Does GRK–β arrestin machinery work as a “switch on” for GPR17-mediated activation of intracellular signaling pathways?

Cellular Signalling 26 (2014) 1310–1325

Contents lists available at ScienceDirect

Cellular Signalling journal homepage: www.elsevier.com/locate/cellsig

Does GRK–β arrestin machinery work as a “switch on” for GPR17-mediated activation of intracellular signaling pathways? Simona Daniele a,1, Maria Letizia Trincavelli a,⁎,1, Marta Fumagalli b, Elisa Zappelli a, Davide Lecca b, Elisabetta Bonfanti b, Pietro Campiglia c, Maria P. Abbracchio b, Claudia Martini a,⁎ a b c

Department of Pharmacy, University of Pisa, 56126 Pisa, Italy Department of Pharmacological and Biomolecular Sciences, University of Milan, 20133 Milan, Italy Department of Pharmacy, University of Salerno, 84084 Salerno, Italy

a r t i c l e

i n f o

Article history: Received 11 February 2014 Accepted 27 February 2014 Available online 5 March 2014 Keywords: GPCR desensitization Signaling transduction GRK/β-arrestin machinery Intracellular signaling Oligodendrocyte differentiation

a b s t r a c t During oligodendrocyte-precursor cell (OPC) differentiation program, an impairment in the regulatory mechanisms controlling GPR17 spatio-temporal expression and functional activity has been suggested to contribute to defective OPC maturation, a crucial event in the pathogenesis of multiple sclerosis. GRK–β arrestin machinery is the primary actor in the control of G-protein coupled receptor (GPCR) functional responses and changes in these regulatory protein activities have been demonstrated in several immune/inflammatory diseases. Herein, in order to shed light on the molecular mechanisms controlling GPR17 regulatory events during cell differentiation, the role of GRK/β-arrestin machinery in receptor desensitization and signal transduction was investigated, in transfected cells and primary OPC. Following cell treatment with the two classes of purinergic and cysteinylleukotriene (cysLT) ligands, different GRK isoforms were recruited to regulate GPR17 functional responses. CysLT-mediated receptor desensitization mainly involved GRK2; this kinase, via a G protein-dependent mechanism, promoted a transient binding of the receptor to β-arrestins, rapid ERK phosphorylation and sustained nuclear CREB activation. Furthermore, GRK2, whose expression parallels that of the receptor during differentiation process, appeared to be crucial to induce cysLT-mediated maturation of OPCs. On the other hand, purinergic ligand exclusively recruited the GRK5 subtype, and induced, via a G proteinindependent/β-arrestin-dependent mechanism, a receptor/β-arrestin stable association, slower and sustained ERK stimulation and marginal CREB activation. These results show that purinergic and cysLT ligands, through the recruitment of specific GRK isoforms, address distinct intracellular pathways, most likely reinforcing the same final response. The identification of these mechanisms and players controlling GPR17 responses during OPC differentiation could be useful to identify new targets in demyelination diseases and to develop new therapeutical strategies. © 2014 Published by Elsevier Inc.

1. Introduction Oligodendrocyte precursor cells (OPCs) are the myelinating cells of the central nervous system (CNS), and the end product of a cell lineage which undergoes a complex and timely program of proliferation, migration, differentiation and myelination, to finally produce the insulating sheath of axons [1,2]. A very dynamic interplay between transcription factors and specific proteins regulates the progression of OPCs toward mature myelinating cells. Among these proteins, a crucial role has emerged for the membrane G protein coupled receptor (GPCR),

⁎ Corresponding authors at: Department of Pharmacy, University of Pisa, Via Bonanno, 6, Pisa 56126, Italy. Tel.: +39 0502219522 509. E-mail addresses: [email protected] (M.L. Trincavelli), [email protected] (C. Martini). 1 Equally contributed.

http://dx.doi.org/10.1016/j.cellsig.2014.02.016 0898-6568/© 2014 Published by Elsevier Inc.

GPR17 [3–9]. GPR17 stimulation by both classes of its putative agonists (uracil-nucleotides like UDP, UDP-glucose, or cysteinyl-leukotrienes, cysLTs, like LTC4, LTD4) promotes cell differentiation and myelination in primary OPCs [5], in Oli-Neu cells [8] and in primary murine glioblastoma cells [10]. At rather advanced differentiation stages (i.e., in immature oligodendrocytes expressing the O4 protein), loss of GPR17 seems to be a prerequisite to allow cells to further proceed to terminal maturation, because the forced expression of GPR17 at such late stages prevented myelination and induced precocious death [4]. To explain GPR17 transient expression in OPCs and its effects on cell maturation, a current hypothesis is that, by binding to GPR17, its endogenous ligands can first induce early precursor cells to undergo differentiation, and then switch the receptor off by agonist-induced desensitization, thus allowing cells' terminal maturation. Thus, by controlling the active state of receptors at the plasma membrane, agonist-mediated GPR17 desensitization/internalization finely regulates cells' progression along

S. Daniele et al. / Cellular Signalling 26 (2014) 1310–1325

their differentiation pathway. This may also imply that, other than serving to turn-off its biological response, GPR17 desensitization may act as an “on” switch sustaining long-term signaling and inducing nuclear events at the basis of OPC terminal maturation. Typically, regulation of GPCR responses involved the activation of desensitization machinery which started with phosphorylation of agonist-activated receptor by second messenger-dependent and/or GPCR kinases (GRKs [11,12]). Agonist-triggered phosphorylation of GPCRs by GRKs primes the recruitment of the regulatory proteins β-arrestins, leading to receptor un-coupling from G proteins and internalization [11]. Besides controlling receptor responsiveness, GRKs and β-arrestins can also act as agonist-regulated scaffolds assembling macromolecular signalosomes in the receptor environment, thereby contributing to signal propagation from cytosol to nucleus, and controlling gene transcription machinery [13,14]. Recent evidence suggests that the GRK/arrestin desensitization machinery fulfills a vital role in regulating cellular responses to GPCRs [15–18] and that changes in expression/functioning of these regulatory proteins may be crucial in the progression of various acute and chronic inflammatory/autoimmune disorders, including multiple sclerosis (MS) and rheumatoid arthritis [17,19–21]. In addition, GRK/arrestin machinery has been involved in the control of cell differentiation program [22]. These data are consistent with the notion that GPCR responsiveness may be differentially regulated during cell differentiation. Herein, the involvement of GRK/β-arrestin machinery in GPR17 desensitization, and the role of these signaling regulatory proteins in the OPC differentiation program evoked by GPR17 ligands, were investigated. We demonstrated that, the two classes of chemically- and metabolically-unrelated ligands recruited different GRK isoforms to regulate GPR17 functional responses and activated distinct intracellular signaling pathways to control OPC differentiation program. Based on our data demonstrating a pivotal role for GPR17 regulatory mechanisms in OPC differentiation, the investigation of these processes becomes of paramount importance not only in understanding the role of GPR17 in OPC differentiation, but also in identifying new targets for the development of remyelinating therapies. 2. Materials and methods 2.1. Primary OPC culture OPCs were isolated from mixed glial cultures from postnatal day 2 Sprague–Dawley rat cortex, by the shaking method, as described [5]. OPCs were cultured in Neurobasal with 2% B27 (Invitrogen, Monza, Italy), 2 mM L-glutamine, 10 ng/ml human platelet-derived growth factor BB (Sigma-Aldrich, Milan, Italy), and 10 ng/ml human basic fibroblast growth factor (Invitrogen, Monza, Italy), to promote proliferation. About 90% of cells were positive for the Olig2; a very low percentage of contaminating astrocytes and microglia was found. After 1 day, cells were switched to a Neurobasal medium lacking growth factors to allow differentiation. In some experiments triiodothyronine T3 was also added to a final concentration of 10 ng/ml. Experiments were performed after 5–6 days of differentiation in culture, when, in our standardized protocol [5], cells reached the immature pre-oligodendrocyte stage; indeed, previous studies [5] have shown that GPR17 expression is maximal in immature preoligodendrocytes and then gradually decreases along with terminal maturation. 2.2. Cell culture and HA Tag-GPR17 transfection Astrocytoma cells (1321N1) were seeded onto 75 cm2 flasks (106 cells) in DMEM-F12 containing 10% FBS, 200 U/ml penicillin,

1311

200 μg/ml streptomycin, and 2 mM L -glutamine at 37 °C, 5% CO2 and 95% humidity. The coding sequence of human GPR17 has been amplified with RTPCR from total brain RNA (Ambion, Life Technologies, Monza, Italy) using the following primers: Fw 5′-ATGTACCCATACGATGTTCCAGATTA CAATGGCCTTGAAGTGGCTC-3′; Rv 5′-TGGGTCTGCTGAGTCCTAAA-3′. In the Fw primer, the GPR17 start codon has been deleted, and a HATag has been introduced upstream to the coding sequence. The obtained PCR product has been cloned in a pcDNA3.1 expression vector (Life Technologies, Monza, Italy). The correctness of sequence and orientation have been confirmed by sequencing. The generated plasmid has been used for transfection experiments in 1321N1 cells. Cells were transfected with pcDNA 3.1-human HA Tag-GPR17 or with the plasmid alone by the PEI method (JetPEI, Polyplus transfection). Two days after transfection, 1321N1 transfected cells were trypsinized and seeded in 10-cm-diameter tissue culture dishes at different densities in medium containing 400 μg/ml G418 for the selection of colonies. Clones were screened by RT-PCR. Positive clones were then maintained in culture with 300 μg/ml G418. The biochemical characterization of HA Tag-GPR17 was performed by evaluating the pharmacological profile of GPR17 agonists/antagonists in GTPγS and cAMP assay [23]. For detailed methods and results see Supporting information (SI text). 2.3. Real time PCR studies Total RNA was extracted using RNeasy® Mini Kit (Qiagen, Milan, Italy). The purity of the RNA samples was determined by measuring the absorbance at 260:280 nm. cDNA synthesis was performed with 1 μg of total RNA using the reverse transcriptase kit (Biorad, Milan, Italy). The RT-PCR reactions consisted of 12.5 μl of Brilliant® II SYBR® Green premix, 2.5 μl of both the forward and reverse primers (at a 10 μM concentration), 3 μl of cDNA and 4.5 μl of H2O. All reactions were performed for 40 cycles using the following temperature profiles: 98 °C for 30 s (initial denaturation); 55 °C for 30 s (annealing) and 72 °C for 3 s (extension). β-Actin was used as the housekeeping gene. PCR specificity was determined using both a melting curve analysis and gel electrophoresis, and the data were analyzed by the standard curve method. mRNA levels for each sample were normalized against GAPDH mRNA levels, and relative expression was calculated using the Ct value. The following primers were used: GRK2 forward, CTCC GAGGGGACGTGTTCCAGAA and reverse GCTTTTTTGTCCAGGCACTT CAT; GRK5 forward, GACCACACAGACGACGACTTC and reverse CGTTCA GCTCCTTAAAGCATTC; β-arrestin1 forward, GGTCCTGGTGGATCCTGA GT and reverse GTCAGTGGCTTCTTGTCCTC; β-arrestin2 forward, TGAG ACAGTATGCCGACATC and reverse GTCTTCGTGCTTGAGTTGCC. For GPR17, MPB and GAPDH primers see Fumagalli et al. [5]. 2.4. Measurement of cyclic AMP levels Intracellular cAMP levels were measured using a competitive protein binding method, as previously reported [5,23]. In some experiments, transfected cells were incubated with random siRNA (control cells), or siRNA GRK2, or siRNA GRK5, as described above. 48 h after transfection, the entire medium was removed, and the cells were incubated at 37 °C for 15 min with 0.4 ml of DMEM in the presence of the phosphodiesterase inhibitor, Ro20-1724 (20 μM). Then, cells were stimulated with 10 μM UDP-glucose or 10 nM LTD4 for 15 min, and cAMP levels were quantified. For homologous desensitization experiments, transfected cells were pre-treated with 100 μM UDP-glucose or 100 nM LTD4 for different times (5–120 min). Then, cells were washed with 400 μl of saline and stimulated with the agonists as described above. For OPCs, cells were plated in 24 well-plates and after 6 days in culture functional responsiveness of GPR17 was assessed as described [5], using 500 nM UDP-glucose or 5 nM LTD4, as stimuli. For homologous

1312

S. Daniele et al. / Cellular Signalling 26 (2014) 1310–1325

B 1

RNA abundance (normalized to peak value)

A 2

3

4

110 100 90 80 70 60 50 40 30 20 10

GPR17 MBP GRK2 GRK5 β-ARRESTIN 1 β-ARRESTIN 2

1

2

3

4

5

OPC differentiation stages

5

*** ***

0'

' 90

' 60

12

10 FK

FK

Pretreatment 50 nM LTD4

Pretreatment 5 µM UDP-glucose

5 nM LTD 4

500 nM UDP-glucose

F

**

Pretreatment 5 µM UDP-glucose 500 nM UDP-glucose

** ***

***

0' 12

' 90

' 60

'

***

30

***

µM

0' 12

' 90

'

***

60

' 30

' 15

5'

***

'

**

** ***

#

10

FK

10

µM

**

Immature oligodendrocytes

110 100 90 80 70 60 50 40 30 20 10 0

15

#

cAMP/well vs FK 10µM (set to 100%)

Immature oligodendrocytes

FK

110 100 90 80 70 60 50 40 30 20 10 0

5'

E cAMP/well vs FK 10µM (set to 100%)

'

***

30

0'

' 90

' 60

' 30

'

***

12

10

5'

***

15

***

### ###

## *

'

***

###

15

*

Pre-oligodendrocytes

5'

### ##

110 100 90 80 70 60 50 40 30 20 10

µM

###

cAMP/well vs FK 10µM (set to 100%)

D

Pre-oligodendrocytes

110 100 90 80 70 60 50 40 30 20 10

µM

cAMP/well vs FK 10µM (set to 100%)

C

Pretreatment 50 nM LTD4 5 nM LTD 4

Fig. 1. GRK/β-arrestin expression and GPR17 desensitization during OPC differentiation. (A) Representative brightfield microscope images showing OPC morphology at the indicated stages are shown (stage 1/2: OPCs, stage 3: pre-oligodendrocytes, stage 4: immature oligodendrocytes, stage 5: mature oligodendrocytes). (B) Total RNA was extracted from rat OPCs at different maturation stages (from stages 1 to 5), as indicated; cDNAs obtained by retrotranscription were used for semiquantitative real-time RT-PCR. Data analysis was performed by BioradCycler Software with quantification and melting curve options. Fold changes are expressed as percentage of the peak value of each gene, set to 100%. (C–F) OPCs, isolated and differentiated at pre-oligodendrocytes (stage 3, C, D) or at immature-oligodendrocytes (stage 4, E, F), were treated with 5 μM UDP-glucose or 50 nM LTD4 for different times (5–120 min). After extensive washing, cells were treated for 15 min with 10 μM FK, in the absence or in the presence of 500 nM UDP-glucose (C, E) or 5 nM LTD4 (D, F). Intracellular cAMP levels were evaluated as reported in the Materials and methods section. Data are expressed as the percentage of FK-stimulated cAMP levels, set to 100%, and represent the means ± SEM of independent experiments (N = 4). Statistical significance was determined with a one-way ANOVA with Bonferroni post-test: *P b 0.05, **P b 0.01, ***P b 0.001 vs FK alone; #P b 0.05, ##P b 0.01, ###P b 0.001 vs 500 nM UDP-glucose or 5 nM LTD4.

S. Daniele et al. / Cellular Signalling 26 (2014) 1310–1325

desensitization experiments, OPCs were pre-treated with UDP-glucose (5 μM) or LTD4 (5 nM) for different times (5–120 min), in the absence

1313

(control cells) or in the presence of 1 μM peptide 7 [24] or of 100 nM calmodulin [25], as selective GRK2 and GRK5 inhibitors, respectively. Then,

1321N1 cells

A

B Cytosol

Membrane

Membrane

GRK2

75 KDa

400

50 KDa

OD (% vs basal)

GRK5 65 KDa

50 KDa

β-actin 43 KDa

37 KDa 100 KDa

Cytosol

300

***

GRK2

200

***

***

GRK5 100 80 60 40 20

** **

***

***

4

U D Ba P- s gl al uc os LT e D U D Ba 4 P- s gl al uc os LT e D U D Ba 4 P- s gl al uc os LT e D U D Ba 4 P- s gl al uc os LT e D

GRK2 80 KDa

75 KDa

GRK5

***

β-actin 43 KDa

1321N1 cells

D

**

4

*

2

LT

D

4

se

D U

D U

I.P. HA Tag-GPR17

lu co

uc o

Pgl

Ba

sa

se

l

0 sa l

GRK5 65 KDa

50 KDa

**

6

Pg

75 KDa 75 KDa

G RK5

8

4

GRK2 80 KDa

***

10

Ba

HA Tag-GPR17 60 KDa

###

D

GRK-GPR17 association (fold over basal)

75 KDa 50 KDa 100 KDa

G RK2

12

LT

C

Pre-oligodendrocytes GRK2

50 KDa

GPR17 48 KDa

37 KDa 100 KDa

GRK2 80 KDa

75 KDa 75 KDa

GRK5 65 KDa

50 KDa

GRK-GPR17 association (fold over basal)

F

E

#

10

GRK5

***

8

***

6 **

4

**

2

4

D LT

l gl uc os e P-

4

D LT

e gl uc os

Ba sa

D U

U

D

P-

Ba

sa

l

0

I.P. GPR17 Fig. 2. Effects of GPR17 agonists on GRK2/GRK5 membrane translocation and receptor association. (A, B) 1321N1 HA Tag-GPR17 cells were treated with medium alone (basal) or with 100 μM UDP-glucose or 100 nM LTD4 for 5 min. Cytosol and plasma membrane fractions were lysed and the levels of GRK2 and GRK5 in both fractions were quantified by immunoblotting analysis using specific antibodies. (C, D) 1321N1 HA Tag-GPR17 cells were treated with medium alone or with 100 μM UDP-glucose or 100 nM LTD4 for 5 min. Following incubation, GPR17 was immunoprecipitated using an anti-HA-Tag antibody and immunoprecipitates were probed with anti-GRK2 or anti-GRK5 antibodies. (E, F) OPCs, isolated and differentiated at pre-oligodendrocytes (stage 3), were treated with medium alone or with 5 μM UDP-glucose or 50 nM LTD4 for 5 min. Rat GPR17 was immunoprecipitated using an anti-GPR17 antibody, and immunoprecipitates were probed with anti-GRK2 or anti-GRK5 antibodies. A, C, E, representative immunoblots. B, D, F, signals were quantified by densitometry and expressed as percentage versus basal value. Data are the means ± SEM (N = 3). Statistical significance was determined with a one-way ANOVA with Bonferroni post-test: *P b 0.05, **P b 0.01, ***P b 0.001 vs basal value.

1314

S. Daniele et al. / Cellular Signalling 26 (2014) 1310–1325

cells were washed with 400 μl of saline and stimulated with the agonists as described above. 2.5. GRK or β-arrestin translocation Cells were treated with 100 μM UDP-glucose or 100 nM LTD4 for 5 min, washed thoroughly in PBS buffer and rapidly lysed in a hypotonic solution containing 10 mM Tris, pH 7.4, 5 mM EDTA, 2 μg/ml pepstatin, 5 μg/ml benzamidine and 5 μg/ml soybean trypsin inhibitor. Membrane and cytosolic fractions were prepared by centrifugation at 40,000 g for 20 min. Equal amount of cytosolic and particulate fraction proteins was resolved by SDS-PAGE electrophoresis and GRK protein levels in both fractions were visualized by immunoblotting using a specific antibody for GRK2 (Santa Cruz Biotechnology, sc-562; 1:200) or GRK5 (Santa Cruz Biotechnology, sc-565; 1:100) or β-arrestin1/2 (Santa Cruz Biotechnology, sc-74591; 1:200). 2.6. Receptor association with GRKs or β-arrestins 1321N1 HA Tag-GPR17 cells and OPCs were treated with medium alone (basal) or with UDP-glucose (100 μM or 5 μM, respectively) or LTD4 (100 nM or 50 nM, respectively) for 5 or 30 min, and then lysed as described above. In the case of GRKs, 1 mg cell lysates were incubated with anti-HA Tag antibody (for transfected cells) or with a home-made rabbit anti-GPR17 antibody (for OPCs [2]) overnight at 4 °C under constant rotation. In the case of β-arrestins, 1.5 mg cell lysates from transfected cells were incubated with anti-β-arrestin1 (Santa Cruz Biotechnology, sc-9182; 5 μg/sample) or anti-β-arrestin2 (abcam, ab31294; 5 μg/sample) overnight at 4 °C. Probes were then immunoprecipitated with protein A-Sepharose (2–3 h at 4 °C). Immunocomplexes, after being washed, were resuspended in Laemmli solution and boiled for 5 min, resolved by SDS-PAGE (8.5%), transferred to PVDF membranes and probed overnight at 4 °C with the specific primary antibodies: anti-GRK2 (Santa Cruz Biotechnology, sc-562; 1:200); anti-GRK5 (Santa Cruz Biotechnology, sc-565; 1:100); anti-HA Tag (1:500); and anti-GPR17 (1:1000). The primary antibodies were detected using anti-rabbit or anti-mouse IgG light chains conjugated to peroxidase (diluted 1:10,000 and 1:5000, respectively).

1:750). The primary antibodies were detected using anti-rabbit IgG light chains conjugated to peroxidase (diluted 1:10,000). The peroxidase was detected using a chemiluminescent substrate (ECL, Perkin Elmer). In some experiments, cells were incubated with random siRNA (control cells), or siRNA GRK2, or siRNA GRK5 and processed as described above. 2.8. siRNA mediated inhibition of gene expression in transfected cells 1321N1 HA Tag-GPR17 cells have been transfected with a siRNA specifically designed for the silencing of the human GRK2, GRK5, βarrestin1 or β-arrestin2 (Santa Cruz Biotechnology, Heidelberg, Germany). The siRNAs have been transfected with siRNA transfection reagent (Invitrogen, Monza, Italy) to a final concentration of 50 nM, following the manufacturer's protocol. In parallel to each silencing experiment, an ineffective sequence of RNA has been used as negative control (Santa Cruz Biotechnology, Heidelberg, Germany). Transfected cells were used 48 h after siRNA transfection. The silence efficacy was verified by both RT-PCR and Western blot analysis (see Supporting information). 2.9. ERK1/2 phosphorylation assays Cells were cultured in 96-well microplates (5000 cells/well) and treated with 100 μM UDP-glucose or 100 nM LTD4 for different times (5–60 min). The ERK1/2 activation was assessed by Fast Activated Cell-based ELISA Kits [26]. When indicated, cells were preincubated with 200 ng/ml PTX for 18 h, before GPR17 ligand-treatments. In some experiments, cells were incubated with siRNA random, or siRNA β-arrestin2, or siRNA β-arrestin1, or the two siRNAs combined together. 48 h after transfection, the entire medium was removed, and the cells were treated as described above. To evaluate the cellular location of activated ERK, nuclear cell fractions were isolated as previously described [27] and pERK1/2 were detected in both cytoplasmic and nuclear fractions by immunoblotting using an anti-pERK1/2 antibody (Santa Cruz Biotechnology, sc-7383; 1:100). 2.10. CREB phosphorylation assays

2.7. Receptor phosphorylation 1321N1 HA Tag-GPR17 cells were treated with medium alone (control) or with 100 μM UDP-glucose or 100 nM LTD4 for different times (5 or 30 min), and then lysed for 60 min at 4 °C by the addition of 200 μl RIPA buffer (9.1 mM NaH2PO4, 1.7 mM Na2HPO4, 150 mM NaCl, pH 7.4, 0.5% sodium deoxycholate, 1% Nonidet P-40, and 0.1% SDS, protease inhibitor cocktail). Extracts were then equalized by protein assay, and 1 mg cell lysates were precleared with protein A-Sepharose (1 h at 4 °C) to precipitate and eliminate IgG. Samples were then centrifuged for 10 min at 4 °C (14,000 g). The supernatants were incubated with anti-HA Tag antibody (Millipore, Massachusetts, USA, Cat # 05-904; 5 μg/sample) overnight at 4 °C under constant rotation and then, immunoprecipitated with protein A-Sepharose (2 h at 4 °C). Immunocomplexes, after being washed, were resuspended in Laemmli solution and boiled for 5 min, resolved by 8.5% SDS-PAGE, transferred to PVDF membranes and probed overnight at 4 °C with primary antibody anti-Phosphothreonine (Millipore, Massachusetts, USA, Cat # AB1607; 1:750) or anti-Phosphoserine (Millipore, Cat # AB1603;

1321N1 HA Tag-GPR17 cells were incubated with 100 μM UDPglucose or 100 nM LTD4 for different times (2.5–60 min), and levels of phosphorylated CREB were detected by the high-throughput TransAM® assay (Active Motif, La Hulpe, Belgium), following the manufacturer's instructions. 2.11. GRK2 silencing in OPCs during cell differentiation OPCs were transfected with a mixture of four siRNAs provided as a single reagent (SMARTpool) and designed for silencing rat GRK2 (Thermo Scientific). In parallel, an ineffective randomly designed pool of siRNAs was used as negative control (Thermo Scientific). siRNAs (c.f. 50 nM) were transfected with Lipofectamine RNAiMAX reagent (Life Technologies) following the manufacturer's protocol. Western blot analysis was performed 24, 48, and 96 h after RNA interference maintaining cells in differentiation medium with T3, as previously described [28]. Briefly, approximately 25–30 μg aliquots from each protein sample were loaded on 12% SDS-PAGE (for MBP and

Fig. 3. Agonist-mediated GPR17 phosphorylation and GRK specificity. (A, B) 1321N1 HA Tag-GPR17 cells were treated with medium alone (basal) or with 100 μM UDP-glucose or 100 nM LTD4 for different times (5–30 min). Following incubation, GPR17 was immunoprecipitated using an anti HA-Tag antibody, and immunoprecipitates were probed with antiphosphothreonine or anti-phosphoserine antibodies. (C, D) Cells were transfected with siRNA random, or siRNA GRK2 or siRNA GRK5. Cells were treated with 100 μM UDP-glucose or 100 nM LTD4 and receptor phosphorylation levels were determined as in (A). (E, F) OPCs, isolated and differentiated at pre-oligodendrocytes (stage 3), were treated with medium alone or with 5 μM UDP-glucose or 50 nM LTD4 for 5 min. Rat GPR17 was immunoprecipitated using an anti-GPR17 antibody, and immunoprecipitates were probed with anti-phosphothreonine antibody. A, C, E, representative immunoblots. B, D, F, signals were quantified by densitometry and expressed as percentage versus basal value. Data are the means ± SEM (N = 3). Statistical significance was determined with a one-way ANOVA with Bonferroni post-test to correct for multiple comparisons between the respective siRNA random transfected cells and siRNA GRK2/5-transfected cells: *P b 0.05, **P b 0.01, ***P b 0.001 vs basal value; #P b 0.05, ##P b 0.01 vs siRNA random.

S. Daniele et al. / Cellular Signalling 26 (2014) 1310–1325

CNPase detection) or on 8.5% SDS-PAGE (for GPR17 and GRK2 detection) blotted onto nitrocellulose membrane or PVDF membranes (Bio-Rad, Milan, Italy). Filters were saturated with 10% non-fat dry milk in Tris-buffered saline (TBS) (1 mM Tris–HCl, 15 mM NaCl, pH 8) for 1 h at RT, and then incubated overnight at 4 °C with the following

1315

primary antibodies: rabbit anti-GRK2 (1:200 in 5% non-fat dry milk in TBS), rabbit anti-GPR17 (1:1000 in 5% non-fat dry milk in TBS, inhouse made [8]); rabbit anti-CNPase (1:250 in 5% non-fat dry milk in TBS, Santa Cruz), rat anti-MBP primary antibody (1:500 in 5% non-fat dry milk in TBS, Chemicon, Millipore) and mouse anti-α-tubulin

1321N1 cells

B

2

** *

0

30

5

Ba

3.0

**

1.5 1.0 0.5

PD

P-

U

D

#

siRNA random siRNA GRK5

#

2.5

**

**

*

2.0 1.5 1.0 0.5

U

D

P-

F

***

2.0 *

1.5 1.0 0.5

4

0.0 Ba sa l Pgl uc os e LT D

I.P. GPR17

p-THR

2.5

D

p-THR

3.0

U

GPR17

GPR17 Phosphorylation (fold vs basal)

50 KDa 37 KDa

4

LT D

se co

4

LT D

co gl u

U

D

P-

Ba sa

l

se

0.0

Pre-oligodendrocytes

E

4

uc

os

sa gl

uc

Ba U

p-THR

os e LT D

0.0 l

50 KDa

**

**

2.0

4

HA Tag-GPR17

2.5

Ba

75 KDa

min

siRNA random siRNA GRK2

##

e

siRNA GRK5 siRNA random

3.0

LT D

siRNA random siRNA GRK2

30

5

Ba

C

GPR17 Phosphorylation (fold vs basal)

I.P. HA Tag-GPR17

***

1

GPR17 Phosphorylation (fold vs basal)

D

***

*

sa l

p-SER

p-SER ***

3

sa l

p-THR

***

4

gl

50 KDa

UDP-glucose LTD4

***

5

gl u

HA Tag-GPR17

l

GPR17 Phosphorylation (fold vs basal)

p-THR

sa

30 min

sa l

5 min

75 KDa

Ba

A

1316

S. Daniele et al. / Cellular Signalling 26 (2014) 1310–1325

(1:1500 in 5% non-fat dry milk in TBS, Sigma). Filters were then washed in TBS-T (TBS plus 0.1% Tween), incubated for 1 h with goat anti-rat, anti-rabbit, anti-mouse secondary antibody conjugated to horseradish peroxidase (1:1000, 1:4000 or 1:2000, in 5% non-fat dry milk in TBS, respectively, Sigma, Milan, Italy). Detection of proteins was performed by enhanced chemiluminescence (Amersham Biosciences, Milan, Italy) and autoradiography. Densitometric analysis of protein bands was performed using “ImageJ” software.

2.12. Immunocytochemistry in OPCs To verify the involvement of GRK2 in the LTD4-induced formation of mature oligodendrocytes, primary OPCs, maintained in differentiating medium, were treated at the pre-oligodendrocyte stage with LTD4 (100 nM) in the absence (control) or in the presence of 1 μM GRK2 inhibitor (peptide 7). After 48 h, cells were fixed at room temperature with 4% paraformaldehyde in 0.1 M PBS, to determine their maturation degree by immunocytochemistry. Labeling was performed using the rat anti-MBP (1:200, Chemicon, Millipore) primary antibody in Goat Serum Dilution Buffer (GSDB; 450 mM NaCl, 20 mM sodium phosphate buffer, pH 7.4, 15% goat serum, 0.3% Triton X-100). Cells were then incubated for 1 h at RT with the secondary goat anti-rat antibody conjugated to Alexa Fluor 555 (1:600 in GSDB; Molecular Probes, Invitrogen). Nuclei were labeled Hoechst-33258 (1:10,000, Molecular Probes, Invitrogen, Milan). Coverslips were finally mounted with a fluorescent mounting medium (Dako, Milan), and analyzed as previously described [5].

3.2. Desensitization experiments in primary OPCs The kinetics and the extent of agonist-induced GPR17 desensitization were investigated in pre-oligodendrocytes and in immatureoligodendrocytes, by the use of a cAMP assay. In pre-oligodendrocytes (stage 3 in Fig. 1A), GPR17 exhibited specific responses to both UDPglucose and LTD4, with EC50 values of 424.7 nM and 1.29 nM, respectively [5]. In immature oligodendrocytes (stage 4, Fig. 1E and F), a lower efficacy of UDP-glucose and LTD4 in promoting cAMP inhibition was observed, according to lower GPR17 expression at this stage of cell maturation compared to pre-oligodendrocytes. In desensitization experiments, cells were treated for different times (5–120 min) with 50 nM LTD4 or 5 μM UDP-glucose (almost 10 times over their EC50 values). Cells were then washed, and cAMP assay performed as described above. Fig. 1C and D shows that, in preoligodendrocytes, both UDP-glucose and LTD4 decreased GPR17 responses after an initial challenge with a high concentration of either agonists. These effects occurred in a time-dependent manner, resulting in almost complete inhibition (N 85%) of GPR17 activation after 120 min of pre-incubation with either agonists. Conversely, in immatureoligodendrocytes (Fig. 1E and F), GPR17 desensitization became significant only after 120 min of cell pre-treatment with agonists. The slower desensitization kinetics in immature-oligodendrocytes may be most likely ascribed to the low expression of GRKs at this more advanced differentiation stage. 3.3. GPR17–GRK association

2.13. Statistical analysis A non-linear multipurpose curve-fitting program, Graph-Pad Prism (Version 5.00), was used for data analysis and graphic presentation. Data are reported as the mean ± SEM of 3–9 different experiments (performed in duplicate). Statistical analyses of binding data were performed using a one-way ANOVA study followed by the Bonferroni test for repeated measurements. Differences were considered statistically significant when P b 0.05. The densitometric analysis of immunoreactive bands was performed using the ImageJ program.

3. Results 3.1. GRK and β-arrestin expression during OPC differentiation As a first step, we analyzed mRNA expression of GRK 2/5 and βarrestin1/2, compared with that of GPR17 and the major myelin basic protein (MBP), during spontaneous in vitro OPC differentiation (Fig. 1A and B). According to our previous data [5], GPR17 expression was maximal in pre-oligodendrocytes and completely segregated from that of mature myelin. GRK2/5 mRNAs were already expressed at low levels at early differentiation stages, and they reached a maximal peak in pre-oligodendrocytes, when MBP levels started to increase. Parallel to GPR17, GRK levels progressively declined, reaching their lowest levels in the terminal phases of differentiation (Fig. 1B). While βarrestin1 levels did not shown substantial changes during the maturation process, levels of β-arrestin2 paralleled those of GPR17 and GRK2/5.

The molecular mechanisms underlying GPR17 desensitization were then deeply investigated in a transfected cell model in parallel with primary OPCs. 1321N1 astrocytoma cells were transfected with a plasmid containing the coding sequence of GPR17 in frame to a HA Tag allowing direct immuno-labeling of the receptor with an anti-HA antibody. Transfection resulted in high expression of HA-tagged GPR17 at both mRNA and protein levels (Supplemental Fig. 1A and B). Importantly, by pharmacological analysis, we also demonstrated that HA-tagged GPR17expressing cells display a pharmacological response profile fully comparable to that observed upon expression of untagged hGPR17 in the same cells [23] (Supplemental Fig. 2). In pcDNA 3.1-transfected cells, no functional responses to either UDP-glucose or LTD4 were observed (Supplemental Fig. 2A). By RT-PCR, 1321N1 cells were demonstrated to express P2Y14 receptor at low levels and not to express cysLTRs [23], confirming that, in 1321N1 cells, 1) P2Y14 receptor, although expressed at low levels, is not involved in the functional response to sugar nucleotides [29] and that, 2) LTD4-evoked responses cannot be ascribed to the activation of any cys-LT receptor subtypes in these cells. Thus, we employed HA Tag-GPR17 transfected cells to assess GRK recruitment and association upon GPR17 stimulation. Exposure of transfected cells to high concentrations of both agonists, UDP-glucose or LTD4, induced a significant translocation of cytosolic GRK2 and GRK5 to the plasma membrane (Fig. 2A and B), but with different outcomes for the two classes of ligands. LTD4 induced a significantly higher translocation of GRK2 compared to GRK5, while UDP-glucose was more potent in inducing GRK5 translocation with respect to LTD4. We also showed, by co-immunoprecipitation studies, that GRK physically associates with GPR17. In transfected cell lysates and GPR17

Fig. 4. GRK specificity in agonist-mediated GPR17 desensitization. (A–D) 1321N1 HA Tag-GPR17 cells were transfected with the indicated siRNA, and treated with 100 μM UDP-glucose (A, C) or 100 nM LTD4 (B, D) for different times (5–120 min). Then cells were extensively washed with medium alone, to remove agonists, and subsequently treated for 15 min with 1 μM FK, in the absence or in the presence of 10 μM UDP-glucose or 10 nM LTD4. (E–H) OPCs, isolated and differentiated at pre-oligodendrocytes (stage 3), were treated with 5 μM UDP-glucose (E, G) or 50 nM LTD4 (F, H) for different times (5–120 min), in the absence (white bars) or in the presence (black bars) of the selective GRK2 inhibitor (1 μM peptide 7) or GRK5 inhibitor (100 nM calmodulin). After extensive washing, cells were treated for 15 min with 10 μM FK, in the absence or in the presence of 500 nM UDP-glucose or 5 nM LTD4. Intracellular cAMP levels were evaluated as reported in the Materials and methods section. Data are expressed as the percentage of FK-stimulated cAMP levels, set to 100%, and represent the means ± SEM of independent experiments (N = 6). Statistical significance was determined with a one-way ANOVA with Bonferroni post-test: *P b 0.05, **P b 0.01, ***P b 0.001 vs UDP-glucose or LTD4 stimuli.

S. Daniele et al. / Cellular Signalling 26 (2014) 1310–1325

1317

1318

S. Daniele et al. / Cellular Signalling 26 (2014) 1310–1325

immunoprecipitates, anti-HA Tag antibody recognized a single band of approximately 60 kDa (Supplemental Fig. 1B and C). The specificity of the immunoprecipitation assay was confirmed by the absence of a specific immunoreactive band in wild-type cells (Supplemental Fig. 1C). Under basal conditions, GPR17 weakly associated with GRK2 or GRK5 and this association was significantly enhanced after 5 min receptor stimulation with UDP-glucose or LTD4 (Fig. 2C and D). According to the data obtained in the GRK translocation assay, LTD4 preferentially induced the association between GPR17 and the GRK2 isoform with respect to GRK5. Vice versa, UDP-glucose mainly favored the association between the receptor and GRK5, compared to GRK2. A similar pattern of GPR17–GRK association was observed in pre-oligodendrocytes (Fig. 2E and F). Globally, these data suggest that the two classes of GPR17 ligands preferentially recruit different GRK isoforms. 3.4. GPR17 phosphorylation To compare purinergic and cysLT ligands for bulk receptor phosphorylation, we analyzed the levels of GPR17 phosphorylation on serine and threonine residues after different times of cell stimulation with a high concentration of purinergic or cysLT agonist. In transfected cells (Fig. 3A and B), UDP-glucose and LTD4 similarly induced GPR17 phosphorylation on threonine and, to a lesser extent, on serine residues. Similar results were obtained in primary cells (Fig. 3E and F). Next, we examined the role of individual GRKs in GPR17 phosphorylation induced by distinct receptor agonists. 1321N1 HA Tag-GPR17 cells were transfected with either random siRNA or siRNAs specifically designed to silence either GRK2 or GRK5. The efficiency of siRNA transfection in reducing GRK2 or GRK5 gene and protein expression was demonstrated by RT-PCR and Western blot analysis, respectively (Supplemental Fig. 3A and B). Agonist-mediated GPR17 phosphorylation following silencing of either GRK2 or GRK5 was then evaluated (Fig. 3C and D). After selective GRK2-knockdown, HA Tag-GPR17 phosphorylation on threonine residues induced by LTD4 was markedly reduced and almost back to basal values. On the contrary, GRK2 silencing did not induce any significant decrease in UDP-glucose-mediated phosphorylation at the same amino acid residues. GRK5 siRNA led to a significant reduction of both UDP-glucoseand LTD4-mediated phosphorylation. Densitometric analysis of immunoreactive bands revealed that, after GRK5-knockdown, GPR17 phosphorylation by UDP-glucose was completely abrogated at threonine residues. On the contrary, receptor phosphorylation induced by LTD4, was only partially reduced, and receptor phosphorylation levels remained still significantly higher with respect to basal value. These data demonstrate that LTD4-induced GPR17 phosphorylation is preferentially mediated by GRK2 and only partially by GRK5, whereas UDP-glucose-mediated receptor phosphorylation exclusively requires the GRK5 isoform. 3.5. GRK specificity in GPR17 desensitization We examined the involvement of GRK2 and GRK5 in agonistinduced desensitization of GPR17. To this purpose, transfected cells were silenced for GRK2 or GRK5, and were then treated with UDPglucose or LTD4 for different times (5–120 min). After extensive washings to remove agonists, the functional responsiveness of the receptor to both agonists was evaluated by cAMP assay. In transfected cells, after an initial challenge with a maximal concentration of either UDP-glucose (Fig. 4A and C, white bars) or LTD4 (Fig. 4B and D, white bars), GPR17 functional responses to both agonists were decreased, confirming induction of homologous desensitization by both purinergic and cysLT ligands [23]. After selective GRK2 knock-down, UDP-glucose was still able to induce GPR17 desensitization, with kinetics similar to those observed in control non-silenced cells, suggesting that GRK2 is not needed for desensitization of purinergic responses (Fig. 4A, black bars). On the contrary, in GRK2-silenced cells, the response of GPR17 to the cysLT agonist was fully preserved even after an initial challenge with LTD4, thus

confirming that GRK2 indeed mediates LTD4-induced desensitization (Fig. 4B, black bars). Next, we examined the effect of GRK5 silencing on purinergic and cysLT-induced desensitization. UDP-glucose-mediated GPR17 desensitization was completely abolished in GRK5 silenced cells (Fig. 4C, black bars), demonstrating a requirement for GRK5 in the desensitization of the GPR17 purinergic response. On the contrary, in GRK5silenced cells, LTD4 was still able to induce receptor desensitization, even if to a minor extent compared to cells expressing GRK5 (Fig. 4D, black bars). These results suggest a partial involvement of GRK5 in LTD4-mediated desensitization of GPR17. In primary cells, the specific involvement of GRK2 and GRK5 in controlling GPR17 desensitization was evaluated by using selective inhibitors, peptide 7 [24] and calmodulin [25], respectively. Pretreatment of OPCs with the GRK2 inhibitor, peptide 7, selectively impaired LTD4-mediated desensitization (Fig. 4F, black bars), whereas it did not affect desensitization promoted by UDP-glucose (Fig. 4E, black bars). The selective inhibition of GRK5 completely blocked UDPglucose-mediated desensitization (Fig. 4G, black bars), whereas receptor desensitization induced by LTD4 was yet detectable, even if to a lesser extent (Fig. 4H, black bars). These data parallel those obtained in transfected cells and confirm that GRK5 is only partially involved in desensitization of cysLT responses. 3.6. β-Arrestin recruitment and association with GPR17 GRK-phosphorylated GPCRs generally bind to β-arrestins, which desensitize receptor-mediated G protein signaling via several mechanisms, including direct steric hindrance of the receptor by β-arrestin attachment, recruitment of second messenger-degrading enzymes, and by acting as a scaffold for proteins facilitating receptor internalization [30]. To investigate the role of β-arrestin1/2 in GPR17 signaling, we verified its recruitment from cytosol to plasma membrane and the role of each GRK isoform in this translocation. Results showed that, in siRNA random transfected cells, both UDP-glucose and LTD4 induced a significant translocation of β-arrestin1/2 from the cytosol to the plasma membrane after 5 min of stimulation (Fig. 5A and B). GRK2 silencing completely abrogated LTD4-, but not UDP-glucose-mediated translocation of β-arrestin. On the contrary, GRK5 silencing completely impaired UDP-glucose-mediated translocation of β-arrestin1/2 with only a marginal effect on LTD4 (Fig. 5A and B). These data demonstrate that β-arrestin translocation is mediated by GRK2 isoform upon LTD4 stimulation, whereas UDP-glucose-mediated β-arrestin recruitment exclusively requires the GRK5 isoform. Receptor-β-arrestin1 or 2 association was then evaluated. Cells were stimulated for 5 or 30 min with UDP-glucose or LTD4, and Western blot analysis for HA Tag-GPR17 was performed on samples of immunoprecipitated β-arrestin1 or 2. Under basal conditions, GPR17 weakly, but appreciably, associated with β-arrestin1 and β-arrestin2 (Fig. 5C). After 5 min of receptor stimulation, both UDP-glucose and LTD4 induced a significant association of the receptor to both βarrestin isoforms (Fig. 5C and D). Immunocomplexes were still detectable after 30 min of incubation with UDP-glucose, suggesting the formation of stable GPR17–arrestin complexes; on the contrary, upon stimulation with LTD4, complexes formed by GPR17 with arrestins were transient and dissociated within 30 min. The difference in stability of receptor–arrestin complexes following exposure to different GPR17 ligands was also confirmed by immunofluorescence studies (Supplemental Fig. 4). Cell visualization by confocal microscopy showed that, in the absence of agonists, a basal association between the receptor and arrestin occurred, suggesting a constitutive receptor association to β-arrestin in resting conditions (Supplemental Fig. 4A). Five minutes of treatment with both types of agonists led to the plasma membrane redistribution of β-arrestin and its coalescence with GPR17 (Supplemental Fig. 4B and C, middle and right panels), confirming coimmunoprecipitation experiments. After exposure to UDP-glucose for

S. Daniele et al. / Cellular Signalling 26 (2014) 1310–1325

A

B Cytosol

β-actin 43 KDa

siRNA random siRNA GRK5 siRNA GRK2

75 KDa

Membrane β-arrestin1/2 55 KDa

50 KDa

siRNA random siRNA GRK5

*** ***

200

siRNA GRK2

**

**

150

Cytosol

120 100 80 60 40 20

***

***

***

75 KDa

β-arrestin1 55 KDa

β-arrestin1

β-arrestin2

4 **

3

**

**

**

30

5

** *

2 1

5

30

5

30

5

30 min

Ba

sa

50 KDa

UDP-glucose LTD4

5

l

C

β-arrestin -GPR17 association (fold over basal value)

D β-actin 43 KDa

***

4

β-arrestin1/2 55 KDa

50 KDa

Membrane

UD P- Bas gl al uc os LT e D UD P- Bas 4 gl al uc os LT e D UD 4 P- Bas gl al uc os LT e D UD 4 P- Bas gl al uc os LT e D UD 4 P- Bas gl al uc os LT e D UD 4 P- Bas gl al uc os LT e D

75 KDa

250

OD (% vs basal)

siRNA random siRNA GRK5 siRNA GRK2

1319

75 KDa

HA Tag-GPR17

50 KDa 5

30

5

30 min

I.P. β-arrestin1 75 KDa

β-arrestin2 56 KDa

50 KDa 75 KDa

HA Tag-GPR17 50 KDa 5

30

5

30 min

I.P. β-arrestin2 Fig. 5. Effects of GPR17 agonists on β-arrestin1/2 membrane translocation and receptor association. (A, B) 1321N1 HA Tag-GPR17 cells were treated with medium alone (basal) or with 100 μM UDP-glucose or 100 nM LTD4 for 5 min. β-Arrestin1/2 levels were quantified in both cytosol and plasma membrane fractions by immunoblotting analysis. (C, D) Cells, were treated with medium alone or with 100 μM UDP-glucose or 100 nM LTD4 for 5 or 30 min. Following incubation, β-arrestin1 or β-arrestin2 was immunoprecipitated and immunoprecipitates were probed with anti-HA Tag antibody. A, C, representative immunoblots. B, D, signals were quantified by densitometry and expressed as fold of increase versus basal value. Data are the means ± SEM of independent experiments (N = 3). Statistical significance was determined with a one-way ANOVA with Bonferroni post-test: *P b 0.05, **P b 0.01, ***P b 0.001 vs basal value; ##P b 0.01 vs siRNA random transfected cells.

30 min, β-arrestin1 redistribution in the cytoplasm fully overlapped with the internalized receptor (middle panels, green; right panels, yellow), suggesting the formation of stable receptor/β-arrestin complexes

that remain associated throughout receptor endocytosis and sorting. After 30 min of LTD4 treatment (Supplemental Fig. 4C), colocalization between internalized receptor and β-arrestin1 appeared to be

1320

S. Daniele et al. / Cellular Signalling 26 (2014) 1310–1325

qualitatively weaker compared to UDP-glucose-treated cells, suggesting that GPR17–β-arrestin1 complexes mostly dissociate at or near the plasma membrane following receptor internalization.

up to 60 min. On the contrary, UDP-glucose induced only a marginal stimulation of CREB, with a fast kinetics that returned to basal values within 15 min. Similar results were also obtained in preoligodendrocytes (Fig. 7C, right panel).

3.7. GPR17 agonist-mediated ERK1/2 and CREB activation 3.8. Role of GRKs in GPR17 agonist-mediated OPC differentiation To verify if different modalities of GPR17 interaction with β-arrestins could result in the activation of different intracellular pathways, we evaluated the effects of GPR17 agonists on the ERK1/2 signaling system, which plays a central role in membrane-to-nucleus communication [31]. In transfected cells, as well as in pre-oligodendrocytes, LTD4 induced a rapid and transient increase in ERK1/2 phosphorylation, which peaked at 1 min and rapidly returned to basal levels after 15 min (Fig. 6A). In contrast, UDP-glucose stimulation of ERK1/2 occurred with a slower kinetics. In transfected cells, ERK activation peaked at 30 min and returned to basal value after 60 min (Fig. 6A, left panel). In pre-oligodendrocytes, activation kinetics appeared to be slower with a maximum after 60 min (Fig. 6A, right panel). The different kinetics of ERK1/2 activation (rapid and transient for LTD4, slow and sustained for UDP-glucose) confirmed our previous data in PC12 rat pheochromocytoma cells [26]. To determine the contribution of the Gi-dependent pathway to ERK1/2 activation by GPR17 agonists, cells were pretreated with the Gαi inhibitor PTX (200 ng/ml) for 18 h prior to stimulation with receptor agonists. PTX did not induce any significant effects on UDP-glucosemediated ERK1/2 phosphorylation at all tested times (Fig. 6B). On the contrary, inhibition of Gi completely abrogated ERK1/2 activation induced by LTD4 (Fig. 6C). At least for some GPCRs, arrestin proteins have well documented roles as agonist-regulated adaptor scaffolds for the cell surface receptor to ERK1/2 signaling [32]. To determine whether β-arrestins contributed to GPR17 ligand-mediated ERK activation, we used RNA interference to reduce the expression of endogenous β-arrestin1 and/or β-arrestin2 in 1321N1 cells. Targeting of β-arrestin1 or β-arrestin2 by specific siRNAs effectively silenced the expression of these proteins, as demonstrated by RT-PCR and Western blot analysis (Supplemental Fig. 3C and D). Depletion of β-arrestin1 and 2 attenuated phospho-ERK1/2 (pERK1/2) levels induced by UDP-glucose, and virtually abolished any sustained signal (Fig. 6D). Vice versa, siRNA-mediated depletion of β-arrestins did not alter LTD4-mediated ERK1/2 activation (Fig. 6E). These data demonstrate that purinergic and cysLT ligands activate ERK1/2 by a G proteinindependent and G protein-dependent mechanism, respectively. To confirm the different pathway of ERK1/2 activation elicited by the two classes of GPR17 ligands, experiments were repeated in GRK2- or GRK5-silenced cells. Overall, depletion of GRK2 or GRK5 did not reduce the early phase of LTD4-induced ERK activation but paradoxically prolonged ERK phosphorylation with respect to siRNA random cells (Fig. 6G), as previously demonstrated for other receptors [33], confirming that the cysLT ligand activates ERK1/2 by a GRK/β-arrestin independent mechanism. On the contrary, when cells were probed with UDP-glucose, only GRK5 silencing caused a significant reduction in ERK1/2 phosphorylation with respect to siRNA random cells (Fig. 6F). These data confirm that ERK1/2 activation induced by the purinergic agonist requires the GRK5–β-arrestin machinery. We then demonstrated that the two classes of GPR17 agonists induced a different cellular localization of activated ERKs. Cell treatment with LTD4 caused a rapid nuclear localization of activated pERKs, while when cells were treated with UDP-glucose, most pERKs remained in the cytoplasm, and only a small amount translocated to the nucleus (Fig. 7A and B). Finally, since the different subcellular distribution of activated-ERKs in response to GPR17 agonists may impact on the activation of nuclear CREB, we measured CREB phosphorylation after LTD4 or UDP-glucose exposure. In transfected cells, LTD4 induced a more marked activation of CREB phosphorylation with respect to UDP-glucose (Fig. 7C, left panel). This effect peaked after 5 min of cell treatment and persisted

To dissect the actual involvement of GRK in OPC maturation, we assessed the effects of GRK-down-regulation in cell maturation. The silencing efficiency of GRK2 in OPC was evaluated by Western blotting (Supplemental Fig. 5). As depicted in Fig. 8A and B, GRK2 silencing resulted in up-regulation of GPR17 and down-regulation of the mature markers CNPase and MBP, indicating a shift of cells toward a less differentiated stage. Having established that, in primary cultured OPCs, LTD4 mediated desensitization of GPR17 through the primary recruitment of GRK2, we then asked whether GRK2 pharmacological inhibition had any effects on cysLT-promoted cell maturation. OPC exposure to LTD4 resulted in appearance of a myelinating phenotype in culture and an increase of the MBP + oligodendrocytes, demonstrating acceleration of cell maturation [5]. In the presence of the specific GRK2 inhibitor (1 μM), LTD4-mediated differentiation was significantly inhibited (Fig. 8C and D), demonstrating that GRK2-mediated desensitization of GPR17 is indeed necessary to enable OPCs to complete their differentiation program. In neither case were these effects due to changes in the total number of cells in culture because no changes in cell labeling with Hoechst 33258 were detected. 4. Discussion OPCs natively express GPR17 at high levels. In these precursor cells, GPR17 acts as a key actor in dictating cell differentiation to mature oligodendrocytes, that, in turn, play a primary role in both physiological myelination and repair of myelin dysfunction at demyelinating sites [5,6], where GPR17 has been found to be up-regulated [4]. Based on previously published data demonstrating that the prolonged-forced expression of the receptor in pre-oligodendrocytes blocks cells at an immature stage, we suggested that, at a specific timing during OPC differentiation, GPR17 has to be switched off and downregulated to allow final cell maturation [4,5]. Altered expression and/or functioning of GPCR regulatory proteins (GRKs and β-arrestins) has been suggested to be involved in the etiopathogenesis of inflammatory/demyelinating diseases [16–21]. In this scenario, shedding light on the desensitization machinery regulating GPR17 responses during the OPC differentiation process becomes highly attractive, and may unveil new targets to foster myelination at demyelinated sites, characterized by an impairment of re-myelination mechanisms. Here we show that, in OPCs, as well as in transfected cells, GPR17 underwent desensitization upon a challenge with purinergic and cysLT agonists and this process involved specific GRKs in dependence on the classes of ligand-activating receptor. GRK2 is the primary kinase involved in LTD4-evoked receptor desensitization while GRK5 mediated the functional loss of receptor responsiveness promoted by UDPglucose. These data suggest that two distinct intracellular machineries are activated by the two types of ligands in cells that natively express GPR17. Interestingly, in OPCs, GRK2 expression paralleled that of GPR17 and it has been demonstrated that GRK2-mediated GPR17 desensitization is necessary to allow cells to complete their differentiation program evoked by the treatment of early OPCs with cysLT ligands. The changes in GRK2 expression levels during OPC differentiation, and the consequent ability of these proteins to efficiently regulate receptor responses, may account for the results reported by Hennen et al. [34], demonstrating that the new GPR17 agonist (MDL29,951) impaired OPC differentiation, in pre-immature OPC. In fact, at this differentiation stage, the

S. Daniele et al. / Cellular Signalling 26 (2014) 1310–1325

1321

160 150

1321N1 cells ***

140

UDP-glucose LTD4

***

***

wild-type UDP-glucose wild-type LTD 4

***

***

130

ERK 1/2 phosphorylation (% vs basal)

ERK 1/2 phosphorylation (% vs basal)

A

120 110 100 90 135

15

30

45

*** *** 170 ***

190

***

***

150 130 110 90

60

135

15

30

Time (min)

150

***

*** *

140

*** ***

**

130

*

120 110 100 90

110 100 90

* ##

120 #

### # ###

100

###

### ###

80 3

5

15

30

min

***

140

130

*

*** *

*

*

*

*

100 80 3

1

100 1 3 5

15

Time (min)

30

5

15

30

min

100 nM LTD4

G

110

**

120

***

**

*** ***

***

ERK 1/2 phosphorylation (% vs basal)

UDP-glucose siRNA GRK2 UDP-glucose siRNA GRK5 UDP-glucose

140

120

30 min

15

***

***

160

100 µM UDP-glucose

150

5

***

Ba

sa

1

Ba

ERK 1/2 phosphorylation (% vs basal)

3

siRNA β-arrestin1/2

180

l

140

***

sa

***

ERK 1/2 phosphorylation (% vs basal)

siRNA β-arrestin1/2

160

l

ERK 1/2 phosphorylation (% vs basal)

1

control siRNA β-arrestin1 siRNA β-arrestin2

E

siRNA β-arrestin2

160

*

120

l

control siRNA β-arrestin1

D

F

#

*

130

30 min

15

#

140

Ba

sa

5

LTD4+PTX

150

Ba

3

60

LTD4

***

160

sa

1

###

C ERK 1/2 phosphorylation (% vs basal value)

160

45

Time (min)

UDP-glucose UDP-glucose+PTX

l

ERK 1/2 phosphorylation (% vs basal value)

B

UDP-glucose *** LTD4

Pre-oligodendrocytes

210

190 180 170 160 150 140 130 120 110 100 90

Control LTD 4 siRNA GRK2 LTD 4 siRNA GRK5 LTD 4

***

***

*** *** *** **

***

***

1 3 5

15

30

Time (min)

Fig. 6. Kinetics and mechanism of ERK activation induced by GPR17 agonists. (A) 1321N1 HA Tag-GPR17 cells and pre-oligodendrocytes were treated for different times (1–60 min) with UDP-glucose (100 μM and 5 μM) or LTD4 (100 nM and 50 nM). Following incubation, the levels of phosphorylated ERK1/2 were quantified using an ELISA kit (see Materials and methods section). (B, C) Cells were treated for 18 h with 200 ng/ml PTX and then stimulated as in (A). (D–G) Roles of β-arrestin and GRK isoform on ERK activation by GPR17 agonists. 1321N1 HA Tag-GPR17 cells were transfected with siRNA specific for β-arrestin1 and/or 2 (D, E) or siRNA specific for GRK2 or GRK5 (F, G), and treated for different times with 100 μM UDP-glucose (D, F) or 100 nM LTD4 (E, G). Then, the levels of phosphorylated ERK1/2 were quantified using an Elisa kit (see Materials and methods section). Data are expressed as percentage of basal value (set to 100%) and represent the mean ± SEM of independent experiments (N = 6). Statistical significance was determined with a one-way ANOVA with Bonferroni post-test: *P b 0.05, ** P b 0.01, *** P b 0.001 vs basal; #P b 0.05, ##P b 0.01, ###P b 0.001 vs cells not treated with PTX or vs siRNA random.

1322

S. Daniele et al. / Cellular Signalling 26 (2014) 1310–1325

Cytosol

A 50 KDa

β-actin min LTD4

UDP-glucose

Nuclei

B

225

p-ERK in Nuclei (% vs basal)

p-ERK 37 KDa

***

UDP-glucose LTD4

***

200

**

175 150

*

125 100

50 KDa

p-ERK

2.5

37 KDa 20 KDa

30

60

min

H3

10KDa

min UDP-glucose

LTD4

C 175 1321N1 cells

UDP-glucose*** LTD4

***

***

150 ***

125

*** ** **

100 0 2.5 5

15

30

45

Time (min)

60

175 Pre-oligodendrocytes

CREB phosphorylation (% vs basal value)

CREB phosphorylation (% vs basal value)

5

150

***

UDP-glucose LTD4

***

*** *** ***

125

100 0 2.5 5

15

30

45

60

Time (min)

Fig. 7. Effects of GPR17 agonists on activated-ERK cellular location and on CREB activation. (A, B) 100 μM UDP-glucose or 100 nM LTD4 was added to GPR17-transfected cells for different times (2.5–60 min), and the cytoplasm and nucleus fractions were separated as described in the Materials and methods section. Immunoblotting was used to monitor the phosphorylated ERK1/2. (A) Representative immunoblots, (B) signals of p-ERK in nuclei were quantified by densitometry. (C) Phosphorylated CREB levels obtained in 1321N1 cells and pre-oligodendrocytes, in response to UDP-glucose (100 μM or 5 μM) or LTD4 (100 nM or 50 nM), were quantified using an Elisa kit. Data are expressed as percentage of basal value (set to 100%) and represent the mean ± SEM of independent experiments (N = 6). Statistical significance was determined with a one-way ANOVA with Bonferroni post-test: *P b 0.05, **P b 0.01, ***P b 0.001 vs basal value.

cellular machinery responsible for GPR17 desensitization is already fully operative and this may cause a precocious and complete loss of receptor functioning leading to inhibition of OPC maturation and myelination. In order to evaluate if the recruitment of different kinases in mediating GPR17 desensitization invariably activates the same pattern of signaling events or alternatively engenders different intracellular programs, GPR17 signaling pathways activated in response to the two classes of agonists, were investigated. Receptor activation by UDP-glucose and LTD4 promoted receptor association with the signal terminal proteins, β-arrestins: this association was stable up to 30 min following UDP-glucose treatment and surprisingly transient following stimulation with LTD4. These differences in the stability of receptor–arrestin interaction could certainly account for the different kinetics in GPR17 internalization [8] and recycling observed following receptor activation by the two agonists [23], but could also profoundly affect the subsequent intracellular events. It is indeed known that β-arrestins play a dual role in GPCR signaling: they serve both to terminate G protein-dependent signals and to confer novel intracellular properties to the receptor, by acting as adaptors or scaffolds for other signaling proteins, such as ERKs [33]. The stability of the receptor/β-arrestin complex represents a significant factor in determining both the mechanism of ERK activation by a GPCR and

the functional consequences of ERK activation within the cell. Specifically, a higher stability of the receptor–arrestin complex may favor the βarrestin pathway of ERK activation, whereas a transient arrestin–receptor interaction can selectively prompt G protein-dependent signals. ERK activated by G proteins generally accumulates in the nucleus, where it phosphorylates and activates various transcription factors. In contrast, ERK activated by arrestin is largely excluded from the nucleus and is confined to the cytoplasmic compartment where it presumably phosphorylates a distinct set of effectors [35]. Based on this evidence, the role of the GRK–β-arrestin machinery in the activation of ERKs upon challenge with different GPR17 agonists was investigated. According to previous data in PC12 cells [26], in both GPR17 transfected cells and primary OPCs, UDP-glucose and LTD4 stimulated ERK phosphorylation with different kinetics. LTD4-mediated ERK activation was fast and transient and primarily involved a G proteindependent mechanism; vice versa, UDP-glucose induced slower and prolonged ERK activation by a G protein-independent and β-arrestindependent mechanism. Our observation provides a clear demonstration of the agonist-selective signaling theory, which suggests that the efficacy of a given agonist on different signaling pathways can be different [36]. Using specific siRNAs for GRK2 or GRK5, we also demonstrated that UDP-glucose-mediated ERK1/2 activation mainly involves GRK5 rather than GRK2. These results are in line with the emerging notion

S. Daniele et al. / Cellular Signalling 26 (2014) 1310–1325

m

K2

iRN

s

A

A iRN

GR

s

B GPR17 48 KDa CNPase 45 KDa

MBP 18.5-17 KDa

200

siRNA random

**

siRNA GRK2

protein amount (% vs control)

do

an Ar

1323

150

100

*

*

50

α-tubulin 54 KDa Control

GRK2 inhibitor

MBP

MBP

LTD4

GRK2 inhibitor + LTD4

D

MBP/HOECHST (% vs control)

C

CNPase

GPR17

200

*

150

**

100

50

0

l

r

tro

ito

n Co

MBP

MBP

MBP

b hi

K2

in

D4

D4

LT

LT

to

bi

i nh

GR

r+

2i

K GR

Fig. 8. Role of GRK2 on oligodendrocyte maturation and LTD4-mediated differentiation. (A, B) OPCs were incubated with siRNA random or siRNA targeting GRK2. Expression levels of GPR17, CNPase and MBP were assessed by Western blot analysis. A, representative immunoblotting at 96 h after transfection is shown. B, histograms show the densitometric analysis of the indicated proteins, corrected for the corresponding α-tubulin band on the same Western blot and normalized to control condition, set to 100%, at 96 h after siRNA transfection. Data are the mean ± SEM of two samples/condition from three independent experiments. (C, D) OPCs, maintained in differentiating medium, containing T3, were treated with LTD4 (100 nM) in the absence (control) or in the presence of 1 μM of the specific GRK2 inhibitor, peptide 7. After 48 h, cells were fixed to determine their maturation degree by immunostaining with anti-MBP antibody. Hoechst 33258 was used to label cell nuclei. The number of positive cells was counted in 50 optical fields under a 40× magnification (~2500 cells/coverslip in the control condition). D, histograms show the quantification of the percentage of cells expressing the mature marker MBP in control and treated cells (with vehicle-treated control cells set to 100%). Data are the mean ± SEM of cell counts of 8 coverslips/condition from two independent experiments. *P b 0.05; **P b 0.01 vs control; ##P b 0.01 vs LTD4 alone (non-parametric Mann–Whitney test).

that GRK5 (or GRK-6) is required for β-arrestin-dependent ERK activation by different GPCRs like AT1AR [37], V2R [38] and β2AR [39]. Furthermore, we demonstrated that LTD4 induces a rapid and sustained ERK translocation to the nucleus, whereas UDP-glucose determines only a weak nuclear localization of ERK that was significant only after 30 min. These data suggest that the different mechanisms of ERK activation driven by purinergic and cysLT agonists (which are, respectively, β-arrestin- or G protein-dependent) have important consequences on ERK cellular localization and on the activation of specific ERK-dependent transcription factors, like CREB. Likely, LTD4 induced a marked and sustained activation of nuclear CREB, whereas UDPglucose induces only a marginal stimulation of CREB, which rapidly returns to basal value within 15 min. By comparing the kinetics of ERK and CREB activation we speculate that: i) LTD4-mediated CREB activation is likely a direct consequence of ERK phosphorylation and nuclear translocation; ii) UDP-glucose-mediated CREB activation instead occurs

with a faster kinetics compared to ERK phosphorylation, thus suggesting the involvement of a different mechanism. Recent work has indeed revealed that, in response to the activation of certain GPCRs, β-arrestins can translocate from the cytoplasm to the nucleus and associate with transcription co-factors, such as P300 and CREB, mediating their activation [13]. Our results demonstrate that, after binding to GPR17, purinergic and cysLT agonists likely favor different receptor conformations that activate different intracellular signaling pathways with important consequences on nuclear events (see Fig. 9). Our data are in accordance with Hennen et al. [34] who confirmed a temporally controlled expression of GPR17 in differentiated oligodendrocytes and demonstrated that, in a transfected cell model, GPR17 activated the recruitment of beta arrestin through a dual mechanism, i.e., dependently or independently of G protein activity. They also suggested that, in recombinant systems, arrestin recruitment may mainly

1324

S. Daniele et al. / Cellular Signalling 26 (2014) 1310–1325

UDP-glucose

LTD4

GPR17 P

P

P GRK5

Desensitization

P GRK2

Desensitization P

Stable association

P GRK5 β -Arr

β -Arrestin-dependent ERK 1/2 activation

Signalling

Transient association

Signalling

G protein-dependent ERK 1/2 activation

P

P β-Arr ERK

P GRK2 P β -Arr

P

Transient association

P GRK2 β -Arr

αi

β γ

Cytosolic substrates? ERK

CREB activation

CREB activation

Fig. 9. A cartoon illustrating intracellular signaling pathways activated by different GPR17 agonists, LTD4 and UDP-glucose. LTD4, through recruitment of GRK2 and via a G-protein dependent mechanism, induces transient binding of GPR17 to β-arrestins, rapid induction of ERK phosphorylation and nuclear translocation, and sustained CREB activation; conversely, UDPglucose, through GRK5 as a primary kinase and by a completely G protein-independent/β-arrestin-dependent mechanism, induces a stable association of GPR17 to β-arrestins, stimulation of ERK and cytosolic ERK retention. Thus, by acting on GPR17, cysLTs activate signaling pathways culminating in transcriptional effects, while purinergic ligands mainly influence cytosolic events.

serve to desensitize the receptor and regulate its functional responsiveness, a hypothesis that has been fully proved for the native receptor in the present paper. It is important to say that even if β-arrestin recruitment, receptor desensitization and signaling occur in the order of minutes/hours, nuclear ERKs and arrestins influence much longer time frame events, by directly or indirectly regulating transcription mechanisms, with important role in final cell fates (proliferation, apoptosis and differentiation). In this respect, ERK1/2 and CREB signaling has been suggested to crucially and time-dependently regulate OPC differentiation and myelin gene expression [40]. Further studies are necessary to clarify if the different pathways and kinetics of ERK and CREB activation, elicited by the two classes of GPR17 ligands, could have functional consequences on the extent and time-course of myelination. Although both purinergic and cysLT ligands promote differentiation and myelination [3,5], we believe that their specific time-course and concentrations under physiological or demyelinating/inflammatory conditions, where these mediators massively accumulate, may address distinct intracellular pathways, participating to the same final biological response. In addition, low levels of GRKs, that have been described in demyelinating conditions [18,19,21], could contribute to maintain an elevated expression of GPR17, as it has indeed been found in demyelinated sites [4]. Here we demonstrated that low levels of GRK2/5 caused a slow and not complete desensitization/downregulation of the receptor: if this event occurs in demyelinating conditions, even elevated concentrations of cysLTs or nucleotides may not be sufficient to allow GPR17 switch-off and thus a correct re-

myelination. Further studies are in progress to verify this hypothesis in damaged oligodendrocytes. 5. Conclusions • Purinergic and cysLT ligands desensitized GPR17 responses both in transfected cells and in primary OPCs. • In response to cysLT ligands, GRK2 was the main kinase involved in GPR17 desensitization: it promoted GPR17–β-arrestin transient binding, a G protein-dependent and rapid ERK phosphorylation and sustained CREB activation. • During the OPC differentiation process, GRK2 expression paralleled that of the receptor. In addition this kinase is required for cysLTmediated OPC differentiation. • Purinergic ligand signaling through GRK5 isoform and through a βarrestin-dependent mechanism, induced a stable GPR17–β-arrestin association and β-arrestin-dependent ERK stimulation with a slower kinetics. • Depending on the type of ligand, multiple G-protein dependent or -independent desensitization and intracellular signaling pathways are recruited, with differential involvement of cytoplasmic ERKs and nuclear CREB. • The two classes of chemically- and metabolically-unrelated ligands, through the activation of the same receptor, engender alternative intracellular signaling pathways converging in the same final biological response.

S. Daniele et al. / Cellular Signalling 26 (2014) 1310–1325

Contributors SD carried out almost all the experiments, elaborated results and also contributed in the writing of the manuscript; MLT designed most of the study protocols also playing a fundamental role as supervisor of the experiments. She elaborated results and wrote the article; MF and EB performed differentiation studies on OPCs; EZ and DL performed transfection experiments and cell culture; PC provided GRK inhibitor; MPA gave important help in writing article discussion section; CM gave a fundamental contribution in the significance of the results, and important help in writing article discussion section. All authors contributed to and have approved the final manuscript. Conflict of interest None. Role of funding source Authors are deeply grateful to the Italian Multiple Sclerosis Foundation (FISM) for financial support (Project N. 2013/R1 to MPA). Acknowledgments We thank Mr. Antonio Daniele and Mr. Alessandro Lapi for technical support. We thank Dr Claudia Gargini and Dr Ilaria Tonazzini for ICC analysis. Appendix A. Supplementary data Supplementary data to this article can be found online at http://dx. doi.org/10.1016/j.cellsig.2014.02.016. References [1] H. Takebayashi, Y. Nabeshima, S. Yoshida, O. Chisaka, K. Ikenaka, Y. Nabeshima, Curr. Biol. 12 (2002) 1157–1163. [2] Q. Zhou, D.J. Anderson, Cell 109 (2002) 61–73. [3] D. Lecca, M.L. Trincavelli, P. Gelosa, L. Sironi, M. Fumagalli, C. Verderio, C. Grumelli, U. Guerrini, E. Tremoli, P. Rosa, S. Cuboni, C. Martini, A. Buffo, M. Cimino, M.P. Abbracchio, PLoS One 3 (2008) 3579–3593. [4] Y. Chen, H. Wu, S. Wang, H. Koito, J. Li, F. Ye, J. Hoang, S.S. Escobar, A. Gow, H.A. Arnett, B.D. Trapp, N.J. Karandikar, J. Hsieh, Q.R. Lu, Nat. Neurosci. 12 (2009) 1398–1406. [5] M. Fumagalli, S. Daniele, D. Lecca, P.R. Lee, C. Parravicini, R.D. Fields, P. Rosa, F. Antonucci, C. Verderio, M.L. Trincavelli, P. Bramanti, C. Martini, M.P. Abbracchio, J. Biol. Chem. 286 (2011) 10593–10604. [6] E. Boda, F. Viganò, P. Rosa, M. Fumagalli, V. Labat-Gest, F. Tempia, M.P. Abbracchio, L. Dimou, A. Buffo, Glia 59 (2011) 1958–1973. [7] S. Ceruti, F. Viganò, E. Boda, F. Ferrario, G. Magni, M. Bocazzi, P. Rosa, A. Buffo, M.P. Abbracchio, Glia 59 (2011) 363–378.

1325

[8] A. Fratangeli, E. Parmigiani, M. Fumagalli, D. Lecca, R. Benfante, M. Passafaro, A. Buffo, M.P. Abbracchio, P. Rosa, J. Biol. Chem. 288 (2013) 5241–5256. [9] H. Franke, C. Parravicini, D. Lecca, E.R. Zanier, C. Heine, K. Bremicker, M. Fumagalli, P. Rosa, L. Longhi, N. Stocchetti, M.G. De Simoni, M. Weber, M.P. Abbracchio, Purinergic Signal 9 (2013) 451–462. [10] J.D. Dougherty, E.L. Fomchenko, A.A. Akuffo, E. Schmidt, K.Y. Helmy, E. Bazzoli, C.W. Brennan, E.C. Holland, A. Milosevic, Cancer Res. 72 (2012) 4856–4868. [11] S.S. Ferguson, Pharmacol. Rev. 53 (2001) 1–24. [12] E.V. Gurevich, J.J. Tesmer, A. Mushegian, V.V. Gurevich, J. Pharmacol. Exp. Ther. 133 (2012) 40–69. [13] L. Mai, G. Pei, J. Cell Sci. 120 (2007) 213–218. [14] S.W. Ng, D. Bakowski, C. Nelson, R. Mehta, R. Almeyda, G. Bates, A.B. Parekh, Nature 482 (2012) 111–115. [15] M. Giorelli, P. Livrea, M. Trojano, J. Neuroimmunol. 155 (2004) 143–149. [16] A. Vroon, C.J. Heijnen, A. Kavelaars, J. Leukoc. Biol. 80 (2006) 1214–1221. [17] M.S. Lombardi, A. Kavelaars, M. Schedlowski, J.W. Bijlsma, K.L. Okihara, M. Van de Pol, S. Ochsmann, C. Pawlak, R.E. Schmidt, C.J. Heijnen, FASEB J. 13 (1999) 715–725. [18] M. Giorelli, P. Livrea, G. Defazio, L. Iacovelli, L. Capobianco, A. Picascia, M. Sellese, D. Martino, M.S. Aniello, M. Trojano, A. De Blasi, Cell. Signal. 14 (2002) 673–678. [19] A. Vroon, M.S. Lombardi, A. Kavelaars, C.J. Heijnen, J. Neuroimmunol. 137 (2003) 79–86. [20] A. De Blasi, G. Parruti, M. Sallese, J. Clin. Invest. 95 (1995) 203–210. [21] A. Vroon, A. Kavelaars, V. Limmroth, M.S. Lombardi, M.U. Goebel, A.M. Van Dam, M. G. Caron, M. Schedlowski, C.J. Heijenen, J. Immunol. 174 (2005) 4400–4406. [22] R.F. Spurney, Calcif. Tissue Int. 73 (2003) 153–160. [23] S. Daniele, M.L. Trincavelli, P. Gabelloni, D. Lecca, P. Rosa, M.P. Abbracchio, C. Martini, J. Pharmacol. Exp. Ther. 338 (2011) 559–567. [24] A. Carotenuto, E. Cipolletta, I. Gomez-Monterrey, M. Sala, E. Vernieri, A. Limatola, A. Bertamino, S. Musella, D. Sorriento, P. Grieco, B. Trimarco, E. Novellino, G. Iaccarino, P. Campiglia, Eur. J. Med. Chem. 69 (2013) 384–392. [25] T.T. Chuang, L. Paolucci, A. De Blasi, J. Biol. Chem. 271 (1996) 28691–28696. [26] S. Daniele, D. Lecca, M.L. Trincavelli, O. Ciampi, M.P. Abbracchio, C. Martini, Cell. Signal. 22 (2010) 697–706. [27] C. Martini, E. Da Pozzo, C. Carmassi, S. Cuboni, M.L. Trincavelli, G. Massimetti, D. Marazziti, L. Dell'Osso, World J. Biol. Psychiatry 14 (2013) 396–402. [28] E. Coppi, L. Cellai, G. Maraula, A.M. Pugliese, F. Pedata, Neuropharmacol. 73 (2013) 301–310. [29] D. Communi, N.S. Gonzales, M. Detheux, S. Brèzillon, V. Lannoy, M. Parmentier, J.M. Boeynaems, J. Biol. Chem. 276 (2001) 41479–41485. [30] L.M. Luttrell, D. Gesty-Palmer, Pharmacol. Rev. 62 (2010) 305–330. [31] S.H. Yang, A.D. Sharrocks, A.J. Whitmarsh, Gene 513 (2013) 1–13. [32] S.M. DeWire, S. Ahn, R.J. Lefkowitz, S.K. Shenoy, Annu. Rev. Physiol. 69 (2007) 483–510. [33] H. Zheng, H.H. Loh, P.Y. Law, Mol. Pharmacol. 73 (2008) 178–190. [34] S. Hennen, H. Wang, L. Peters, N. Merten, K. Simon, A. Spinrath, S. Blättermann, R. Akkari, R. Schrage, R. Schröder, D. Schulz, C. Vermeiren, K. Zimmermann, S. Kehraus, C. Drewke, A. Pfeifer, G.M. König, K. Mohr, M. Gillard, C.E. Müller, Q.R. Lu, J. Gomeza, E. Kostenis, Sci. Signal. 22 (2013) ra93. [35] A. Ishii, M. Furusho, R. Bansal, J. Neurosci. 33 (2013) 175–186. [36] J.D. Urban, W.P. Clarke, M. von Zastrow, D.E. Nichols, B. Kobilka, H. Weinstein, J.A. Javitch, B.L. Roth, A. Christopoulos, P.M. Sexton, J. Pharmacol. Exp. Ther. 320 (2007) 1–13. [37] J. Kim, W.P. Clarke, M. von Zastrow, D.E. Nichols, B. Kobilka, H. Weinstein, J.A. Javitch, B.L. Roth, A. Christopoulos, P.M. Sexton, K.J. Miller, M. Spedding, R.B. Mailman, Proc. Natl. Acad. Sci. U. S. A. 102 (2005) 1442–1447. [38] X.R. Ren, E. Reiter, S. Ahn, J. Kim, W. Chen, R.J. Lefkowitz, Proc. Natl. Acad. Sci. U. S. A. 102 (2005) 1448–1453. [39] S.K. Shenoy, M.T. Drake, C.D. Nelson, D.A. Houtz, K. Xiao, S. Madabushi, E. Reiter, R.T. Premont, O. Lichtarge, R.J. Lefkowitz, J. Biol. Chem. 281 (2005) 1261–1273. [40] C. Sato-Bigbee, S. Pal, A.K. Chu, J. Neurochem. 72 (1999) 139–147