf., 1991; Lemaire et al.. 1991) and they bend the double helix by approximately 5.5” towards the major groove (Sip et al.. 1992). DBase I has been already used as an enzymatic probe to visualize the size of the DN4 structure alteration induced by a single adduct (Hurley ef al.. 19x7: Visse et al.. 1991: \‘eaute & Fuchs, 1991). In this communication. we show that the DNase I cleavage patterns of an oligonucleotide, bearing or not a ris-DDP interstrand cross-link, are very different. To complete this work, we compare these cleavage patterns t,o those relative to oligonucleotides bearing either a single tmlls-DDP-interstrand cross-link or a single monofunctional dien-Ptaclduct (frnns-dian~minedichloroplatinum(II), transDDP. and chlorodiet~y~enetriamineplatinum(IT)chloricle, clien-Pt. are chnically ineffective) or a single ris-DDP-intrastrand cross-link which is the major adduct formed in the in ZGOO and in vitro reaction between ris-DDP and DNA (Lepre & Lippard, 1990). The double-stranded oligonucleotides (52-mer) bearing a single adduct were prepared according to the scheme shown in Figure 1. The starting products were two pyrimidine-rich oligonucleotides (22-mer) differing by one base in their sequences. One had the d(GG) doublet in the centre of its sequence and the

Numerous studies suggest that the ceytotosic action of the antitumoral drug ris-cliamminedi~hlorol)latinum(TT) (ris-l)l)Pt) 1~ ‘. related to its ability to reac*t with c*ellular 1)X.4. Lesions produced in l)KA have heen mainly characterized as hifunrtional adducts including intrastrand and interstrand crosslinks (for general reviews, see Lepre B Lippard. 1990: Roberts of r/l.. 1988). It is not yet established whic*h lesions are responsible for the antitumoi activity of ris-f)l)P. Although the interstrand WOSSlinks make UfJ only 5 to f O”, of al1 adducts (Hansson 8 \\‘ootl. 1989: Jones et al., I991 : C’alsou pt [cl.. 1992). correlation between the cis-Df)P cyt,otoxicity and interstrand cross-links has been reported (Roberts pf cl/.. 1988). Recently. it was shown that after ris-DI)P treat.ment. several genes in the cells resistant to this drug and l~arental’c~ells had similar initial eontents of intrastrand and interstrand cross-links (Zhen rf rl.1.. 1992). However, the interstrand cross-links were removed more effciently in the resistant than in the parental cell lilies. These result,s suggest that acquired cellular resistance to ris-I)l)P is associated with an increased DX.4 repair efficiency of the interstrand cross-links are cross-links. /IL rGt,o, interstrand elongation blocbks for prokaryotic and strong eukaryotica R.NA polymerases ((!orda ef rri.. 1993). t Ahhreviations usetl: ris-I)I)P. tli~hloro~~lati~~~~~~~(II): Irnns-I)I)P.

compleses:

cis-rliammineImn.s-tliammine

~l~lo~otlirtli~l~t~~-

969 0

1994 Academic-

Press

Limited

(‘ovnnlu,1icntio,ls

970

JdienPt

icis-DDP . .G’G’.

ltrans-DDP

. .G’C..

.

J..CC ..G'G'.. ..cc

..GC..

..Gc..

* .GG..

. .

. .G’C..

l..CG..

l..CG..

. .G’C.. ..CG..

. .

bifunctional adduct

monofunctional adduct (d)

tic)

. .G’C.. l..CG..

. .G’C.. . .C’G..

..G*C . . . .C G’. .

interstrand cross-link

interstrand cross-link

(It)

(1,)

C

TCCTTCCTTCTTGGTTCTTCTC AGGAAGAACCAAGAAGAGCTTC G +

+

EcoRI

Bind111

CGTGCTGAATTCGTG CACGACTTAAGCACAGGA

GAAGGAAGCTTAGCG CTTCGAATCGCT

C CGTGCTGAATTCGTGTCCTTCCTTCTTGGTTCTTCTCGAAGGAAGCTTAGCG CACGACTTAAGCACAGGAAGGAAGAACCAAGAAGAGCTTCCTTCGAATCGCT G Figure 1. Scheme of the s@hesis of t.he platinated oli~[onIl~lrotitl~s hearing a single atltluc~t. Thr sin+strantlrtl oligonucleotides d(TCC’TTCCTTCTTGG(C)TT~‘TT<‘T~‘) MW~ reacted with thv platinum derivatives and then bybritlizrtl with their complement.ary strands. The double-stranded oliyonucleotidrs containing a single intraor interstrand adduct were ligated with T4 DIVA ligase successiveI); with the dolrl)lr-strande~l olipontrc~lrotitlr containing thr Ili~~tlTII or /GoI< I binding sites. respectively. The oligonucleotldes were purified by gel electrophorrsis (l?O,, (w/v) l)ol?ac~r~larliitlc~ untlr~~ denaturing conditions). After purification. they were submitted to a heating-reannralinC q&. (i,) for the ci.+DDP intrastrand cross-link at the d(G(:) site. (I,) and (I,) for the cis-l)l)l’ cross-links at the d(GC!/W) and d(G/C’) SI -‘t es. (d) for the ~hlorodieth~le~~e~riarnir~el)lati~~~~~~~(TT)

other had the d(GC) doublet (upper strands. Figure 1). The reaction of platination to form the cis-DDP-intrastrand cross-link (i,) at the d(W) site. the cis-DDP-interstrand cross-link (I,) at the d(G(‘/ GC) site, the truns-DDP-interstrand cross-link (I,) at the d(G/C) site (tmns-DDP cross-links complementary G and C residues: Urabec & Leng. 1993) and the monofunctional diethylenetriamineplatinum(1~) adduct (d) at the d(G) site was done as previousl> described

(Marrot

&

Brabec & Leng, 1993). 5’ ends, the plat,inated tides

were

mixed

with

Leng,

1989;

Sip

ef

nl.,

1992:

After phosphorylation at the double-stranded oligonucleothe

double-stranded

oligo-

nucleotide containing the Ili?tdTIT binding site (the upper strand being phosphorylatecl at the 5’ end) and ligated in conditions as described by Visse rt nl. (1991). The same procedure was used to ligate the double-stranded oligonucleotide containing the EcoRI binding site (the lower strand being phosphorylated at the 5’ end). The samples were purified by gel electrophoresis under denaturing conditions. They were “P-end labellecl at the 5’ ends. restricted

with

The adducts or Irrc~~I)I)l’

arr narwtl interstrand

atltluc-t at the (I((:) site.

either EcoRT or IfiutlTTT nucleases and purifietl gel electrophoresis under native conditions. The unmoditied oligonucleotides and the oligonucleotides hearing a single atltluct were suhjectetl to a mild digestion with I)Nase I. The hydrolysis products were incubated in 0.2 11 Sa(‘S (basic pH). overnight and at 45°C’ to remove the hound platinum (Bauer PI rtl.. 1978: Schwartz rl nl., 1990) antl then analysetl hy electrophoresis on seclucncing gels. In the unmodified oligonucleotides (Figure 2. lanes T). DSase I cuts at every internllcleotitl(, bond with varying efficiencies (Travers. 1989). The adducts affect the I)Sasr I patterns to different extents (Figure 2). In order to visualize the intrinsic print of the adducts. the intensities of all the cleavage products were measured hy scanning densitomet ry. C\‘e normalized the different tracks hy taking into account the intensities of the hands located at more than 1% residues from the adducts. AS compared to the unplatinated sample (Figure 3). in the upper strand. the main effect of the mononofunc,tional diethylenetriamineplatinum hy

C’wmmunications

upper T

i,

971

strand d I,

lower I,

T

T

i,

strand d I,

I,

T 3’

G 3

C C

5

:: G A A C G A A G A A G A G C T

f 5’ Figure 2. I)l\;ase I footprinting of the platinated and unplatinated oligonurleotides. The double-stranded oligonu~leotitles (B np) \vitb a .i’-labelled upper strand (left) or lower strand (right) were subjected to limited DBase I digestion in .iO ~1 buffer wntaining “0 mXI Hepes (pH 8). I00 m&I KU. 7 mM MgU,, I.-S mRI CaCI,. @I mM EDTA, 0.1 mg/ml BSr\. 2 pg sonicated calf thymus DK;A and 0.1 unit DSase I (Boehringer). Similar results were obtained with 0.06 or (b:! unit DBase I. The digestions were carried out for 3 min at 20°C’. The reactions were stopped by addition of 5 mbl E(iT.4. The samples were incubated in W:! \I, SaCN (basic pH). DX’X was precipitated with ethanol-sodium acetate and loaded on to I Zoo denaturing polyacrylamide gel. i\utoradiograms of the gels were scanned on a Camag rniclotlensitolnetrr. Masam and Gilbert sequencing reactions were run in parallel (not shown). adduct (d) is to inhibit the DBase I cutting over three residues. on both sides of (d). In the lower strand. the cutt,ing site at the c’ residue cotnplementsry to the platinated C residue is strongI> ink‘ihited. The cis-DDP intrastrand woss-link (i,) alters the 1)Sase I cleavage pattern over five base-pairs. In the upper strand. the I)Sase I cutting is strongly inhibited at the two nucleotide residues adjacent to (i,j on its 5’ side uhile it is enhanced at t.he nucleotide resitluw acljacent to (i,) on its 3’ side. In the lower strand. a new DBase I-sensitive sit,e appears at the C’ residue complimentary t,o the platinated 5’ G. It is worth pointing out that these results and those reported hy Visse et ~1. (1991) are in good agreement. although in the two oligonuc4eot8ides. the bases in the vicinity of the adducts are different. The cis-DDP interstrand cross-link (I,) and the Imns-I)DP interstrand cross-link (I,) induce large changes in the DNase 1 cleavage patterns. The

changes are not the same. However, they have in common the disappearance of several strong DBase I-sensitive sites. They have also in common the appearance of an enhanced cleavage site, in the lower strand. at the fifth residue (A) on the 3’ side of the addurt. Anot,her enhanced cleavage site is observecl at the fifth residue (T) on the 3’side of (I,), but not of (I,), in the upper strand. The binding of t.he platinum derivatives to DNA modifies the accessibility, the local electrostatic pot,ential (the adducts bear two posit,ive charges) and the geometry of t#he double helix (for general reviews, see Reedijk, 1987; Kozelka & Chottard, 1990: Lepre & Lippard, 1990). In agreement with other techniques, chemical probes indicat,e that t’he distort,ions induced in the DIVA double helix by the (d), (i,). (I,) and (I,) addurt,s are mainly located at the level of the adducts, spreading no further than 1-Z base-pairs on one side or both sides of the adducts (Marrot & Leng, 1989; Sip et al., 1992;

..

. ..AGGAAGGAAGAACCAAGAAGAGCTT...

--.AGGAAGGA.AGAACGAAGMGAGCTT---

(4.l

-**TCCTTCCTTCTTGCTTCTTCTCGAA*."'AGGAAGGAAGAACGAAGAAGAGCTT--0

..-TCCTTCCTTCTTGCTTCTTCTCGAA-0. "'AGGAAGGAAGAACGAAGAAGAGCTT--a]~=-"]

Ll~~~-pyJJ-~~m (4 Figure

(1,) 3.

Quantitative

representation

autoradiograms were scanned and thp represented by bars. The white bars DBase I cleavage of the upper strands

of

DSase

I

cleavage

bands intensity normalizrd are for the unplatinated and lower strands are

Brabec ef a,l., 1992. 1993). The three (I,). (I,) and (i,) adducts but not t.he (d) adduct hend the douf~lr helix towards the major groove but the hending angles are different (see Table 1). The three a.dducts unwind the double helix t.o various extents (Table I). Several studies (Tulfius, 1989: Sigman, 1990: Befguise-Valfadier & Fuchs, 1991) suggested that the larger size of the distortion of the douf~le helix sensed by DBase I as compared to rhemical f)rof,es might be due to the size of the prolIes themselves. Crystallographic structure of f)Xase T-DNA complex revealed that an exposed loof) of the fjrotein penetrates into the I)I\;A minor groove ant1

Bending a,nd mwindiny

for

fJun.Y-DDP dicn-Pt

(i,) d(G*G*/C(‘) (I,) d(G*(‘/G*C) (I,) (I((:*/(‘*) (d) d(G*/(‘)

unplatinated

Table 1 of DNA by platinum

3” o-3.) 3 5.5 ‘a “6 ’ 0’

and

))latinatrtl

sam))lrs.

The

interacts asymmetrically with the l~ac~kl~onr of I)oth strands. f)r;‘ase I contacts two f)hosf)hate groups 011 each side of the cleavetf bond and two fhosphate groufls on the other strand across the minor groove (Suck & Oefner. 19%: Suck pt nl.. IWH). Assuming that these contacsts are needed for f)rotic*ient in& sion. some comments c&an be matfe on the results presented in Figure 3 (such an apflroach (Fwirall 8 R,hocfes, 1992) has been usecl into the analysis of DBase I footprinting of TFTIIA/5 S 11X.4 c~omples). In the upper strand. over one to three base-pairs on each side of the monofunc,tionaI adduct ((I). several DKase I-sensitive sites disaf,f)ear which suggests that the distortion of the double helix is mainI>

Bent

ri.9.DDP

the

as described in the test. The normalized intensities are sam)&++ and the dark bars for the I)latinatetl sam~)lrs. sho\vn above ’ and h&\\ the StY,“~Il”t5.

adducts

1Tnwinding I3 ” 70 <’ I”” (i o

(I. 2) (3. 4) 1i! 7)

973

(‘omm~unications

located at the level of the adduct. The distortion induced hy the interstrancl cross-link (I,) extends over 2-3 base-pairs in both directions from (I,) as judged hg the strong inhibition of DBase I cleavage near the atlcluct and by the enhanced cleavage occqlrring at the fifth residues cm the 3’ side of (1,) in the lower and upper strands. The size of the distortion is larger than the one deduced from chemical prohrs. The distortion induced hy the interstrand cross-link (I,) spreads over one and 2-3 base-pairs on the right and the left sides of (It). respectively. Finally. the clistortion induced hy the intrastrancl cross-iink (i,) is mainly located at the level of the adduet. InterestingIT. two DXase I-sensitive sites appear on opposite sides of the minor groove. at the level of the adduct, This might he a consequence of the bend in DSA as previously proposed (Visse el nl.. 1S91). Although the (I,) and (I,) adducts hencl the clouhle helix. no such new sensitive sites are detected which underlines the importance of the hendahility and the minor groove width of DXA in determining the DBase T efficiency (Suck et nl.. lSX8). In conclusion. the present study shows that the platinum adducts which induce specific local conformational changes in DXA are differently recognized hv DSase I. These results and the recent discover! 0; proteins in mammalian cellular est,racts capable of recognizing sperifically cis-f)DP adclu& at the d((X:) and d(AG) sites ((‘hu & (‘hang, 1988: Toney et nl.. 1989: (‘ha0 ef al.. 1991; Hughes ef al.. 1992: Pil & Lipparcl. 1992) incites the search of prot.eins interacting specifically with the platinum adclucts. This is likely to he important for understanding of the antitumour ac+tivity of cis-DDP or. at least. for understanding of the recognition and processing of the platinum adducts hy the cellular machinery. \!‘e are indebted to I)r hl. Decoville. ,J. M. Malinge and A. R. Rahmouni for helpful discussions. This work was supported in part by la Ligur contre le C’ancer. la Fondation pour la Rrchrrche Xclicale and the E.E.C’. contract (C’HRS-(‘T9”-o016).

References Bawr. \\‘.. (ionias. S. I,.. Ksm. S. K.. \Z’u. K. C’. & Lippard. 8. .I. (1978). Binding of the antitumor drug platinum uracil blue to closed and nicked circular duplex DSAs. Bioche,&~ry. 17. 106&1068. Bellon. S. F.. C’olrman, .J. H. 8: Lippard. S. J. (1991). DSA un\vincling procluced by site-specific intrastrand cross-links of the antitumor clrug cis-diammineclic~hloroJ)lati~~urn( II). Riochrmistry. 30. 8026-8035. I~rtgclise-\‘allaclier. I’. B Fuchs. R. I’. I’. (1991). Strong srquen~e-clepericlent pol~niorpbisni in adcluctinduced DSA analysis of single structure: S-“-acetvla,ninoflItlorelle resiclues bound within the Sfl I.1 r;lutation hot spot. Biochemistry. 30. IOOSI-10100. Brabec. V. & Leng, &I. (1993). DKA interstrand crosslinks of trans-dianiminec~ichloroplatinUm(II) are preferentially formecl between guanine and complementary cytosine residues. Proc. Nat. rlcad. Sci.. l’..S..-l 90. 5345-534s.

Brabec. V.. Reedijk, J. & Leng, &I. (1992). Sequence-dependent distortions induced in DNA by monofunctional platinum(H) binding. Biockemiutry, 31. l23Si-l24W. Braber. V.. Sip, M. & Leng. M. (1993). DKA conformational change produced by site-specific inter&and cross-link of Iran+diamminedichloroplatinum(II). Hiockemzlstry. 32. I 1676 I 168 I. (‘alsou. I’.. Frit. P. & Salles. B. (1992). Repair synthesis by human cell extracts in cisplatin-damaged DKA is preferentially determined by minor adducts. NW/. Acids

Res.

20.

6363-6368.

C’hao. C’. (‘.-K.. Huang, 8.-L. Lee, L.-Y & Lin-Chao. S. (1991). Identification of inducible damage-recognition proteins that are overexpressed in HeLa cells resistant to ci.y-diamminedichloroptatinum(I1). Hiochem.

J. 277.

875-878.

C’hu. G. & Chang. E. (1988). Xeroderma pigmentosum group E cells lack a nuclear factor that binds a damaged DSX. S’cience. 242. 564-567. (:orda. Y.. *Job. C.. Anin. $1. F.. Leng, M. & Job. D. (1993). Spectrum of DKA-platinum adduct recognition by procaryotic and eucaryotir DNA-dependent R,NA polymerases. Biochemistry. 32, 858’2-8588. Fairall. 1,. & Rhodes. 1). (1992). A new approach to the analysis of DSase I footprinting data and its apptication to the TFIIIA/SS DNA complex. .VacI. Acids Rex 18. 4527~731. Hansson, J. & Wood. R. D. (1989). Repair synthesis by human cell est,racts in DKA damaged by cis- and Iran.+diamminedichloroptatinum(I1). ,Vucl. Arids Res. 17. 8073-809 I. Hopkins. P. 13.. Millard. ,J. T.. Woo. ,J.. Weidner. M. F.. Kirchner. J. J.. Sigurdsson. S. T. & Raurher S. (1991). Sequence preferences of DKA interstrand cross-linking agents: importance of minimal DNA structural reorganisation in the rross-linking reactions of mechlorethamine. cisplatin, and mitomycin C’. Tetrahedron.

47.

%475-“489.

Hughes. E. S.. Engelsberg. 13. X. & Billings. P. c’. (1992). Purification of nurlear proteins t.hat bind to cisplatinclamagecl DSA. J. Biol. (‘hem. 267. 135”&13527. Hurley. L. H.. Seeclham-Vandevanter. D. R. & Lee. C.-S. (1987). Demonstration of the asymmetric effect. of (‘(‘-1065 on local DKA structure using a site-directed aclcluc*t in a ll7-base-pair fragment from M13mpl. Proc. .\‘nl. drnd. Sci.. l’.S.il. 84. 6412-6416. JO~PS. .J. c’.. Zehn. W.. Reecl. E.. Parker. R. J.. Sancar. A. & Bohr. \‘. A. (1991). Gene-specific formation and adducts and interrepait of cisplatin intrastrand strancl cross-links in chinese hamst,er ovary cells. ,J. Hiol. (‘hem. 266. 7101-7107. Keck. 11. \‘. & Lippard. S. ,J. (1992). Unwinding of supercoiled DXA by platinum-ethidium and related complexes. J. .-lmw. C’kenc. Sot. 114, 3386-3390. Kozelka. J. 8r C’hottard, ,J. c’. (1990). How does cisplatin alter DSA structure! A mote~utar mechanics study on clouble-stranded oligonucleotides. Biophys. Chem. 35. 165-178. Lemaire. $1. A.. Schwart,z. A.. Rahmouni. A. R. & Leng, ~1. (IS91 ). Interstrand cross-linkshare preferentially formed at the d(W) sites in the reaction between C~Sdiamminedic+hloroplatinum(II) and DNA. Prop. Naf. Acnd. Sci., Ir.S.A. 88. 1982-1985. S. J. (1990). Interaction of Lepre. c. A. & Lippard. plat,inum ant,itumor compounds with DNA. In Nucleic Acids and Molecular Biology (Eckstein, F. 6 Lilley, D. M. J.. eds). vol. 4, pp. 3-9, SpringerVerlag. Berlin.

C’ommzinicnfions

974

Msrrot, L. & Leng, M. (1989). Chemical probes of t,he conformation of DNA modified by cis-diamminedichloroplatinum(I1). Riochemistry, 28. l-&G1461. Pil, P. M. & Lippard, S. J. (1993). Specific binding of chromosomal protein HMGI to DKA damaged by t,he anticancer drug cisplatin. Scien.ce. 256. 234-237. Reedijk, J. (1987). The mechanism of action of platinum anti-tumor drugs. Pure & dppl. Chem. 59. 181-19”. Rice, J. A.. Crothers. D. M.. Pinto. A. L. & Lippard. S. J. (1988). The major adduct of the antitumor drug cisdiamminedichloroplatinum(I1) with DKA bends the duplex by zz 40°C’ toward the major groove. I’ror. N&. Acad. Sci., cT.S.A. 85. 41583161. Roberts. J. J.. Knox. R: J., Pera. M. F.. Friedlos. F. 8: Lullal, P. A. (1988). The role of plat.inum-DSA interactions in the cellular toxicity and ami-tumour effects of platinum co-ordination co~~~pou~~ls. In Platinum and Other Melal f’oordination Cornpounds in Ca.ncer Chencolherupy (Kicolini. M.. ed.). pp. 16-31. Kijhoff. Boston. Schwartz. A., Sip, M. 8: Leng. M. (1990). Sodium cyanide: a chemical probe of the conformation of DR’A modified by the antitumor drug cis-diamminedirhloroplatinum(D). J. Amer. Chem. Sot. 112. 3673-31374. Sigman. D. S. (1990). Chemical nucleases. Hiochenrisfry. 29, 9097-9105. Sip, M., Schwartz. A.. Vovelle. F.. Ptak. M. & Leng. 11. (1992). Distortions induced in DKA by cizr-platinum interstrand adducts. Biochemistry. 31. 25OS2513. Suck. D. & Oefner. C. (1986). Crystallographic relinemrnt

(Received

1.5 October

1993;

and structure of DKAse I at B A resolution. ./. ~Mol. Biol. 192. 605-63”. Suck. I).. Lahm. A. 8r Orfner. t’. (1988). Structure rrtinc~l to 4 .A of a nicked DSA octanuclrotitlr c~~mplrs \rith DBase I. Sn(sre (London). 332. 464468. Torwv. ,J. H.. Donahue. 13. A.. Kellett. P. .I.. liruhn. S. I,.. Kssigman. ,J. ,\I. 8; Lippard. S. ,J. (1989). Isolation of cDKAs encoding a human protein that bintls selcctively to DKA modified by the anticancer drug cisdiamn~inrdichlorol~latinur,~(TI). I’roc. Sal. .-Imrd. Sri.. 1 ‘.S..-l 86. 8328-833”. Travers. A. A. (1989). DIVA conformation and protein binding. Anna. Hrc. Hiorhrnr. 58. -I?i -LX?. Tullius. T. 1). (1989). E’hysical studies of protein-IjS.4 con~plrxrs by footprinting. .-Inn II. Ih~. Hiophys. Chwn. 18. ~Zl3-Z~i. Veautr. S. & Fuchs. R. I’. I’. (1991). I’ol~~no~~l~t~isIn in S-~-acrt~laminofluorene induced IIS. stru(*turc as revealed by DSase I footprinting. SW/. .-lcids Has. 19. 5603-5606. Vissr. R.. de Ruijter. M. Brou\vrr. .I.. Brandsma. .I. A. & van de Putt,r. I’. (I!191 ). l’vr escision reliair lirotrin cornpIes of Eschrrichifr m/i binds to the (~nvex side of a ~isl)lat.in-indu~~(l kink in the IJS.4. ./. Hiol. (‘hem. 266. 760976317. Zhen, \V.. Link, C. J.. O’Connor, I’., Reed. E.. E’arkrr. R.. Howell, S. B. & Bohr, V. A. (1992). Increased genespecific repair of risplatin interstrand cross-links in risplatin-resistant human ovarian cancer cell lines. Mol.

accepted

(‘ell

Biol.

12.

3689-3698.

14 Decev1be.r 1993)