Do mRNA and rRNA Binding Sites of E. coli Ribosomal Protein S15 Share Common Structural Determinants?

doi:10.1016/S0022-2836(02)00553-3 available online at http://www.idealibrary.com on

w B

J. Mol. Biol. (2002) 320, 963–978

Do mRNA and rRNA Binding Sites of E. coli Ribosomal Protein S15 Share Common Structural Determinants? Alexander Serganov1, Eric Ennifar1, Claude Portier2 Bernard Ehresmann1 and Chantal Ehresmann1* 1

UPR 9002 du CNRS, Institut de Biologie Mole´culaire et Cellulaire, 15 rue Rene´ Descartes, 67084 Strasbourg cedex, France 2

Institut de Biologie Physico-Chimique, 13 rue Pierre et Marie Curie, 75005 Paris, France

Escherichia coli ribosomal protein S15 recognizes two RNA targets: a threeway junction in 16 S rRNA and a pseudoknot structure on its own mRNA. Binding to mRNA occurs when S15 is expressed in excess over its rRNA target, resulting in an inhibition of translation start. The sole apparent similarity between the rRNA and mRNA targets is the presence of a G-U/G-C motif that contributes only modestly to rRNA binding but is essential for mRNA. To get more information on the structural determinants used by S15 to bind its mRNA target as compared to its rRNA site, we used site-directed mutagenesis, substitution by nucleotide analogs, footprinting experiments on both RNA and protein, and graphic modeling. The size of the mRNA-binding site could be reduced to 45 nucleotides, without loss of affinity. This short RNA preferentially folds into a pseudoknot, the formation of which depends on magnesium concentration and temperature. The size of the loop L2 that bridges the two stems of the pseudoknot through the minor groove could not be reduced below nine nucleotides. Then we showed that the pseudoknot recognizes the same side of S15 as 16 S rRNA, although shielding a smaller surface area. It turned out that the G-U/G-C motif is recognized from the minor groove in both cases, and that the G-C pair is recognized in a very similar manner. However, the wobble G-U pair of the mRNA is not directly contacted by S15, as in rRNA, but is most likely involved in building a precise conformation of the RNA, essential for binding. Otherwise, unique specific features are utilized, such as the three-way junction in the case of 16 S rRNA and the looped out A(2 46) for the mRNA pseudoknot. q 2002 Elsevier Science Ltd. All rights reserved

*Corresponding author

Keywords: ribosomal protein S15; translational regulation; pseudoknot structure; RNA –protein interaction; molecular mimicry

Introduction Translational regulation is used by bacteria and phages to rapidly adapt protein expression to their need as a function of growth and environmental variations. Initiation of translation is frePresent address: A. Serganov, Laboratory of Nucleic Acid and Protein Structures, Memorial Sloan-Kettering Cancer Center, 1275 York Avenue, New York, NY 10021, USA. Abbreviations used: CMCT, 1-cyclohexyl-3(2-(1methylmorpholino)ethyl)-carbodiimide; DAP, diaminopurine; DEPC, diethylpyrocarbonate; disoC, deoxyribo-iso-cytidine; DMS, dimethylsulfate; HMK, heart muscle kinase; I, inosine. E-mail address of the corresponding author: [email protected]

quently challenged by RNA-binding proteins that recognize specific targets on mRNA. This type of control is facilitated by the fact that transcription and translation are tightly coupled, rendering nascent mRNA transcripts easily accessible to ribosomes and regulatory proteins, and allowing a high flexibility in the control process at a minimal energetic cost. A particularity of regulatory proteins in procaryotes is that their primary role is not devoted to their regulatory function. Rather, they appear to be utilized for this purpose on the grounds of their functional properties. This is highlighted by the feedback regulation of ribosomal protein (r-protein) expression in Escherichia coli, in which most of the ribosomal operons are negatively regulated by the product of one of their cistrons, generally a primary rRNA-binding

0022-2836/02/$ - see front matter q 2002 Elsevier Science Ltd. All rights reserved

964

The mRNA Binding Sites of Ribosomal Protein S15

Figure 1. The mRNA-binding site of E. coli ribosomal protein S15 and determination of the minimum site. The Shine and Dalgarno sequence (SD) is shown in an orange box and the AUG initiation codon in a green box. The G-U/G-C motif is shown in a yellow box. The different fragments used here are shown with their Kd value, determined by direct binding to S15. The values shown in parenthesis were determined by competition experiments in the presence of rRNA. (a) Equilibrium between the stem-loop and the pseudoknot structures in mRNA AB5313.24 This fragment (214 nucleotides) contains the 50 -UTR of rpsO mRNA and the first 47 nucleotides of the mRNA coding frame. Fragment mRNA67 resulted from the deletion of both 50 and 30 parts (indicated by brackets). (b) Assays to reduce the size of loop L2. The sequence of mRNA45 (containing nine nucleotides in loop L2 and resulting from the deletion of nucleotides (2 28) to (27)) is indicated in two possible forms, the open (left) and the pseudoknot (right) forms. The size of loop L2 was further reduced to six and four nucleotides by deleting the boxed sequences, leading to mRNA42 and mRNA40, respectively. The isolated stem-loop I (mRNA2) is also shown in a gray box. (c) The 16 S rRNA binding site is shown for comparison. Conserved nucleotides are shown in red, and nucleotides protected from hydroxyl radical hydrolysis are indicated by filled circles. Protein S15 is schematized in green with its two sites: the three-way junction (site 1) and the G-U/G-C motif (site 2). Binding at both sites triggers a conformational adjustment in the purine-rich loop (pink box). Results are from Nikulin et al. and Serganov et al.10,13

protein.1,2 The detection of primary and/or secondary structure similarities between rRNA and mRNA-binding sites led Nomura to propose an attractive mechanism, based on molecular mimicry and competition.1 This model assumed that a regulatory r-protein, when synthesized in excess over its primary rRNA target, would bind its own mRNA and stop translation. This simple mechanism would allow to precisely adjust and coordinate the synthesis of r-proteins to the rate of rRNA transcription. Molecular mimicry in protein synthesis regulation has been demon-

strated or is highly suspected in several cases.3 Both genetic and biochemical evidence strongly argue in favor of such a mechanism in the case of autoregulation by r-proteins L14 and S8.5 Molecular mimicry was clearly demonstrated in the case of the autoregulation of the thrS gene by threonyl-tRNA synthetase (ThrRS).6,7 Furthermore, a structural basis for this mechanism was recently provided by comparing the crystal structures of ThrRS complexed to its cognate tRNA8 and to its major determinant in mRNA.9

965

The mRNA Binding Sites of Ribosomal Protein S15

Table 1. Effect of mutation on S15 binding. All mutations were tested in the mRNA45 context. The mutations are indicated in comparison to the corresponding wild-type sequence. Krel is the ratio of the apparent dissociation constant (Kd) measured for the mutant on the Kd measured for wild-type RNA. The percentage of retention is also indicated. In the case of biphasic curves (U(249) I(2 36) and disoC(2 49) DAP(2 36)), only the Kd and retention for the high affinity site are indicated. Mutation Wild-type U(þ 10) A(244) U(þ 9) A(243) D(246) C(246) dSp(246) dA(246) G(250) C(235) U(249) A(236) C(249) A(236) G(249) U(236) C(249) G(236) dT(249) G(236) rT(249) G(236) disoC(249) DAP(236) U(249) I(236)

Wt nucleotides

Kd (nM)

Krel

Retention (%)

Wild-type A·U A·U A A A A C·G U·G U·G U·G U·G U·G U·G U·G U·G

43 38 62 .5000 .5000 .1400 34 .1000 .3000 .4500 .3000 .3000 49 23 33 74

1.0 0.8 1.4 .100 .100

52 67 32

0.8 .25 .75 .100 .75 .75 1.1 0.5 0.8 1.7

39

The interaction of S15 with its rRNA target is fully documented at atomic level. The crystal structures of Thermus thermophilus S15 bound to rRNA fragments, either alone10 or associated with proteins S6 and S1811 are available. The structures of these complexes are similar to that observed in the crystal structure of the complete small subunit ˚ resolution.12 The E. coli from T. thermophilus at 3 A S15 – rRNA interaction is closely related to that observed in T. thermophilus (Ref. 13 and references herein). It turns out that S15 recognizes two distinct sites on its rRNA target (Figure 1(c)). The first one, which provides the major contribution to binding, consists of the highly conserved threeway junction. The invariant bases are not directly recognized by S15 but serve to constrain a precise and unique backbone folding, which is recognized by the protein. Conversely, binding at site 2, which is characterized by sequence-specific recognition of a conserved G-U/G-C motif, only provides a minor contribution to binding and depends on proper binding at site 1. Binding at both sites triggers conformational adjustments that are required for subsequent binding of protein S6 and S18.11,13,14 Ribosomal protein S15 was shown to regulate the expression of its own mRNA by a feedback mechanism at the translational level.15 The translational operator overlaps the ribosome binding site and folds into two mutually exclusive structures, one consisting of two stem-loops (I and II) and the other one forming a pseudoknot16,17 (Figure 1(a)). The two structures, which seem to be energetically equivalent18 are in dynamic equilibrium, and the pseudoknot is stabilized by binding of S15. However, binding of S15 does not prevent 30 S subunit binding but traps the subunit into an incompetent translation initiation complex.19 Repression can be alleviated by 16 S rRNA, which is able to displace the bound S15, thus allowing translation to proceed.20 This mech-

29 40 6 20

anism, referred to as “entrapment” mechanism, is an alternative to the “displacement” mechanism, in which binding of the repressor competes with ribosome binding.21 A similar mechanism has also been proposed for the feedback control of the a operon by protein S4.22,23 The requirements for S15 recognition and in vivo control were investigated by extensive site-directed mutagenesis. These studies revealed that the pseudoknot stem S2 (Figure 1(a)) is absolutely required, without detectable base specificity.17,24 Otherwise, a G-U/G-C motif present in stem S1 (Figure 1(a)) was shown to be essential for S15 autoregulation, suggesting that it should represent the sole base-specific determinant for S15 recognition.25 These results correlate with hydroxyl radical footprinting experiments that suggested the presence of two contacts areas, one located in the distal part of stem S2, and the second one in S1, covering the G-U/G-C motif and the junction between stems S1 and S2.17 The sole apparent similarity between the rRNA and mRNA targets is the presence of two distinct binding sites, one of which includes a G-U/G-C motif (Figure 1). However, S15 recognizes the mRNA operator with a much weaker affinity than its rRNA target (Figure 1) and the relative contribution of both sites appears to highly differ. Therefore, the fact that S15 might recognize common features on both RNAs remains questionable. Notably, S15 from Bacillus stearothermophilus was recently found to bind its own mRNA, at a site that overlapped the ribosome binding site, but did not show any similarity with the E. coli mRNA site.26 Instead, the protein recognized a three-way junction and an internal loop that have little sequence homology with the rRNA binding site but might present structural homology. Here, we delineated the minimum mRNA fragment still retaining the full capability to bind S15. Its ability to form a pseudoknot and its dynamic behavior were studied. Then, we used site-directed

966

The mRNA Binding Sites of Ribosomal Protein S15

Figure 2. Probing of mRNA45. (a) Modification of (N7)A with 2 and 4 ml of DEPC for 30 minutes, and with 1 ml of 60 mM NiCR for 15 and 30 minutes, in buffer B. Incubation control without (lane C) or with (lane Cp) aniline. (b) Effect of magnesium concentration and temperature on the accessibility to RNase T2. Cleavage by RNase T2 (0.02 unit) as a function of [Mg2þ] was at 20 8C for 15 minutes in 50 mM Hepes-KOH (pH 7.5), 100 mM KCl, 0.1 mM EDTA, supplemented with 1 mM EDTA, 1 mM MgCl2, 5 mM MgCl2, or 20 mM MgCl2. Cleavage by RNase T2 (0.02 unit) as a function of temperature was for 15 minutes in buffer B (containing 5 mM Mg2þ) at 10, 20, 37, and 50 8C. Lane C, incubation control. (c) Probing with lead(II) was in buffer C at 20 8C for 15 minutes with 0.7, 1.4, 2.8, and 5.6 mM of lead acetate. Incubation control (lane C). Alkaline ladder (lane L), RNase U2, T1 or from Bacillus cereus ladders (lane U2, T1, Bc, respectively). (nd), not determined.

mutagenesis and substitution by nucleotide analogs, as well as footprinting experiments on both RNA and protein, to get clues on how S15 recognizes its mRNA target. Particular questions were addressed: (i) is the G-U/G-C motif recognized in a similar way in both RNAs? (ii) what is the extent of similarity between the rRNA threeway junction and the pseudoknot geometry? Finally, we constructed a 3D model of the complex which accounts for most experimental data.

Results and Discussion The minimal mRNA-binding site Up to now, most experiments were conducted on a large mRNA fragment (AB5313) covering the

complete 30 -UTR (167 nucleotides) and 47 nucleotides of the reading frame.24 In its natural context stem-loops I and II, found in equilibrium with the pseudoknot form, were preceded by a hairpin structure which was shown to be dispensable for control.15 This fragment binds S15 with a Kd value of 231 nM. Attempts to reduce the size of the mRNA fragment are summarized in Table 1 and Figure 1(a) and (b). First, we deleted nucleotides upstream and downstream of hairpins I and II, that can potentially form the two stem-loop structures and the pseudoknot (mRNA67), without reduction of binding. The size of loop L2 could be reduced to nine nucleotides (mRNA45) without altering binding capacity. However further attempts to reduce L2 (mRNA42 and mRNA40) were detrimental to binding. In addition, mRNA67 and mRNA45 were able to compete

967

The mRNA Binding Sites of Ribosomal Protein S15

Figure 3. Summary of probing the mRNA45 structure. (a) Accessibility of mRNA45 to RNase T2 as a function of Mg2þ concentration and temperature. The equilibrium between the pseudoknot (left) and the open (right) forms is shown. Arrows indicate the RNase T2 cut in the absence of Mg2þ at 20 8C, with their size proportional to their intensity. Increased or decreased cleavage upon addition of increasing Mg2þ concentration is denoted by (þ) and (2 ), respectively. The temperature dependence at 5 mM Mg2þ is indicated by the color of the arrows: red for increase, blue for decrease. (b) Modification of N7A and N7G with DEPC and NiCR, respectively. Three levels of modification are denoted by white, gray and black circles, from weak to strong. (c) Sensitivity to lead-induced cleavage. The size of the arrows reflects the order of appearance as lead(II) concentration was increased. All results are from gels shown in Figure 2.

with rRNA. Note that the isolated stem-loop I (mRNA2), although containing stem S1 and the G-U/G-C motif, was unable to bind S15. Thus, we concluded that mRNA45 contained all essential determinants for S15 binding. In the preceding experiments, the mRNA fragments were uniformly labeled with 32P during in vitro transcription and therefore contained a terminal tri-phosphate group and a 30 OH. Surprisingly, labeling mRNA45 or mRNA67 by addition of a terminal [32P]pCp decreased the Kd by fourfold (43 nM). This unexpected effect was not due to the nature of the additional base residue but rather to the presence of an additional 30 -dangling nucleotide and negative charges (data not shown). This was interpreted by a stabilizing effect of the interaction through additional non-specific ionic contacts with S15 and/or to stabilization of stem S2.

Factors influencing the formation of the pseudoknot mRNA45 can potentially fold into two alternative structures, corresponding to either the pseudoknot or stem-loop I flanked by an unpaired 30 tail, referred as the “open” form (Figure 1(b)). To investigate the conformation of mRNA45, we probed the reactivity of N7 positions of purines to DEPC and NiCR that are both very sensitive to stacking.27,28 We found that only A(2 3) to A(þ 1) (in loop L2) were highly reactive to DEPC (Figures 2(a) and 3(b)). Besides, A(2 46) was reactive while A(2 47), A(2 43), A(2 41) and A(2 39) were only marginally modified. Remarkably, only G(þ 3) was modified by NiCR to a high extent, while G(2 42) and G(2 40) were only weakly modified. These results clearly indicated that the pseudoknot is

968

The mRNA Binding Sites of Ribosomal Protein S15

Figure 4. Footprinting experiments of S15 on mRNA45. (a) Hydroxyl radical footprint on 50 -labeled mRNA45 (20 pM) was at 20 8C in buffer D in the absence and in the presence of 20 or 40 pM of S15. (b) Footprinting with RNase V1 (1.5 unit) on 50 -labeled mRNA45 (6 pM) in the absence or in the presence of 40 pM of S15, for 15 minutes at 20 8C in buffer D. (c) Footprinting with RNase V1 (1.5 unit) and RNase T2 (0.006 unit) on 30 -labeled mRNA45 (20 pM), in the absence and presence of 20 or 40 pM of S15, for 15 minutes at 20 8C in buffer D. Alkaline ladder (lane L), RNase U2, T1 or from Bacillus cereus ladders (lane U2, T1, Bc, respectively). Protection from RNase V1 and hydroxyl radical is indicated by black or gray arrow heads (for strong and weak) and protection from RNase T2 by black and gray circles. Enhanced accessibility is denoted by (þ ). (nd), not determined.

predominantly formed, under the conditions used. This contrasts with the full-length mRNA operator (AB5313), in which A(2 3) to A(2 1) were only poorly reactive to DEPC while A(2 43) and A(2 41) were highly reactive.16 This can be explained by the effect of the deletion in loop L2. This deletion not only reduces the size of the loop, but also prevents the formation of stem-loop II that is in equilibrium with the pseudoknot in larger fragments. The absence of an alternative stable structure thus favors the formation of the pseudoknot. Then we used RNase T2, that cleaves unpaired nucleotides (with a preference for adenines), to follow folding of mRNA45 as a function of Mg2þ concentration and temperature (Figures 2(b) and 3(a)). In the absence of Mg2þ and at 20 8C, the resistance of stem S1 to cleavage, together with the sensitivity of the 30 tail of the RNA and the

apical loop of stem-loop I, indicates that the RNA is essentially in the open form. As the Mg2þ concentration increased, a clear reduction of cleavage of the 30 end of the RNA and of the 30 half of the apical loop was observed. In parallel, A(2 46) and nucleotides directly flanking stem S1 (U(2 3) to U(2 5)) became more susceptible to RNase T2 cleavage, thus resulting in a high sensitivity of both loops L1 and L2 of the pseudoknot. Unexpectedly, a strong cut still persisted at A(2 43) while U(2 45) and U(2 44) became more susceptible to RNase T2. On the other hand, increasing the temperature (in the presence of 5 mM Mg2þ) resulted in opposite effects, i.e. a melting of stem S2 accompanied by an enhanced accessibility of the 30 -part of the RNA (Figures 2(b) and 3(a)). Under the same conditions, stem S1 remained stable. Finally, mRNA45 was subjected to increasing concentrations of lead, which induces preferential

969

The mRNA Binding Sites of Ribosomal Protein S15

cleavage in flexible regions29 (Figures 2(c) and 3(c)). At low lead concentration, only U(2 44), A(2 43), U(2 4) and A(2 3) were cleaved. Increasing lead concentration enhanced or induced the appearance of cuts around these sites, leaving stem S1 and the proximal part of stem S2 relatively resistant to lead attack. There was a striking similarity between the lead-induced cleavage profile and the sensitivity to RNase T2. The occurrence of RNase T2 cuts and lead-induced cleavage at A(2 43), correlated with a low reactivity to DEPC, might reflect some instability of the distal part of stem S2 or/ and the persistence of a fraction of the RNA in the open form. In the latter case, the observed cleavages would reflect a hyper-susceptibility of the free apical loop to RNase T2 and lead around this position at high Mg2þ concentration. These results suggested that the pseudoknot is favored by increasing Mg2þ concentration and destabilized by temperature and that stem S2 unfolded before stem S1 upon increasing temperature. Our results are fully consistent with previous studies on thermal stability and ion requirement for pseudoknot stabilization.30 – 32 Recent high resolution structures of pseudoknots also revealed how Mg2þ (or monovalent ions) participate in pseudoknot stabilization.33,34

covering the G-U/G-C motif and A(2 46) bridging stems S1 and S2. In the absence of protein, RNase V1 cleaved in stem S1 and in the 30 -strand of stem S2. As expected no cleavage was observed in loop L2. Binding of S15 reduced accessibility of almost all cleavage sites, with the exception of C(230) that remained accessible, and C(2 37) and U(2 29) that showed an enhanced sensitivity. Finally, an almost complete protection to RNase T2 was observed at A(2 46) that bridges stem S1 and S2. Beside, loop L2 remains fully accessible, with the only exception of U(þ 2). It should be noted that A(2 43) still displayed a high susceptibility to RNase T2 cleavage. As mentioned above, this most likely accounted for the residual fraction of the RNA in the open form, which is not recognized by S15. These results are in general good agreement with previous footprinting results observed in the large context.16,17 One difference is the absence of protection in loop L2. Nevertheless, the protection observed in the large context was not necessarily accounted by direct protection but rather by possible tertiary interaction of loop L2 in the minor groove of stem S1. The footprint delineates a surface contact that covers the G-U/G-C motif in stem S1, the distal part of stem S2 and loop L1 bridging the two helices.

Footprint of protein S15 on mRNA45

Determinants of binding in mRNA45

The footprint of S15 on mRNA45 was then determined by hydroxyl radical cleavage and RNase V1 and T2 hydrolysis. Representative gels are shown in Figure 4 and the results are summarized in Figure 5. The hydroxyl radical footprint can be divided into two regions, one located in the distal part of stem S2, and the second one in stem S1,

Two types of substitution were introduced in mRNA45 (shown in Figure 6(a)). Natural base substitution was aimed at verifying that binding of mRNA45 obeys the same rules as those governing in vivo control. Substituting natural nucleotides by nucleotide analogs was designed to get a better description of the RNA determinants. The effect of

Figure 5. Summary of footprinting experiments on mRNA45. (a) Hydroxyl radical footprint. Protection is indicated by black or gray arrow heads (for strong and weak). (b) RNase V1 and T2 footprint. Cuts in the absence of S15 are indicated by blue bars (RNase V1) and red arrows (RNase T2), with three levels of cleavage: strong (thick), medium (thin), weak (dotted). Protection is indicated by black or gray circles (for strong and weak), enhanced accessibility is denoted by (þ).

970

The mRNA Binding Sites of Ribosomal Protein S15

Figure 7. Interaction between EcS15 and the variant mRNAs. Typical binding data are shown for wild-type mRNA45 (triangle), U(2 49)A(2 36) (square), I(236) (circles) and dSp(246) (diamond) derivatives. All RNAs are 30 -end labeled. Theoretical binding curves are calculated using one binding site assumption for wild-type RNA (Kd ¼ 51 nM and retention E ¼ 0:53) and two binding sites for the I(2 36) substitution (Kd1 ¼ 60:4 nM; E1 ¼ 0:2; Kd2 ¼ 3:9 mM; E2 ¼ 0:79). The theoretical binding curves for the two other RNAs are not shown, since saturation of binding was not reached during experiments and data could not be fitted well to the equation.

Figure 6. Effect of mutations and substitutions on S15 binding. (a) The changes are shown on the secondary structure of mRNA45 and the effect on binding is indicated as follows. Green, no effect; yellow, weak effect (Krel , 2); orange, strong effect (Krel . 25). (b) Schematic representation of the wild-type G-U wobble pair and its different variants (G-T, I-U, DAP-disoC).

as well as any attempt to replace the U(2 49)G(2 36) pair by either a canonical pair (U-A or CG), an inverted G-U pair or a non-canonical C·A pair led to a complete loss of specific binding. Also, the deletion of A(2 46) or its replacement by C abolished binding. These results are in full agreement with previous results,24,25 and indicate that mRNA45 is a valuable model to study mRNA – S15 interactions. The wobble G-U pair in the G-U/G-C motif

mutations on S15 binding was tested by a filter binding assay, using 30 -end labeled fragments. The Kd measured for wild-type mRNA45 was 43 nM, a value inferior to the value determined for uniformly or 50 -labeled fragment, as discussed in the first paragraph. Several binding curves are shown in Figure 7, and the results are summarized in Table 1. Although most of the mutations demonstrated monophasic binding curves assuming 1:1 complex, biphasic curves were obtained for diaminopurine-deoxyribo-iso-cytidine (DAP-disoC) and inosine-U (I-U) substitutions of the G-U pair (Figure 7). These curves were fitted to a binding isotherm that assumes formation of two stoichiometric protein– RNA complexes with different affinities and filter retention efficiencies.35 The lower affinity observed at high protein concentration is believed to correspond to recognition of an unfavorable conformation and unspecific binding. We found that inversion of the two A-U basepairs at the extremity of stem S2 had no effect on S15 binding. Inversion of the C(2 50)-G(2 35) pair,

It is known from the crystallographic structure of the T. thermophilus S15 –rRNA complex that the G667-C739 pair is specifically recognized through the minor groove by His41 and Asp48.10 One amino acid, Ser51, was found involved in the specific recognition of the wobble G666-U740 pair, via a water molecule making H-bonds with the exocyclic amino group of G(2 36) and O2 of U(2 49). In addition, the hydroxyl group of Ser51 was at a H-bond distance of the 20 OH of U740. The fact that these amino acid residues are conserved in the E. coli S15 protein suggests a common mode of recognition of the G-U/G-C motif in both mRNA and rRNA. To test this hypothesis, we substituted different functional groups of the G-U pair, potentially involved in S15 recognition. First, we replaced U(2 49) by rT. This substitution did not affect binding affinity, indicating that the addition of a methyl group in the major groove, close to the O2 group of the uracil ring did not impede recognition. The involvement of the 20 OH group of ribose (2 49) in protein

971

The mRNA Binding Sites of Ribosomal Protein S15

interaction was tested by replacing U(2 49) by its deoxyribonucleotide analog dT. This substitution did not reduce S15 binding. Then, we tested the involvement of the exocyclic amino group of G(2 36) by substituting G(2 36) by I, which lacks the amino group without altering the geometry of the base-pair (Figure 6(b)). The G to I substitution weakened binding by a factor of 2. On the other hand, replacing the G(2 36)-U(2 49) pair by DAPdisoC, which is isosteric with G-U (Figure 6(b)),36 had no significant effect on binding. This base-pair maintains the presence of an exocyclic amino group (positioned as in the G-U pair), but substitutes a 2-amino group for the O2 group present in the parent pyrimidine. Besides, the O6 group of the purine ring in the major groove is replaced by an amino group (Figure 6(b)). These results show that the substitution of G-U by canonical or non-canonical base-pairs dramatically affects binding, whereas punctual substitution of functional groups in both RNA grooves that do not alter the precise geometry of the ribose phosphate backbone has no or very little effect. Only the amino group of G was found to contribute modestly to the interaction, while neither the O2 group of U, nor the 20 OH group of its ribose moiety, make a significant contribution to binding. The energetic contribution of a single protein-base H-bond is 1 to 2 kcal/mol.37 Since the DG0 of the interaction is about 9.8 kcal/mol, the loss of one H-bond was expected to repress the affinity by about tenfold. Thus, our results contrasts with the well-known example of tRNAAla recognition by alanyl-tRNA synthetase, in which the acceptor stem G3-U70 pair of the tRNA was identified as a major determinant of identity. In the latter case, substitution of I-U for G3-U70 pair depressed the affinity for alanyl-tRNA synthetase by at least 20fold.38 Therefore, our data imply that neither the exocyclic amino group of G, nor the O2 and the 20 OH group of U is essential for S15 binding. More likely, the G-U pair influences binding indirectly through its effect on the conformation of the RNA, in particular the adjacent G-C. It was reported that an internal I-U pair is about 1 kcal/ mol less stable than a G-U pair, due to the loss of a structured water molecule H-bounded between the guanine amino group and the uracil.36,39 Notably, a water molecule was found in the S15 – 16 S rRNA complex, bridging the amino group of G666 and the O2 group of U740.10 Our conclusion that G-U is not directly recognized by S15 is further supported by preliminary results on the protein side (C. Portier et al., personal communication). Thus, the G-U/G-C motif is probably recognized in a way similar but not identical to the corresponding motif in rRNA. Noticeably the structural environment of the G-U/ G-C motif is different in both RNAs. It is flanked by regular Watson – Crick pairs in the mRNA, while directly adjacent to the irregular purine-rich motif in rRNA (Figure 1(c)). These differences might thus account for subtle differences of the

conformation of helix geometry around the G-U pair. The bridging A(2 46) Among the changes previously made at this position, only the G substitution was able to sustain control in vivo, with only a 1.5-fold reduction.24 Nevertheless, it was not clear whether the bridging A(2 46) is directly recognized by S15 or is involved in building a precise conformation of the pseudoknot. In particular, its deletion or its replacement by U was found to stabilize stem-loop I to the detriment of the pseudoknot, thus inhibiting binding and control indirectly.17 Here we showed the A to C change abolished binding without altering pseudoknot formation (see below). In addition, substitution of dA for A(2 46) indicated that the 20 OH of A(2 46) is not essential. However, its deletion or its replacement by a deoxyribose phosphate spacer missing the base ring (dSp for deoxyspacer) abolished binding. Taking into account the fact that A(2 46) is most likely bulging out, as indicated by its reactivity to DEPC in the free RNA, together with its protection upon binding of S15, our results are in favor of direct recognition of the base by S15. The fact that the A to G substitution is tolerated24 might point to the N7 group as a possible contact with the protein. Clearly, the identification of possible contact sites needs additional modified RNAs to be tested. Conformation of the RNA variants A complete interpretation of data also required us to verify the ability of the RNA variants to form the correct pseudoknot. Thus, RNAs were probed by RNase V1 and T2, which provided a reliable signature of both pseudoknot and open forms, and compared to the wild-type mRNA45. As expected, RNAs with mutations in stem S1 displayed RNase V1 cuts in both strands of stem S2 (with the 30 strand being more efficiently cleaved than the 50 strand), that are the signature of the pseudoknot formation. Only subtle changes in the RNase digestion profiles in the vicinity of the mutated sites were observed (not shown). However, mutations at A(2 46) clearly influenced the relative amount of pseudoknot and open forms (Figure 8). The substitution of A(2 46) by its deoxyribose analog (dA) did not affect the RNase cleavage profiles, with the only exception of dA which is expectedly not cleaved by RNase T2. The fraction of the open form was clearly enhanced by the deletion of A(2 46) (D-46) or its replacement by a deoxyribose phosphate link (dSp), as shown by increased RNase T2 cleavage in both strands of stem S2 (Figure 8). Thus, the loss of binding of S15 to these RNAs is mostly explained by their inability to form a stable and correctly folded pseudoknot. On the opposite, the replacement of A(2 46) by C resulted in a clear reduction of RNase T2 cuts in stem S2, concomitant with enhanced RNAse V1

972

Figure 8. Probing RNA variants with RNase V1 and T2. RNase digestion was as described in Materials and Methods. The most important changes as compared to wild-type mRNA45 (WT) are denoted by (þ) for enhanced and (2) for reduced accessibility. U2 and T1 RNase ladders, and alkaline ladder (L) are shown on the left.

cleavage (Figure 8). This indicates that the A to C change that abolished S15 binding did not prevent pseudoknot formation but instead stabilized it. Footprint of mRNA45 on protein S15 In order to get additional information on the interaction of S15 and its two RNA sites, we compared the footprints of both rRNA and mRNA on S15. The protein was labeled with radioactive ATP, after introducing a phosphorylation site at either its N or C terminus. After limited proteolysis in the presence and absence of RNA, the cleavage products were separated according to their size on SDS-gel electrophoresis and visualized by autoradiography. The labeled S15 was complexed with different RNA fragments derived from 16 S rRNA (a large one containing 183 nucleotides corresponding to position 584 –757 of 16 S rRNA and

The mRNA Binding Sites of Ribosomal Protein S15

the 57-nucleotide minimum fragment) or rpsO mRNA (mRNA AB5313, and mRNA45 containing 214 and 45 nucleotides, respectively). A representative footprinting experiment using Pronase, a proteinase with no cleavage specificity, is shown in Figure 9(a), and a summary of digestion with other proteases is presented in Figure 9(b). Cuts were assigned by analyzing the electrophoretic mobility of cleavage products generated by several amino acid-specific proteases (Figure 9(b)). All bands could not be unambiguously assigned, due to the absence of cuts at some potential cleavage sites, and to difficulties in fractionating the small peptides arising from the extremities of the protein. Nevertheless, an overall good estimation of cleavage positions was obtained. The interaction of labeled S15 with all fragments derived from rRNA or mRNA resulted in very similar footprint patterns, independently of their size. Rather unexpectedly, binding of rRNA or mRNA fragments induced extensive protection from Pronase hydrolysis, covering most of the protein, with the exception of residues in helix a2 (Figure 9). We verified that the high S15 and RNA concentrations used in the assay (in the 1 –2 mM range), did not account for non-specific binding in addition to specific contacts. Indeed, the observed protections appeared to result from specific binding, since tRNAs that are known not to interact with S15 did not induce any protection (see lane (t) in Figure 9(a)). Furthermore, a 16 S rRNA fragment carrying the G654C mutation13 and a mRNA variant lacking A(2 46), which lost their ability to bind S15, were unable to induce any protection (not shown). We also failed to detect any significant difference between the footprint of rRNA or mRNA, even using proteases of different specificity (not shown). An explanation for this surprising result must probably be found in the fact that the target molecule S15, is small as compared to its RNA ligand and the proteinases used for probing (which are two to sixfold bigger). Thus, the steric hindrance effect is most likely very important and should impede the target accessibility. Besides, specific interactions with RNAs should significantly stabilize the protein structure, indirectly reducing the cleavage rate. Nevertheless, the virtually identical protection patterns induced by rRNA and mRNA molecules indicate a similarity in the global arrangement of the two complexes. Modeling of the S15 – mRNA complex We used the crystallographic structure of the T. thermophilus rRNA – S15 complex10 and the already modeled pseudoknot17 to get further topological information on the mRNA complex compared to the rRNA complex. First, amino acid changes corresponding to the E. coli protein were introduced into the crystallographic structure of the T. thermophilus protein.13 Then, we docked the pseudoknot onto the S15 structure by superposing

The mRNA Binding Sites of Ribosomal Protein S15

973

Figure 9. RNA footprinting on protein EcS15HMKC. (a) Protein footprinting with Pronase of S15 free or complexed with different RNA fragments derived from 16 S rRNA (a large one containing 183 nucleotides corresponding to position 584– 757 of 16 S rRNA, and the 57-nucleotide minimum fragment) or rpsO mRNA (mRNA AB5313 and mRNA45 containing 214 and 45 nucleotides, respectively). Total E. coli tRNAs (t) were used as a source of unrelated RNAs. Incubation control (lane C), no RNA added (lane 2), 1 mM RNA (lanes 3, 5, 7, 10), 2 mM RNA added (lanes 4, 6, 8, 9, 11). Cleavage products were separated on 18% polyacrylamide/SDS-Tricine gel, and revealed by autoradiography. Bottom part of the gel is not shown. Lane C corresponds to a control without proteinase. (b) Summary of digestion/footprinting experiments with other proteinases. The bars are proteinase cleavages positioned as they would appear on a gel of the same size as the one shown in (a). Thickness of the bars is proportional to intensity of the cleavage. Band assignment is indicated on the left from the band. Bands in green denote protection by rRNA and mRNA fragments. Bands for which no footprinting information is available are in black. Asp-N and Glu-C were only used for helping band assignments. Secondary structure scheme of T. thermophilus S1510 is shown on the right. Tr, trypsin; L, Lys-C; Ar, Arg-C; As, Asp-N; G, Glu-C.

the G-U/G-C motif of the pseudoknot on the rRNA’s analogous motif (Figure 10(a)). The modeled pseudoknot conformation, with loop L1 containing only one nucleotide (A(2 46)), corresponds to the genetically defined form of the pseudoknot, competent in translational control.40 This single residue is sufficient to cross the major groove of the seven base-pair helix of stem S1 without helical twist and stem S2 was co-axially stacked on stem S1, forming a continuous helical domain.17 Nucleotide A(2 46), forming loop L1, was in a bulged out conformation accounting for its reactivity at N7 to DEPC. However, in the absence of defined constraints, its orientation was arbitrary. Nucleotides from loop L2 were removed with the exception of G(þ 3) the position of which is also arbitrary. We verified that nine nucleotides were sufficient to bridge stems S1 and S2. However, it clearly appeared that the length of the loop could not be reduced without altering the topology of the pseudoknot, in keeping with experimental data which defined the minimal size of the pseudoknot still able to bind S15 without loss of affinity (see first paragraph). Notably, the presence of the bulged U(2 53) might allow some flexibility in

stem S1. That loop L2 might establish interactions in the minor groove of stem S1 is probable, especially in the complete pseudoknot. Indeed, the high resolution structures of different pseudoknots revealed base triple or quadruple formation involving base – base, base –ribose or ribose zipper motif.33,34,41,42 Nevertheless, the fact that the size of loop L2 could be reduced and that no S15-induced protection was observed suggests that such interactions, if they exist, are not directly involved in S15 binding. It is clear that pseudoknot geometry relies on an interplay between the length of stems S1 and S2, the size of loops L1 and L2, and possible helical twist between the two base-pairs at the junction.42 However, the present model is primarily aimed to get topological information on the complex and not to describe the structure of the pseudo-knot at molecular level. The RNA pseudoknot could be docked onto S15 without steric clash, remarkably accounting for the hydroxyl radical footprint (Figure 10(b)). The model clearly indicated that the axes of helix H22 in rRNA and the helical domain formed by stems S1 and S2 in the pseudoknot, significantly diverged, while keeping the G-U/G-C motifs

974

The mRNA Binding Sites of Ribosomal Protein S15

Figure 10. Modeling of the interaction between E. coli S15 and its mRNA target site. (a) Superimposition of the mRNA pseudoknot17 and the crystallographic structure of the S15– rRNA complex.10 Amino acid changes corresponding to the E. coli protein were introduced into the crystallographic structure of the T. thermophilus protein.13 The protein and rRNA backbones are shown in green and gray, respectively. Nucleotides forming stem-loop I are represented in light blue (nucleotides 257 to 2 29) and the 30 part that interacts with stem S1 (nucleotides 4 to 10) resulting in the formation of stem S2 is in dark blue. Loop L2 is omitted with the exception of G(þ3), whose position is arbitrary. The G-U/G-C motifs of rRNA and mRNA are shown in red and yellow, respectively. (b) Hydroxyl radical footprint of S15 on mRNA. Colors are the same as in (a) and protections are indicated in red and yellow for strong and weak, respectively. Although the position of the bulged A(246) forming loop L1 is arbitrary, it can be seen that potential contacts might occur between the base ring and residues in helix a3. Stereoscopic views were drawn with ViewerLite.

superposed. This is clearly due to the presence in H22 of the purine-rich loop that induces an important widening of the deep groove.10 Furthermore, the looped out C748 also results in a significant kink of the helical axis. Notably, the part of S15 that recognizes the rRNA three-way junction (C-terminal part of helix a3 and loop 4) does not appear to be involved in the mRNA pseudoknot recognition (Figure 10(b)). This probably accounts for the large difference of stability measured between the rRNA and mRNA complexes. Accord˚ 2 from ingly, rRNA was found to shield 2600 A solvent on the accessible surface of S15 (calculated by CNS43), while mRNA was calculated to shield ˚ 2 in the proposed model. On approximately 1600 A the other hand, the N-terminal part of helix a3

and loop 1, which recognize helix H22 of 16 S rRNA through the minor groove above the threeway junction, appear to be in a favorable position to contact the minor groove of the distal part of stem S2 of the pseudoknot (Figure 10(b)). Otherwise, the model predicts that specific contacts might be formed between S15 (most likely in helices a2 and a3) and the pseudoknot. In particular, the looped out A(2 46) represents a potential candidate for establishing such specific interaction. However, any attempt to describe the S15 – mRNA complex in more details remains speculative at that level. An extensive mutagenesis work on the S15 side will provide further clues to understand in more detail the structural basis of the interaction. The model also accounts for the fact that

975

The mRNA Binding Sites of Ribosomal Protein S15

S15 binding does not impede the recognition of the 30 S subunit to the Shine-Dalgarno sequence. Indeed, loop L2 (which is not represented in the model) is located on the other side of the pseudoknot, as compared to S15. Notably, the E. coli translational operator apparently differs from that of B. stearothermophilus, which might share a threeway junction motif with rRNA.26 These results emphasize the versatility of RNA –protein recognition rules.

Materials and Methods Chemicals and enzymes DMS was from Fluka, DEPC from Sigma and H202 from Merck. Acrylamide and N,N0 -methylene bis-acrylamide were from BDH Chemicals. KHSO5 (in the form 2KHSO5·KHSO4·K2SO4, oxone) was purchased from Aldrich. NiCR [(2,12-dimethyl-3,7,11,17-tetraazabicyclo[11.3.1]heptadeca-1(17),2,11,13,15-pentaenato)nickel(II) perchlorate] was kindly provided by Dr S. Rokita. Radiochemicals were from New England Nuclear. T4 DNA ligase, restriction enzymes and Vent DNA polymerase were from New England Biolabs. RNA ligase and RNases were from Pharmacia Biotech. Phage T4 polynucleotide kinase was from US Biochemical Co. Heart muscle kinase (HMK) was from Sigma, proteinases from Roche Molecular Biochemicals. Phage T7 RNA polymerase was purified from the overproducing strain BL21/pAR1219, following the purification protocol provided by F. W. Studier. Pefabloc was from Interchim. Preparation of biological materials The wild-type mRNA AB5313 was transcribed from the plasmid DNA linearized by Sal I.24 The mRNA fragments used for minimization were obtained by in vitro transcription with phage T7 RNA polymerase from double-stranded DNA templates. Most of the doublestranded DNA templates were obtained by annealing of two complementary single-stranded oligonucleotides, containing the T7 promoter and sequence of interest. Fragment 584– 757 from E. coli 16 S rRNA was prepared as described by Serganov et al.13 The minimum 57nucleotide rRNA fragment that binds S15 was designed on similar bases to that of T. thermophilus10 and has the following sequence: 50 GGGCGGUCUUCGGGCUUGAGUCUCGUAGAGGGGAAACCUGGACGACGAAACUGACGCUC30 . Uniformly labeled RNAs were prepared by in vitro transcription with T7 RNA polymerase in the presence of [a-32P]ATP (3000 Ci/mmol). After transcription the reaction mixture was treated with DNase I. RNAs were purified by electrophoresis on 8 or 15% (w/v) polyacrylamide/8 M urea gels. Labeled RNAs were recovered from the gels by passive elution followed by phenol – chloroform extraction and ethanol-precipitation. 50 -End labeling of dephosphorylated RNAs was performed at 37 8C with [g-32P]ATP and T4 polynucleotide kinase according to the manufacturers protocol (New England Biolabs). Labeling at 30 -end was conducted with [g-32P]pCp and T4 RNA ligase.44 Chemical RNA synthesis was made using TOM-phosphoramidites by Xeragon (Switzerland). RNAs were renatured at 42 8C for 15 minutes in buffer A (50 mM Tris –HCl (pH 7.5), 20 mM MgCl2, 270 mM KCl, 5 mM dithiothreitol, 0.02% (w/v) bovine serum albumin) and chilled on ice.

Protein S15 from E. coli was purified under non-denaturing conditions as described by Serganov et al.13 with two extra steps: chromatography on hydroxyapatite (Bio-Rad) and gel-filtration on Superdex 75 (Pharmacia Biotech). Protein binding assays Filter binding assays were conducted in buffer A as described,45 using 10,000 cpm of labeled RNA (, 0.1 pM) and increasing concentrations of S15 (0.1 nM to 0.1 mM). Non-specific retention of RNAs (1– 5%) was measured by filtration of the reaction mixture without the protein. The apparent dissociation constants (Kd) were determined as the concentration of S15 necessary to obtain half-saturation, assuming that complex formation obeys a simple bimolecular equilibrium and concentration of the labeled RNA is negligible. Results were fitted with the equation: Q ¼ ½S15=ðKd þ ½S15Þ where Q represents the fraction of radiolabeled RNA bound to the filter. In the case of biphasic binding, the data were also fitted with a binding isotherm that assumes that protein binds independently to two different RNA sites with different dissociation constants and different filter retention efficiencies. Fitting was done using Sigma Plot (Jandel Scientific, San Rafael, USA) and Microcal Origin (Microcal Software, Northampton, MA) softwares. In competition experiments we used a constant concentration of S15 (6 nM), negligible amount of labeled E. coli wild-type 16 S rRNA fragment46 and variable concentrations (0.5 nM to 2 mM) of unlabeled mRNA. Competition experiments were fitted with Lin and Riggs equations (5)47 using Sigma Plot. Dissociation constants are the average of at least two experiments conducted with different protein and labeled RNA samples. Typical standard errors do not exceed 30%. Radioactivity on the gels was quantified using a BAS 2000 BioImager (Fuji). Probing RNA and footprinting All assays contained 100,000 cpm of radioactively labeled mRNA and 1 to 2 mg of unlabeled total E. coli tRNA. RNA probing experiments with RNases and chemicals were conducted at 20 8C in 20 ml buffer B (50 mM sodium cacodylate (pH 7.5), 100 mM KCl, 5 mM MgCl2) unless otherwise stated. Probing by RNase V1 and RNase T2 was done for 15 minutes with 0.26 unit and 0.007 unit of nuclease, respectively. Modification of (N7)A was done with 2 and 4 ml of DEPC for 30 minutes. Modification of (N7)G by nickel was done by addition of 1 ml of 60 mM NiCR and 1 ml of 1 mM KHSO528 for 15 and 30 minutes. Reaction was stopped by addition of 10 mM EDTA. All modified samples were then treated with aniline.48 Lead (II) cleavage was conducted in buffer C (50 mM Hepes-KOH (pH 7.5), 100 mM potassium acetate and 5 mM Mg acetate) with 0.7, 1.4, 2.8, and 5.6 mM of lead acetate for 15 minutes. Reaction was stopped by addition of 10 mM EDTA. All cleaved RNA samples were precipitated by ethanol at 220 8C, dissolved in urea-containing buffer and analyzed on 15% polyacrylamide/8 M urea gels together with alkaline ladder and sequencing reactions performed by nucleases from Bacillus cereus, T1, and U2. In footprinting experiments, unlabeled RNA was added to the labeled RNA at the desired concentration.

976

The S15– RNA complexes were formed by incubating RNA and S15 (added at the indicated concentration) at 37 8C for 30 minutes in buffer D (buffer B with 0.02% bovine serum albumin), chilled on ice and equilibrated at reaction temperature. Fe(II)-EDTA-generated hydroxyl radical cleavage reaction was as previously described45 and the reaction was stopped by addition of 10 mM thiourea. RNAs were extracted by phenol – chloroform, ethanol-precipitated and analyzed as above.

Footprinting RNA on S15 A phosphorylation site (RRASV) was introduced either at the N or C terminus of the protein. The sites were introduced by PCR using wild-type S15 gene as template and oligonucleotides 50 CGAATTCCATATGTCTCTAAGTACTGAAGCAACAG and 50 ATAGGATCCTTAAACAGATGCGCGACGCAGACCCAGGCGCTCGAT for C-terminal modification (EcS15HMKC), and CGAATTCCATATGGCACGTCGCGCATCTGTAAGTACTGAAGCAACAGCTAAAAT and ATAGGATCCTTAGCGACGCAGACCCAGGCGCTC for N-terminal modification (EcS15HMKN). After PCR amplification, the DNA fragments were purified on agarose gel, cleaved by Nde I and Bam HI restriction enzymes and cloned into the corresponding sites of the pET11c vector.49 EcS15HMKC had three extra residues (ASV) on its C terminus. The N-terminal sequence of EcS15HMKN (ARRASVS) contained four extra residues and a L/V substitution, compared to the wild-type sequence SLS. Both EcS15HMKN and EcS15HMKC were expressed and purified as wildtype S15, their molecular weight was verified by massspectrometry, and RNA-binding properties were assayed in filter binding experiments. Both proteins bound both E. coli 16 S rRNA fragment (nt 584– 757) and mRNA AB5313 with affinities similar to the wild-type S15. Since EcS15HMKC is less modified, most of the footprinting experiments were done with this protein variant. The engineered proteins (3 mg) were labeled with HMK (one unit) in the presence of 5 ml of [g-32P]ATP (3000 Ci/mM) in 20 ml of buffer containing 20 mM Tris – HCl (pH 7.5), 100 mM NaCl, 12 mM MgCl2, 2 mM DTE, at 25 8C for 15 minutes. Reaction was diluted with the same buffer to 500 ml, and unincorporated ATP was removed by multiple rounds of concentration/dilution using Microcon-3 (Millipore). BSA (10 mg) was routinely added to the solution to prevent non-specific adsorption of the protein on the membrane during filtration. For footprinting experiments, labeled S15 (200,000 cpm) was mixed with unlabeled protein to a final concentration of 1 mM. The RNA –protein complex was formed by incubation with the selected RNA (1 mM to 2 mM) at 37 8C for 15 minutes in buffer E (20 mM Hepes-KOH (pH 7.6), 100 mM KCl, 10 mM MgCl2, 5 mM DTT, 100 mg/ml BSA). The reaction mixtures were chilled on ice and equilibrated at 25 8C. Digestion with proteases was carried out in 10 ml at 25 8C for 15 minutes in the same buffer. CaCl2 (1 mM) was added to Arg-C, and cysteine (1 mM) to Asp-N. Proteolytic digestions were performed with Arg-C (0.0125 unit), Asp-N (0.3 unit), Glu-C (30 ng), Lys-C (0.00333 unit), Pronase (20 ng), trypsin (100 ng). The reaction was stopped by addition of Pefabloc (4 mM), plus EDTA (10 mM) in the case of Asp-N reaction. Three ml of 5 £ SDS loading buffer50 were added to the tubes, the samples were denatured at 90 8C for two minutes, chilled on ice, and half of each mix was immediately loaded on the gel. Cleavage products were

The mRNA Binding Sites of Ribosomal Protein S15

fractionated using 6% stacking/20% separation polyacrylamide/SDS-Tricine gel electrophoresis.51 The gels (20 cm £ 40 cm £ 0.04 cm) were run at 50 mA for 18 hours and subjected to autoradiography. Computer modeling The E. coli S15 – mRNA complex was modeled with the program O,52 using the pseudoknot mRNA model17 and the S15 protein from T. thermophilus10 mutated to the E. coli sequence.13 All Figures were done with ViewerLite (Accelrys Inc).

Acknowledgments P. Romby is thanked for helpful discussions and comments on the manuscript. This work was supported by the Centre National de la Recherche Scientifique (CNRS). A.S. was successively a fellow of the CNRS within the Frensh-Russian Scientific Collaboration framework and from the Fondation pour la Recherche Me´dicale (FRM).

References 1. Nomura, M., Yates, J. L., Dean, D. & Post, L. E. (1980). Feedback regulation of ribosomal protein gene expression in Escherichia coli: structural homology of ribosomal RNA and ribosomal protein mRNA. Proc. Natl Acad. Sci. USA, 77, 7084– 7088. 2. Zengel, J. M. & Lindahl, L. (1994). Diverse mechanisms for regulating ribosomal protein synthesis in Escherichia coli. Prog. Nucl. Acid Res. 47, 331–370. 3. Springer, M., Portier, C. & Grunberg-Manago, M. (1998). RNA mimicry in the translational control. In RNA Structure and Function (Simons, R. W. & Grunberg-Manago, M., eds), pp. 377– 413, Cold Spring Harbor Laboratory Press, Cold Spring Harbor. 4. Said, B., Cole, J. R. & Nomura, M. (1988). Mutational analysis of the L1 binding site of 23 S rRNA in Escherichia coli. Nucl. Acids Res. 16, 10529– 10545. 5. Jiang, W. H. & Zimmermann, R. A. (1994). The binding site for ribosomal protein S8 in 16 S rRNA and spc mRNA from Escherichia coli: minimum structural requirements and the effects of single bulged bases on S8 –RNA interaction. Nucl. Acids Res. 22, 1687– 1695. 6. Graffe, M., Dondon, J., Caillet, J., Romby, P., Ehresmann, C., Ehresmann, B. & Springer, M. (1992). The specificity of translational control switched with transfer RNA identity rules. Science, 255, 994– 996. 7. Romby, P., Caillet, J., Ebel, C., Sacerdot, C., Graffe, M., Eyermann, F. et al. (1996). The expression of E. coli threonyl-tRNA synthetase is regulated at the translational level by symmetrical operator – repressor interactions. EMBO J. 15, 5976– 5987. 8. Sankaranarayanan, R., Dock-Bregeon, A. C., Romby, P., Caillet, J., Springer, M., Rees, B. et al. (1999). The structure of threonyl-tRNA synthetase-tRNA (Thr) complex enlightens its repressor activity and reveals an essential zinc ion in the active site. Cell, 97, 371– 381.

The mRNA Binding Sites of Ribosomal Protein S15

9. Torres-Larios, A., Dock-Bregeon, A.-C., Romby, P., Ress, B., Sankaranarayanan, R., Caillet, J. et al. (2002). Structural basis of translational control by Escherichia coli threonyl-tRNA synthetase. Nature Struct. Biol. 9, 343– 347. 10. Nikulin, A., Serganov, A., Ennifar, E., Tishchenko, S., Nevskaya, N., Shepard, W. et al. (2000). Crystal structure of the S15– rRNA complex. Nature Struct. Biol. 7, 273–277. 11. Agalarov, S. C., Prasad, G., Funke, P. M., Stout, C. D. & Williamson, J. R. (2000). Structure of the S15,S6,S18 –rRNA complex: assembly of the 30 S ribosome central domain. Science, 288, 107– 112. 12. Wimberly, B. T., Brodersen, D. E., Clemons, W. M., Morgan-Warren, R. J., Carter, A. P., Vonrhein, C. et al. (2000). Structure of the ribosomal subunit. Nature, 407, 327– 339. 13. Serganov, A., Be´nard, L., Portier, C., Ennifar, E., Garber, M., Ehresmann, B. & Ehresmann, C. (2001). Role of conserved nucleotides in building the 16 S rRNA binding site for ribosomal protein S15. J. Mol. Biol. 305, 785– 803. 14. Agalarov, S. C. & Williamson, J. R. (2000). A hierarchy of RNA subdomains in assembly of the central domain of the 30 S ribosomal subunit. RNA, 6, 402–408. 15. Portier, C., Dondon, L. & Grunberg-Manago, M. (1990). Translational autocontrol of the Escherichia coli ribosomal protein S15. J. Mol. Biol. 211, 407– 414. 16. Philippe, C., Portier, C., Mougel, M., GrunbergManago, M., Ebel, J. P., Ehresmann, B. & Ehresmann, C. (1990). Target site of Escherichia coli ribosomal protein S15 on its messenger RNA. Conformation and interaction with the protein. J. Mol. Biol. 211, 415–426. 17. Philippe, C., Be´nard, L., Portier, C., Westhof, E., Ehresmann, B. & Ehresmann, C. (1995). Molecular dissection of the pseudoknot governing the translational regulation of Escherichia coli ribosomal protein S15. Nucl. Acids Res. 23, 18 – 28. 18. Gultyaev, A. P., van Batenburg, F. H. & Pleij, C. W. (1999). An approximation of loop free energy values of RNA H-pseudoknots. RNA, 5, 609–617. 19. Philippe, C., Eyermann, F., Benard, L., Portier, C., Ehresmann, B. & Ehresmann, C. (1993). Ribosomal protein S15 from Escherichia coli modulates its own translation by trapping the ribosome on the mRNA initiation loading site. Proc. Natl Acad. Sci. USA, 90, 4394–4398. 20. Ehresmann, C., Philippe, C., Westhof, E., Benard, L., Portier, C. & Ehresmann, B. (1995). A pseudoknot is required for efficient translational initiation and regulation of the Escherichia coli rpsO gene coding for ribosomal protein S15. Biochem. Cell. Biol. 73, 1131– 1140. 21. Draper, D. E. (1987). Translational regulation of ribosomal proteins in Escherichia coli. Molecular mechanisms. In Translational Regulation of Gene Expression (Ilan, J., ed.), pp. 1 – 26, Plenum Press, New York. 22. Spedding, G. & Draper, D. E. (1993). Allosteric mechanism for translational repression in the Escherichia coli alpha operon. Proc. Natl Acad. Sci. USA, 90, 4399–4403. 23. Schlax, P. J. & Draper, D. E. (2001). Translational repression of the Escherichia coli a operon mRNA. Importance of an mRNA conformational switch and a ternary entrapment complex. J. Biol. Chem. 276, 38494– 38501.

977 24. Be´nard, L., Philippe, C., Dondon, L., GrunbergManago, M., Ehresmann, B., Ehresmann, C. & Portier, C. (1994). Mutational analysis of the pseudoknot structure of the S15 translational operator from Escherichia coli. Mol. Microbiol. 14, 31– 40. 25. Be´nard, L., Mathy, N., Grunberg-Manago, M., Ehresmann, B., Ehresmann, C. & Portier, C. (1998). Identification in a pseudoknot of a U.G motif essential for the regulation of the expression of ribosomal protein S15. Proc. Natl Acad. Sci. USA, 95, 2564– 2567. 26. Scott, L. G. & Williamson, J. R. (2001). Interaction of the Bacillus stearothermophilus ribosomal protein S15 with its 50 -translational operator mRNA. J. Mol. Biol. 314, 413– 422. 27. Ehresmann, C., Baudin, F., Mougel, M., Romby, P., Ebel, J. P. & Ehresmann, B. (1987). Probing the structure of RNAs in solution. Nucl. Acids Res. 15, 9109 –9128. 28. Chen, X., Woodson, S. A., Burrows, C. J. & Rokita, S. E. (1993). A highly sensitive probe for guanine N7 in folded structures of RNA: application to tRNAPhe and Tetrehymena group 1 intron. Biochemistry, 32, 7610 –7616. 29. Gornicki, P., Baudin, F., Romby, P., Wiewiorowski, M., Kryzosiak, W., Ebel, J. P. et al. (1989). Use of lead(II) to probe the structure of large RNA’s. Conformation of the 30 terminal domain of E. coli 16 S rRNA and its involvement in building the tRNA binding sites. J. Biomol. Struct. Dyn. 6, 971–984. 30. Wyatt, J. R., Puglisi, J. D. & Tinoco, I., Jr (1990). RNA pseudoknots. Stability and loop size requirements. J. Mol. Biol. 214, 455– 470. 31. Gluick, T. C., Gerstner, R. B. & Draper, D. E. (1997). Effects of Mg2þ, Kþ, and Hþ on an equilibrium between alternative conformations of an RNA pseudoknot. J. Mol. Biol. 270, 451– 463. 32. Giedroc, D. P., Theimer, C. A. & Nixon, P. L. (2000). Structure, stability and function of RNA pseudoknots involved in stimulating ribosomal frameshifting. J. Mol. Biol. 298, 167– 185. ˚ 33. Nix, J., Sussman, D. & Wilson, C. (2000). The 1.3 A crystal structure of a biotin-binding pseudoknot and the basis for RNA molecular recognition. J. Mol. Biol. 296, 1235– 1244. 34. Su, L., Chen, L., Egli, M., Berger, J. M. & Rich, A. (1999). Minor groove RNA triplex in the crystal structure of a ribosomal frameshifting viral pseudoknot. Nature Struct. Biol. 6, 285– 292. 35. Gerstner, R. B., Pak, Y. & Draper, D. E. (2001). Recognition of 16 S rRNA by ribosomal protein S4 from Bacillus stearothermophilus. Biochemistry, 40, 7165 –7173. 36. Strobel, S. A., Cech, T., Usman, N. & Beigelman, L. (1994). The 2,6-diaminopurine riboside·5-methylisocytidine wobble base pair: an isoenergetic substitution for the study of G·U pairs in RNA. Biochemistry, 33, 13824– 13835. 37. Lesser, D. R., Kurpiewski, M. R. & Jen-Jacobson, L. (1990). The energetic basis of specificity in the EcoR1 endonuclease DNA interaction. Science, 250, 776 –786. 38. Musier-Forsyth, K., Bartel, D. P., Szostak, J. W., Horvath, S. J. & Feigon, J. (1994). Specificity for aminoacylation of an RNA helix: an unpaired, exocyclic amino group in the minor groove. Science, 253, 784– 786. 39. Holbrook, S. R., Cheong, C., Tinoco, I. & Kim, S. H. (1991). Crystal structure of an RNA double helix

978

40.

41.

42.

43.

44. 45.

The mRNA Binding Sites of Ribosomal Protein S15

incorporating a track of non-Watson –Crick base pairs. Nature, 353, 579– 581. Be´nard, L., Philippe, C., Dondon, L., GrunbergManago, M., Ehresmann, B., Ehresmann, C. & Portier, C. (1994). Mutational analysis of the pseudoknot structure of the S15 translational operator from Escherichia coli. Mol. Microbiol. 14, 31 – 40. Kolk, M. H., Van der Graaf, M., Wijmenga, S. S., Pleij, C. W. A., Heus, H. A. & Hilbers, C. W. (1998). NMR structure of a classical RNA pseudoknot: interplay of single- and double-stranded RNA. Science, 280, 434– 439. Michiels, P. J. A., Versleijen, A. A. M., Verlaan, P. W., Pleij, C. W. A., Hilbers, C. W. & Heus, H. A. (2001). Solution structure of the pseudoknot of SRV-1 RNA, involved in ribosomal frame-shift. J. Mol. Biol. 310, 1109 –1123. Bru¨nger, A. T., Adams, P. D., Clore, G. M., DeLano, W. L., Gros, P., Grosse-Kunstleve, R. W. et al. (1998). Crystallography and NMR system: a new software suited for macromolecular structure determination. Acta Crystallog. sect. D, 54, 905– 921. England, T. E. & Uhlenbeck, O. C. (1978). 30 -Terminal labeling of RNA with T4 RNA ligase. Nature, 275, 560– 561. Serganov, A. A., Masquida, B., Westhof, E., Cachia, C., Portier, C., Garber, M. et al. (1996). The 16 S rRNA binding site of Thermus thermophilus ribosomal protein S15: comparison with Escherichia coli S15, minimum site and structure. RNA, 2, 1124– 1138.

46. Mougel, M., Philippe, C., Ebel, J. P., Ehresmann, B. & Ehresmann, C. (1988). The E. coli 16 S rRNA binding site of ribosomal protein S15: higher-order structure in the absence and in the presence of the protein. Nucl. Acids Res. 16, 2825– 2839. 47. Lin, S.-Y. & Riggs, A. D. (1972). lac repressor binding to non-operator DNA: detailed studies and comparison of equilibrium and rate competition methods. J. Mol. Biol. 72, 671–690. 48. Peattie, D. A. & Gilbert, W. (1980). Chemical probes for higher-order structure in RNA. Proc. Natl Acad. Sci. USA, 77, 4679– 4682. 49. Studier, F. W., Rosenberg, A. H., Dunn, J. J. & Dubendorff, J. W. (1990). Use of T7 polymerase to direct expression of cloned genes. Methods Enzymol. 185, 60 – 89. 50. Lykke-Andersen, J. & Garrett, R. A. (1997). RNA– protein interactions of an archaeal homotetrameric splicing endoribonuclease with an exceptional evolutionary history. EMBO J. 16, 6292– 6300. 51. Schagger, H. & von Jagow, G. (1987). Tricine-sodium dodecyl sulfate-polyacrylamide gel electrophoresis for the separation of proteins in the range from 1 to 100 kDa. Anal. Biochem. 166, 368– 379. 52. Jones, T. A., Zhou, J. Y., Cowan, S. W. & Kjeldgaard, M. (1991). Improved methods for the building of protein models in electron density maps and the location of errors in these models. Acta Crystallog. sect. A, 47, 110 – 119.

Edited by J. Karn (Received 14 March 2002; received in revised form 13 May 2002; accepted 3 June 2002)