- Email: [email protected]
Domain III of Calpain Is a Ca2+-Regulated Phospholipid-Binding Domain
Biochemical and Biophysical Research Communications 280, 1333–1339 (2001) doi:10.1006/bbrc.2001.4279, available online at http://www.idealibrary.com on
Domain III of Calpain Is a Ca 2⫹-Regulated Phospholipid-Binding Domain Peter Tompa,* ,1 Yasufumi Emori,† Hiroyuki Sorimachi,‡ Koichi Suzuki,§ and Peter Friedrich* *Institute of Enzymology, Biological Research Center, Hungarian Academy of Sciences, H-1518 Budapest, Hungary; †Department of Biophysics and Biochemistry, Graduate School of Science and ‡Graduate School of Agricultural and Life Sciences, University of Tokyo, Tokyo, Japan; and §Tokyo Metropolitan Institute of Gerontology, Tokyo, Japan
Received January 5, 2001
The X-ray structure of m-calpain shows that domain III of the large subunit is structurally related to C2 domains, Ca 2ⴙ-regulated lipid binding modules in many enzymes. To address whether this structural similarity entails functional analogy, we have characterized recombinant domain III from rat - and m-calpain and Drosophila CALPB. In a Ca 2ⴙ overlay assay domain III displays a large capacity for Ca 2ⴙ binding, commensurable with that of domain IV, the principal Ca 2ⴙ-binding domain of calpains. The amount of Ca 2ⴙ bound to domain III increases 2- to 10-fold upon the addition of liposomes containing 20 – 40% di- and triphosphoinositides. Conversely, phospholipid-binding in spin-column size-exclusion chromatography is significantly promoted by Ca 2ⴙ, in a manner similar to known C2 domains. These results suggest that domain III might be the primary lipid binding site of calpain and may play a decisive role in orchestrating Ca 2ⴙ- and lipid activation of the enzyme. © 2001 Academic Press Key Words: calpain; domain III; Ca 2ⴙ binding; phospholipid binding; C2 domain.
Calpains, the Ca 2⫹-activated intracellular thiol proteases are regulatory enzymes transducing intracellular Ca 2⫹ signals into the limited proteolytic modification of their substrate proteins (1, 2). Members of this rapidly expanding superfamily are thought to have diverse and basic functions in various key cellular processes such as cell division, differentiation, motility, apoptosis and many more. The activity of the best studied, so called typical, forms of calpain is absolutely dependent on Ca 2⫹ and is thought to be greatly facilitated by phospholipids (3, 4). Also, the Ca 2⫹-dependent Abbreviations used: IPTG, isopropyl -D-thiogalactopyranoside; EDTA, ethylenediaminetetraacetic acid. 1 To whom correspondence should be addressed. Fax: (361) 4665465. E-mail: [email protected].
translocation of the enzyme to the plasma membrane has been reported in several studies (5, 6); some models of in vivo calpain activation draw on this observation (7, 8). The lipid-binding site of calpain has not yet been firmly identified, although some data point at a particular sequence within the small subunit of the enzyme (9, 10). Typical calpains, such as vertebrate - and m-calpain, are heterodimers of an 80 kDa large and a 30 kDa small subunit. Their domain structure has been originally assigned by sequence homology (11): the large subunit is composed of four domains, of which domain II is the papain-like cysteine protease domain and domain IV is a calmodulin-like Ca 2⫹-binding domain with multiple EF-hand motifs. The small subunit also has a calmodulin-like domain (domain VI). The other domains, i.e., domains I and III of the large subunit and domain V of the small subunit display no apparent similarity to any other known protein sequences, thus an assignment of their function was not originally possible. Recently, the X-ray structure of rat and human m-calpain has been determined to high resolution, underlining that the domain structure suggested by amino acid sequence is basically correct (12, 13). An unexpected, but welcome, insight emerging from the 3D structure is about the possible function of domain III. This domain folds into an antiparallel -sandwich of a pair of four-stranded -sheets in a topological way rather similar to C2 domains originally identified in protein kinase C and found later in many different, mainly Ca 2⫹-regulated proteins (14). The C2 domain of about 130 residues can bind phospholipids in a Ca 2⫹-dependent manner and is thought to be responsible for orchestrating Ca 2⫹- and membrane regulation of enzyme activity. Ca 2⫹ binding by the C2 domain has been ascribed to two spatially adjacent loops that contain several conserved acidic residues. It is noteworthy that domain III of m-calpain large subunit also has a highly acidic loop in a position spatially analogous to the Ca 2⫹-coordinating loops in C2 domains (12, 13).
1333
0006-291X/01 $35.00 Copyright © 2001 by Academic Press All rights of reproduction in any form reserved.
Vol. 280, No. 5, 2001
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
This cluster of up to 10 acidic side-chains shows significant conservation among calpain species and may have a capacity to bind several Ca 2⫹ ions. It may well be that Ca 2⫹ binding to domain III is indispensable for the structural changes accompanying calpain activation to come about. As noted in (13), a large-scale conformational change in domain II is required to bring the active site residues into the proper spatial arrangement for catalysis; the presently known Ca 2⫹binding sites of calpain, domains IV–VI, however, are too distant and undergo too little structural change upon Ca 2⫹ binding to fully account for this (13). It is appealing that domain III, which occupies a central position in calpain structure, is actively involved in these processes. In keeping with this notion, mutation of two acidic residues within this domain that abolished salt bridges between domains II and III were found to have a significant effect on the Ca 2⫹sensitivity of the enzyme (15). All these foregoing considerations raise the possibility that domain III of calpains serves as an important Ca 2⫹- and lipid binding site of the enzyme. To test this hypothesis, we have expressed domain III from three different calpain species, i.e., from rat - and m-calpain and from Drosophila CALPB in Escherichia coli. Our studies with these purified recombinant proteins lend a significant support to the domain III-C2 analogy by demonstrating that domain III, in fact, has the capacity for Ca 2⫹- and lipid binding in a mutually cooperative manner. MATERIALS AND METHODS Construction of expression vectors. The cDNA fragments encoding domain III from three different calpain species were amplified from each of cloned cDNA by using a high fidelity thermostable DNA polymerase (Pyrobest DNA polymerase) and the primers CAGACATATGCGGAACTGGAATACCACA and CCTGCTCGAGGTCATCTAGTTCCTGGGT for rat -calpain, CACCCATATGTACAAGAAGTGGAAACTCAC and AATTCTCGAGATCATCGACAGTTTGGTAGT for rat m-calpain and TTTCCATATGAAGTGGGAAATGTCCATGTTC and ATTACTCGAGAATGCGATCGTCGGTCTCGC for Drosophila CALPB. The amplified fragments were digested by NdeI–XhoI and ligated by Ligation high into a pET-20b(⫹) vector pre-treated with the same enzymes and bovine alkaline phosphatase. Ligation products were transformed into competent JM 83 cells. From selected colonies, overnight cultures were grown and plasmids were prepared by a Kurabo PI-50 automatic DNA isolation system. Plasmids containing the insert were sequenced from both directions by using T7 promoter and terminator primers on a Perkin–Elmer ABI Prism 310 Genetic Analyzer. For long-term storage and protein expression plasmids were prepared by the Omega Biotek EZNA kit. Expression and purification of recombinant proteins. For domain III preparation BL21 (DE3) cells were transformed with the recombinant plasmid and grown in 200 ml LB medium containing 100 g/ml ampicillin at 37°C, 120 rpm to an OD 550 ⫽ 0.3. Expression of the recombinant protein was induced by 0.5 mM IPTG and allowed to proceed for 2 h. The culture was cooled on ice for 15 min and cells were collected by centrifugation at 12,000g for 5 min at 4°C. The pellet was washed with 60 ml buffer A (50 mM Tris/HCl, pH 7.5, 150 mM NaCl) and centrifuged again. Pelleted cells were resuspended in
6 ml buffer A and sonicated 20 ⫻ 3 s at 25 m on ice. The sonicate was centrifuged at 12,000g for 10 min at 4°C, the supernatant was discarded and the pellet was washed with 20 ml buffer A. Inclusion bodies were dissolved in 6 ml buffer B (buffer A ⫹ 8 M urea) by a 2-h incubation at 0°C with occasional stirring. Insoluble material was removed by centrifugation at 12,000g for 10 min. Purification and renaturation of the recombinant protein was achieved in one step. The supernatant was applied to 2 ml Talon resin (an affinity matrix with immobilized cobalt for His-tagged proteins) equilibrated with buffer B. The column was washed with 6 ml buffer C (buffer B ⫹ 1.0 M NaCl), a linear gradient of 6 ml buffer C – 6 ml buffer D (buffer A ⫹ 1.0 M NaCl) at a rate of 25 l/min overnight and 5 ml buffer D. Bound protein was finally eluted with 500 mM imidazole in buffer D, peak fractions were collected and imidazole was removed by dialysis in buffer D. The protein was stored at 4°C until use. Domain IV of human - and m-calpain were prepared as described previously (16). Ca 2⫹ overlay assay. 1 l samples containing 0.5–1.0 g protein were spotted on a nitrocellulose membrane pre-wetted by distilled water. The membrane was washed for 2 ⫻ 10 min with buffer and incubated with 7 M 45Ca 2⫹ at a specific activity of 28 GBq/mmol for 20 min. Following incubation the membrane was rinsed briefly in distilled water and dried for autoradiography. Dots with bound Ca 2⫹ were visualized on an AGFA CP-B medical X-ray film by a 48- to 72-h exposure. Preparation of liposomes. Liposomes were prepared from a crude bovine brain extract of phosphoinositides (Sigma P6023) that contains 20-40% di- and triphosphoinositide (a minimum of 5–10% for each) and 60 – 80% phosphatidylinositol and phosphatidylserine. 2 mg mixture was dissolved in 500 l 1:4 methanol:chloroform and dried in aliquots of 25 l (100 g) in a Savant Speedvac concentrator. Dried samples, kept at ⫺80°C until use, were resuspended in 200 l buffer A by vortexing for 5 min. Liposomes were prepared by 5 ⫻ 15s sonication at 30 and centrifuged at 15,000 rpm ⫻ 1 min to remove large aggregates. Assay of protein-phospholipid binding. Binding of proteins to lipid vesicles was assayed by spin-column size exclusion chromatography on MicroSpin S200 HR columns. The assay is based on that liposome binding promotes elution of a protein from the column as it separates solutes by size. A significant part of the gel from the columns supplied was removed to reduce wet bed height to about 4 mm (170 l) because the original column retains proteins completely irrespective of the presence of liposomes. For washing or sample elution columns were centrifuged at 2800 rpm (530 g) for 20 s in a Sigma Kubota 3615 microcentrifuge. Prior to sample application, columns were prespun with 2 ⫻ 200 l buffer D and 2 ⫻ 100 l buffer D with liposomes and EDTA or Ca 2⫹. Proteins at a final concentration of about 0.05– 0.1 mg/ml were applied in 50 l sample volume with or without 50 g/ml liposome and EDTA or Ca 2⫹ at concentrations as indicated. The same volume of eluate could be collected and was treated for SDS–PAGE. Miscellaneous procedures. SDS–PAGE was carried out according to Laemmli (17), gels were either Coomassie Brilliant Blue R250- or silver stained. Protein concentration was determined by a BCA protein assay. Materials. Restriction enzyme NdeI was from New England Biolabs, XhoI was from Boehringer Mannheim. Bovine alkaline phosphatase, Pyrobest DNA polymerase and Ligation-high mixture was purchased from Toyobo Co. pET-20b(⫹) vector and Escherichia coli strains BL21 (DE3) and JM 83 were from Novagene. Talon metal affinity resin was from Clontech. A phosphoinositide mixture (P 6023) was from Sigma. 2D-silver stain II kit was from Daiichi Pure Chemicals Co., BCA protein assay was from Pierce, prestained “broad range” SDS protein marker was from New England Biolabs. 45CaCl 2 at an activity of 28 GBq/mmol was from Izinta Ltd., Budapest.
1334
Vol. 280, No. 5, 2001
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 1. Domain III sequences and purification of recombinant proteins. (A) The sequence of domain III and the short flanking segments included in the expression constructs of rat - and m-calpain and Drosophila CALPB are aligned (the C-terminal His 6 tags are not shown). Domain boundaries are marked by vertical lines, the putative Ca 2⫹-binding acidic loop is boxed. Amino-acid similarity is marked by points and colons, identity is marked by asterisks. The numbering runs with the rat m-calpain construct, where the starting methionine corresponds to M 353 in the full-length large subunit. (B) SDS–PAGE of recombinant domain IIIs. Rat m-calpain domain III could not be purified and is used as is in SDS sample buffer. Domain III of rat -calpain and Drosophila CALPB were purified and renatured as given in the text. The proteins run at an apparent M w calculated from their position relative to prestained markers (theoretical M w in parentheses): rat , 19.6 (20.1); rat m, 20.8 (20.2); and CALPB, 20.3 (20.4).
RESULTS Cloning and Purification of Domain III of Rat - and m-Calpain and Drosophila CALPB The cDNA encoding for domain III with short flanking regions (Fig. 1A) of rat - and m-calpain and Drosophila CALPB have been cloned into the NdeI-XhoI sites of pET-20b(⫹) plasmid that fuses recombinant protein with a C-terminal His 6 tag. The proteins were expressed in BL21 (DE3) E. coli in very high yields, typically on the order of 5–10 mg in a 200 ml culture. Domain III invariably appeared in inclusion bodies and
efforts at obtaining it in the soluble fraction such as varying time of induction, temperature of culturing or IPTG concentration have all failed. Preparation of inclusion bodies, nevertheless, has yielded high quantities of rather pure protein. Domain III of rat m-calpain could not be solubilized from inclusion bodies in 8 M urea and was used without further purification (Fig. 1B). Domain III from rat -calpain and Drosophila calpain B readily dissolved in 8 M urea and could be purified by Talon metal affinity chromatography. Subsequent studies showed that even a very careful and slow removal of urea by
1335
Vol. 280, No. 5, 2001
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
CALPB) (Fig. 2C). No such facilitating effect is seen with domain IV, thus, in the presence of phospholipid, domain III binds much more Ca 2⫹ than domain IV. High ionic strength significantly diminishes Ca 2⫹ binding by domain III; it also counteracts the facilitating effect of phospholipids (Figs. 2D and 2E). Liposome Binding
FIG. 2. Overlay assay of Ca 2⫹ binding by domain III. 0.5–1.0 g of proteins was dotted on nitrocellulose and Ponceau Red-stained (A) or laid over with 45Ca 2⫹ under different conditions (B through E). The dots are: (1) calmodulin, (2) BSA, (3) human -calpain domain IV, (4) human m-calpain domain IV, (5) rat -calpain domain III, (6) rat m-calpain domain III, (7) Drosophila CALPB domain III. The conditions applied are: (B) buffer A, (C) buffer A ⫹ 50 g/ml phospholipid, (D) buffer A ⫹ 1.0 M NaCl (buffer D), (E) buffer D ⫹ 50 g/ml phospholipid.
dialysis causes domain III to precipitate and go completely into pellet upon centrifugation at 100,000g for 1 h. In pilot experiments in the presence of 2% polyethylene glycol, 5% glycerol and 0.65 or 1.15 M NaCl it was found that high ionic strength keeps some of domain III in solution upon removal of urea. Based on these findings a purification-renaturation scheme has been worked out in which the protein, dissolved in 8 M urea, was bound to Talon resin and urea concentration is reduced to zero by applying a slow descending urea gradient in the presence of 1.15 M NaCl. Domain III can be eluted from the column by 500 mM imidazole that is removed by dialysis. Domain III prepared this way is in the 100,000g 1-h supernatant (Fig. 1B) at a maximal concentration of about 0.5 mg/ml (Drosophila CALPB) and 0.1 mg/ml (rat -calpain). It is to be noted, though, that it is rather unstable even in this state, and tends to aggregate upon storage or any change in buffer composition. Preparations of similar quality and character could be obtained by separate purification and renaturation steps, i.e., by first applying metal affinity chromatography in the presence of 8 M urea and subsequent removal of urea by a stepwise dialysis (i.e., 6 – 4 –3–2–1– 0 M, data not shown).
Liposome binding of domain III of rat -calpain and Drosophila calpain B has been tested by size-exclusion chromatography applied in the spin column format. As MicroSpin S200 HR columns have been designed to fully remove small solutes from the sample, their bed size had to be reduced significantly to let some, but not all, of domain III through. This way the amount of domain III eluted is sensitive to binding to a liposome which is much larger in size and is thus diagnostic to domain III-liposome interaction. Figure 3 shows the evidence that domain III of both rat -calpain and Drosophila CALPB binds to liposomes. With rat domain III, very little of the protein elutes from the column under the given conditions; the amount significantly increases in the presence of liposomes. Furthermore, the binding appears to be sensitive to the presence of Ca 2⫹, as more protein elutes with liposomes in the presence than in the absence of Ca 2⫹. Drosophila CALPB domain III exhibits a qualitatively very similar behavior as its elution from the column is also significantly promoted by liposomes, with a marked facilitation by Ca 2⫹. BSA was also tested in this setup: its elution is insensitive to either liposomes or Ca 2⫹. The observed differences in the amount of protein eluting with liposomes in the absence and presence of Ca 2⫹ allows a quantitative measurement of the Ca 2⫹ sensitivity of liposome binding. Columns were equili-
Ca 2⫹ Overlay Assay Ca 2⫹ binding by an overlay technique was tested on dot-blots as all the proteins included in the assay are homogeneous by SDS–PAGE (cf. Fig. 1). Domain III from all three sources has a high capacity for binding Ca 2⫹ (Fig. 2B): it appears to bind at least as much Ca 2⫹ as domain IV. Furthermore, Ca 2⫹ binding by domain III is highly stimulated by phospholipids: in the presence of 50 g/ml phospholipid the amount of Ca 2⫹ bound under the given conditions increases 2- (rat calpain), 10- (rat m-calpain) and 5-fold (Drosophila
FIG. 3. Liposome binding by domain III. (A) Domain III of rat -calpain (0.05 mg/ml) and Drosophila CALPB (0.15 mg/ml) as well as BSA (0.1 mg/ml) was gel-filtered through a spin column of 170 l bed volume in 50 l. The eluate was collected and run on 15% SDS–PAGE. The bands are as follows: sample applied at column (1), eluate without liposomes (2), and eluate in the presence of 50 g/ml liposomes (3) plus 0.3 mM EDTA (4) or 2 mM Ca 2⫹ (5). (B) Band intensities were determined by densitometry and are shown for the various conditions from 1 through 5.
1336
Vol. 280, No. 5, 2001
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
DISCUSSION
FIG. 4. The effect of Ca 2⫹ on domain III–liposome interaction. (A) Domain III of rat -calpain and Drosophila CALPB were gel-filtered through a spin column as in Fig. 3 either without liposomes (1) or with 50 g/ml liposomes in the presence of 0.3 mM EDTA (2) or various free Ca 2⫹ concentrations (3 through 10) such as: 20, 50, 100, 200, 500, 1000, 2000, 4000 M. Samples passing through the column were run on 15% SDS–PAGE and silver-stained. (B) Band intensities were determined by densitometry and plotted against free Ca 2⫹ concentration for rat -calpain (F) and Drosophila CALPB (}). Open symbols stand for protein eluted without phospholipid. Data points represent averages of three separate experiments.
brated and domain III was eluted without or with liposomes at various Ca 2⫹ concentrations. The protein eluting was visualized by SDS–PAGE. Figure 4A shows the gel picture for both rat -calpain- and Drosophila CALPB domain III. Liposome binding is clearly promoted by Ca 2⫹ in a concentration-dependent manner: in both cases more protein eluted upon increasing the concentration of Ca 2⫹. Band intensities were determined by densitometry to quantitatively characterize this effect (Fig. 4B). With rat domain III phospholipid increases the amount of eluted protein by 40%; Ca 2⫹ adds a further 200% with a half-effective concentration around 900 M. In the case of Drosophila CALPB, phospholipid in itself has an effect of 60%; Ca 2⫹ stimulates this by a further 230%, with a halfeffective concentration of about 700 M.
The functional dissection of the structure of calpain has shown a significant disparity for many years. Since the determination of its complete amino-acid sequence, domain II of the large subunit is known to carry the residues responsible for catalytic activity whereas domain IV with its multiple EF-hand motifs is primarily responsible for regulation by Ca 2⫹ (11). The function of the other two domains, I and III, and of domain V within the small subunit has remained obscure despite much studies aimed at the structure-function relationship of calpain. The situation has significantly changed, however, with solving the X-ray structure of rat and human m-calpains to high resolution (12, 13). These structures show that domain III is engaged in extensive ionic interactions with all the other domains within the large subunit and thus seems to function as an organizing center of calpain. Possibly, alterations of these interactions determine domain movements—the closure of domain II in particular—and hence the mode of activation of the enzyme; a putative “electrostatic switch” mechanism to account for these regulatory molecular details has been put forward (13). Furthermore, the resemblance of domain III to C2 domains, Ca 2⫹and phospholipid-binding modules in many other enzymes (14, 18), suggests that it might be involved in orchestrating calpain activation by these activating factors. The results in this paper provide experimental support for most of these suggestions. Our difficulties at renaturing recombinant domain III underline that this domain is firmly integrated into the structural scaffold of the enzyme. Renaturation is only possible at high ionic strength (above 1 M NaCl), and conventional agents such as PEG and glycerol are of no help; even under these conditions domain III tends to aggregate. It is logical to assume that stripping this domain of its ionic interactions with other parts of the enzyme make it rather unstable and difficult to keep in solution: counter-ions provided by the salt are poor substitutes for the contacts within the native protein fold. Remarkably, domain III in this respect differs significantly from C2 domains which have been noted to be autonomous folding units, easy to study in isolation (14, 18). Ca 2⫹- and phospholipid binding by domain III, on the other hand, shows a remarkable functional analogy with C2 domains. For a quantitative characterization of the strength and stoichiometry of Ca 2⫹ binding, equilibrium dialysis would have been an ideal choice which, however, could not be carried out properly due to the inherent instability of recombinant domain III. Thus, Ca 2⫹ binding was demonstrated by an overlay with 45 Ca 2⫹; domain III from all three sources appears to bind more Ca 2⫹ than domain IV. This difference could be due to binding of multiple Ca 2⫹ ions to the acidic loop as suggested by the X-ray structure (13) and/or a
1337
Vol. 280, No. 5, 2001
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
tighter binding than by domain IV. Furthermore, unlike with domain IV, phospholipids promote Ca 2⫹ binding several fold which is very notable considering the known lipid activation of calpain that might narrow the gap between physiologic Ca 2⫹ signals and the Ca 2⫹ requirement of the enzyme observed in vitro (3, 4). The lipid mixture used in our studies contains 20 – 40% diand triphosphoinositides which are the most effective in calpain activation. If we assume that lipid activation of calpain is relayed by domain III, these earlier observations are in full agreement with the phospholipidfacilitated Ca 2⫹ binding to domain III. The demonstration of lipid binding by domain III is very much in line with these considerations. Although translocation to the membrane is a recurring theme in the models of calpain activation (5– 8), little is known about which part of the enzyme is actually involved. Some data imply a particular sequence within domain V of the small subunit (9, 10), but many aspects of lipid binding are still unclear. In light of our data, it is reasonable to assume that domain III is the primary lipid-binding site of the enzyme. Translocation of calpain to membranes is promoted by Ca 2⫹ (5, 6) which fits perfectly with our observation that Ca 2⫹ markedly facilitates the binding of domain III to liposomes. The observed low sensitivity of this facilitating effect to Ca 2⫹ may be irrelevant as Ca 2⫹ binding with renatured domain III is highly impaired by high ionic strength; this is evident from the difference in Ca 2⫹ binding observed at 1.15 vs 0.15 M NaCl in the overlay assay. Taking this fact into consideration, it is quite conceivable that the Ca 2⫹ concentration needed under isotonic conditions is well within the physiological range. The possible large capacity of domain III for Ca 2⫹ binding, however, is somewhat difficult to reconcile with earlier quantitative data concerning the stoichiometry of Ca 2⫹ binding to calpain. Heterodimeric -calpain was found to bind 4 (2 by each subunit (19, 20)) to 8 (4 by each subunit (21)) Ca 2⫹ ions, whereas m-calpain appears to bind 6 Ca 2⫹ ions (2 by the smalland 4 by the large subunit (19, 20)). X-ray crystallographic studies of domain VI show 3– 4 bound Ca 2⫹ depending on conditions (22, 23) and a similar number is likely to apply to domain IV. Accordingly, the total number of Ca 2⫹ ions that bind to calpain can be accounted for quite well by assuming binding to EF-hand motifs in domains IV and VI, as originally suggested (11); nevertheless, the contribution of domain III to the observed Ca 2⫹ binding cannot be excluded. To be compatible with all relevant data, it is most reasonable to assume that domain III binds Ca 2⫹ in the absence of phospholipids at a low (probably 1:1) stoichiometry, but in the presence of phospholipids a higher stoichiometry and/or stronger binding may occur. A further point to scrutinize is the possible role of Ca 2⫹ binding to domain III in the activation of calpain. A comparison of m-calpain structure determined in the
absence of Ca 2⫹ (12, 13) and the Ca 2⫹-bound structure of domain VI heterodimer (22, 23) reveals a rather minor conformational change within domain VI (and possibly domain IV) upon binding of Ca 2⫹. Given the spatial separation of domains IV–VI from domain II, it is hard to imagine how this small structural change is transduced into a relatively large-scale rearrangement at the active site, unless with the intervention of domain III. Thus, an active role of domain III has been suggested (13), which is fully compatible with Ca 2⫹ binding to this domain. On the other hand, the role of domain IV in the events leading to activation is unquestionable: recent detailed mutation studies have shown the essential function of EF-hands (24). It was found that the individual EF-hands each contributed to activation of calpain, and Ca 2⫹ binding to any one of them was sufficient to fully activate the enzyme. Furthermore, deletion of domain IV was found to yield an active, but Ca 2⫹-independent enzyme whereas excision of domain III leaves the enzyme with impaired activity but only slightly decreased Ca 2⫹ sensitivity (25). In contrast, we found in similar studies that the deletion of domain IV does not make calpain Ca 2⫹-independent (unpublished observations). Also, a chimeric form composed of domains I-III of -calpain and domain IV of m-calpain has a Ca 2⫹ sensitivity characteristic of -, and not of m-, calpain (25). Thus, a consensus has not yet been reached on how much domain III contributes to calpain’s activation by Ca 2⫹. Nevertheless, it seems likely that domain III somehow gates and amplifies the signal coming from domain IV; its role may be in the regulation of activity but also of lipid activation/ membrane translocation by Ca 2⫹. Strong Ca 2⫹ binding in this case would fit very nicely with an earlier hypothesis that regulation of various aspects of calpain action such as membrane binding, calpastatin inhibition, proteolytic activity and autolysis reflects specific responses to Ca 2⫹ binding at distinct sites on the molecule (7), the most sensitive being membrane anchoring of the enzyme. Taken all these considerations, it is warranted to propose that domain III is the major site of Ca 2⫹dependent lipid binding of calpain, in a way similar to other enzymes that achieve this goal via the structurally related C2 domains. Given its topology within the structure of the enzyme, it seems now evident that full understanding of calpain activation and action is not possible without a deeper insight into the function of this domain. ACKNOWLEDGMENTS P.T. acknowledges the support of the Hungarian Academy of Sciences-Japanese Society for the Promotion of Science (Project No. 27) and the Bolyai Ja´nos Scholarship. The work in Hungary was supported by Grants T 22069, T 29059, and T 32360 from OTKA and 98-45 3,3 from AKP.
1338
Vol. 280, No. 5, 2001
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
REFERENCES 1. Sorimachi, H., Ishiura, S., and Suzuki, K. (1997) Biochem. J. 328, 721–732. 2. Ono, Y., Sorimachi, H., and Suzuki, K. (1998) Biochem. Biophys. Res. Commun. 245, 289 –294. 3. Pontremoli, S., Melloni, E., Sparatore, B., Salamino, F., Michetti, M., Sacco, O., and Horecker, B. L. (1985) Biochem. Biophys. Res. Commun. 129, 389 –395. 4. Saido, T. C., Shibata, M., Takenawa, T., Murofushi, H., and Suzuki, K. (1992) J. Biol. Chem. 267, 24585–24590. 5. Molinari, M., Anagli, J., and Carafoli, E. (1994) J. Biol. Chem. 269, 27992–27995. 6. Michetti, M., Salamino, F., Tedesco, I., Averna, M., Minafra, R., Melloni, E., and Pontremoli, S. (1996) FEBS Lett. 392, 11–15. 7. Goll, D. E., Thompson, V. F., Taylor, R. G., and Zalewska, T. (1992) BioEssays 14, 549 –556. 8. Suzuki, K., and Sorimachi, H. (1998) FEBS Lett. 433, 1– 4. 9. Crawford, C., Brown, N. R., and Willis, A. C. (1990) Biochem. J. 265, 575–579. 10. Arthur, J. S., and Crawford, C. (1996) Biochim. Biophys. Acta 1293, 201–206. 11. Ohno, S., Emori, Y., Imajoh, S., Kawasaki, H., Kisaragi, M., and Suzuki, K. (1984) Nature 312, 566 –570. 12. Hosfield, C. M., Elce, J. S., Davies, P. L., and Jia, Z. (1999) EMBO J. 18, 6880 – 6889. 13. Strobl, S., Fernandez-Catalan, C., Braun, M., Huber, R., Ma-
14. 15. 16. 17. 18. 19. 20. 21. 22. 23.
24. 25.
1339
sumoto, H., Nakagawa, K., Irie, A., Sorimachi, H., Bourenkow, G., Bartunik, H., Suzuki, K., and Bode, W. (2000) Proc. Natl. Acad. Sci. USA 97, 588 –592. Rizo, J., and Sudhof, T. C. (1998) J. Biol. Chem. 273, 15879 – 15882. Hosfield, C. M., Moldoveanu, T., Davies, P. L., Elce, J. S., and Jia, Z. (2001) J. Biol. Chem., in press. Suo, S., Koike, H., Sorimachi, H., Ishiura, S., and Suzuki, K. (1999) Biochem. Biophys. Res. Commun. 257, 63– 66. Laemmli, U. K. (1970) Nature 227, 680 – 685. Nalefski, E. A., and Falke, J. J. (1996) Protein Sci. 5, 2375–2390. Minami, Y., Emori, Y., Kawasaki, H., and Suzuki, K. (1987) J. Biochem. (Tokyo) 101, 889 – 895. Zimmerman, U. J., and Schlaepfer, W. W. (1988) Arch. Biochem. Biophys. 266, 462– 469. Michetti, M., Salamino, F., Minafra, R., Melloni, E., and Pontremoli, S. (1997) Biochem. J. 325, 721–726. Blanchard, H., Grochulski, P., Li, Y., Arthur, J. S., Davies, P. L., Elce, J. S., and Cygler, M. (1997) Nat. Struct. Biol. 4, 532–538. Lin, G. D., Chattopadhyay, D., Maki, M., Wang, K. K., Carson, M., Jin, L., Yuen, P. W., Takano, E., Hatanaka, M., DeLucas, L. J., and Narayana, S. V. (1997) Nat. Struct. Biol. 4, 539 –547. Dutt, P., Arthur, J. S., Grochulski, P., Cygler, M., and Elce, J. S. (2000) Biochem. J. 348, 37– 43. Vilei, E. M., Calderara, S., Anagli, J., Berardi, S., Hitomi, K., Maki, M., and Carafoli, E. (1997) J. Biol. Chem. 272, 25802– 25808.
Domain III of Calpain Is a Ca 2⫹-Regulated Phospholipid-Binding Domain Peter Tompa,* ,1 Yasufumi Emori,† Hiroyuki Sorimachi,‡ Koichi Suzuki,§ and Peter Friedrich* *Institute of Enzymology, Biological Research Center, Hungarian Academy of Sciences, H-1518 Budapest, Hungary; †Department of Biophysics and Biochemistry, Graduate School of Science and ‡Graduate School of Agricultural and Life Sciences, University of Tokyo, Tokyo, Japan; and §Tokyo Metropolitan Institute of Gerontology, Tokyo, Japan
Received January 5, 2001
The X-ray structure of m-calpain shows that domain III of the large subunit is structurally related to C2 domains, Ca 2ⴙ-regulated lipid binding modules in many enzymes. To address whether this structural similarity entails functional analogy, we have characterized recombinant domain III from rat - and m-calpain and Drosophila CALPB. In a Ca 2ⴙ overlay assay domain III displays a large capacity for Ca 2ⴙ binding, commensurable with that of domain IV, the principal Ca 2ⴙ-binding domain of calpains. The amount of Ca 2ⴙ bound to domain III increases 2- to 10-fold upon the addition of liposomes containing 20 – 40% di- and triphosphoinositides. Conversely, phospholipid-binding in spin-column size-exclusion chromatography is significantly promoted by Ca 2ⴙ, in a manner similar to known C2 domains. These results suggest that domain III might be the primary lipid binding site of calpain and may play a decisive role in orchestrating Ca 2ⴙ- and lipid activation of the enzyme. © 2001 Academic Press Key Words: calpain; domain III; Ca 2ⴙ binding; phospholipid binding; C2 domain.
Calpains, the Ca 2⫹-activated intracellular thiol proteases are regulatory enzymes transducing intracellular Ca 2⫹ signals into the limited proteolytic modification of their substrate proteins (1, 2). Members of this rapidly expanding superfamily are thought to have diverse and basic functions in various key cellular processes such as cell division, differentiation, motility, apoptosis and many more. The activity of the best studied, so called typical, forms of calpain is absolutely dependent on Ca 2⫹ and is thought to be greatly facilitated by phospholipids (3, 4). Also, the Ca 2⫹-dependent Abbreviations used: IPTG, isopropyl -D-thiogalactopyranoside; EDTA, ethylenediaminetetraacetic acid. 1 To whom correspondence should be addressed. Fax: (361) 4665465. E-mail: [email protected].
translocation of the enzyme to the plasma membrane has been reported in several studies (5, 6); some models of in vivo calpain activation draw on this observation (7, 8). The lipid-binding site of calpain has not yet been firmly identified, although some data point at a particular sequence within the small subunit of the enzyme (9, 10). Typical calpains, such as vertebrate - and m-calpain, are heterodimers of an 80 kDa large and a 30 kDa small subunit. Their domain structure has been originally assigned by sequence homology (11): the large subunit is composed of four domains, of which domain II is the papain-like cysteine protease domain and domain IV is a calmodulin-like Ca 2⫹-binding domain with multiple EF-hand motifs. The small subunit also has a calmodulin-like domain (domain VI). The other domains, i.e., domains I and III of the large subunit and domain V of the small subunit display no apparent similarity to any other known protein sequences, thus an assignment of their function was not originally possible. Recently, the X-ray structure of rat and human m-calpain has been determined to high resolution, underlining that the domain structure suggested by amino acid sequence is basically correct (12, 13). An unexpected, but welcome, insight emerging from the 3D structure is about the possible function of domain III. This domain folds into an antiparallel -sandwich of a pair of four-stranded -sheets in a topological way rather similar to C2 domains originally identified in protein kinase C and found later in many different, mainly Ca 2⫹-regulated proteins (14). The C2 domain of about 130 residues can bind phospholipids in a Ca 2⫹-dependent manner and is thought to be responsible for orchestrating Ca 2⫹- and membrane regulation of enzyme activity. Ca 2⫹ binding by the C2 domain has been ascribed to two spatially adjacent loops that contain several conserved acidic residues. It is noteworthy that domain III of m-calpain large subunit also has a highly acidic loop in a position spatially analogous to the Ca 2⫹-coordinating loops in C2 domains (12, 13).
1333
0006-291X/01 $35.00 Copyright © 2001 by Academic Press All rights of reproduction in any form reserved.
Vol. 280, No. 5, 2001
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
This cluster of up to 10 acidic side-chains shows significant conservation among calpain species and may have a capacity to bind several Ca 2⫹ ions. It may well be that Ca 2⫹ binding to domain III is indispensable for the structural changes accompanying calpain activation to come about. As noted in (13), a large-scale conformational change in domain II is required to bring the active site residues into the proper spatial arrangement for catalysis; the presently known Ca 2⫹binding sites of calpain, domains IV–VI, however, are too distant and undergo too little structural change upon Ca 2⫹ binding to fully account for this (13). It is appealing that domain III, which occupies a central position in calpain structure, is actively involved in these processes. In keeping with this notion, mutation of two acidic residues within this domain that abolished salt bridges between domains II and III were found to have a significant effect on the Ca 2⫹sensitivity of the enzyme (15). All these foregoing considerations raise the possibility that domain III of calpains serves as an important Ca 2⫹- and lipid binding site of the enzyme. To test this hypothesis, we have expressed domain III from three different calpain species, i.e., from rat - and m-calpain and from Drosophila CALPB in Escherichia coli. Our studies with these purified recombinant proteins lend a significant support to the domain III-C2 analogy by demonstrating that domain III, in fact, has the capacity for Ca 2⫹- and lipid binding in a mutually cooperative manner. MATERIALS AND METHODS Construction of expression vectors. The cDNA fragments encoding domain III from three different calpain species were amplified from each of cloned cDNA by using a high fidelity thermostable DNA polymerase (Pyrobest DNA polymerase) and the primers CAGACATATGCGGAACTGGAATACCACA and CCTGCTCGAGGTCATCTAGTTCCTGGGT for rat -calpain, CACCCATATGTACAAGAAGTGGAAACTCAC and AATTCTCGAGATCATCGACAGTTTGGTAGT for rat m-calpain and TTTCCATATGAAGTGGGAAATGTCCATGTTC and ATTACTCGAGAATGCGATCGTCGGTCTCGC for Drosophila CALPB. The amplified fragments were digested by NdeI–XhoI and ligated by Ligation high into a pET-20b(⫹) vector pre-treated with the same enzymes and bovine alkaline phosphatase. Ligation products were transformed into competent JM 83 cells. From selected colonies, overnight cultures were grown and plasmids were prepared by a Kurabo PI-50 automatic DNA isolation system. Plasmids containing the insert were sequenced from both directions by using T7 promoter and terminator primers on a Perkin–Elmer ABI Prism 310 Genetic Analyzer. For long-term storage and protein expression plasmids were prepared by the Omega Biotek EZNA kit. Expression and purification of recombinant proteins. For domain III preparation BL21 (DE3) cells were transformed with the recombinant plasmid and grown in 200 ml LB medium containing 100 g/ml ampicillin at 37°C, 120 rpm to an OD 550 ⫽ 0.3. Expression of the recombinant protein was induced by 0.5 mM IPTG and allowed to proceed for 2 h. The culture was cooled on ice for 15 min and cells were collected by centrifugation at 12,000g for 5 min at 4°C. The pellet was washed with 60 ml buffer A (50 mM Tris/HCl, pH 7.5, 150 mM NaCl) and centrifuged again. Pelleted cells were resuspended in
6 ml buffer A and sonicated 20 ⫻ 3 s at 25 m on ice. The sonicate was centrifuged at 12,000g for 10 min at 4°C, the supernatant was discarded and the pellet was washed with 20 ml buffer A. Inclusion bodies were dissolved in 6 ml buffer B (buffer A ⫹ 8 M urea) by a 2-h incubation at 0°C with occasional stirring. Insoluble material was removed by centrifugation at 12,000g for 10 min. Purification and renaturation of the recombinant protein was achieved in one step. The supernatant was applied to 2 ml Talon resin (an affinity matrix with immobilized cobalt for His-tagged proteins) equilibrated with buffer B. The column was washed with 6 ml buffer C (buffer B ⫹ 1.0 M NaCl), a linear gradient of 6 ml buffer C – 6 ml buffer D (buffer A ⫹ 1.0 M NaCl) at a rate of 25 l/min overnight and 5 ml buffer D. Bound protein was finally eluted with 500 mM imidazole in buffer D, peak fractions were collected and imidazole was removed by dialysis in buffer D. The protein was stored at 4°C until use. Domain IV of human - and m-calpain were prepared as described previously (16). Ca 2⫹ overlay assay. 1 l samples containing 0.5–1.0 g protein were spotted on a nitrocellulose membrane pre-wetted by distilled water. The membrane was washed for 2 ⫻ 10 min with buffer and incubated with 7 M 45Ca 2⫹ at a specific activity of 28 GBq/mmol for 20 min. Following incubation the membrane was rinsed briefly in distilled water and dried for autoradiography. Dots with bound Ca 2⫹ were visualized on an AGFA CP-B medical X-ray film by a 48- to 72-h exposure. Preparation of liposomes. Liposomes were prepared from a crude bovine brain extract of phosphoinositides (Sigma P6023) that contains 20-40% di- and triphosphoinositide (a minimum of 5–10% for each) and 60 – 80% phosphatidylinositol and phosphatidylserine. 2 mg mixture was dissolved in 500 l 1:4 methanol:chloroform and dried in aliquots of 25 l (100 g) in a Savant Speedvac concentrator. Dried samples, kept at ⫺80°C until use, were resuspended in 200 l buffer A by vortexing for 5 min. Liposomes were prepared by 5 ⫻ 15s sonication at 30 and centrifuged at 15,000 rpm ⫻ 1 min to remove large aggregates. Assay of protein-phospholipid binding. Binding of proteins to lipid vesicles was assayed by spin-column size exclusion chromatography on MicroSpin S200 HR columns. The assay is based on that liposome binding promotes elution of a protein from the column as it separates solutes by size. A significant part of the gel from the columns supplied was removed to reduce wet bed height to about 4 mm (170 l) because the original column retains proteins completely irrespective of the presence of liposomes. For washing or sample elution columns were centrifuged at 2800 rpm (530 g) for 20 s in a Sigma Kubota 3615 microcentrifuge. Prior to sample application, columns were prespun with 2 ⫻ 200 l buffer D and 2 ⫻ 100 l buffer D with liposomes and EDTA or Ca 2⫹. Proteins at a final concentration of about 0.05– 0.1 mg/ml were applied in 50 l sample volume with or without 50 g/ml liposome and EDTA or Ca 2⫹ at concentrations as indicated. The same volume of eluate could be collected and was treated for SDS–PAGE. Miscellaneous procedures. SDS–PAGE was carried out according to Laemmli (17), gels were either Coomassie Brilliant Blue R250- or silver stained. Protein concentration was determined by a BCA protein assay. Materials. Restriction enzyme NdeI was from New England Biolabs, XhoI was from Boehringer Mannheim. Bovine alkaline phosphatase, Pyrobest DNA polymerase and Ligation-high mixture was purchased from Toyobo Co. pET-20b(⫹) vector and Escherichia coli strains BL21 (DE3) and JM 83 were from Novagene. Talon metal affinity resin was from Clontech. A phosphoinositide mixture (P 6023) was from Sigma. 2D-silver stain II kit was from Daiichi Pure Chemicals Co., BCA protein assay was from Pierce, prestained “broad range” SDS protein marker was from New England Biolabs. 45CaCl 2 at an activity of 28 GBq/mmol was from Izinta Ltd., Budapest.
1334
Vol. 280, No. 5, 2001
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 1. Domain III sequences and purification of recombinant proteins. (A) The sequence of domain III and the short flanking segments included in the expression constructs of rat - and m-calpain and Drosophila CALPB are aligned (the C-terminal His 6 tags are not shown). Domain boundaries are marked by vertical lines, the putative Ca 2⫹-binding acidic loop is boxed. Amino-acid similarity is marked by points and colons, identity is marked by asterisks. The numbering runs with the rat m-calpain construct, where the starting methionine corresponds to M 353 in the full-length large subunit. (B) SDS–PAGE of recombinant domain IIIs. Rat m-calpain domain III could not be purified and is used as is in SDS sample buffer. Domain III of rat -calpain and Drosophila CALPB were purified and renatured as given in the text. The proteins run at an apparent M w calculated from their position relative to prestained markers (theoretical M w in parentheses): rat , 19.6 (20.1); rat m, 20.8 (20.2); and CALPB, 20.3 (20.4).
RESULTS Cloning and Purification of Domain III of Rat - and m-Calpain and Drosophila CALPB The cDNA encoding for domain III with short flanking regions (Fig. 1A) of rat - and m-calpain and Drosophila CALPB have been cloned into the NdeI-XhoI sites of pET-20b(⫹) plasmid that fuses recombinant protein with a C-terminal His 6 tag. The proteins were expressed in BL21 (DE3) E. coli in very high yields, typically on the order of 5–10 mg in a 200 ml culture. Domain III invariably appeared in inclusion bodies and
efforts at obtaining it in the soluble fraction such as varying time of induction, temperature of culturing or IPTG concentration have all failed. Preparation of inclusion bodies, nevertheless, has yielded high quantities of rather pure protein. Domain III of rat m-calpain could not be solubilized from inclusion bodies in 8 M urea and was used without further purification (Fig. 1B). Domain III from rat -calpain and Drosophila calpain B readily dissolved in 8 M urea and could be purified by Talon metal affinity chromatography. Subsequent studies showed that even a very careful and slow removal of urea by
1335
Vol. 280, No. 5, 2001
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
CALPB) (Fig. 2C). No such facilitating effect is seen with domain IV, thus, in the presence of phospholipid, domain III binds much more Ca 2⫹ than domain IV. High ionic strength significantly diminishes Ca 2⫹ binding by domain III; it also counteracts the facilitating effect of phospholipids (Figs. 2D and 2E). Liposome Binding
FIG. 2. Overlay assay of Ca 2⫹ binding by domain III. 0.5–1.0 g of proteins was dotted on nitrocellulose and Ponceau Red-stained (A) or laid over with 45Ca 2⫹ under different conditions (B through E). The dots are: (1) calmodulin, (2) BSA, (3) human -calpain domain IV, (4) human m-calpain domain IV, (5) rat -calpain domain III, (6) rat m-calpain domain III, (7) Drosophila CALPB domain III. The conditions applied are: (B) buffer A, (C) buffer A ⫹ 50 g/ml phospholipid, (D) buffer A ⫹ 1.0 M NaCl (buffer D), (E) buffer D ⫹ 50 g/ml phospholipid.
dialysis causes domain III to precipitate and go completely into pellet upon centrifugation at 100,000g for 1 h. In pilot experiments in the presence of 2% polyethylene glycol, 5% glycerol and 0.65 or 1.15 M NaCl it was found that high ionic strength keeps some of domain III in solution upon removal of urea. Based on these findings a purification-renaturation scheme has been worked out in which the protein, dissolved in 8 M urea, was bound to Talon resin and urea concentration is reduced to zero by applying a slow descending urea gradient in the presence of 1.15 M NaCl. Domain III can be eluted from the column by 500 mM imidazole that is removed by dialysis. Domain III prepared this way is in the 100,000g 1-h supernatant (Fig. 1B) at a maximal concentration of about 0.5 mg/ml (Drosophila CALPB) and 0.1 mg/ml (rat -calpain). It is to be noted, though, that it is rather unstable even in this state, and tends to aggregate upon storage or any change in buffer composition. Preparations of similar quality and character could be obtained by separate purification and renaturation steps, i.e., by first applying metal affinity chromatography in the presence of 8 M urea and subsequent removal of urea by a stepwise dialysis (i.e., 6 – 4 –3–2–1– 0 M, data not shown).
Liposome binding of domain III of rat -calpain and Drosophila calpain B has been tested by size-exclusion chromatography applied in the spin column format. As MicroSpin S200 HR columns have been designed to fully remove small solutes from the sample, their bed size had to be reduced significantly to let some, but not all, of domain III through. This way the amount of domain III eluted is sensitive to binding to a liposome which is much larger in size and is thus diagnostic to domain III-liposome interaction. Figure 3 shows the evidence that domain III of both rat -calpain and Drosophila CALPB binds to liposomes. With rat domain III, very little of the protein elutes from the column under the given conditions; the amount significantly increases in the presence of liposomes. Furthermore, the binding appears to be sensitive to the presence of Ca 2⫹, as more protein elutes with liposomes in the presence than in the absence of Ca 2⫹. Drosophila CALPB domain III exhibits a qualitatively very similar behavior as its elution from the column is also significantly promoted by liposomes, with a marked facilitation by Ca 2⫹. BSA was also tested in this setup: its elution is insensitive to either liposomes or Ca 2⫹. The observed differences in the amount of protein eluting with liposomes in the absence and presence of Ca 2⫹ allows a quantitative measurement of the Ca 2⫹ sensitivity of liposome binding. Columns were equili-
Ca 2⫹ Overlay Assay Ca 2⫹ binding by an overlay technique was tested on dot-blots as all the proteins included in the assay are homogeneous by SDS–PAGE (cf. Fig. 1). Domain III from all three sources has a high capacity for binding Ca 2⫹ (Fig. 2B): it appears to bind at least as much Ca 2⫹ as domain IV. Furthermore, Ca 2⫹ binding by domain III is highly stimulated by phospholipids: in the presence of 50 g/ml phospholipid the amount of Ca 2⫹ bound under the given conditions increases 2- (rat calpain), 10- (rat m-calpain) and 5-fold (Drosophila
FIG. 3. Liposome binding by domain III. (A) Domain III of rat -calpain (0.05 mg/ml) and Drosophila CALPB (0.15 mg/ml) as well as BSA (0.1 mg/ml) was gel-filtered through a spin column of 170 l bed volume in 50 l. The eluate was collected and run on 15% SDS–PAGE. The bands are as follows: sample applied at column (1), eluate without liposomes (2), and eluate in the presence of 50 g/ml liposomes (3) plus 0.3 mM EDTA (4) or 2 mM Ca 2⫹ (5). (B) Band intensities were determined by densitometry and are shown for the various conditions from 1 through 5.
1336
Vol. 280, No. 5, 2001
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
DISCUSSION
FIG. 4. The effect of Ca 2⫹ on domain III–liposome interaction. (A) Domain III of rat -calpain and Drosophila CALPB were gel-filtered through a spin column as in Fig. 3 either without liposomes (1) or with 50 g/ml liposomes in the presence of 0.3 mM EDTA (2) or various free Ca 2⫹ concentrations (3 through 10) such as: 20, 50, 100, 200, 500, 1000, 2000, 4000 M. Samples passing through the column were run on 15% SDS–PAGE and silver-stained. (B) Band intensities were determined by densitometry and plotted against free Ca 2⫹ concentration for rat -calpain (F) and Drosophila CALPB (}). Open symbols stand for protein eluted without phospholipid. Data points represent averages of three separate experiments.
brated and domain III was eluted without or with liposomes at various Ca 2⫹ concentrations. The protein eluting was visualized by SDS–PAGE. Figure 4A shows the gel picture for both rat -calpain- and Drosophila CALPB domain III. Liposome binding is clearly promoted by Ca 2⫹ in a concentration-dependent manner: in both cases more protein eluted upon increasing the concentration of Ca 2⫹. Band intensities were determined by densitometry to quantitatively characterize this effect (Fig. 4B). With rat domain III phospholipid increases the amount of eluted protein by 40%; Ca 2⫹ adds a further 200% with a half-effective concentration around 900 M. In the case of Drosophila CALPB, phospholipid in itself has an effect of 60%; Ca 2⫹ stimulates this by a further 230%, with a halfeffective concentration of about 700 M.
The functional dissection of the structure of calpain has shown a significant disparity for many years. Since the determination of its complete amino-acid sequence, domain II of the large subunit is known to carry the residues responsible for catalytic activity whereas domain IV with its multiple EF-hand motifs is primarily responsible for regulation by Ca 2⫹ (11). The function of the other two domains, I and III, and of domain V within the small subunit has remained obscure despite much studies aimed at the structure-function relationship of calpain. The situation has significantly changed, however, with solving the X-ray structure of rat and human m-calpains to high resolution (12, 13). These structures show that domain III is engaged in extensive ionic interactions with all the other domains within the large subunit and thus seems to function as an organizing center of calpain. Possibly, alterations of these interactions determine domain movements—the closure of domain II in particular—and hence the mode of activation of the enzyme; a putative “electrostatic switch” mechanism to account for these regulatory molecular details has been put forward (13). Furthermore, the resemblance of domain III to C2 domains, Ca 2⫹and phospholipid-binding modules in many other enzymes (14, 18), suggests that it might be involved in orchestrating calpain activation by these activating factors. The results in this paper provide experimental support for most of these suggestions. Our difficulties at renaturing recombinant domain III underline that this domain is firmly integrated into the structural scaffold of the enzyme. Renaturation is only possible at high ionic strength (above 1 M NaCl), and conventional agents such as PEG and glycerol are of no help; even under these conditions domain III tends to aggregate. It is logical to assume that stripping this domain of its ionic interactions with other parts of the enzyme make it rather unstable and difficult to keep in solution: counter-ions provided by the salt are poor substitutes for the contacts within the native protein fold. Remarkably, domain III in this respect differs significantly from C2 domains which have been noted to be autonomous folding units, easy to study in isolation (14, 18). Ca 2⫹- and phospholipid binding by domain III, on the other hand, shows a remarkable functional analogy with C2 domains. For a quantitative characterization of the strength and stoichiometry of Ca 2⫹ binding, equilibrium dialysis would have been an ideal choice which, however, could not be carried out properly due to the inherent instability of recombinant domain III. Thus, Ca 2⫹ binding was demonstrated by an overlay with 45 Ca 2⫹; domain III from all three sources appears to bind more Ca 2⫹ than domain IV. This difference could be due to binding of multiple Ca 2⫹ ions to the acidic loop as suggested by the X-ray structure (13) and/or a
1337
Vol. 280, No. 5, 2001
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
tighter binding than by domain IV. Furthermore, unlike with domain IV, phospholipids promote Ca 2⫹ binding several fold which is very notable considering the known lipid activation of calpain that might narrow the gap between physiologic Ca 2⫹ signals and the Ca 2⫹ requirement of the enzyme observed in vitro (3, 4). The lipid mixture used in our studies contains 20 – 40% diand triphosphoinositides which are the most effective in calpain activation. If we assume that lipid activation of calpain is relayed by domain III, these earlier observations are in full agreement with the phospholipidfacilitated Ca 2⫹ binding to domain III. The demonstration of lipid binding by domain III is very much in line with these considerations. Although translocation to the membrane is a recurring theme in the models of calpain activation (5– 8), little is known about which part of the enzyme is actually involved. Some data imply a particular sequence within domain V of the small subunit (9, 10), but many aspects of lipid binding are still unclear. In light of our data, it is reasonable to assume that domain III is the primary lipid-binding site of the enzyme. Translocation of calpain to membranes is promoted by Ca 2⫹ (5, 6) which fits perfectly with our observation that Ca 2⫹ markedly facilitates the binding of domain III to liposomes. The observed low sensitivity of this facilitating effect to Ca 2⫹ may be irrelevant as Ca 2⫹ binding with renatured domain III is highly impaired by high ionic strength; this is evident from the difference in Ca 2⫹ binding observed at 1.15 vs 0.15 M NaCl in the overlay assay. Taking this fact into consideration, it is quite conceivable that the Ca 2⫹ concentration needed under isotonic conditions is well within the physiological range. The possible large capacity of domain III for Ca 2⫹ binding, however, is somewhat difficult to reconcile with earlier quantitative data concerning the stoichiometry of Ca 2⫹ binding to calpain. Heterodimeric -calpain was found to bind 4 (2 by each subunit (19, 20)) to 8 (4 by each subunit (21)) Ca 2⫹ ions, whereas m-calpain appears to bind 6 Ca 2⫹ ions (2 by the smalland 4 by the large subunit (19, 20)). X-ray crystallographic studies of domain VI show 3– 4 bound Ca 2⫹ depending on conditions (22, 23) and a similar number is likely to apply to domain IV. Accordingly, the total number of Ca 2⫹ ions that bind to calpain can be accounted for quite well by assuming binding to EF-hand motifs in domains IV and VI, as originally suggested (11); nevertheless, the contribution of domain III to the observed Ca 2⫹ binding cannot be excluded. To be compatible with all relevant data, it is most reasonable to assume that domain III binds Ca 2⫹ in the absence of phospholipids at a low (probably 1:1) stoichiometry, but in the presence of phospholipids a higher stoichiometry and/or stronger binding may occur. A further point to scrutinize is the possible role of Ca 2⫹ binding to domain III in the activation of calpain. A comparison of m-calpain structure determined in the
absence of Ca 2⫹ (12, 13) and the Ca 2⫹-bound structure of domain VI heterodimer (22, 23) reveals a rather minor conformational change within domain VI (and possibly domain IV) upon binding of Ca 2⫹. Given the spatial separation of domains IV–VI from domain II, it is hard to imagine how this small structural change is transduced into a relatively large-scale rearrangement at the active site, unless with the intervention of domain III. Thus, an active role of domain III has been suggested (13), which is fully compatible with Ca 2⫹ binding to this domain. On the other hand, the role of domain IV in the events leading to activation is unquestionable: recent detailed mutation studies have shown the essential function of EF-hands (24). It was found that the individual EF-hands each contributed to activation of calpain, and Ca 2⫹ binding to any one of them was sufficient to fully activate the enzyme. Furthermore, deletion of domain IV was found to yield an active, but Ca 2⫹-independent enzyme whereas excision of domain III leaves the enzyme with impaired activity but only slightly decreased Ca 2⫹ sensitivity (25). In contrast, we found in similar studies that the deletion of domain IV does not make calpain Ca 2⫹-independent (unpublished observations). Also, a chimeric form composed of domains I-III of -calpain and domain IV of m-calpain has a Ca 2⫹ sensitivity characteristic of -, and not of m-, calpain (25). Thus, a consensus has not yet been reached on how much domain III contributes to calpain’s activation by Ca 2⫹. Nevertheless, it seems likely that domain III somehow gates and amplifies the signal coming from domain IV; its role may be in the regulation of activity but also of lipid activation/ membrane translocation by Ca 2⫹. Strong Ca 2⫹ binding in this case would fit very nicely with an earlier hypothesis that regulation of various aspects of calpain action such as membrane binding, calpastatin inhibition, proteolytic activity and autolysis reflects specific responses to Ca 2⫹ binding at distinct sites on the molecule (7), the most sensitive being membrane anchoring of the enzyme. Taken all these considerations, it is warranted to propose that domain III is the major site of Ca 2⫹dependent lipid binding of calpain, in a way similar to other enzymes that achieve this goal via the structurally related C2 domains. Given its topology within the structure of the enzyme, it seems now evident that full understanding of calpain activation and action is not possible without a deeper insight into the function of this domain. ACKNOWLEDGMENTS P.T. acknowledges the support of the Hungarian Academy of Sciences-Japanese Society for the Promotion of Science (Project No. 27) and the Bolyai Ja´nos Scholarship. The work in Hungary was supported by Grants T 22069, T 29059, and T 32360 from OTKA and 98-45 3,3 from AKP.
1338
Vol. 280, No. 5, 2001
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
REFERENCES 1. Sorimachi, H., Ishiura, S., and Suzuki, K. (1997) Biochem. J. 328, 721–732. 2. Ono, Y., Sorimachi, H., and Suzuki, K. (1998) Biochem. Biophys. Res. Commun. 245, 289 –294. 3. Pontremoli, S., Melloni, E., Sparatore, B., Salamino, F., Michetti, M., Sacco, O., and Horecker, B. L. (1985) Biochem. Biophys. Res. Commun. 129, 389 –395. 4. Saido, T. C., Shibata, M., Takenawa, T., Murofushi, H., and Suzuki, K. (1992) J. Biol. Chem. 267, 24585–24590. 5. Molinari, M., Anagli, J., and Carafoli, E. (1994) J. Biol. Chem. 269, 27992–27995. 6. Michetti, M., Salamino, F., Tedesco, I., Averna, M., Minafra, R., Melloni, E., and Pontremoli, S. (1996) FEBS Lett. 392, 11–15. 7. Goll, D. E., Thompson, V. F., Taylor, R. G., and Zalewska, T. (1992) BioEssays 14, 549 –556. 8. Suzuki, K., and Sorimachi, H. (1998) FEBS Lett. 433, 1– 4. 9. Crawford, C., Brown, N. R., and Willis, A. C. (1990) Biochem. J. 265, 575–579. 10. Arthur, J. S., and Crawford, C. (1996) Biochim. Biophys. Acta 1293, 201–206. 11. Ohno, S., Emori, Y., Imajoh, S., Kawasaki, H., Kisaragi, M., and Suzuki, K. (1984) Nature 312, 566 –570. 12. Hosfield, C. M., Elce, J. S., Davies, P. L., and Jia, Z. (1999) EMBO J. 18, 6880 – 6889. 13. Strobl, S., Fernandez-Catalan, C., Braun, M., Huber, R., Ma-
14. 15. 16. 17. 18. 19. 20. 21. 22. 23.
24. 25.
1339
sumoto, H., Nakagawa, K., Irie, A., Sorimachi, H., Bourenkow, G., Bartunik, H., Suzuki, K., and Bode, W. (2000) Proc. Natl. Acad. Sci. USA 97, 588 –592. Rizo, J., and Sudhof, T. C. (1998) J. Biol. Chem. 273, 15879 – 15882. Hosfield, C. M., Moldoveanu, T., Davies, P. L., Elce, J. S., and Jia, Z. (2001) J. Biol. Chem., in press. Suo, S., Koike, H., Sorimachi, H., Ishiura, S., and Suzuki, K. (1999) Biochem. Biophys. Res. Commun. 257, 63– 66. Laemmli, U. K. (1970) Nature 227, 680 – 685. Nalefski, E. A., and Falke, J. J. (1996) Protein Sci. 5, 2375–2390. Minami, Y., Emori, Y., Kawasaki, H., and Suzuki, K. (1987) J. Biochem. (Tokyo) 101, 889 – 895. Zimmerman, U. J., and Schlaepfer, W. W. (1988) Arch. Biochem. Biophys. 266, 462– 469. Michetti, M., Salamino, F., Minafra, R., Melloni, E., and Pontremoli, S. (1997) Biochem. J. 325, 721–726. Blanchard, H., Grochulski, P., Li, Y., Arthur, J. S., Davies, P. L., Elce, J. S., and Cygler, M. (1997) Nat. Struct. Biol. 4, 532–538. Lin, G. D., Chattopadhyay, D., Maki, M., Wang, K. K., Carson, M., Jin, L., Yuen, P. W., Takano, E., Hatanaka, M., DeLucas, L. J., and Narayana, S. V. (1997) Nat. Struct. Biol. 4, 539 –547. Dutt, P., Arthur, J. S., Grochulski, P., Cygler, M., and Elce, J. S. (2000) Biochem. J. 348, 37– 43. Vilei, E. M., Calderara, S., Anagli, J., Berardi, S., Hitomi, K., Maki, M., and Carafoli, E. (1997) J. Biol. Chem. 272, 25802– 25808.