Does elevated human chorionic gonadotropin alone trigger spontaneous ovarian hyperstimulation syndrome?

Does elevated human chorionic gonadotropin alone trigger spontaneous ovarian hyperstimulation syndrome? Rachel Michaelson-Cohen, M.D.,a Gheona Altarescu, M.D.,b Uziel Beller, M.D.,a Renat Reens, M.D.,a Tamar Halevy-Shalem, M.D.,a and Talia Eldar-Geva, M.D., Ph.D.a a

Department of Obstetrics and Gynecology, b Medical Genetics Unit, Shaare Zedek Medical Center, Hebrew University, Jerusalem, Israel

Objective: To test whether elevated hCG alone triggers spontaneous ovarian hyperstimulation syndrome (sOHSS). Design: Retrospective analysis. Setting: Departments of obstetrics and gynecology and of medical genetics in an academic medical center. Patient(s): A patient with sOHSS and 109 patients with elevated hCG. Intervention(s): Collecting blood samples. Main Outcome Measure(s): Follicle-stimulating hormone receptor gene sequence, levels of TSH and hCG. Result(s): We described a case of sporadic, nonfamilial sOHSS. Sequencing of the entire coding region the FSH gene revealed wild-type alleles for all the known mutations, and the A919G and A2039G polymorphisms, previously associated with good response to FSH stimulation and severe iatrogenic OHSS. We ruled out hypothyroidism. The level of hCG reached a peak of 344,350 IU/L (95th percentile). One hundred nine pregnancies with hCG of >150,000 IU/L were identified from 2001–2006. After patients with gestational trophoblastic diseases, multiple pregnancies, and iatrogenic OHSS were excluded, 27 patients remained. None of those patients experienced OHSS. Conclusion(s): Elevated hCG cannot be responsible for sOHSS as a single factor. Factors other than the hCG– FSH-receptor interaction additionally are involved in the pathogenesis of this syndrome. A combination of mechanisms may allow understanding of this enigmatic disorder. The pathophysiology of sOHSS, a rare phenomenon, has not yet been elucidated. (Fertil Steril 2008;90:1869–74. 2008 by American Society for Reproductive Medicine.) Key Words: Spontaneous ovarian hyperstimulation syndrome, hCG, FSH receptor

Ovarian hyperstimulation syndrome (OHSS) occurrs as a complication of ovulation induction therapy. The clinical manifestations of the syndrome can vary from abdominal distention and discomfort to potentially life-threatening massive ovarian enlargement with a fluid shift from the vascular compartments, creating hemoconcentration with various complications (1, 2). Although the pathophysiology of the syndrome has not been completely elucidated, it involves promiscuous activation of the luteinizing hormone/human chorionic gonadotropin receptor (LH/hCGr), causing excessive follicular recruitment and luteinization of granulosa cells. The latter secrete vasoactive substances that increase capillary permeability, causing fluid shift into a third space (3, 4). Administration of hCG causes an increase in vascular endothelial growth factor (VEGF) that is known to trigger OHSS (4). However, the level of VEGF does not always correlate with hCG concentrations (5). Therefore, factors other than hCG may be involved in the pathogenesis of this syndrome.

Received April 22, 2007; revised and accepted September 24, 2007. Reprint requests: Rachel Michaelson-Cohen, M.D., Department of Obstetrics and Gynecology, Shaare Zedek Medical Center, Hebrew University, Jerusalem, Israel (FAX: 972-2-6666053; E-mail: drraymico@ hotmail.com).

0015-0282/08/$34.00 doi:10.1016/j.fertnstert.2007.09.049

Spontaneous OHSS (sOHSS) is an extremely rare event and has been reported exclusively during pregnancy. Most of the cases described elsewhere have been familial and recurrent (6–9). Ovarian hyperstimulation syndrome has been categorized into three types according to the proposed mechanisms (3): mutation of the FSH receptor (FSHr) (1), hypothyroidism (10–12), and elevated levels of hCG (5, 13, 14). Normal FSHr are very weakly stimulated during pregnancy, because FSH is almost undetectable in the serum (15). The mutations are thought to induce a structural change in the FSHr, causing an increase in constitutive activity and a decrease in the specificity barrier toward hCG. These phenomena may cause hCG–FSHr interactions to be functionally effective. Hyperstimulation of the FSHr by hCG causes massive recruitment and growth of ovarian follicles. The follicles acquire LHL/hCGr, which also are stimulated by hCG, inducing luteinization and oversecretion of vasoactive molecules (1, 16, 17). To date, five FSHr mutations have been described in sOHSS, all in the transmembrane domain (exon10). The mutant FSHr displays an abnormally high sensitivity to hCG in transfection experiments. The following mutations have been

Fertility and Sterility Vol. 90, No. 5, November 2008 Copyright ª2008 American Society for Reproductive Medicine, Published by Elsevier Inc.

1869

correlated with sOHSS: T449I (18), T449A (2), I545T (3), D567G (1), and D567N (14).

prophylaxis was achieved by the application of low–molecular weight heparin (40 mg/d SC).

Elevated levels of hCG are related to gestational trophoblastic disease, multiple pregnancies, Rhesus factor isoimmunization, and pregnancies complicated with diabetes mellitus or chronic renal failure (19). It has been suggested that extremely high levels of hCG exaggeratedly activate FSHr and LHr, causing follicular recruitment, luteinization, and secretion of vasoactive substances (3, 4). In profound hypothyroidism, the extremely high TSH levels may also stimulate wild-type hCGr, resulting in sOHSS (3). To date, four cases of sOHSS attributed to elevated hCG levels have been described: two singleton pregnancies in the first trimester (137,000 and 348,344 IU/L; respectively, Haimov-Kochman et al. [20] and Oleson and Neumann [21]), one twin pregnancy (143,000 IU/L) (22), and one case in a patient with preeclampsia in the second trimester (153,790 IU/L), Saisto et al. [19]).

The ovarian dimensions and amount of ascites were followed by serial ultrasound examinations.

We present the fifth case in the literature of sporadic, nonfamilial sOHSS that is associated with an elevated hCG level. We ruled out the etiology of FSHr mutation or high TSH levels. To test the hypothesis of hCG as the only triggering mechanism for sOHSS, we investigated other women with pregnancies with elevated hCG levels who presented to our department. MATERIALS AND METHODS Patient With sOHSS A 36-year-old woman, gravida 7 para 6, was referred to our department in the 10th week of gestation because of abdominal discomfort and bilateral ovarian cysts that had been observed during an ultrasound examination. The woman had always been healthy. She had not taken drugs for ovulation induction. None of her relatives had experienced OHSS in their pregnancies (her 3 sisters had each been through 2–4 normal pregnancies and deliveries). She had experienced hyperemesis gravidarum in a previous pregnancy, for which she had been hospitalized. In the past, she had never had OHSS. On admission, physical examination revealed mild abdominal distention and tenderness. Ultrasound examination showed a normally developing fetus, but the patient’s ovaries were enlarged and multicystic (right ovary, 106  98 mm; left ovary, 116  110 mm). There was mild ascites. Pulsed Doppler examination revealed normal ovarian vessels. The following laboratory tests were obtained: complete blood count, renal function, E2, FSH, TSH, free T4, and tumor markers (CA-125, CA15-3, CA19-9, and CEA). The level of hCG was measured by using the first International Reference Preparation (IRP) (3rd International Standard [IS]) assay (Abbott, Abbott Park, IL). Intravenous fluids were administered to maintain a meticulous fluid balance and prevent hemoconcentration. Thrombosis 1870

Michaelson-Cohen et al.

Deoxyribonucleic acid (DNA) was extracted from a peripheral blood sample by using standard procedures (23). The coding regions (exons 1–10) and exon–intron junctions of the FSHr gene were amplified by standard polymerase chain reactions (Table 1). Amplified exons were subjected to direct sequencing on an Avant analyzer (Applied Biosystems, Foster City, CA).

Patients With High hCG Levels To correlate high hCG levels with pregnancy complications or sOHSS, we collected data on all patients who had hCG of >150,000 IU/L in our laboratory from 2001 to 2006. The medical records were reviewed for the following: [1] gestational age at time of hCG measurement, [2] chief complaint at time of hCG measurement, [3] hCG level, [4] ultrasonographic findings, [5] diagnosis, [6] pregnancy outcome, and [7] complications. After excluding patients with gestational trophoblastic diseases, multiple pregnancies, and iatrogenic OHSS, we contacted the remaining patients. We requested the following information: [1] whether they were familiar with the term OHSS; [2] whether they had experienced abdominal distention and discomfort and/or respiratory distress during the 1st trimester; [3] whether they had had complications related to ovaries, abdominal fluid, or unusual ultrasonic findings; and [4] whether they had had complications during pregnancy, labor, and/or delivery. RESULTS Patient With sOHSS Laboratory testing showed a hematocrit of 44% and a mild leukocytosis of 11.4 (103 per mL). Concentrations of creatinine (41.5 mmol/L) and blood urea nitrogen (2.5 mmol/L), E2 (48,319 pmol/L), and FSH (<0.5 IU/L) were normal. Thyroid-stimulating hormone was undetectable (<0.03 mIU/L), despite a normal level of free T4 (2.21 nmol/L). CA125 was slightly elevated (43.5 U/mL); CA15-3 (11.9 U/mL), CA19-9 (11.9 U/mL), and CEA (<0.5 ng/mL) were normal. The level of hCG reached a peak of 344,350 IU/L (the 95th percentile of the peak hCG level in a normal pregnancy is 300,000 IU/L; Fig. 1). A few weeks later, the level decreased to 161,103 IU/L. No mutations were found in any of the sequenced exons. Sequencing of exon 10 of the FSHr gene revealed wildtype alleles for the T449I, T449A, I545T, D567G, and D567N mutations. The sequencing showed threonine (T) at position 919 (A919G) and asparagine (N) at position 2039 (A2039G).

Mechanism of spontaneous OHSS

Vol. 90, No. 5, November 2008

TABLE 1 Primers used for polymerase chain reactions of each exon. Exon

Forward or reverse

ex1 ex1 ex2 ex2 ex3 ex3 ex4 ex4 ex5 ex5 ex6 ex6 ex7 ex7 ex8 ex8 ex9 ex9 Exon 10a Exon 10a

F R F R F R F R F R F R F R F R F R F R

Exon 10b

F

Exon 10b

R

Exon 10c

F

Exon 10c

R

Exon 10d

F

Exon 10d

R

Primer sequence cacatgaccctaccagttct aatagtacgcaatgcacaaa tggcaagcacttagtatatgg tagatgtggtctgaggttgc ggaaaggagttttgtgtgtc ctcccaggaatgtagaagaa aatagatgggtggatgagtg aataggcttgcactatttaatca attctggaaagttcatgctc gctaacccagagcaatacat gctgatcatcttctaaacaaca aggagcatccaattatgaga gtgctgtctgcccttgct gaaggaaaacacaaagccaca caaggccatttaaagggaaa ggaagcttctcccctagctg tgtctgctattttgcctgct ggcttgagacagggaactct tgctatactggatctgagatgttga GCTTAGGGGAGCAG GTCAC GAGTCCAGCTACAGC AGAGGA AAGACAGTGAAAAAG CCAGCA TACCTGCTGCTCATT GCATC CGATCCTGGTGTCAC TAGAGG CTACCTCACAGTGCG GAACC cccttcaaaggcaagactga

Note: F ¼ forward primer; R ¼ reverse primer. Michaelson-Cohen. Mechanism of spontaneous OHSS. Fertil Steril 2008.

A few days after admission, the ovarian dimensions had reached their peak (right ovary, 166  163 mm; left ovary, 163  157 mm). However, only minimal ascites was noted (Fig. 2). The clinical condition and laboratory testing improved during the following weeks. The size of the ovaries diminished slowly, and the cysts regressed. The ascites was minimal throughout the patient’s admission. At the gestational age of 40 weeks, the patient had a spontaneous delivery of a healthy male infant weighing 3,536 g. The delivery was otherwise uneventful. The dimension and structure of the ovaries were normal at the ultrasound scan 2 months after delivery, with no fluid in the pelvis. Fertility and Sterility

Patients With High hCG Levels One hundred nine pregnancies with hCG of >150,000 IU/L were identified in our laboratory from 2001 to 2006. After patients with gestational trophoblastic diseases, multiple pregnancies, and iatrogenic OHSS were excluded, 27 patients remained (Table 2). Their hCG levels ranged from 151,980 to 398,743 IU/L. The patients were evaluated in the emergency room for several symptoms, which included vomiting (n ¼ 6), lower abdominal pain (n ¼ 5), vaginal bleeding (n ¼ 5), diarrhea (n ¼ 2), flank pain (n ¼ 2), vertigo (n ¼ 2), constipation (n ¼ 1), urinary retention (n ¼ 1), leg pain (n ¼ 1), headache (n ¼ 1), and cough (n ¼ 1). Blood samples were obtained for analysis. An ultrasound examination was performed on all patients; none had enlarged or multicystic ovaries, ascites, or any other unusual findings. None were hospitalized during pregnancy. None were familiar with the term OHSS; none had experienced abdominal distention and discomfort and/or respiratory distress during the 1st trimester; and none recalled any complication related to ovaries or abdominal fluid or unusual ultrasonic findings. In two cases, the pregnancy ended with an early miscarriage without complications. The remaining 25 patients had normal pregnancies with no major complications at labor and/or delivery.

DISCUSSION Cases of sOHSS described elsewhere in the literature have been recurrent and familial. We present an interesting case, in which the patient and her family members had not experienced OHSS in any of their previous pregnancies. In addition, none of the FSHr mutations described in previous sOHSS cases were found in our patient’s DNA analysis. Furthermore, sequencing of the entire FSHr gene showed a normal sequence. We found the A919 genotype and A2039 genotype for the polymorphisms of the FSHr. Their occurrence has not been investigated in other sOHSS cases. Polymorphisms in positions 919 and 2039 of exon 10 of the FSHr may be associated with the development of iatrogenic OHSS (A919G, A2039G) (1). The frequency of the A allele for A919G and A2039G polymorphisms in Caucasians is 60% and 61%, respectively (16). Because of near-complete disequilibrium, results usually follow the same pattern for the A919G and A2039G polymorphism (16). The combination of A919 and A2039 is frequent in 39% of the Caucasian population (16). The A allele for 2039 has been associated with lower basal FSH levels, a good response to ovulation induction, higher pregnancy rates (24), and iatrogenic OHSS (16). In one study, higher prevalence of this polymorphism was observed in women who developed severe iatrogenic OHSS (1, 16). It was then suggested that this genotype could be a predictor of severity in OHSS patients. In later studies, however, this polymorphism was not found to be correlated with ovarian response to ovulation induction (25) or OHSS (26) and therefore is probably of minimal clinical significance. 1871

FIGURE 1

FIGURE 2

Human chorionic gonadotropin (IU/L) by week of gestation. LMP ¼ last menstrual period. ªCopyright 2000 by Diagnostic Medlab Limited, with permission.

Sonographic images of sOHSS patient’s ovaries.

Michaelson-Cohen. Mechanism of spontaneous OHSS. Fertil Steril 2008.

Michaelson-Cohen. Mechanism of spontaneous OHSS. Fertil Steril 2008.

Our patient had neither clinical hypothyroidism nor indicative laboratory findings. Eight days after fertilization, the trophoblast begins to secrete hCG that normally peaks at 100,000 IU/L in maternal serum by week 8–10 of gestation (20). In the case presented, as well in the four previously published cases, hCG levels reached the 95th percentile. This could have been interpreted as the trigger to sOHSS, as suggested in reports elsewhere (19–22). However, hCG may not be the only triggering mechanism. There are many arguments against this theory, according to our findings and those of and other investigators. These are the following: 1. The normal corpus luteum releases vasoactive molecules that cause vascular permeability. From the 5th week of pregnancy, despite increasing hCG levels, the corpus luteum activity diminishes, and the levels of these substances decrease (1, 19). 2. The levels of VEGF, the key vasoactive substance in OHSS, do not always correlate with hCG concentra1872

Michaelson-Cohen et al.

tions, even when VEGF levels correlate with the course of OHSS (5). 3. If hCG were indeed the only triggering mechanism of sOHSS, one would expect sOHSS to occur frequently in patients with significantly elevated hCG levels. Despite exceptionally high hCG levels and theca lutein cyst formation during molar and multiple pregnancies, the prevalence of OHSS in these patients is low (5). A multiplicity of factors could influence the secretion of and the response to the vasoactive substances in the presence of high hCG levels. 4. We investigated 27 spontaneous, nonmolar, singleton pregnancies with high hCG levels (151,000–398,000 IU/L) and discovered that none of these patients experienced OHSS. One would expect sOHSS to occur in these cases if hCG were indeed the only triggering mechanism. 5. Elsewhere, four cases of sOHSS attributed to elevated hCG levels have been described: two singleton pregnancies in the 1st trimester (137,000 and 348,344

Mechanism of spontaneous OHSS

Vol. 90, No. 5, November 2008

TABLE 2 Patients with high hCG levels. Pregnancy wk hCG level (IU/L) 150,000–200,000

200,000–300,000

300,000–400,000

Chief complaint

No. of cases

Wk no.

No. of cases

Complaint

No. of cases

Pregnancy outcome

18

6

1

Abdominal pain

4

16 uncomplicated deliveries, 2 missed abortions

5

7 8 9 10 11 12 9

2 2 3 1 5 4 2

Vaginal bleeding Vomiting Diarrhea Urinary retention Flank pain Headache Abdominal pain

5 4 2 1 1 1 1

4

10 12 8

2 1 2

Vomiting Other Abdominal pain

1 3 2

9

2

Vomiting

2

5 uncomplicated deliveries

4 uncomplicated deliveries

Michaelson-Cohen. Mechanism of spontaneous OHSS. Fertil Steril 2008.

IU/L; respectively, Haimov-Kochman et al. [20] and Oleson and Neumann [21]), one twin pregnancy (143,000 IU/L) (Suzuki et al. [22]), and one case in a patient with preeclampsia in the second trimester (153,790 IU/L) (19). Therefore, only one patient had levels reaching the 95th percentile, similar to our patient. 6. The relationship of OHSS and the level of hCG is inconsistent. For example, Ludwig et al. (5) described a case in which sOHSS developed when the hCG level had declined, after termination of pregnancy. We conclude that elevated hCG cannot be the only factor responsible for sOHSS. There may be a variant hCG with higher biological activity that is able to activate the FSHr. Another possibility is that hCG triggers the generation of other substances that are responsible for sOHSS (and that act similarly to VEGF). Granulosa cells more sensitive to FSHr stimulation may be implicated. High levels of placental hormones (particularly E2) may act in synergy with the FSHr to promote granulosa cell proliferation. Factors other than the hCG– FSHr interaction additionally are involved in the pathogenesis of this syndrome. Contributions of other cytokines, prostaglandins, and components of the renin–angiotensin system have not been completely clarified. A combination of mechanisms may allow understanding of this enigmatic disorder. Singling out one factor is an oversimplification of a complex, multifactorial syndrome. Therefore, the pathophysiology of the sOHSS, a rare phenomenon, has not yet been elucidated. Fertility and Sterility

Acknowledgment: The authors are grateful to Pinchas Renbaum, Ph.D., from the Medical Genetics Unit, for his help in the sequencing of the FSHr gene.

REFERENCES 1. Delbaere A, Smits G, De Leener A, Costagliola S, Vassart G. Understanding ovarian hyperstimulation syndrome. Endocrine 2005;26: 285–9. 2. Montanelli L, Delbaere A, Di Carlo C, Nappi C, Smits G, Vassart G, et al. A mutation in the follicle stimulating hormone receptor as a cause of familial spontaneous ovarian hyperstimulation syndrome. J Clin Endocrinol Metab 2004;89:1255–8. 3. De Leener A, Montanelli L, Van Durme J, Chae H, Smits G, Vassart G, et al. Presence and absence of FSH receptor mutations provide some insights to spontaneous ovarian hyperstimulation syndrome physiopathology. J Clin Endocrinol Metab 2006;91:555–62. 4. Elchalal U, Schenker JG. The pathophysiology of ovarian hyperstimulation syndrome—views and ideas. Hum Reprod 1997;12:1129–37. 5. Ludwig M, Gembruch U, Bauer O, Diedrich K. Ovarian hyperstimulation syndrome (OHSS) in a spontaneous pregnancy with fetal and placental triploidy: information about the general pathophysiology of OHSS. Hum Reprod 1998;13:2082–7. 6. Zalel Y, Orvieto R, Ben Rafael Z, Homburg R, Fisher O, Insler V. Recurrent spontaneous ovarian hyperstimulation syndrome associated with polycystic ovary syndrome. Gynecol Endocrinol 1995;9: 313–5. 7. Olatunbosun O, Gilliland B, Brydon LA, Chizen DR, Pierson R. Spontaneous ovarian hyperstimulation syndrome in four consecutive pregnancies. Clin Exp Obstet Gynecol 1996;23:127–32. 8. Di Carlo C, Bruno P, Cirillo D, Morgera R, Pellicano M, Nappi C. Increased concentrations of renin, aldosterone and Ca125 in a case of spontaneous, recurrent, familial, severe ovarian hyperstimulation syndrome. Hum Reprod 1997;12:2115–7. 9. Edi-Osagie E, Hopkins R. Recurrent idiopathic ovarian hyperstimulation syndrome in pregnancy. Br J Obstet Gynaecol 1997;104:952–4.

1873

10. Rotmensch S, Scommegna A. Spontaneous ovarian hyperstimulation syndrome associated with hypothyroidism. Am J Obstet Gynecol 1989;160:1220–2. 11. Nappi RG, Di Naro E, D’Aries AP. Natural pregnancy in hypothyroid women complicated by spontaneous ovarian hyperstimulation syndrome. Am J Obstet Gynecol 1998;178:610–1. 12. Taher BM, Ghariabeh RA, Ajfouni KM. Spontaneous ovarian hyperstimulation syndrome caused by hypothyroidism in an adult. Eur J Obstet Gynecol Reprod Biol 2004;112:107–9. 13. Rosen GF, Lew MW. Severe ovarian hyperstimulation in a spontaneous singleton pregnancy. Am J Obstet Gynecol 1991;165:1312–3. 14. Smits G, Olantunbosun MB, Delbaere A, Pierson R, Vassart G, Costagliola S. Ovarian hyperstimulation syndrome due to a mutation in the follicle-stimulating hormone receptor. N Engl J Med 2003;349:760–6. 15. Mesiano S, Jaffe RBz. The endocrinology of human pregnancy and fetalplacental neuroendocrine development. In: Strauss J, Barbieri R, eds. Yen and Jaffe’s reproductive endocrinology. 5th ed. Philadelphia, PA: Elsevier, 2004:326–7. 16. Daelemans C, Smits G, De Maertelaer V, Costagliola S, Englert Y, Vassart G, et al. Prediction of severity of symptoms in iatrogenic ovarian hyperstimulation syndrome by follicle-stimulating hormone receptor Ser680Asn polymorphism. J Clin Endocrinol Metab 2004;89:6310–5. 17. Delbaere A, Smits G, Olantunbosun MB, Pierson R, Vassart G, Costagliola S. New insights into the pathophysiology of ovarian hyperstimulation syndrome. What makes the difference between spontaneous and iatrogenic syndrome? Hum Reprod 2004;19:486–9. 18. Vasseur C, Rodien P, Beau I, Desroches A, Gerard C, de Poncheville L, et al. A chorionic gonadotropin-sensitive mutation in the follicle-stimu-

1874

Michaelson-Cohen et al.

19.

20.

21. 22.

23.

24.

25.

26.

lating hormone receptor as a cause of familial gestational spontaneous ovarian hyperstimulation syndrome. N Engl J Med 2003;349:753–9. Saiso T, Tiitinen A, Ulander VM, Kaaja R. Clinical cure of severe, early onset preeclampsia with low molecular weight heparin therapy in primigravida with hyperreactio luteinalis and thrombophilia. Hum Reprod 2004;19:725–8. Haimov-Kochman R, Yanai N, Yagel S, Amsalem Y, Lavy Y, Hurwitz A. Spontaneous ovarian hyperstimulation syndrome and hyperreactio luteinalis are entities in continuum. Ultrasound Obstet Gynecol 2004;24:675–8. Oleson PG, Neumann GA. Spontaneous ovarian hyperstimulation syndrome in a normal singleton pregnancy. Ugeskr Laeger 2005;167:411–2. Suzuki S. Comparison between spontaneous ovarian hyperstimulation syndrome and hyperreactio luteinalis. Arch Gynecol Obstet 2004;269: 227–9. Miller SA, Dykes DD, Polesky HF. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res 1988;16:1215. Jun JK, Yoon JS, Ku SY, Choi YM, Hwang KR, Park SY, et al. Folliclestimulating hormone receptor gene polymorphism and ovarian responses to controlled ovarian hyperstimulation for IVF-ET. J Hum Genet 2006;51:665–70. Klinkert ER, te Velde ER, Weima S, van Zandvoort PM, Hanssen RG, Nilsson PR, et al. FSH receptor genotype is associated with pregnancy but not with ovarian response in IVF. Reprod Biomed 2006;13:687–95. d’Alva CB, Serafini P, Motta E, Kohek MB, Latronico AC, Mendonca BB. Absence of follicle-stimulating hormone receptor activating mutations in women with iatrogenic ovarian hyperstimulation syndrome. Fertil Steril 2005;83:1695–9.

Mechanism of spontaneous OHSS

Vol. 90, No. 5, November 2008