Docosahexaenoic acid inhibits mechanical allodynia and thermal hyperalgesia in diabetic rats by decreasing the excitability of DRG neurons

Experimental Neurology 271 (2015) 291–300

Contents lists available at ScienceDirect

Experimental Neurology journal homepage: www.elsevier.com/locate/yexnr

Docosahexaenoic acid inhibits mechanical allodynia and thermal hyperalgesia in diabetic rats by decreasing the excitability of DRG neurons Li-Jun Heng a,b,1, Rui Qi c,1, Rui-Hua Yang c,⁎, Guo-Zheng Xu a,⁎ a b c

Department of Neurosurgery, Wuhan General Hospital of Guangzhou Military Command, Wuhan, Hubei 430070, China Department of Neurosurgery, Tangdu Hospital of Fourth Military Medical University, Xi'an, Shaanxi 710038, China Department of Nutrition and Food Hygiene, School of Public Health, The Fourth Military Medical University, Xi'an 710032, China

a r t i c l e

i n f o

Article history: Received 20 March 2015 Received in revised form 7 June 2015 Accepted 24 June 2015 Available online 26 June 2015 Keywords: Painful diabetic neuropathy Docosahexaenoic acid Dorsal root ganglion Neuron excitability Sodium channel Potassium channel

a b s t r a c t Diabetes mellitus is a common metabolic disease in human beings with characteristic symptoms of hyperglycemia, chronic inflammation and insulin resistance. One of the most common complications of early-onset diabetes mellitus is peripheral diabetic neuropathy, which is manifested either by loss of nociception or by allodynia and hyperalgesia. Dietary fatty acids, especially polyunsaturated fatty acids, have been shown the potential of antiinflammation and modulating neuron excitability. The present study investigated the effects of docosahexaenoic acid (DHA) on the excitability of dorsal root ganglion (DRG) neurons in streptozotocin (STZ)-induced diabetes rats. The effects of DHA on the allodynia and hyperalgesia of diabetic rats were also evaluated. Dietary DHA supplementation effectively attenuated both allodynia and hyperalgesia induced by STZ injection. DHA supplementation decreased the excitability of DRG neurons by decreasing the sodium currents and increasing potassium currents, which may contribute to the effect of alleviating allodynia and hyperalgesia in diabetic rats. The results suggested that DHA might be useful as an adjuvant therapy for the prevention and treatment of painful diabetic neuropathy. © 2015 Elsevier Inc. All rights reserved.

1. Introduction Diabetes mellitus (DM) is a metabolic disease in human beings with characteristic symptoms of hyperglycemia, chronic inflammation (Leinonen et al., 2004; Martins et al., 2010) and insulin resistance. Painful diabetic neuropathy (PDN) is a neurological disorder that is a common complication of diabetes. Patients with PDN can suffer from painful disorder characterized by hyperalgesia and allodynia. The mechanisms underlying abnormal nociception in diabetes are unclear. Inflammatory cytokines were proved to play an important role in the development of neuropathic pain (Xu et al., 2006; Sommer and Kress, 2004). It has been reported that abnormal hyperexcitability of primary sensory neurons contributed to the exaggerated pain associated with diabetic neuropathy (Hong et al., 2004a; Sun et al., 2012a; Jackson and Bean, 2007). It has been shown that Nav1.7 and Nav1.8 were over-expressed and the transient sodium current was increased significantly in small dorsal root ganglion (DRG) neurons Abbreviations: STZ, streptozotocin; DM, diabetes mellitus; PDN, painful diabetic neuropathy; PUFAs, polyunsaturated fatty acids; DHA, docosahexaenoic acid; EPA, eicosapentaenoic acid; DRG, dorsal root ganglion; ACSF, artificial cerebrospinal fluid; AP, action potential; TTX, tetrodotoxin; TTX-S, TTX-sensitive; TTX-R, TTX-resistant. ⁎ Corresponding authors. E-mail addresses: [email protected] (R.-H. Yang), [email protected] (G.-Z. Xu). 1 These authors contributed equally to this work.

http://dx.doi.org/10.1016/j.expneurol.2015.06.022 0014-4886/© 2015 Elsevier Inc. All rights reserved.

in streptozotocin (STZ)-induced diabetic rats (Hong et al., 2004a; Sun et al., 2012a). Sun et al. (2012b) reported that diabetes caused a decrease of potassium currents in small DRG neurons. In contrast to the well-studied small DRG neurons in PDN, the role of medium and large DRG neurons in diabetic states has rarely been examined. Cao et al. (2010) reported that the density of potassium currents was markedly reduced in dissociated medium and large, but not small DRG neurons in diabetic rats, which suggested that the medium and large diameter DRG neurons might contribute to the development and maintenance of painful diabetic neuropathy. N − 3 polyunsaturated fatty acids (PUFA) have been shown antiinflammatory role in the nervous system (Belayev et al., 2011; Moranis et al., 2012; Song et al., 2009; Luchtman et al., 2012). In addition, it has been reported that n − 3 PUFA had beneficial effects in pain states (Kremer et al., 1990; Tomer et al., 2001). In rat DRG neurons, extracellular docosahexaenoic acid (DHA, C22:6 n − 3) and eicosapentaenoic acid (EPA, C20:5 n − 3) inhibited sodium current and reduced neuron excitability (Hong et al., 2004a). Although many studies show pain relief effects of n −3 PUFA, the effects of n−3 PUFA on the DRG in diabetes are not fully known. Therefore, the purpose of the current study was to elucidate the contribution of medium and large DRG neurons to the development of mechanical allodynia and thermal hyperalgesia in diabetic rats. We further explored the effect of DHA on PDN and its cellular mechanisms.

292

L.-J. Heng et al. / Experimental Neurology 271 (2015) 291–300

2. Material and methods 2.1. Animal model and DHA deliver A total of 100 adult (200–230 g) male Sprague–Dawley rats were housed individually and kept on a reversed light–dark 12–12 h cycle, and food and water were available ad libitum. Animal care was in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals, and was approved by the Animal Use and Protection Committee of our University. All efforts were made to minimize animal suffering. Diabetes was induced by a 60 mg/kg intraperitoneal injection of STZ (Sigma, St. Louis, MO, USA). Control animals received saline injection. Ten days before STZ administration, 40 animals were randomly divided into four groups, which were the control group, diabetic group, control + DHA and diabetic + DHA group. DHA was dissolved in corn oil to the concentration of 100 mg/mL. DHA was supplemented daily in the morning via gavage (200 mg/kg body weight) during the whole experimental period. The control group and diabetic group received corn oil (0.2 mL/kg body weight). Blood glucose levels were monitored with a blood glucometer (OneTouch II; Johnson) beginning on day 3 after STZ injection. Animals were considered diabetic if plasma glucose levels exceeded 16.7 mmol/L (Fig. 1A). Body weights were assessed weekly. In a separate experiment, local DHA delivery was performed from 12 days to 23 days after STZ injection through a PE-10 catheter, which has been implanted intrathecally in rats (Obata et al., 2004). Briefly, a laminectomy of the L5 vertebra was performed under anesthesia with sodium pentobarbital. The dura was cut, and a soft tube (PE-10) was inserted into the subarachnoid space of the spinal cord at the L4/5

DRG level. The position of the catheter was checked postmortem. DHA (50, 100 and 200 μM) was injected intrathecally (10 μL) and flushed with 10 μL of saline. The vehicle group received same volume of vehicle (saline contained 3% DMSO) injection.

2.2. Behavioral testing Animals were inspected and tested three times prior to STZinjection and every four days for 32 days after STZ-injection, for a total of 11 testing sessions. To quantify withdrawal to punctate mechanical stimulation of the foot (mechanical allodynia), the rat was placed in a clear plastic cage with a floor of metal mesh. The cage was elevated so that stimuli could be applied to each hind foot from beneath the cage. Von Frey filament of any given force was applied 10 times and the percentage of withdrawal responses was plotted as a function of force; the mechanical threshold was defined as the force corresponding to a 50% withdrawal (Fuchs et al., 2010). The method of Hargreaves et al. (1988) was used to assess pawwithdrawal latency to a thermal nociceptive stimulus (thermal hyperalgesia). Rats were placed in a plastic enclosure on top of the glass surface and allowed to acclimate for 30 min before testing. A mobile radiant heat source (a high-intensity light beam) located under the glass was focused onto the plantar surface of hind paw. The paw-withdrawal latency was recorded by a digital timer. Stimulus intensity was kept constant throughout the entire experiment. The withdrawal latencies of both hind paws were tested once every 10 min until three consistent thresholds were obtained. The mean value of the three consistent thresholds was

Fig. 1. DHA inhibited mechanical allodynia and thermal hyperalgesia, but not hyperglycemia in diabetic rats. (A) Body weight significantly decreased in STZ-injected rats. (B) STZ injection induced rapid hyperglycemia on day 3 and remained so for 35 days. There were no significant difference of both blood glucose and body weight between standard chow and fish oil supplement diet. Panels C and D showed the effects of DHA on pain behaviors induced by diabetes. Mechanical allodynia (C) and thermal hyperalgesia (D) developed in diabetic rats. Administration of DHA attenuated mechanical allodynia and thermal hyperalgesia induced by STZ injection. *p b 0.01, compared to the control group, #p b 0.01, compared to the diabetic group.

L.-J. Heng et al. / Experimental Neurology 271 (2015) 291–300

used as the thermal threshold. A cutoff time of 20 s was used to prevent potential tissue damage.

2.3. Patch-clamp recording Patch-clamp recording was performed on the whole dorsal root ganglion in vitro. After the behavioral tests, animals were anesthetized with pentobarbital sodium (40 mg/kg i.p.), the L4 and L5 DRGs were carefully removed, cleaned the connective tissue, and digested with a mixture of 0.4 mg/mL trypsin (Sigma) and 1.0 mg/mL type A collagenase (Sigma) for 40 min at 37 °C and agitated by gentle bubbling with 95% O2 and 5% CO2. Afterward, the ganglia were transferred into ACSF and incubated at 26 °C under 95% O2 and 5% CO2 for at least 1 h. During the recordings, the ganglion was kept submerged in a chamber perfused with ACSF. The ACSF contained (in mM): 124 NaCl, 2.5 KCl, 1.2 NaH2 PO4, 1.0 MgCl2, 2.0 CaCl2, 25 NaHCO3, and 10 Glucose. The intrapipette solution contained (in mM): KCl 140, MgCl2 2, Hepes 10, Mg-ATP 2, and pH 7.4. Osmolarity was adjusted to 280–290 mOsm. All chemicals were obtained from Sigma, St. Louis, MO, USA. Individual neurons were visualized with a 40× water-immersion objective under a microscope (BX51WI; Olympus, Tokyo, Japan) equipped with infrared differential interference contrast optics. Whole-cell current and voltage recording was carried out by using a Multiclamp 700B amplifier (Molecular Devices Corporation, Sunnyvale, CA, USA) after a giga-ohm seal had been established. Patch pipettes (4–7 MΩ) were pulled from borosilicate glass capillaries in a two-stage fashion on a vertical puller (model PP-83, Narishige, Tokyo, Japan). The series-resistance was 10–20 MΩ. All potentials were corrected online for the junction potential by adjusting the offset of the pipette using the Multiclamp 700B commander software. Neurons were selected for further study if they had a resting membrane potential that was more negative than −45 mV and if they exhibited overshooting action potentials. For sodium current recording, the borosilicate glass pipettes were filled with the following solution (in mM): CsF 140, EGTA 1, NaCl 10, Hepes 10, and pH 7.4, and the external bathing solution was adjusted to contain (in mM): NaCl 140, MgCl2 1, KCl 3, CaCl2 1, CdCl2 0.1, and Hepes 10 (pH 7.4). For potassium current recording, the borosilicate glass pipettes were filled with the following solution (in mM): KCl 140, CaCl2 1, MgCl2 2, EGTA 11, HEPES 10, Mg adenosine triphosphate 2, Li guanosine triphosphate 1, and pH 7.4. The bath solution was changed to one used for recording potassium currents, which contained 130 mM choline Cl, 5 mM KCl, 1 mM MgCl2, 2 mM CoCl2, 10 mM HEPES, and 10 mM glucose. The pH was adjusted to 7.4 with Tris base, and the osmolarity was adjusted to approximately 300–310 mOsm with sucrose.

293

Table 2 Electrophysiological properties of DRG neurons (means ± S.E.).

RMP (mV) Single spike threshold (mV) AP amplitude (mV) AP width (ms) Rheobase (pA)

Control

Diabetic

Diabetic + DHA

−59.0 ± 2.3 −29.6 ± 1.6 102.3 ± 1.5 5.2 ± 0.4 68.8 ± 5.2

−58.6 ± 2.1 −37.2 ± 1.6⁎ 98.9 ± 1.5 4.9 ± 0.4 40.3 ± 4.4⁎

−58.0 ± 3.1 −33.2 ± 1.6⁎,# 100.3 ± 1.7 4.9 ± 0.2 61.3 ± 3.8⁎,#

RMP = resting membrane potential, AP = action potential, DHA = docosahexaenoic acid. ⁎ One-way ANOVA, p b 0.05 vs Control. # p b 0.05 vs Diabetic.

2.4. Analysis of sodium and potassium channel subtype expression After the behavioral tests, the L4/L5 DRGs were harvested and total RNA was isolated from DRG by Stratagene Absolutely RNA Miniprep Kit (Stratagene, La Jolla, CA, USA). Immediately after isolation, RNA was transcribed into cDNA using an iScript cDNA kit (Bio-Rad). Relative channel expression was determined by real-time PCR using a Stratagene MX-Pro 3005P. cDNA samples were amplified in a 25 μL reaction volume (400 nM gene-specific Na channel primers, SYBR green reaction mix (Roche Applied Science, Indianapolis, IN)). Fluorescence was normalized with the reference dye ROX, and gene expression was normalized to the housekeeping gene hypoxanthine ribosyltransferase (HPRT),

Table 1 Primers used for RT-PCR experiments. Name

Primers Forward, reverse

Nav1.1 Nav1.2 Nav1.3 Nav1.6 Nav1.7 Nav1.8 Nav1.9 Kv1.1 Kv1.2 Kv1.3 Kv1.4 Kv3.1 Kv3.4 Kv4.2 Kv4.3 HPRT

ATCCGAGTCCGAAGATAGCA, GTCTCGGGGAAAACAGTGAG CGGAGAGTTCGTCAGTAGCC, AAGAGAGACTGGTGCGGAGA AACTTGGTGCCATCAAATCC, CAGATTCACACCCATGATGC TACAGTGGCTACAGCGGCTA, TGTTTGTGACCACGCTCATT GACAAGAAGTAAGAACTAGAGAGCCTTTT, CCATGGTGGACATTTTTGTCT CACGGATGACAACAGGTCAC, GATCCCGTCAGGAAATGAGA GGCAGCCAAGTCAATCTTTC, GGGCCACAGTTGTGCTTAAT CGCAGCTCCTCTACTATCAGC, TACAGAGTGGGACAGGAGTCG CAGACCCAAGCTCCACTCTC, GACCCAGAGCCTTCTGTGAG GAAGGACTATCCCGCCTCTC, AGATGATGCACAGGGTCTCC TCCCATGATCCTCAAGGAAG, GCATCAGGTCTGAGCAATGA GTGCTCATCTTTGCCACCAT, GAAGCCGATGGGGATATTTT GGGACTATGCCTGTGCTGAT, ATGGGCATAGTTGGACGAGA TGGAAGTGCAAATGCCTACA, TGGAAGTGCAAATGCCTACA AAGAGCTCAGCACCATCCAC, CCTGTTTGCATGTGACGACT GCAGACTTTGCTTTCCTTGG, TACTGGCCACATCAACAGGA

Fig. 2. Effect of DHA on the membrane excitability of medium DRG neurons. Suprathreshold voltage responses evoked by rheobase current injection in DRG neuron of control (A, left), diabetic (B, left) and diabetic + DHA (C, left) groups. The rheobase currents were indicated in the bottom. Repetitive firings were evoked by 100 pA (500 ms) current injection (A–C, right). (D) Graphic representation of the rheobase in the control, diabetic and diabetic + DHA groups. (E) With current injection ranging from 10 to 160 pA, firing frequency was significantly increased in diabetic group compared with controls. The firing frequency of diabetic + DHA neurons was lower than diabetic group but higher than control group. Differences were significant for all current values above at 25 pA. *p b 0.05, compared to the control group, #p b 0.05, compared to the diabetic group.

294

L.-J. Heng et al. / Experimental Neurology 271 (2015) 291–300

Fig. 3. Effect of DHA on the shape of action potential and its role in neuron excitability. (A) Action potential was evoked by brief positive current pulse in control, diabetic and diabetic + DHA neurons. (B) The traces in (A) are superimposed to facilitate comparison of the membrane potential after AP. (C) The neuron was stimulated with long positive current pulses (85 pA, 500 ms). Seven, ten and six spikes are evoked in control, diabetic and diabetic + DHA neurons, respectively. (D) The traces in control and diabetic neurons are shown superimposed. Note that the spikes are initiated at more depolarized potentials in diabetic neuron than in control neuron. (E) Superimposed traces of control and diabetic + DHA neurons.

run on the same plate. The forward and reverse primers used for generating cDNA standards were showed in Table 1. PCR products were verified by melting point analysis at the end of each experiment and, during protocol development, by gel electrophoresis. The amplification data were analyzed using MxPRO software (Stratagene) to determine values for amplification threshold and relative expression.

2.6. Data acquisition and statistics Data values are presented as means ± S.E. The normality test was conducted and One-way ANOVAs followed by post hoc pairwise comparisons (Student–Newman–Keuls method) (SigmaStat 2.03) were used to determine the statistical significance of differences between the experimental groups. In all experiments, a probability of 0.05 or less was considered statistically significant.

2.5. Western blot After the behavioral tests, animals were sacrificed and the bilateral DRGs (L4 and L5) were isolated and homogenized in ice-cold homogenizing buffer (50 mM Tris-Cl, pH 7.4, 150 mM NaCl, 5 mM EDTA, 0.1% SDS, 1% NP-40, 1% deoxycholate, 1% Triton X-100, 10 mM PMSF, 50 mM sodium vanadate and 0.1% protease inhibitors cocktail) (Roche, Switzerland). After centrifugation at 12,000 ×g for 15 min at 4 °C, the supernatant was collected and the protein content was subsequently assayed by using a BCA™ Protein Assay Kit (Pierce, Rockford, IL, USA). Equal quantities of total protein (30 μg per lane) were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), followed by transfer to nitrocellulose membranes. The membranes were incubated in 5% milk at room temperature for 2 h. Blots were then incubated with primary antibodies including rabbit polyclonal antibody for Nav1.3 (diluted 1:1000), Nav1.7 (diluted 1:1000), Nav1.8 (1:1000), Kv4.2 (1:1000) and Kv4.3 (1:1000) or β-actin (1:2000). After washing with buffer, the blots were incubated in anti-rabbit (Zhong Shan, Beijing, China, 1:1000) secondary antibody conjugated with horseradish peroxide in TBS-T with 5% milk at 4 °C overnight. The blots were visualized using a West Pico Chemiluminescent Kit (Pierce, Rockford, IL, USA), and the density of protein bands quantified by transmittance densitometry using volume integration with LumiAnalyst Image Analysis software.

3. Results 3.1. DHA inhibited mechanical allodynia and thermal hyperalgesia in diabetic rats Streptozotocin injection resulted in a diabetic syndrome verified by the presence of polydypsia, polyuria, hyperglycemia, and weight loss in the diabetic animals. Significant weight loss was observed in STZ-induced diabetic rats compared with the control group (Fig. 1A, p b 0.01). Mean blood glucose levels in the diabetic groups were significantly higher than the control group after STZ injection (Fig. 1B, p b 0.01). By the end of week 5, blood glucose levels in diabetic groups remained significantly elevated. As shown in Fig. 1C, treatment of DHA significantly attenuated the development of mechanical allodynia in diabetic rats. Similarly, the STZ-induced thermal hyperalgesia was dramatically reduced by DHA administration (Fig. 1D, p b 0.01). In contrast, mechanical and thermal nociception in normal rats was not altered by DHA administration. Despite dramatic inhibition of diabetic allodynia and hyperalgesia, DHA did not exert a significant effect on hyperglycemia (Fig. 1B). DHA administration numerically increased the body weight of diabetic rats, which did not reach statistical significance (Fig. 1A).

L.-J. Heng et al. / Experimental Neurology 271 (2015) 291–300

3.2. DHA inhibited the excitability of DRG neurons in diabetic rats Whole cell patch-clamp recordings were obtained from medium diameter DRG neurons (about 30–40 μm in diameter) of different groups. The action potential properties of the neurons are summarized in Table 2. The resting membrane potential of DRG neurons was not altered by either diabetes or DHA treatment. The amplitude, peak voltage and duration of the action potential (AP) of DRG neurons were not significantly changed in the diabetic group and DHA treatment group. However, the single spike threshold of diabetic neurons was lower than control neurons (p b 0.05). DHA administration reversed the changes of single spike threshold induced by diabetes (Table. 2). The rheobase of diabetic neurons was 40.3 ± 4.4 pA (n = 15), which was significantly higher than that of neurons in control animals (68.8 ± 5.2 pA, n = 15, p b 0.05) and diabetic + DHA animals (61.3 ± 3.8 pA, n = 15, p b 0.05) (Table 2, Fig. 2D). Repetitive action potentials could be elicited with depolarizing current injection in the neurons. In current injections ranging from 10 to 160 pA, the firing frequency of diabetic neurons was significantly increased for all current amplitudes above 40 pA (Fig. 2E). The firing frequency of DHA treatment diabetic rats was higher than the control group but lower than the diabetic group, which was statistically significant (Fig. 2E). Under current-clamp mode, a single spike was evoked from the resting potential by brief positive current pulse. Diabetic neurons showed a more positive afterhyperpolarization potential. Representative results from three neurons were shown in Fig. 3A, and superimposed in Fig. 3B. Repetitive discharges could be evoked when a long positive current pulse (85 pA, 500 ms) was injected. The firing frequency in diabetic neurons (10.8 ± 0.6 Hz, n = 15) was significantly higher than that in control and Diabetic + DHA neurons (6.9 ± 0.5 and 8.7 ± 0.6 Hz, respectively, Fig. 3C). As shown in Fig. 3D, more positive afterhyperpolarization potential in diabetic neuron made it easier to reach the action potential threshold for the next spike.

295

level. The expression of Nav1.7 reduced towards normal level in the diabetic + DHA group, although the value was still significantly higher than that in control animals (p b 0.05). An example was shown in Fig. 5C. Similar results were obtained in three replicate experiments.

3.4. DHA increased the potassium currents of DRG neurons in diabetic rats Voltage-activated K currents were recorded as shown in Fig. 6A. The membrane was held at − 60 mV, and voltage steps were applied in 10 mV increments up to a value of + 60 mV after a 1 s prepulse to −120 mV. The total K current was comprised of sustained components, as measured at the end of the 500-ms pulse, and transient components which largely decayed during the pulse. The current densities of both transient (p b 0.05) and sustained components (p b 0.05) were decreased in diabetic neurons (Fig. 6B, C). The effect of diabetes was significant at all points above 0 mV. DHA administration increased K currents of diabetic rats (Fig. 6B, C). To investigate the alteration of potassium channel expression, RT-PCR was performed on DRGs from control, diabetic and diabetic + DHA groups. The results showed lower Kv4.2 and Kv4.3 mRNA expressions in diabetic rats. DHA administration increased the expression of Kv4.2 and Kv4.3 (Fig. 7A, B, p b 0.05). The results from Western blot detection were consistent with the mRNA levels except that DHA totally reversed the alteration of Kv4.3 protein expression in diabetic rats (Fig. 7C, D, p b 0.05).

3.3. DHA inhibited the sodium currents of DRG neurons in diabetic rats Voltage-dependent sodium currents are important to neuron excitability. Thus, we studied the effects of DHA on voltage-dependent sodium currents in DRGs of STZ-induced diabetic rats. The membrane potential was held at −60 mV, and 300-ms voltage steps were delivered from hyperpolarized potentials (− 100 mV) to depolarized potentials (30 mV) in 10 mV increments. Voltagedependent Na current was measured first in the absence of TTX to obtain the total Na current (Fig. 4A) and then in the presence of TTX to obtain the TTX-resistant (TTX-R) current (Fig. 4B). By subtracting the latter from the former, the TTX-sensitive (TTX-S) current was obtained (Fig. 4C). TTX-S and TTX-R currents were activated at approximately −30 mV for all of the three groups, and reached maximal levels at 0 mV (Fig. 4D, E). Both TTX-S and TTX-R sodium currents significantly increased in the diabetic group compared with the control group (n = 15, two way repeated measures ANOVA, p b 0.05). DHA administration reversed the changes of sodium currents of diabetic rats. There was no significant difference between the diabetic + DHA and control group. To investigate the alteration of sodium channel expression, RT-PCR was performed on DRGs from control, diabetic and diabetic + DHA groups. There were significantly higher expressions of Nav1.3, Nav1.7 and Nav1.8 in diabetic rats (Fig. 5A). The fold-increases in Nav 1.3, 1.7, and 1.8 were showed in Fig. 5B. However, compared to the diabetic group, treatment with DHA significantly decreased the mRNA expressions of sodium channels (Fig. 5A, B, p b 0.05). The protein level of Nav1.3, 1.7, and 1.8 in the L4/5 DRG from different groups was determined by Western blot. As shown in Fig. 5C and D, STZ-injection significantly increased the levels of Nav1.3, Nav1.7 and Nav1.8 in DRGs. The expression of Nav1.3 and Nav1.8 in the diabetic + DHA group significantly decreased to the control

Fig. 4. DHA decreased sodium currents in diabetic rats. For each neuron, membrane potential was held at −60 mV. Whole cell sodium currents were elicited by a series of 80 ms test pulses ranging from −100 to +30 mV in 10-mV steps. (A) Total sodium currents. (B) TTXresistant currents obtained during application of 300 nM TTX. (C) TTX-sensitive currents obtained by subtracting TTX-R currents from total. (D) Comparison of mean voltage–current relationship for TTX-S current in control, diabetic and diabetic + DHA neurons. Diabetes increased the TTX-S currents significantly (n = 15, p b 0.01). DHA administration decreased TTX-S currents in diabetic rats. (E) Diabetes increased the TTX-R currents significantly (n = 15, p b 0.01). DHA administration decreased TTX-R currents in diabetic rats.

296

L.-J. Heng et al. / Experimental Neurology 271 (2015) 291–300

Fig. 5. Expression of Na channels in DRG neurons. (A) Profile of Na channel expression relative to HPRT. (B) Fold-change in expression of the 3 highly changed Na channels in diabetic group. (C) Representative blots of Nav1.3, Nav1.7 and Nav1.8. (D) Densitometric analyses for protein levels. The changes were expressed as the percentage of β-actin. Data represent mean ± S.E. (n = 3). *p b 0.05, compared to the control group, #p b 0.05, compared to the diabetic group.

3.5. The effect of intrathecal injection of DHA on the pain behaviors of diabetic rats To investigate the direct effects of DHA on DRG neurons, DHA was injected intrathecally to rats everyday from 12 days to 23 days after STZ injection. Administration of DHA significantly attenuated the mechanical allodynia and thermal hyperalgesia in diabetic rats which were dose dependent (Fig. 8A, C). Mechanical and thermal nociception in normal rats was not altered by DHA treatment (Fig. 8B, D).

4. Discussion Along with retinopathy, nephropathy and cardiovascular disease, neuropathy has been listed as one of the complications of diabetes. Some patients with diabetic neuropathy develop severe pain, which can be extremely difficult to treat. This painful signal is believed to originate in the peripheral nervous system, however, the exact peripheral mechanisms underlying diabetic allodynia and hyperalgesia are not well understood (Calcutt, 2002; Gooch and Podwall, 2004; Schmader, 2002; Ziegler, 2008). Evidence has accumulated that abnormal hyperexcitability of primary sensory neurons may contribute to the exaggerated pain associated with diabetic neuropathy (Chen and Levine, 2003; Hong et al., 2004a; Sun et al., 2012a, 2012b). Fatty acids are an essential nutrient for humans and are involved in a variety of biological functions. Adequate dietary availability of n − 3 PUFA in human health and nutrition has been recognized for decades. PUFA has been proven beneficial for different pain states (Kremer et al., 1990; Tomer et al., 2001; Yehuda and Carasso, 1993). However, the mechanisms underlying the effect of PUFA on relieving pain are only partially

understood (Kremer et al., 1990; Tomer et al., 2001; Yehuda and Carasso, 1993; Hong et al., 2004b). The present study demonstrated that DHA could attenuate both mechanical allodynia and thermal hyperalgesia of diabetic rats, which is probably due to the effect on excitability of DRG neurons. It is noteworthy that both myelinated and unmyelinated afferents have been implicated in diabetic neuropathic pain. A subset of nociceptive primary sensory neurons exhibited high frequency firing to sustained mechanical stimulation under diabetic conditions and contributed to the exaggerated pain in diabetic neuropathy (Chen and Levine, 2001, 2003; Sun et al., 2012a, 2012b). It was also reported that A-fiber afferents developed abnormal spontaneous discharges and increased sensitivity to mechanical stimuli in diabetic rats (Khan et al., 2002). The precise cellular mechanisms of neuropathic pain remain poorly understood, but the remodeling of ion channels that can increase excitability of the sensory neurons may play a critical role (Coderre et al., 1993; Campbell and Meyer, 2006). In the present study, the threshold of mechanical allodynia was decreased and the latency of thermal hyperalgesia was decreased significantly in STZ-induced diabetic rats, accompanied by the significantly enhanced excitability of DRG neurons. Using whole-cell patch-clamp recording from medium DRG neurons, we found that the rheobase for the generation of an action potential and the threshold were decreased significantly in diabetic rats compared to the normal rats (Fig. 2, Table 2), and more action potentials were evoked by current injection in the diabetic group. In an attempt to investigate the possible underlying reasons for the excitability changes, we further studied the effect of diabetes on the sodium and potassium currents of DRG neurons. Here, we showed that diabetes significantly increased both TTX-S and TTX-R current density, which is involved in the enhancement of

L.-J. Heng et al. / Experimental Neurology 271 (2015) 291–300

297

Fig. 6. Effect of DHA on potassium currents. (A) Example currents shown were evoked by depolarizing pulses from −60 to +60 mV. The difference between the peak current (1) and the current at the end of the pulse (2) was used as a measure of the transient K current. (B) The current densities of transient component were decreased in diabetic neurons and DHA reversed the alterations. (C) The current densities of sustained components were decreased in diabetic neurons. DHA increased the sustained K currents in diabetic rats.

neuron excitability. Nine different genes for voltage-gated Na channels have been described, with Nav1.1–Nav1.7 mediating TTX-sensitive current and Nav1.8 and 1.9 mediating TTX-resistant currents (Ogata and Ohishi, 2002). Nav1.4 is normally predominantly expressed in skeletal muscle and Nav1.5 is predominantly expressed in cardiac muscle (Lai et al., 2003). Of the seven detected Na channels, 3 showed much higher expression in diabetic rats which were Nav1.3, 1.7, and 1.8. Huang et al. (2014) also reported that Nav1.7 was up-regulated in large and small sized DRG neurons in STZ-induced diabetic rats. It is known that Nav1.1, 1.3, 1.6 and 1.7 highly expressed in large and medium DRG neurons and mediated TTX-S Na currents. There were about 20% of large neurons that expressed high levels of Nav1.8 and mediated TTX-R Na current (Ho and O'Leary, 2011; Lai et al., 2003) Although we did not exclude the small cells when performing the RT-PCR and Western blot detection, according to the results from patch-clamp recording, we proposed that both Nav1.3 and 1.7 contributed to the increase of TTX-S Na currents and Nav1.8 was the main contributor of TTX-R Na current of medium DRG neurons in STZ-induced diabetic rats. Potassium currents, including slowly inactivating ‘sustained’ currents (IK) and rapidly inactivating ‘transient’ A-type currents (IA), have important roles in modulating neuronal excitability (Gold et al., 1996; Yang et al., 2009). It has been reported that Atype K channels contributed to the excitability of DRG neurons and played a role in diabetic neuropathy (Cao et al., 2010; Sun et al., 2012b). In the present study we found that diabetes caused downregulation of both transient and sustained K current amplitudes in DRG neurons, which may partially contribute to the increase of neuron excitability. Fatty acids are classified as saturated fatty acids that have no double bonds or unsaturated fatty acids that have double or triple bonds. Based

on the number of double bonds present, unsaturated fatty acids are further divided into monounsaturated fatty acids with only one double bond and polyunsaturated fatty acids (PUFAs) with two or more double bonds (Tokuyama and Nakamoto, 2011). PUFAs include n−3 series and n−6 series, and DHA is a representative of n−3 series fatty acids. It has been reported that fatty acids modulated acute and chronic nociceptive responses (Shir et al., 2001). Dietary fatty acids suppressed mechanical allodynia and thermal hyperalgesia (Pérez et al., 2004). DHA was observed antinociceptive effects in various pain tests (Nakamoto et al., 2010). Hong et al. (2004b) reported that DHA inhibited TTX-S current and had considerable impact on the excitability of sensory neurons. In the present study, we found that administration of DHA significantly attenuated painful behaviors in diabetic rats, and significantly decreased both TTX-S and TTX-R sodium currents. We further explored that DHA decreased sodium channel expression in both protein and mRNA levels, suggesting that reduction of the sodium current may contribute to the improvement of painful neuropathy of diabetic rats. Also, we found that DHA increased both transient and sustained K currents of medium DRG neurons in diabetic rats. However, with RT-PCR and Western blot detection, we only found that the expression of Kv4.2 and Kv4.3 was significantly different between the diabetic and control groups, which were identified contributors of transient K current. However, it should be noted that we did not examine all the possible genes coding for K currents that might mediate the sustained or transient currents observed, and other Kv α-subunit might also contribute to the electrophysiological data of potassium currents. The ionic mechanism needs further investigation. Diabetes was characterized by hyperglycemia, chronic inflammation and insulin resistance. Reports have shown that activation of inflammatory cascades plays an important role in the

298

L.-J. Heng et al. / Experimental Neurology 271 (2015) 291–300

Fig. 7. Effect of DHA on the expression of potassium channels. (A) Profile of K channel expression relative to HPRT. (B) Fold-change in expression of the 2 highly changed K channels in diabetic group. (C) Representative blots of Kv4.2 and Kv4.3. (D) Densitometric analyses for protein levels. The changes were expressed as the percentage of β-actin. Data represent mean ± S.E. (n = 3). *p b 0.05, compared to the control group, #p b 0.05, compared to the diabetic group.

Fig. 8. Effect of intrathecal injection of DHA on the pain behaviors of diabetic rats. Intrathecal administration of DHA (50, 100 and 200 μM) attenuated mechanical allodynia (A) and thermal hyperalgesia (C) in diabetic rats. DHA (100 μM) had no effective on mechanical threshold (B) and thermal latency (D) in control group.

L.-J. Heng et al. / Experimental Neurology 271 (2015) 291–300

development and persistence of neuropathic pain states (Galloway and Chattopadhyay, 2013). Fish oil supplementation significantly attenuated painful behaviors in diabetic rats by decreasing the level of TNF-α and CXCL1 and modulating phosphorylation of AKT and GSK-3β in DRG neurons, which suggested the combined modulation of inflammatory cytokines and insulin signaling (Li et al., accepted for publication). DHA performed the neuroprotective effect on hippocampal neurons by preventing inflammatory cytokine expression (Yang et al., 2014). Dietary n − 3 PUFA exhibited significant anti-nociceptive effect after spinal cord injury, which was correlated with reduction of inflammatory biomarkers in dorsal horn neurons (Figueroa et al., 2013). DHA has been reported other function such as decreasing inflammation, inhibiting oxidative stress, and modulating insulin signal pathway in diabetic animals (Yang et al., 2014; Jia et al., 2014; Sun et al., 2014). The up-regulation of sodium channels which induced excitability enhancement in DRG neurons may also be related to the inflammatory stimulation in diabetic animals (Huang et al., 2014). We are liable to believe that systemic DHA administration is helpful to improve the overall condition of diabetic rats. It has been reported that fish oil supplementation increased EPA and DHA in serum (Young et al., 2005), which suggested that DHA may have direct effect on the DRG neurons. In the present study, DHA was administrated intrathecally and attenuated pain behaviors of diabetic rats, which may be associated with its direct effect on modulating the neuron excitability. We did not detect the response of dorsal horn neurons after DHA injection intrathecally, so we cannot exclude the contribution of dorsal horn neurons on the pain behavioral improvement. After cessation of intrathecal injection of DHA, the behavioral test came to the pre-drug levels within a couple of days, which suggested a transient direct inhibition of neuron excitability. However, systemic administration of n − 3 PUFA exhibited a long-term preventive effect on painful behavior after spinal cord injury (Figueroa et al., 2013). Further studies are needed to determine the possible mechanism of DHA in pain control. In summary, the present study demonstrated that dietary DHA administration inhibited the allodynia and hyperalgesia in STZinduced painful diabetic neuropathy. The effectiveness of DHA might reflect the modulation of excitability of medium DRG neurons by decreasing the sodium currents and increasing potassium currents. Due to its low side-effect profile and long history of safe use, DHA may find clinical application in treating PDN in the diabetic patients. Authors' contributions LJH and RQ conducted the behavioral test, PCR and Western blot experiments. LJH drafted the manuscript. RHY participated in the electrophysiological recording. LJH and GZX performed data analysis and statistical analysis. RHY conceived of the study, and participated in experimental design and coordination and helped to draft the manuscript. All authors read and approved the final manuscript. Disclosure statement The authors declare that they have no conflict of interest. Acknowledgments This work was supported by Program for Changjiang Scholars and Innovative Research Team in University (PCSIRT). This work was supported by the National Natural Science Foundation of China (81271194) and the Science and Technology Program of Shaanxi Province [2011JM4002].

299

References Belayev, L., Khoutorova, L., Atkins, K.D., Eady, T.N., Hong, S., Lu, Y., Obenaus, N.G., 2011. Docosahexaenoic acid therapy of experimental ischemic stroke. Transl. Stroke Res. 2, 33–41. Calcutt, N.A., 2002. Potential mechanisms of neuropathic pain in diabetes. Int. Rev. Neurobiol. 50, 205–228. Campbell, J.N., Meyer, R.A., 2006. Mechanisms of neuropathic pain. Neuron 52, 77–92. Cao, X.H., Byun, H.S., Chen, S.R., Cai, Y.Q., Pan, H.L., 2010. Reduction in voltage-gated K channel activity in primary sensory neurons in painful diabetic neuropathy: role of brain-derived neurotrophic factor. J. Neurochem. 114, 1460–1475. Chen, X., Levine, J.D., 2001. Hyper-responsivity in a subset of C-fiber nociceptors in a model of painful diabetic neuropathy in the rat. Neuroscience 102, 185–192. Chen, X., Levine, J.D., 2003. Altered temporal pattern of mechanically evoked C-fiber activity in a model of diabetic neuropathy in the rat. Neuroscience 121, 1007–1015. Coderre, T.J., Katz, J., Vaccarino, A.L., Melzack, R., 1993. Contribution of central neuroplasticity to pathological pain: review of clinical and experimental evidence. Pain 52, 259–285. Figueroa, J.D., Cordero, K., Serrano-Illan, M., Almeyda, A., Baldeosingh, K., Almaguel, F.G., De Leon, M., 2013. Metabolomics uncovers dietary omega-3 fatty acid-derived metabolites implicated in anti-nociceptive responses after experimental spinal cord injury. Neuroscience 255, 1–18. Fuchs, D., Birklein, F., Reeh, P.W., Sauer, S.K., 2010. Sensitized peripheral nociception in experimental diabetes of the rat. Pain 151, 496–505. Galloway, C., Chattopadhyay, M., 2013. Increases in inflammatory mediators in DRG implicate in the pathogenesis of painful neuropathy in Type 2 diabetes. Cytokine 63, 1–5. Gold, M.S., Shuster, M.J., Levine, J.D., 1996. Characterization of six voltage-gated K currents in adult rat sensory neurons. J. Neurophysiol. 75 (6), 2629–2646. Gooch, C., Podwall, D., 2004. The diabetic neuropathies. Neurologist 10, 311–322. Hargreaves, K., Dubner, R., Brown, F., Flores, C., Joris, J., 1988. A new and sensitive method for measuring thermal nociception in cutaneous hyperalgesia. Pain 32, 77–88. Ho, C., O'Leary, M.E., 2011. Single-cell analysis of sodium channel expression in dorsal root ganglion neurons. Mol. Cell. Neurosci. 46 (1), 159–166. Hong, S., Morrow, T.J., Paulson, P.E., Isom, L.L., Wiley, J.W., 2004a. Early painful diabetic neuropathy is associated with differential changes in tetrodotoxin-sensitive and -resistant sodium channels in dorsal root ganglion neurons in the rat. J. Biol. Chem. 279, 29341–29350. Hong, M.P., Kim, H.I., Shin, Y.K., Lee, C.S., Park, M., Song, J.H., 2004b. Effects of free fatty acids on sodium currents in rat dorsal root ganglion neurons. Brain Res. 1008, 81–91. Huang, Y., Zang, Y., Zhou, L., Gui, W., Liu, X., Zhong, Y., 2014. The role of TNF-alpha/NFkappa B pathway on the up-regulation of voltage-gated sodium channel Nav1.7 in DRG neurons of rats with diabetic neuropathy. Neurochem. Int. 75, 112–119. Jackson, A.C., Bean, B.P., 2007. State-dependent enhancement of subthreshold A-type potassium current by 4-aminopyridine in tuberomammillary nucleus neurons. J. Neurosci. 27, 10785–10796. Jia, D., Heng, L.J., Yang, R.H., Gao, G.D., 2014. Fish oil improves learning impairments of diabetic rats by blocking PI3K/AKT/nuclear factor-κB-mediated inflammatory pathways. Neuroscience 258, 228–237. Khan, G.M., Chen, S.R., Pan, H.L., 2002. Role of primary afferent nerves in allodynia caused by diabetic neuropathy in rats. Neuroscience 114, 291–299. Kremer, J.M., Lawrence, D.A., Jubiz, W., DiGiacomo, R., Rynes, R., Bartholomew, L.E., Sherman, M., 1990. Dietary fish oil and olive oil supplementation in patients with rheumatoid arthritis. Clinical and immunological effects. Arthritis Rheum. 33, 810–820. Lai, J., Hunter, J.C., Porreca, F., 2003. The role of voltage-gated sodium channels in neuropathic pain. Curr. Opin. Neurobiol. 13, 291–297. Leinonen, E.S., Hiukka, A., Hurt-Camejo, E., Wiklund, O., Sarna, S.S., Mattson Hultén, L., Westerbacka, J., Salonen, R.M., Salonen, J.T., Taskinen, M.R., 2004. Low-grade inflammation, endothelial activation and carotid intima-media thickness in type 2 diabetes. J. Intern. Med. 256, 119–127. Li, M.Y., Wang, Y.Y., Cao, R., Hou, X.H., Zhang, L., Yang, R.H., Wang, F., 2015. Dietary fish oil inhibits mechanical allodynia and thermal hyperalgesia in diabetic rats by blocking nuclear factor-κB-mediated inflammatory pathways. J. Nutr. Biochem. 26 (accepted for publication). Luchtman, D.W., Meng, Q., Song, C., 2012. Ethyl-eicosapentaenoate (E-EPA) attenuates motor impairments and inflammation in the MPTP-probenecid mouse model of Parkinson's disease. Behav. Brain Res. 226, 386–396. Martins, J.O., Campos, C.A.L., Cruz, J., Manzolli, S., Alves, V.A.F., Vianna, E.O., Jancar, S., Sannomiya, P., 2010. Insulin modulates cytokine release and selectin expression in the early phase of allergic airway inflammation in diabetic rats. BMC Pulm. Med. 10, 39–48. Moranis, A., Delpech, V., De Smedt-Peyrusse, V., Aubert, A., Guesnet, P., Lavialle, M., Joffre, C., Laye, S., 2012. Long term adequate n − 3 polyunsatuated fatty acid diet protects from depressive-like behavior but not from working memory disruption and brain cytokine expression in aged mice. Brain Behav. Immun. 26, 721–731. Nakamoto, K., Nishinaka, T., Mankura, M., Fujita-Hamabe, W., Tokuyama, S., 2010. Antinociceptive effects of docosahexaenoic acid against various pain stimuli in mice. Biol. Pharm. Bull. 33 (6), 1070–1072. Obata, K., Yamanaka, H., Kobayashi, K., Dai, Y., Mizushima, T., Katsura, H., Fukuoka, T., Tokunaga, A., Noguchi, K., 2004. Role of mitogen-activated protein kinase activation in injured and intact primary afferent neurons for mechanical and heat hypersensitivity after spinal nerve ligation. J. Neurosci. 24, 10211–10222. Ogata, N., Ohishi, Y., 2002. Molecular diversity of structure and function of the voltagegated Na+ channels. Jpn. J. Pharmacol. 88, 365–377.

300

L.-J. Heng et al. / Experimental Neurology 271 (2015) 291–300

Pérez, J., Ware, M.A., Chevalier, S., Gougeon, R., Bennett, G.J., Shir, Y., 2004. Dietary fat and protein interact in suppressing neuropathic pain-related disorders following a partial sciatic ligation injury in rats. Pain 111 (3), 297–305. Schmader, K.E., 2002. Epidemiology and impact on quality of life of postherpetic neuralgia and painful diabetic neuropathy. Clin. J. Pain 18, 350–354. Shir, Y., Sheth, R., Campbell, J.N., Raja, S.N., Seltzer, Z., 2001. Soy-containing diet suppresses chronic neuropathic sensory disorders in rats. Anesth. Analg. 92 (4), 1029–1034. Sommer, C., Kress, M., 2004. Recent findings on how proinflammatory cytokines cause pain: peripheral mechanisms in inflammatory and neuropathic hyperalgesia. Neurosci. Lett. 361, 184–187. Song, C., Zhang, X.Y., Manku, M., 2009. Increased phospholipase A2 activity and inflammatory response but decreased nerve growth factor expression in the olfactory bulbectomized rat model of depression: effects of chronic ethyleicosapentaenoate treatment. J. Neurosci. 29, 14–22. Sun, W., Miao, B., Wang, X., Duan, J., Wang, W., Kuang, F., Xie, R., Xing, J., Xu, H., Song, X., Luo, C., Hu, S., 2012a. Reduced conduction failure of the main axon of polymodal nociceptive C-fibres contributes to painful diabetic neuropathy in rats. Brain 135, 359–375. Sun, W., Miao, B., Wang, X., Duan, J., Ye, X., Han, W., Wang, W., Luo, C., Hu, S., 2012b. Gastrodin inhibits allodynia and hyperalgesia in painful diabetic neuropathy rats by decreasing excitability of nociceptive primary sensory neurons. PLoS One 7 (6), e39647. Sun, L.J., Hou, X.H., Xue, S.H., Yan, F., Dai, Y.J., Zhao, C.H., Wang, F., Yang, R.H., 2014. Fish oil modulates glycogen synthase kinase-3 signaling pathway in diabetes-induced hippocampal neurons apoptosis. Brain Res. 1574, 37–49.

Tokuyama, S., Nakamoto, K., 2011. Unsaturated fatty acids and pain. Biol. Pharm. Bull. 34 (8), 1174–1178. Tomer, A., Kasey, S., Conner, W.E., Clark, S., Harker, L.A., Eckman, J.R., 2001. Reduction of pain episodes and prothrombotic activity in sickle cell disease by dietary n−3 fatty acids. Thromb. Haemost. 85, 966–974. Xu, J.T., Xin, W.J., Zang, Y., Wu, C.Y., Liu, X.G., 2006. The role of tumor necrosis factor-alpha in the neuropathic pain induced by lumbar 5 ventral root transection in rat. Pain 123, 306–321. Yang, R.H., Strong, J.A., Zhang, J.M., 2009. NF-κB mediated enhancement of potassium currents by the chemokine CXCL1/growth related oncogene in small diameter rat sensory neurons. Mol. Pain 5, 26. Yang, R.H., Lin, J., Hou, X.H., Cao, R., Yu, F., Liu, H.Q., Ji, A.L., Xu, X.N., Zhang, L., Wang, F., 2014. Effect of Docosahexaenoic acid on hippocampal neurons in high glucose condition: involvement of PI3K/AKT/nuclear factor-κB-mediated inflammatory pathways. Neuroscience 274, 218–228. Yehuda, S., Carasso, R.L., 1993. Modulation of learning, pain thresholds, and thermoregulation in the rat by preparations of free purified a-linolenic and linoleic acids: determination of the optimal N3-to-N6 ratio. Proc. Natl. Acad. Sci. U. S. A. 90, 10345–10349. Young, G.S., Conquer, J.A., Thomas, R., 2005. Effect of randomized supplementation with high dose olive, flax or fish oil on serum phospholipid fatty acid levels in adults with attention deficit hyperactivity disorder. Reprod. Nutr. Dev. 45, 549–558. Ziegler, D., 2008. Painful diabetic neuropathy: treatment and future aspects. Diabetes Metab. Res. Rev. 24 (Suppl. 1), S52–S57.