GM-CSF effect on the myofibroblastic differentiation of human adipose derived stromal cells?

Experimental Cell Research xxx (xxxx) xxx–xxx

Contents lists available at ScienceDirect

Experimental Cell Research journal homepage: www.elsevier.com/locate/yexcr

Do IL-3/GM-CSF effect on the myofibroblastic differentiation of human adipose derived stromal cells? Jae-Sun Lee, Son-Seung Tae, Deok-Yeol Kim, Seung-Kyu Han, Woo-Kyung Kim, Eun⁎ Sang Dhong Department of Plastic Surgery, Korea University, Guro Hospital, Seoul, Republic of Korea

A R T I C L E I N F O

A BS T RAC T

Keywords: Stem cell Myofibroblast Interleukin-3 Granulocyte macrophage-colony stimulating factor

Background: Capsular contracture is an incurable complication after silicone-based implant surgery. Myofibroblast is the predominant cell in the contracted capsule. We hypothesized that human adipose derive stromal cells (hASCs) together with fibroblast may show a similar phenotypic characteristics of myofibroblast after the treatment of inflammatory cytokines in vitro. Materials and methods: Interleukin 3 (IL-3) and granulocyte macrophage colony stimulating factor (GM-CSF) were treated in the culture of hASCs and HDFs. Lyn peptide inhibitor was applied as an inhibitor. The changes of cell surface markers (CD105, CD73, CD34, CD45, CD31, CD325 and CD146) were assessed. The expression of various cytokines related to wound contraction were tested such as TGF-β, α-SMA, HGF, FGF, ENT-1, and TSP-1. Myo-D, α-SMA, and glial fibrillary acidic protein (GFAP) were evaluated by blotting and immunocytochemical staining. The collagen-gel contraction assay was performed for the functional contraction of myofibroblastic phenotype. Results: The expression of α-SMA, Myo-D and GFAP after the treatment of IL-3/GM-CSF showed similar results in hASCs and HDFs. Enhanced expression of TGF- β was observed in HDFs and the increase of ENT-1 and TSP-1 was significant in hASCs. Collagen-gel with HDFs contracted significantly within 24 h after the treatment of IL-3/GM-CSF, and the contraction was inhibited by Lyn peptide inhibitor. But in hASCs, the gelcontraction was not significant. Conclusion: IL-3/ GM-CSF effected on the myofibroblastic differentiation of hASCs as well as it did on HDFs. But hASCs did not show the phenotypic gel-contraction within 24 h.

1. Introduction Capsular contracture is the most serious complication after silicone-based breast implant surgery [1]. It manifests as rigidity or hardening of the breast, deformity, asymmetry, displacement, and prosthetic rupture [2]. The causes of capsular contracture are still unclear, because of the various factors that contribute to it, such as hematomas, seromas, infections, radiotherapy, and the location and surface of the implant [3]. Myofibroblast displays one of the predominant cells in capsule and 25% of it originate from bone marrow during the inflammatory phase [4,5]. Various inflammatory cytokines are responsible for the differentiation of myofibroblast. Transforming growth factor-beta (TGF-β) plays a key role in differentiation [6,7], but differentiation cannot be fully understood by this single factor [8,9]. Recent studies show that interleukin-3 (IL-3) and granulocyte

macrophage colony–stimulating factor (GM-CSF) are inflammatory cytokines that contribute to the accumulation of myofibroblast like cells, differentiation of stem cells, and stimulation of TGF-β expression [10–13]. Both IL-3 and GM-CSF are produced at the acute and chronic lesion within the wound, and stimulate fibrosis and induce granulation tissue [14–16]. Zafirlukast and montelukast are uniquely effective medicine based on clinical evidences for the improvement of contracture, which are leukotriene receptor antagonist (LTRA) and interfere eosinophil survival-enhancing activity (ESEA). Cysteinyl-leukotriene antagonist can inhibit dose-dependently the release of Th2 cytokines: IL-3, IL-4 and GM-CSF [17]. Herein we hypothesize that IL-3/GM-CSF may take part in capsular contracture. The location of silicone implant is another important factor in the development of capsular contracture. Clinically, implantation into the sub-glandular area, which contains a large amount of adipose tissue,

Abbreviations: hASCs, human adipose derive stromal cells; HDFs, human dermal fibroblasts, IL-3, interleukin 3; GM-CSF, granulocyte macrophage colony–stimulating factor ⁎ Correspondence to: Department of Plastic and Reconstructive Surgery, Korea University Guro Hospital, Korea University Medical Center, 148, Gurodong-ro,Gurodong-ro, Guro-Gu, Seoul 152-703, Republic of Korea. E-mail address: [email protected] (E.-S. Dhong). http://dx.doi.org/10.1016/j.yexcr.2017.03.056 Received 3 February 2015; Received in revised form 20 March 2017; Accepted 27 March 2017 0014-4827/ © 2017 Published by Elsevier Inc.

Please cite this article as: Lee, J.-S., Experimental Cell Research (2017), http://dx.doi.org/10.1016/j.yexcr.2017.03.056

Experimental Cell Research xxx (xxxx) xxx–xxx

J.-S. Lee et al.

Table 1 List of Primers for Real Time PCR. Name

Direction

Sequence (5′ to 3′)

Product size (nt)

alpha-SMA alpha-SMA HGF HGF FGF FGF TGFb TGFb THROMBOSPONDIN-1 THROMBOSPONDIN-1 Endothelin-1 Endothelin-1 GAPDH GAPDH

Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse

GTCATCATCGTGGTCACAGG AGATGGCCACCAGAACAATC TCAGCGCATGTTTTAATTGC GCCTGAAAGATATCCCGACA AGCGGCTGTACTGCAAAAAC TTCTGCTTGAAGTTGTAGCTTGAT ACATTGACTTCCGCAAGGAC GGTTGTACAGGGCCAGGA GTCATCATCGTGGTCACAGG AGATGGCCACCAGAACAATC CTGTTGCCTTTGTGGGAAGT GCTCGTCCCTGATGGATAAA GAGTCCACTGGCGTCTTCAC TTCACACCCATGACGAACAT

116 98 113 138 106 130 119

Table 2 Supplemental antibodies used. Antibody

Species

Working dilution

Source

Catalog number

Molecular weight

β-Actin

Mouse

1:5000

Sigma-aldrich

A2547

45 kDa

a-Amooth myscle Actin (a-SMA) MyoD1

Rabbit

1:1000

PTG

14395-1-AP

43 kDa

Mouse

1:1000

Abcam

ab16148

35 kDa

Mouse

1:1000

Millipore

MAB360

51 kDa

C115H184N30O24

1 μg/mL

TOCRIS

2265

Glial Fibrillary Acidic Protein (GFAP) Lyn Peptid Inhibitor

modified Eagle medium (DMEM; Gibco) containing 10% fetal bovine serum (FBS; Gibco) to inactivate the collagenase, and then floating adipocytes were separated from the stromal-vascular fraction by centrifugation at 300×g for 5 min. After the supernatant was discarded, the pellet was re-suspended in DMEM containing 10% FBS and 1.0% penicillin/streptomycin (Gibco) and filtered using a 70-μm nylon mesh. Filtered cell fraction was incubated at 37 ℃ in a 5.0% CO2 atmosphere for 5 days until the cells reached confluence, at which point they were defined as passage “0”. In this experiment hASCs of passage3 were used.

often leads to a more severe degree of inflammation resulting in capsular contracture than insertion into the sub muscular area, which possesses less adipose tissue [18]. Recent studies show that human adipose-derived stem cells (hASCs) can differentiate into myofibroblasts [19,20]. We also hypothesize that fibroblast together with hASCs may play an important role in capsular contracture. Our aim of this study is to evaluate the effects of IL-3 and GM-CSF on the expression of myofibroblastic characters and related cytokines in hASCs comparing with those in human dermal fibroblast (HDF). 2. Materials and methods

2.3. Treatment with IL-3, GM-CSF, and Lyn peptide inhibitor

2.1. Preparation of adipose tissue

For the treatment of IL-3 and GM-CSF, hASCs and HDF (c-013-5c, Invitrogen, Carlsbad, CA, USA) were plated at a density of 1.0×105 cells on 6well culture plate in DMEM, 10% FBS, and 1.0% penicillin/ streptomycin. We used two different concentrations of 10 and 40 ng/ mL of IL-3 or GM-CSF (R & D Systems, Minneapolis, MN, USA) for the real-time PCR and western-blotting [21,22]. We used 40 ng/mL of IL3/GM-CSF for the flow cytometry, immunocytochemistry (ICC) and gel-contraction assay. Lyn peptide inhibitor (Tocris Bioscience, Bristol, UK) was applied for the inhibition of IL-3/GM-CSF because it binds to the common βc subunit to block the activation of the tyrosine kinase involved in βc phosphorylation. A concentration of 1.0 μg/mL Lyn peptide inhibitor was added [23–25]. For the flow cytometry, RT-PCR, and western blotting cells were harvested for the study on Day 5 after the treatment. In this sets, culture medium was changed at every 48 h. For the immunocytochemistry cells were harvested on Day 1 and 2 for the staining after the treatment. For the contraction assay cells were

Adipose tissue was harvested from remnant of abdominal flap in three patients who underwent breast reconstruction using abdominal fat (DIEP). Informed consent was obtained from all patients for the use of their tissues and gene analysis under an experimental protocol approved by the Institutional Review Board (IRB No. AS11180). 2.2. Isolation of hASCs Subcutaneous fat was washed with phosphate-buffered saline (PBS; Gibco, Grand Island, NY, USA) and cut into pieces smaller than 1.0 mm with scissors. The adipose tissue was washed at least three times with sterile PBS and treated with an equal volume of collagenase type I suspension (1.0g/L of Hank's balanced salt solution buffer with 1.0% bovine serum albumin; Gibco) for 1 h at 37 ℃ in a humidified incubator. Digested fat was washed with the same volume of Dulbecco's

2

Experimental Cell Research xxx (xxxx) xxx–xxx

J.-S. Lee et al.

2.5. Real time-polymerase chain reaction analysis (RT-PCR)

harvested on Day 3 for the mixture.

The expression of TGF-β, alpha-smooth muscle actin (α-SMA), hepatocyte growth factor (HGF), fibroblast growth factor (FGF), endothelin-1(ENT-1), and thrombospondin-1(TSP-1) was evaluated. The nucleotide sequences of all primers used in this study are shown in Table 1. Total RNA was extracted from experimental cells with Trizol reagent (Invitrogen). cDNA was synthesized from 1.0 g total RNA via GeneAmp RNA PCR (Applied Biosystems, Foster City, CA, USA) using random hexamers. Primers were designed using Primer 3 software, while secondary structures of the templates were evaluated and excluded using m-fold software. PCR wasper formed on a Light Cycler® 1.5 system (Roche Diagnostics Corporation, Indianapolis, IN, USA) using SYBR Green technology. In 32-well real-time PCR plates,

2.4. Flow cytometric analysis Cell surface markers were detected by fluorescence-activated cell sorting analysis. Cells were incubated with monoclonal antibodies for 30 min at 4 °C, then washed and analyzed. CD105, CD73 antibodies were used as hASCs positive markers, whereas CD34 and CD45 were used as hASCs negative markers (BD Pharmingen, Franklin Lakes, NJ, USA). CD31, CD325 and CD146 (BD Pharmingen) were evaluated as potential characteristics of myofibroblastic markers [26–29]. Data were analyzed by collecting 10,000 events on a BD FACS Calibur flow cytometer system using fluorescence-activated cell sorter software (BD Biosciences, San Jose, CA, USA).

Fig. 1. Cell surface marker changes in hASCs and HDFs. a. CD markers of hASCs, b. CD changes of hASCs, c.CD markers of HDFs, d. CD changes of HDFs, p* < 0.5, p** < 0.05.

3

Experimental Cell Research xxx (xxxx) xxx–xxx

J.-S. Lee et al.

Fig. 1. (continued)

4

Experimental Cell Research xxx (xxxx) xxx–xxx

J.-S. Lee et al.

Fig. 1. (continued)

5

Experimental Cell Research xxx (xxxx) xxx–xxx

J.-S. Lee et al.

Fig. 1. (continued)

6

Experimental Cell Research xxx (xxxx) xxx–xxx

J.-S. Lee et al.

10 μL SYBR Green master mix was combined with 1.0 μL of RNA (corresponding to 50 ng of total RNA) and 900 nM of forward and reverse primers for a total reaction volume of 20 μL. Real-time RT-PCR was performed by incubating samples for 10 min at 95 °C, followed by 40 cycles of denaturation for 10 s at 95 °C, annealing for 10 s at 55 °C, and extension for 15 s at 72 °C. The expression of each gene relative to the GAPDH level (relative gene expression number) was calculated by subtracting the threshold cycle number of the target gene.

2.7. Immunocytochemistry analysis (ICC) After the treatment of IL-3 or GM-CSF (40 ng/mL), cells were stained at two different time points: 24 h and 48 h. Cells were fixed in cold 4.0% paraformaldehyde for 10 min and permeabilized with 0.025% TritronX-100 for another 10 min. They were washed with PBS three times and blocked with 5.0% BSA for 30 min at room temperature. Antibodies to α-SMA (1A4, 1:100, Abcam, Cambridge, UK) were used as primary antibodies [30,31]. After incubation with the primary antibody in blocking buffer for 2 h, samples were washed with PBS three times. An Alexa Fluor 488-conjugated donkey monoclonal antibody against mouse IgG was used as a secondary antibody. Cells were then counter stained with DAPI (4′6-diamidino-2phenylindole) for 1 min. We performed confocal microscopy. Target intensity was analyzed by image J software (http://rsbweb.nih.gov/ij/) using 10 random fields (×100) per 3 batch.

2.6. Measurement of secreted ENT-1 in the culture media Cells were seeded in high-glucose Dulbecco's Modified Eagle's Medium (DMEM) and replace with non-serum medium 24 h before inflammation cytokine treatments. IL-3 and GM-CSF was treated once with the concentration of 1, 5, 10 and 20 ng/mL. The total soluble secreted ENT-1 within the supernatants of cultures on Day1, Day3 and Day5 was measured using a sandwich ELISA (R & D systems. Minneapolis, MN, USA), according to the manufacturer's instructions. The color reaction was developed using a tetramethylbenzidine substrate solution and the absorbance was measured at 450 nm using a model microquant plate reader (Biotek, MicorQaunt, VT, USA).

2.8. Western blotting analysis Myo-D, α-SMA and glial fibrillary acidic protein (GFAP) expressions were evaluated. After the treatment of IL-3/GM-CSF, cells were incubated in serum-free medium for 5 days, washed with ice-cold PBS,

Fig. 2. mRNA expression in hASCs and HDFs. a. mRNA expression in hASCs, b. mRNA expression in HDFs, IL-3: p* < 0.5, p** < 0.05, GM-CSF: p# < 0.5, p## < 0.05).

7

Experimental Cell Research xxx (xxxx) xxx–xxx

J.-S. Lee et al.

Fig. 2. (continued)

Images were transferred to image J for processing. The ratio of contracted areas after each treatment was calculated.

and then lysed in lysis buffer (RIPA buffer). Equal amounts of protein, 30 μg, were separated by sodium dodecyl sulfate–polyacrylamide gel electrophoresis, run at 150 V for 90 min, and then electrophoretically transferred at 280 mA for 2 h to an Immobilon-P transfer membrane (IPVH00010, Millipore). After staining with 0.1% Ponceau-S solution and blocking with 5.0% nonfat milk, membranes were immunoblotted with antibodies and the bound antibodies were visualized with horseradish peroxidase conjugated secondary antibodies using an enhanced chemiluminescence system (Amersham Biosciences, Amersham, UK). Beta actin (Sigma-Aldrich, St. Louis, MO, USA) was used as a loading control (Table 2).

2.10. Statistical analysis Data of flow cytometry, RT-PCR and contraction-assay were statistically analyzed with the aid of a medical statistician. All data was shown as means ± SDs. Nonparametric analyses were used because of small sample sizes. Multiple comparisons were made using a Kruskal–Wallis test with Bonferroni correction to compare more than two groups, followed by a Mann–Whitney U test, using SPSS Statistics 20 software (SPSS, Chicago, IL, USA). A value of p < 0.05 was considered statistically significant.

2.9. In vitro models of wound contraction

3. Results

For this test, type I collagen (Rat tail) was purchased from BD Bioscience (Bedford, MA). Briefly, 200 μL aliquots of collagen solution at physiological pH and ionic strength were polymerized within 12 mm circular scores made on the bottom of 24-multiwell plates [32]. Each 2×104 cells in 1 mL of experimental incubation medium were cultured on collagen matrices for 18 h at 37 °C +5% CO2. After polymerization at 37 ℃ for 1 h, the stressed gel matrix was gently detached from only the edges with a sterile spatula, and 1.0 mL of culture medium was added. Each collagen gel lattice culture was incubated at 37 ℃ for 24 h. At the end of experimental incubation, samples were observed in a Nikon Eclipse. Images were taken every 30 min during 24 h as indicated in the figure legends using phase contrast (Fig. 6E, F).

3.1. Cell surface marker changes in hASCs and HDFs In hASCs, CD105+ decreased after the treatment of IL-3 and CD73+ recovered with Lyn peptide inhibitor in GM-CSF treated group (*p < 0.05). The change regarding CD34, CD45, CD31 (PECAM) and CD146 (MCAM) after IL-3/GM-CSF was not statistically significant (Fig. 1A, B). HDFs showed decrease in CD105+ ratio after the treatment of IL-3/ GM-CSF, and CD73+ after GM-CSF. CD105+decreased after the treatment of Lyn peptide inhibitor in GM-CSF treated group. CD325+ 8

Experimental Cell Research xxx (xxxx) xxx–xxx

J.-S. Lee et al.

scription factor, was increased in hASCs by IL-3/GM-CSF. GFAP expression was totally inhibited by Lyn peptide inhibitor in control and IL-3/GM-CSF treated group (Fig. 5A). The α-SMA in HDF decreased by IL-3/GM-CSF, and also decreased by Lyn peptide inhibitor. GFAP showed also negative band in HDFs by Lyn peptide inhibitor (Fig. 5B). 3.6. Activated phenotype of collagen-gel contraction generated by IL3/GM-CSF HDFs and hASCs showed different patterns of collagen gel contraction (Fig. 6A–F). There were significant contraction only in HDFs after the treatment of IL-3/GM-CSF. Contracted gel-area was 1.7 ± 0.3 (mean ± 2SD) times larger in HDFs than that of hASCs by IL-3, and 1.5 ± 0.3 (mean ± 2SD) times larger by GM-CSF. The HDFs treated by Lyn peptide inhibitor showed decrease in reduction rate significantly in HDFs (Fig. 6A–D). As fibroblasts began to spread, they reorganized to align the collagen matrix resulting in the appearance of tension lines in the collagen between cells, and the cells pulled closer to each other (Fig. 6E,F). 4. Discussion Fibrocyte and fibroblast are known to be the cell source of myofibroblasts mediated by TGF-β activation. TGF-β is a potent fibrotic inflammatory mediator and immunomodulator in capsular contracture. An experimental study suggests that an inhibitor of TGF-β may help reducing capsular contracture, but there is still controversy regarding its clinical application [33]. The entirety of the mechanism of induction of capsular contracture is not fully accounted for by a single factor, especially in inflammatory conditions. Recent studies show that mesenchymal stem cells are also able to differentiate to α-SMA positive cells in response to treatment with TGF-β [34,35]. IL-3/GM–CSF are cytokines that regulate the growth, differentiation, migration, and effector function activities of stem cells, as well as myofibroblast accumulation [7,11,13]. Current medicine available for preventing and managing capsular contracture is zafirlukast and montelukast, which are uniquely effective medicine based on clinical evidences. These are leukotriene receptor antagonist (LTRA) and interfere eosinophil survival-enhancing activity (ESEA). Cysteinylleukotriene antagonist can dose-dependently inhibit the release of Th2 cytokines:IL-3, IL-4 and GM-CSF. In addition, IL-3 has been reported to be involved in the development of a neoplastic B cell lymphoma and an anaplastic large cell lymphoma that originated from a breast implant capsule that caused capsular contracture [28,36,37]. In the flow cytometry, hASCs and HDFs appears to change their CD markers. In hASCs, the decrease of CD105+ after IL-3 cannot confirm the change of cell character; the changes of CD34, CD45, CD31, and CD146 are not significant. In the CD markers of HDFs, even with the increase of CD325+ after IL-3, the complexity of data can’t explain a phenotypic myofibroblastic transform in hASCs and HDFs after the treatment of IL-3/GM-CSF. Alpha SMA is a representative marker of myofibroblasts, while HGF represses it. In RT-PCR, the increase of α-SMA after IL-3/GM-CSF show same myofibroblastic characteristics in hASCs and HDFs. But the expression of TGF-β shows significant responses to GM-CSF (40 ng/ mL) only in HDFs (Fig. 2B). GM-CSF may play a role in the differentiation of myofibroblasts by inducing TGF-β in HDFs. The maintained expression of HGF in hASCs after the treatment of IL-3/ GM-CSF shows the correlation with the lower reduction rate in the collagen gel contraction assay (Fig. 6B). The level of HGF expression in HDFs shows significant fluctuation. These results indicate that HGF of hASCs may have an inhibitory effect in the expression of α-SMA after the treatment of IL-3. These findings need further experiments. In Fig. 2A, the relative expression of α-SMA in hASCs and HDFs are similar in the presence of either IL-3/GM-CSF. In HDFs, levels of α-

Fig. 3. Accumulation of Endothelin-1 in the conditioned media of hASCs cultures.

increased after IL-3, and CD146+ decreased with the Lyn peptide inhibitor in the GM-CSF treated group (Fig. 1C, D). 3.2. mRNA expression after IL-3/GM-CSF treatment In hASCs, α-SMA increased after treatment of IL-3/GM-CSF (40 ng/mL). TSP-1 increased significantly by GM-CSF and ENT-1 by IL-3 after the treatment of 10 and 40 ng/mL (Fig. 2A). In HDF, α-SMA increased significantly by IL-3/GM-CSF. HGF decreased by IL-3/GM-CSF (10 ng/mL), and FGF decreased by IL-3/ GM-CSF in both concentrations. TGFβ and ENT-1 increased by GMCSF (40 ng/mL) (Fig. 2B). 3.3. ENT-1 secretion in hASCs culture Ent-1 concentration in the conditioned media of hASCs cultures on Day 3 and Day 5 showed significant increase in all concentrations by IL-3/GM-CSF (Fig. 3). 3.4. α-SMA in immunocytochemistry Representative fluorescent images of hASCs showed similar staining patterns to HDFs (Fig. 4A, B) At 24 h of incubation, hASCs showed significant increase in α-SMA by GM-CSF. But α-SMA staining in HDF at 24 h showed decrease after the treatment (Fig. 4C). At 48 h, the areas of staining in hASCs and HDFs was similar. Values between hASCs and HDF were not tested statistically because of the size difference between cells. 3.5. Expression of myofibroblastic protein by IL-3/GM-CSF The α-SMA in hASCs was increased by GM-CSF (40 ng/mL) and decreased with Lyn peptide inhibitor. Myo-D, a muscle-specific tran9

Experimental Cell Research xxx (xxxx) xxx–xxx

J.-S. Lee et al.

Fig. 4. Immunocytochemistry. a. α-SMA expression of hASCs (x100), b. α-SMA expression of HDFs (×100), c. diagram of staining at 24 and 48 h.

in HDFs. However, ENT-1 is significantly increased in the GM-CSF treatment groups. (Fig. 2. B) The complexity of various expressions needs further experiments. In ICC assays, α-SMA shows similar pattern of staining in both hASCs and HDFs in response to IL-3/GM-CSF treatment. (Fig. 4) Strong intensity of ICC after the treatment of GM-CSF in hASCs shows a similar data of western blotting. But the time difference between blotting and ICC weakens the correlations. (Figs. 4 and 5) Myo-D, a muscle-specific transcription factor, presents similar characteristics in both hASCs and HDFs, shows decrease after Lyn peptide inhibitor. GFAP, a possible indicator of phenotypic myofibroblast, shows near total suppression in hASCs and HDFs after Lyn peptide inhibitor [31]. Although the functional effects of Lyn peptide inhibitor are not thoroughly investigated, these findings may provide an experimental

SMA are high with a low dose of IL-3/GM-CSF. TGF-β expression after GM-CSF treatment correlates with the α-SMA expression. ENT-1 promotes myofibroblast induction [38,39]. After the treatment of IL-3, ENT-1 expression in hASCs shows significant increase. And in the supernatant, hASCs shows significant secretion of ENT-1 after treatment of IL-3/GM-CSF in various concentrations. TSP-1 also plays a key role in the activation of TGF-β [40]. Increased expression of TSP-1 in hASCs after GM-CSF may show phenotypic correlation between hASCs and myofibroblasts. ENT-1 and TSP-1 are regulatory mediators in hASCs and play an ancillary role in differentiation of myofibroblast. These findings indicate our understanding of the similar phenotypes of differentiation of hASCs and HDFs into myofibroblasts. The expression of FGF, which inhibits differentiation to myofibroblasts shows decrease significantly

10

Experimental Cell Research xxx (xxxx) xxx–xxx

J.-S. Lee et al.

Fig. 5. Expression of myofibroblastic protein by inflammation cytokine. a. hASCs b. HDFs.

11

Experimental Cell Research xxx (xxxx) xxx–xxx

J.-S. Lee et al.

Fig. 5. (continued)

12

Experimental Cell Research xxx (xxxx) xxx–xxx

J.-S. Lee et al.

Fig. 6. Collagen-gel contraction assay in HDFs and hASCs (a, collagen-gel contraction of HDFs in wells; b, collagen-gel contraction of hASCs; c, contraction assay of HDFs; d, contraction assay of hASCs (mean ± SD. (n=3), p* < 0.5, p** < 0.05, p*** < 0.001); e, cell clustering and dispersion of HDFs after 24 h (x40) (A) control (B) control+Lyn peptide inhibitor (C) IL-3 treated HDFs (D) IL-3+Lyn peptide inhibitor (E) GM-CSF treated HDFs, blue arrows indicating microtubule-like matrix remodeling (F) GM-CSF+Lyn peptide inhibitor; f, cell clustering and dispersion of hASCs after 24 h (x40) (A) control (B) control +Lyn peptide inhibitor (C) IL-3 treated hASCs (D) IL-3+Lynpeptide inhibitor (E) GM-CSF treated hASCs, (F) GM-CSF+Lyn peptide inhibitor.

13

Experimental Cell Research xxx (xxxx) xxx–xxx

J.-S. Lee et al.

Fig. 6. (continued)

14

Experimental Cell Research xxx (xxxx) xxx–xxx

J.-S. Lee et al.

Fig. 6. (continued)

myofibroblasts by IL-3/GM-CSF has not yet been confirmed in vivo. Moreover, this study was conducted with a relatively short follow-up of differentiation to myofibroblasts (maximum of 5 days) and it is still unclear whether hASCs can differentiate into myofibroblasts spontaneously in the absence of inflammation, because some papers have reported that hASCs can inhibit myofibroblast proliferation and prevent fibrous contracture without inflammation [44,45].

basis for promising targets to reduce the differentiation of hASCs and HDFs to myofibroblasts. In terms of morphological and contractile responses to IL-3/GMCSF, there are quantitative differences between hASCs and HDFs. As shown in Fig. 6, the contractile amount of hASCs shows less than that of HDFs. Contraction occurs as a consequence of motile activity but cells trying to migrate through the matrix. This process was called tractional remodeling to distinguish it from a smooth muscle-like contraction. Cells in anchored matrices become bipolar and orient along lines of tension [41]. Therefore, we tested the stressed matrix tension and compared the “isometric contraction” between hASCs and HDFs detaching only to the edge of the margins [42,43]. The significant contraction after IL-3/GM-CSF was assessed in HDFs, and which was not found in hASCs. Contractile remodeling and microtubule like appearance were noticed only in HDFs. (Fig. 6e (E)) Our experimental work has some limitations. This mechanism of differentiation to

5. Conclusion IL-3/ GM-CSF effected as mediators in myofibroblastic differentiation of hASCs and HDFs. Although hASCs did not show the phenotypic gel-contraction within 24 h, hASCs and HDFs appear to have similar characteristics of biologic expressions of myofibroblastic differentiation. 15

Experimental Cell Research xxx (xxxx) xxx–xxx

J.-S. Lee et al.

Financial disclosure and products [23]

This research was supported by the Basic Science Research Program though the National Research Foundation of Korea (NRF) funded by the Ministry of Education (No. 2013R1A1A2008766). This research was supported by a Korea University Grant (No. K1132701).

[24]

[25]

References [26] [1] M.H. Brown, R.B. Somogyi, S. Aggarwal, Secondary breast augmentation, Plast. Reconstr. Surg. 138 (2016) 119e–135e. [2] W.Y. Baek, D.H. Lew, D.W. Lee, A retrospective analysis of ruptured breast implants, Arch. Plast. Surg. 41 (2014) 734–739. [3] H. Headon, A. Kasem, K. Mokbel, Capsular contracture after breast augmentation: an update for clinical practice, Arch. Plast. Surg. 42 (2015) 532–543. [4] A.E. Steiert, M. Boyce, H. Sorg, Capsular contracture by silicone breast implants: possible causes, biocompatibility, and prophylactic strategies, Med. Devices 6 (2013) 211–218. [5] C. Isom, V. Kapoor, L. Wilson, C. Fathke, L. Barnes, S.R. Sullivan, F.F. Isik, Breast implant capsules are partially composed of bone marrow-derived cells, Ann. Plast. Surg. 58 (2007) 377–380. [6] S.S. Kuhn A, P.D. Smith, et al., Periprosthetic breast capsules contain the fibrogenic cytokines TGFbeta1 and TGF-beta2, suggesting possible new treatment approaches, Ann. Plast. Surg. 44 (2000) 387–391. [7] M.B. Vaughan, E.W. Howard, J.J. Tomasek, Transforming growth factor-beta1 promotes the morphological and functional differentiation of the myofibroblast, Exp. Cell Res. 257 (2000) 180–189. [8] J.J. Tomasek, G. Gabbiani, B. Hinz, C. Chaponnier, R.A. Brown, Myofibroblasts and mechano-regulation of connective tissue remodelling, Nat. Rev. Mol. Cell Biol. 3 (2002) 349–363. [9] A. Desmouliere, A. Geinoz, F. Gabbiani, G. Gabbiani, Transforming growth factorbeta 1 induces alpha-smooth muscle actin expression in granulation tissue myofibroblasts and in quiescent and growing cultured fibroblasts, J. Cell Biol. 122 (1993) 103–111. [10] A. Kessinger, J.G. Sharp, Mobilization of blood stem cells, Stem Cells 16 (Suppl 1) (1998) S139–S143. [11] A. Nitsche, I. Junghahn, S. Thulke, J. Aumann, A. Radonic, I. Fichtner, W. Siegert, Interleukin-3 promotes proliferation and differentiation of human hematopoietic stem cells but reduces their repopulation potential in NOD/SCID mice, Stem Cells 21 (2003) 236–244. [12] H. Mollmann, H.M. Nef, S. Voss, C. Troidl, M. Willmer, S. Szardien, A. Rolf, M. Klement, R. Voswinckel, S. Kostin, H.A. Ghofrani, C.W. Hamm, A. Elsasser, Stem cell-mediated natural tissue engineering, J. Cell. Mol. Med. 15 (2011) 52–62. [13] S.E. Broughton, U. Dhagat, T.R. Hercus, T.L. Nero, M.A. Grimbaldeston, C.S. Bonder, A.F. Lopez, M.W. Parker, The GM-CSF/IL-3/IL-5 cytokine receptor family: from ligand recognition to initiation of signaling, Immunol. Rev. 250 (2012) 277–302. [14] L. Rubbia-Brandt, A.P. Sappino, G. Gabbiani, Locally applied GM-CSF induces the accumulation of alpha-smooth muscle actin containing myofibroblasts, Virchows Arch. B Cell Pathol. Incl. Mol. Pathol. 60 (1991) 73–82. [15] S. Vyalov, A. Desmouliere, G. Gabbiani, GM-CSF-induced granulation tissue formation: relationships between macrophage and myofibroblast accumulation, Virchows Arch. B Cell Pathol. Incl. Mol. Pathol. 63 (1993) 231–239. [16] Z. Xing, G.M. Tremblay, P.J. Sime, J. Gauldie, Overexpression of granulocytemacrophage colony-stimulating factor induces pulmonary granulation tissue formation and fibrosis by induction of transforming growth factor-beta 1 and myofibroblast accumulation, Am. J. Pathol. 150 (1997) 59–66. [17] Y. Tohda, H. Nakahara, H. Kubo, R. Haraguchi, M. Fukuoka, S. Nakajima, Effects of ONO-1078 (pranlukast) on cytokine production in peripheral blood mononuclear cells of patients with bronchial asthma, Clin. Exp. Allergy 29 (1999) 1532–1536. [18] S.L. Spear, E.J. Bulan, M.L. Venturi, Breast augmentation, Plastic Reconstr. Surg. 118 (2006) 188S–196S (discussion 197S-198S). [19] E.S. Jeon, S.C. Heo, I.H. Lee, Y.J. Choi, J.H. Park, K.U. Choi, D.Y. Park, D.S. Suh, M.S. Yoon, J.H. Kim, Ovarian cancer-derived lysophosphatidic acid stimulates secretion of VEGF and stromal cell-derived factor-1 alpha from human mesenchymal stem cells, Exp. Mol. Med. 42 (2010) 280–293. [20] G. Walenda, K. Abnaof, S. Joussen, S. Meurer, H. Smeets, B. Rath, K. Hoffmann, H. Frohlich, M. Zenke, R. Weiskirchen, W. Wagner, TGF-beta1 does not induce senescence of multipotent mesenchymal stromal cells and has similar effects in early and late passages, PLoS One 8 (2013) e77656. [21] J.B. Klein, M.J. Rane, J.A. Scherzer, P.Y. Coxon, R. Kettritz, J.M. Mathiesen, A. Buridi, K.R. McLeish, Granulocyte-macrophage colony-stimulating factor delays neutrophil constitutive apoptosis through phosphoinositide 3-kinase and extracellular signal-regulated kinase pathways, J. Immunol. 164 (2000) 4286–4291. [22] R. Louis, A. Dowlati, T. Weber, T. Bury, J.L. Corhay, M.F. Radermecker, Modulation of immunological histamine release from human lung fragments by

[27]

[28]

[29]

[30]

[31]

[32] [33]

[34]

[35]

[36]

[37]

[38]

[39]

[40]

[41]

[42] [43]

[44]

[45]

16

stem cell factor, IL-3, IL-5 and GM-CSF: comparison with human leukocytes, Int. Arch. Allergy Immunol. 105 (1994) 18–25. M.E. Dahl, K.I. Arai, S. Watanabe, Association of Lyn tyrosine kinase to the GMCSF and IL-3 receptor common betac subunit and role of Src tyrosine kinases in DNA synthesis and anti-apoptosis, Genes Cells.: Devoted Mol. Cell. Mech. 5 (2000) 143–153. T. Adachi, S. Stafford, S. Sur, R. Alam, A novel Lyn-binding peptide inhibitor blocks eosinophil differentiation, survival, and airway eosinophilic inflammation, J. Immunol. 163 (1999) 939–946. B. Tomkowicz, C. Lee, V. Ravyn, R. Cheung, A. Ptasznik, R.G. Collman, The Src kinase Lyn is required for CCR5 signaling in response to MIP-1beta and R5 HIV-1 gp120 in human macrophages, Blood 108 (2006) 1145–1150. E. Alt, Y. Yan, S. Gehmert, Y.H. Song, A. Altman, S. Gehmert, D. Vykoukal, X. Bai, Fibroblasts share mesenchymal phenotypes with stem cells, but lack their differentiation and colony-forming potential, Biol. Cell 103 (2011) 197–208. M. P, H. S, M. R, G. M, S.K. W, Adult mesenchymal stem cells and cell surface characterization – a systematic review of the literature, Open Orthop. J. 5 (2011) 253–260. P.A. Thompson, H.M. Prince, Breast implant-associated anaplastic large cell lymphoma: a systematic review of the literature and mini-meta analysis, Curr. Hematol. Malig. Rep. 8 (2013) 196–210. O. De Wever, W. Westbroek, A. Verloes, N. Bloemen, M. Bracke, C. Gespach, E. Bruyneel, M. Mareel, Critical role of N-cadherin in myofibroblast invasion and migration in vitro stimulated by colon-cancer-cell-derived TGF-beta or wounding, J. Cell Sci. 117 (2004) 4691–4703. G. Buniatian, B. Hamprecht, R. Gebhardt, Glial fibrillary acidic protein as a marker of perisinusoidal stellate cells that can distinguish between the normal and myofibroblast-like phenotypes, Biol. Cell 87 (1996) 65–73. A.H. Tennakoon, T. Izawa, K.K. Wijesundera, H.M. Golbar, M. Tanaka, C. Ichikawa, M. Kuwamura, J. Yamate, Characterization of glial fibrillary acidic protein (GFAP)-expressing hepatic stellate cells and myofibroblasts in thioacetamide (TAA)-induced rat liver injury, Exp. Toxicol. Pathol.: Off. J. Ges. Toxikol. Pathol. 65 (2013) 1159–1171. E. Tamariz, F. Grinnell, Modulation of fibroblast morphology and adhesion during collagen matrix remodeling, Mol. Biol. Cell 13 (2002) 3915–3929. R. Ruiz-de-Erenchun, J.D. de las Herrerias, B. Hontanilla, Use of the transforming growth factor-beta 1 inhibitor peptide in periprosthetic capsular fibrosis: experimental model with tetraglycerol dipalmitate, Plast. Reconstr. Surg. 116 (2005) 1370–1378. B. Kinner, J.M. Zaleskas, M. Spector, Regulation of smooth muscle actin expression and contraction in adult human mesenchymal stem cells, Exp. Cell Res. 278 (2002) 72–83. D. Wang, J.S. Park, J.S. Chu, A. Krakowski, K. Luo, D.J. Chen, S. Li, Proteomic profiling of bone marrow mesenchymal stem cells upon transforming growth factor beta1 stimulation, J. Biol. Chem. 279 (2004) 43725–43734. D. Aldinucci, D. Poletto, A. Gloghini, P. Nanni, M. Degan, T. Perin, P. Ceolin, F.M. Rossi, V. Gattei, A. Carbone, A. Pinto, Expression of functional interleukin-3 receptors on Hodgkin and Reed-Sternberg cells, Am. J. Pathol. 160 (2002) 585–596. M. Talagas, A. Uguen, F. Charles-Petillon, V. Conan-Charlet, V. Marion, W. Hu, J. Amice, M. De Braekeleer, Breast implant-associated anaplastic large-cell lymphoma can be a diagnostic challenge for pathologists, Acta Cytol. 58 (2014) 103–107. X. Shi-Wen, Y. Chen, C.P. Denton, M. Eastwood, E.A. Renzoni, G. Bou-Gharios, J.D. Pearson, M. Dashwood, R.M. du Bois, C.M. Black, A. Leask, D.J. Abraham, Endothelin-1 promotes myofibroblast induction through the ETA receptor via a rac/phosphoinositide 3-kinase/Akt-dependent pathway and is essential for the enhanced contractile phenotype of fibrotic fibroblasts, Mol. Biol. Cell 15 (2004) 2707–2719. A. Prefontaine, A. Calderone, J. Dupuis, Role of endothelin receptors on basal and endothelin-1-stimulated lung myofibroblast proliferation, Can. J. Physiol. Pharmacol. 86 (2008) 337–342. J. Ahamed, C.A. Janczak, K.M. Wittkowski, B.S. Coller, In vitro and in vivo evidence that thrombospondin-1 (TSP-1) contributes to stirring- and sheardependent activation of platelet-derived TGF-beta1, PLoS One 4 (2009) e6608. B. da Rocha-Azevedo, F. Grinnell, Fibroblast morphogenesis on 3D collagen matrices: the balance between cell clustering and cell migration, Exp. Cell Res. 319 (2013) 2440–2446. F. Grinnell, Fibroblast-collagen-matrix contraction: growth-factor signalling and mechanical loading, Trends Cell Biol. 10 (2000) 362–365. F. Grinnell, C.H. Ho, Y.C. Lin, G. Skuta, Differences in the regulation of fibroblast contraction of floating versus stressed collagen matrices, J. Biol. Chem. 274 (1999) 918–923. J.S. Verhoekx, V. Mudera, E.T. Walbeehm, S.E. Hovius, Adipose-derived stem cells inhibit the contractile myofibroblast in Dupuytren's disease, Plast. Reconstr. Surg. 132 (2013) 1139–1148. F. Castiglione, P. Hedlund, F. Van der Aa, T.J. Bivalacqua, P. Rigatti, H. Van Poppel, F. Montorsi, D. De Ridder, M. Albersen, Intratunical injection of human adipose tissue-derived stem cells prevents fibrosis and is associated with improved erectile function in a rat model of Peyronie's disease, Eur. Urol. 63 (2013) 551–560.