- Email: [email protected]
Dopaminergic receptor D5 mRNA expression is increased in circulating lymphocytes of Tourette syndrome patients
Available online at www.sciencedirect.com
JOURNAL OF PSYCHIATRIC RESEARCH
Journal of Psychiatric Research 43 (2009) 24–29
www.elsevier.com/locate/jpsychires
Dopaminergic receptor D5 mRNA expression is increased in circulating lymphocytes of Tourette syndrome patients Marco Ferrari a,1, Cristiano Termine b,c,1, Diego Franciotta d, Elisabetta Castiglioni b, Alessandra Pagani c, Giovanni Lanzi e, Franca Marino a, Sergio Lecchini a, Marco Cosentino a,*, Umberto Balottin c a
Department of Clinical Medicine, Section of Experimental and Clinical Pharmacology, University of Insubria, Via Ottorino Rossi n. 9, 21100 Varese VA, Italy b Child Neuropsychiatry Unit, Department of Clinical and Biological Sciences, University of Insubria and ‘Macchi Foundation’ Hospital, Varese, Italy c Department of Child Neurology and Psychiatry, IRCCS ‘‘C. Mondino’’, Pavia, Italy d Laboratory of Neuroimmunology, IRCCS Neurological Institute, ‘‘C. Mondino’’, University of Pavia, Pavia, Italy e Dosso Verde Institute and University of Pavia, Pavia, Italy Received 22 September 2007; received in revised form 12 January 2008; accepted 29 January 2008
Abstract Tourette syndrome (TS) is a neuropsychiatric disorder in which dopaminergic dysfunction and immune system abnormalities seem to coexist. Using real-time PCR, we determined mRNA expression of dopamine receptors (DRs) D1-5 in peripheral blood lymphocytes (PBLs) from 15 TS patients and 15 sex- and age-matched healthy controls (HCs). DRD5 mRNA levels in cells from TS were higher than in cells from HCs. In TS patients with obsessive–compulsive disorder, DRD5 mRNA levels in PBLs showed a highly positive correlation with the severity of compulsive symptoms. DRD5 mRNA upregulation in PBLs from TS patients may represent a peripheral marker of dopaminergic dysfunction and supports the involvement of the immune system in TS. Ó 2008 Elsevier Ltd. All rights reserved. Keywords: Tourette syndrome; Dopamine receptors; Peripheral blood lymphocytes; Real-time PCR; Peripheral marker
1. Introduction Tourette syndrome (TS) is a neuropsychiatric disorder characterized by multiple motor tics plus one or more vocal tics (DSM-IV), high prevalence of obsessive–compulsive disorder (OCD) (Carter et al., 1994; Kurlan et al., 2002; Termine et al., 2006) and of attention-deficit hyperactivity disorder (ADHD) (Carter et al., 1994; Spencer et al., 2001). Genetic factors, perinatal injuries, psychological factors and organic substrate involving neural basal ganglia are supposed to play a role in TS aetio-pathogenesis (Albin and Mink, 2006). *
1
Corresponding author. Tel.: +39 0332 217410; fax: +39 0332 217409. E-mail address: [email protected] (M. Cosentino). The first two authors contributed equally to the study.
0022-3956/$ - see front matter Ó 2008 Elsevier Ltd. All rights reserved. doi:10.1016/j.jpsychires.2008.01.014
Dopamine is one of the main neurotransmitters in the central nervous system (CNS), where it plays a critical role in motor control and cognitive function through its interactions with dopaminergic receptors (DRs) D1 to 5. The involvement of dopaminergic circuits in TS is supported by: (a) the beneficial effect of DR antagonists on tics (Fitzgerald et al., 2000), (b) the worsening of symptoms induced by direct and indirect dopaminergic agents (Bruggeman et al., 2001), and (c) the increased number of neuronal dopamine uptake sites and DRD2 in TS patients’ brain, in both caudate nucleus (Wong et al., 1997; Black et al., 1997; Singer et al., 2002) and prefrontal cortex (Minzer et al., 2004). Based upon these findings, the ‘dopaminergic theory’ of TS assumes the occurrence of a disruption (hyperactivity) of central dopaminergic circuits (Albin and Mink, 2006).
M. Ferrari et al. / Journal of Psychiatric Research 43 (2009) 24–29
DRs are also expressed on human peripheral blood lymphocytes (PBLs) (see e.g. McKenna et al., 2002), where they may be dysregulated in different neuropsychiatric disorders involving CNS dopaminergic circuits, e.g. schizophrenia, Alzheimer’s disease, Parkinson’s disease and major depression (Nagai et al., 1996; Barbanti et al., 2000; Ilani et al., 2001; Rocca et al., 2002). Since no information exists on DR expression in PBLs in TS, the aim of the present study was to compare DR mRNA expression in PBLs from healthy subjects and TS patients, and to assess in cells from TS patients the possible association between DR mRNA expression and the main TS comorbidities. 2. Patients and methods 2.1. Patients We recruited 15 children and adolescents with TS (diagnosed according to the DSM-IV criteria) and 15 matched controls (HCs) (Table 1). The protocol was conducted according to the principles stated in the Declaration of Helsinky (www.wma.net/e/policy/b3.htm) and was approved by the Ethics Committee of the Neurological Institute ‘‘Casimiro Mondino” of Pavia. After complete description of the study, written informed consent was obtained from parents. CRS-R:L (Conners, 1997) and CBCL (Achenbach, 1991) were used to diagnose ADHD and OCD. Tics and OCD severity were assessed by the Yale-Global Tic Severity Scale (Y-GTSS) (Leckman et al., 1989) and the Children’s Yale-Brown Obsessive Compulsive Scale (CYBOCS) (Scahill et al., 1997). Patients and controls were drug free for at least 3 months before the recruitment, with the exception of five TS patients on neuroleptics alone (2), SSRIs alone (2) or neuroleptics with SSRIs (1). 2.2. PBL separation and DR mRNA quantification by RealTime PCR All subjects participating in the study underwent a 3 mL venous blood sampling, between 9 and 10 a.m., after an overnight fasting. PBLs were separated by standard density-gradient centrifugation and 1 106 cells were resuspended in Perfect RNA lysis buffer (Eppendorf, Hamburg, Germany). Total mRNA was extracted with
Table 1 Demographic and clinical characteristics of Tourette syndrome (TS) patients and healthy controls (HCs)
Age (years, mean ± SD) Gender (male:female) Pure TS TS + ADHD TS + OCD TS + ADHD + OCD
TS patients
HCs
12.6 ± 0.2 11:4 3 2 6 4
12.5 ± 0.2 11:4 n.a. n.a. n.a. n.a.
ADHD = Attention-Deficit Hyperactivity Disorder; OCD = Obsessive Compulsive Disorder; n.a. = not applicable.
25
Perfect RNA Eukaryotic Mini kit (Eppendorf), quantitated by spectrophotometry at 260 nm, and reverse transcribed using the High-capacity cDNA Archive Kit (Applied Biosystems, Foster City, USA). DR mRNA was analysed by use of an ABI Prism 7700 and FAM dye-labeled TaqMan MGB probes (Applied Biosystems). Primers were designed using Primer express 2.0 (Applied Biosystems) and gene sequence data obtained from the Reference Sequence collection (RefSeq; www.ncbi.nlm. nih.gov/projects/RefSeq). Primers, probes, melting points and amplicon lengths are shown in Table 2. Human brain was used as positive control and Saccharomyces cerevisiae was used as negative control. Linearity of real-time PCR assays was tested by constructing standard curves by use of serial twofold dilutions of a human brain cDNA and regression coefficients (r2) were always > 0.900 (data not shown). Expression data were obtained from Ct values. DR mRNA levels (Ct1) were normalized to 18s rRNA (Ct2) and expressed as 2 DCt, where DCt = Ct1–Ct2. 2.3. Statistical analysis Data are presented as means ± SD. Statistical significance of the between-group differences was assessed by two-tailed Mann–Whitney test. Regression analysis was used for correlations. Calculations were performed using a commercial software (GraphPad Prism version 4.00 for Windows, GraphPad Software, San Diego, CA, USA, www.graphpad.com). 3. Results In agreement with previous observations (Ricci et al., 1999; Cosentino et al., 2007), PBLs expressed detectable levels of mRNA for DRD2–5, but not for DRD1. DRD2, 3 and 4 mRNA expression did not differ in cells from HCs and TS patients. On the contrary, DRD5 mRNA levels were significantly higher in cells from TS patients than from HCs (Fig. 1). No differences in DR mRNA expression were found when subgrouping TS patients according to the presence of ADHD and/or OCD (Table 3), or to the administration of drugs (Table 4). No correlation was found between tic severity, age/gender and DR expression (not shown), however compulsion severity showed a highly positive correlation with DRD5 mRNA expression (Fig. 2). 4. Discussion The main finding of our study is the upregulation of DRD5 mRNA expression in PBLs from TS patients in comparison with HCs, and its correlation with the severity of compulsion in TS patients with OCD. It has been suggested that DRs in PBLs may reflect corresponding DRs in the brain (Nagai et al., 1996; Ilani et al., 2001). Indeed, in TS a defect in CNS dopaminergic systems
26
M. Ferrari et al. / Journal of Psychiatric Research 43 (2009) 24–29
Table 2 Real-time PCR conditions Gene
Primer sequence
Probe sequence
Annealing temperature (°C)
Amplicon length (bp)
RefSeq code
DRD1
Forward CCCAGCGAAGTCCACATTCC Reverse TGACAGGAGATTCTCCCCTTCTGA
ACCCCAAGGCAAGGCGTTTGG
60
151
NM 000794.3
DRD2
Forward GCTGTGTCCCGCGAGAAG Reverse ACAGTGAATCCTGCTGAATTTCC
GTCTACCTGGAGGTGGTAGGT
59
150
NM 000795.2
DRD3
Forward AGAACAGTCAGTGCAACAGTGTCA Reverse GTAGTAACGCTTCAGCTCCAGATG
CCCCAACAAACCCTCTCCTCC
59
89
U32499.1
DRD4
forward TGGTGCTGCCGCTCTTC Reverse GAACCTGTCCACGCTGATG
CTACTCCGAGGTCCAGGGTGG
58
100
NM 000797.2
DRD5
Forward CTCCAGCCTGAATGCAACCTA Reverse GCGGTAGATGCGCGTGTAG
CTTCCTCGCTCATCAGCCTTCT
59
97
NM 000798.3
18s RNA
Forward TGAGTCCACTTTAAATCCTTTAACGA Reverse CGCTATTGGAGCTGGAATTACC
AGGGCAAGTCTGGTGCCAGCA
59
85
X03205
has been hypothesized as the etiological defect (Albin and Mink, 2006), however available evidence points to a preferential involvement of the inhibitory D2-like subclass, which includes the DRD2, DRD3, and DRD4 subtypes, rather than the D1-like subclass (including DRD1 and DRD5 subtypes), inasmuch as DR antagonists beneficial for tics act mainly on D2-like DRs (Fitzgerald et al., 2000), and upregulation of DRD2 (but not of other DR subtypes) has been reported in the brain of TS subjects (Wong et al., 1997; Singer et al., 2002). Moreover, the DRD5 gene locus has been studied in TS families, without finding any genetic linkage (Barr et al., 1997). Our results thus suggest that DRs on PBLs do not necessarily mirror central DRs, at least in TS. The present results of course do not exclude that dysregulation of DRs of the D2-like subclass may occur in TS. Rather, they point to an involvement of the D1-like subclass and in particular of the DRD5 subtype. In particular, the strong correlation between DRD5 mRNA expression and compulsion severity merits consideration. DRD5 are involved in anti-oxidant and anti-hypertensive responses (Yang et al., 2006), and in the modulation of hippocampal ACh release (Hersi et al., 2000), although the behavioral relevance of the latter finding remains to be established. In any case, the therapeutic efficacy of DR antagonists, which are used for tics, correlates with the affinity for DRD2, but not DRD5. Nevertheless, in animal models (a) the D1-like subclass in the prefrontal cortex is critically involved in cocaine-seeking behavior (reviewed in Rebec
and Sun, 2005), and (b) D1-like agonists seem to potentiate grooming chains (super-stereotypy), which are considered to be analogous to complex tics or OCDs (Berridge et al., 2005), an observation which seems to agree with our findings regarding the correlation between DRD5 mRNA expression and compulsion severity. DRs expressed on immune cells mediate the immunomodulating effects of dopamine (reviewed in Basu and
Fig. 1. DR mRNA expression levels in PBLs from healthy controls (empty boxes) and TS patients (hatched boxes). Median values (horizontal bars), 25th–75th percentiles (boxes), and highest and lowest values are shown. n.d. = not detected.
M. Ferrari et al. / Journal of Psychiatric Research 43 (2009) 24–29
27
Table 3 DR mRNA expression levels in PBLs from Tourette syndrome (TS) patients, without (pure) or with obsessive–compulsive disorder (OCD), attentiondeficit hyperactivity disorder (ADHD), or both
Pure TS (3) TS + OCD (6) TS + ADHD (2) TS + OCD + ADHD (4)
DRD1
DRD2
DRD3
DRD4
DRD5
n.d. n.d. n.d. n.d.
2.13 ± 1.98 1.62 ± 1.96 0.10 ± 0.01 2.38 ± 2.13
0.24 ± 0.15 0.30 ± 0.34 0.10 ± 0.09 0.55 ± 0.85
0.36 ± 0.38 0.59 ± 1.06 0.11 ± 0.01 0.16 ± 0.03
4.07 ± 0.55 5.25 ± 0.67 6.40 ± 0.60 5.03 ± 0.50
Data are means ± SD. Numbers in parentheses indicate subjects in each group. n.d. = not detected.
Table 4 DR mRNA expression levels in PBLs from TS patients without or with drug treatments
No drugs (10) On drugs (5) NLs only (2) SSRIs only (2) NLs + SSRIs (1)
DRD1
DRD2
DRD3
DRD4
DRD5
n.d. n.d. n.d. n.d. n.d.
1.38 ± 1.73 2.41 ± 2.10 2.90 ± 3.68 2.67 ± 1.12 0.91
0.40 ± 0.57 0.18 ± 0.05 0.13 ± 0.00 0.21 ± 0.04 0.21
0.14 ± 0.09 0.79 ± 1.12 0.13 ± 0.02 0.49 ± 0.44 2.73
5.35 ± 0.77 4.61 ± 0.93 4.76 ± 1.78 4.43 ± 0.46 4.66
Data are means ± SD. Numbers in parentheses indicate subjects in each group. NLs = neuroleptics; SSRIs = selective serotonin reuptake inhibitors; n.d. = not detected.
Dasgupta, 2000), and interestingly in TS subjects immune abnormalities have been reported, such as increased circulating B lymphocytes (Weisz et al., 2004), overexpressed natural killer cell genes (Lit et al., 2007), and decreased CD4+CD25+ regulatory T cells (Kawikova et al., 2007), a specialized subset of T lymphocytes which play a crucial role in immune homeostasis by suppressing the activity of CD4+ T lymphocytes (Sakaguchi, 2004). We recently showed that activation of DRD5 by endogenous dopamine results in profound reduction of the function of human CD4+CD25+ regulatory T cells (Cosentino et al., 2007), thus the present finding concerning overexpressed DRD5 in PBLs seems in line with the reported reduction of
Fig. 2. Correlation between DRD5 mRNA expression in PBLs and compulsion severity (assessed by CY-BOCS) in TS patients. One patient was missed at the evaluation.
CD4+CD25+ regulatory T cells in TS (Kawikova et al., 2007). Decreased frequency and activity of CD4+CD25+ regulatory T lymphocytes is a common finding in autoimmune diseases (see e.g. Levings et al., 2006), and autoimmune mechanisms have been suggested to represent a common trigger for both TS and the TS-related Paediatric Autoimmune Neuropsychiatric Disorders Associated with Streptococcal infections (PANDAS) (Swedo et al., 1998; Tucker et al., 1996). In conclusion, our findings regarding overexpression of DRD5 mRNA in PBLs of TS patients add to current knowledge regarding immune dysregulation in TS, and give further support to the hypothesis of the occurrence an autoimmune ‘‘trait” in the syndrome. Whether upegulation of DRD5 mRNA levels is exclusively related to TS or is also affected by the presence of ADHD and/ or OCD warrants further investigation, also in view of the high prevalence of such comorbidities in these patients. Nonetheless, the present results give further support to the hypothesis that in TS a link occurs between immune dysregulation and neuropsychiatric disturbances. At least in animal models evidence exists that T lymphocytes in the CNS are essential for neural development, maintenance and repair, under the control of CD4+CD25+ regulatory T cells (Kipnis et al., 2004 and 2005). Further studies are warranted to establish the clinical implications of such basic findings, we propose however, at least as a working hypothesis, that the occurrence of immunological abnormalities in neuropsychiatric disorders such as TS may indicate the involvement of neuroimmunologic mechanisms in the pathogenesis of the disturbances: in the future, clarification of such issue could allow better understanding of disease pathophysiology and possibly also offer novel clues for more effective therapeutic interventions.
28
M. Ferrari et al. / Journal of Psychiatric Research 43 (2009) 24–29
Conflict of Interest The authors declare no competing interests. Contributors M.F., C.T., U.B. and M.C. designed the study; C.T., E.C., A.P. and G.L. were in charge of the patient recruitment and evaluation; C.T. and M.F. collected, prepared and analyzed the samples; D.F., M.F., C.T. and M.C. performed the statistical analysis of the data; D.F., M.F., C.T., F.M., S.L., U.B. and M.C. contributed to the interpretation and discussion of results; M.F., C.T., D.F. and M.C. wrote the paper, and all the authors revised and finally approved the manuscript. Role of funding source The study was supported by a grant from the University of Insubria (FAR 2006) to MC. The University of Insubria had no further role in study design; in the collection, analysis and interpretation of data; in the writing of the report; and in the decision to submit the paper for publication. Acknowledgement The helpful assistance of Dr. Marta Monti in performing some of the assays is gratefully acknowledged. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.jpsychires. 2008.01.014. References Achenbach TM. Manual for the Child Behavior Checklist/4–18 and Profile. Burlington, VT: University of Vermont, Department of Psychiatry; 1991. Albin RL, Mink JW. Recent advances in tourette syndrome research. Trends in Neurosciences 2006;29:175–82. Barbanti P, Fabbrini G, Ricci A, Bruno G, Cerbo R, Bronzetti E, et al. Reduced density of dopamine D2-like receptors on peripheral blood lymphocytes in Alzheimer’s disease. Mechanisms of Ageing and Development 2000;120:65–75. Barr CL, Wigg KG, Zovko E, Sandor P, Tsui L-C. Linkage study of the dopamine D5 receptor gene and Gilles de la tourette syndrome. American Journal of Medical Genetics 1997;74:58–61. Basu S, Dasgupta PS. Dopamine, a neurotransmitter, influences the immune system. Journal of Neuroimmunology 2000;102:113–24. Berridge KC, Aldridge JW, Houchard KR, Zhuang X. Sequential superstereotypy of an instinctive fixed action pattern in hyper-dopaminergic mutant mice: a model of obsessive compulsive disorder and tourette’s. BMC Biology 2005;3:4. Black KJ, Gado MH, Perlmutter JS. PET measurement of dopamine D2 receptor-mediated changes in striatopallidal function. Journal of Neuroscience 1997;17:3168–77. Bruggeman R, van der Linden C, Buitelaar JK, Gericke GS, Hawkridge SM, Temlett JA. Risperidone versus pimozide in tourette’s disorder: a
comparative double-blind parallel-group study. Journal of Clinical Psychiatry 2001;62:50–6. Carter AS, Pauls DL, Leckman JF, Cohen DJ. A prospective longitudinal study of Gilles de la tourette’s syndrome. Journal of American Academy of Child and Adolescent Psychiatry 1994;33:377–85. Conners CK. Conners’ rating scales-revised (CRS-R). Technical manual. New York: MHS Ed; 1997. Cosentino M, Fietta AM, Ferrari M, Rasini E, Bombelli R, Carcano E, et al. Human CD4+CD25+ regulatory T cells selectively express tyrosine hydroxylase and contain endogenous catecholamines subserving an autocrine/paracrine inhibitory functional loop. Blood 2007;109:632–42. Fitzgerald PB, Kapur S, Remington G, Roy P, Zipursky RB. Predicting haloperidol occupancy of central dopamine D2 receptors from plasma levels. Psychopharmacology 2000;149:1–5. Hersi AI, Kitaichi K, Srivastava LK, Gaudreau P, Quirion R. Dopamine D-5 receptor modulates hippocampal acetylcholine release. Brain Research. Molecular Brain Research 2000;76:336–40. Ilani T, Ben-Shachar D, Strous RD, Mazor M, Sheinkman A, Kotler M, et al. A peripheral marker for schizophrenia: increased levels of D3 dopamine receptor mRNA in blood lymphocytes. Proceedings of National Academy Sciences of the United States of America 2001;98:625–8. Kawikova I, Leckman JF, Kronig H, Katsovich L, Bessen DE, Ghebremichael M, et al. Decreased numbers of regulatory T cells suggest impaired immune tolerance in children with tourette syndrome: a preliminary study. Biological Psychiatry 2007;61:273–8. Kipnis J, Cohen H, Cardon M, Ziv Y, Schwartz M. T cell deficiency leads to cognitive dysfunction: implications for therapeutic vaccination for schizophrenia and other psychiatric conditions. Proceedings of the National Academy of Sciences of the United States of America 2004;101:8180–5. Kipnis J, Schwartz M. Controlled autoimmunity in CNS maintenance and repair: naturally occurring CD4+CD25+ regulatory T-cells at the crossroads of health and disease. Neuromolecular Medicine 2005;7:197–206. Kurlan R, Como PG, Miller B, Palumbo D, Deeley C, Andresen EM, et al. The behavioral spectrum of tic disorders: a community-based study. Neurology 2002;59:414–20. Leckman JF, Riddle MA, Hardin MT, Ort SI, Swartz KL, Stevenson J, et al. The Yale Global Tic Severity Scale: initial testing of a clinicianrated scale of tic severity. Journal of the American Academy of Child and Adolescent Psychiatry 1989;28:566–73. Levings MK, Allan S, d’Hennezel E, Piccirillo CA. Functional dynamics of naturally occurring regulatory T cells in health and autoimmunity. Advances in Immunology 2006;92:119–55. Lit L, Gilbert DL, Walker W, Sharp FR. A subgroup of tourette’s patients overexpress specific natural killer cell genes in blood: a preliminary report. American Journal of Medicine Genetics Part B: Neuropsychiatric Genetics 2007;144:958–63. McKenna F, McLaughlin PJ, Lewis BJ, Sibbring GC, Cummerson JA, Bowen-Jones D, et al. Dopamine receptor expression on human T- and B-lymphocytes, monocytes, neutrophils, eosinophils and NK cells: a flow cytometric study. Journal of Neuroimmunology 2002;132:34–40. Minzer K, Lee O, Hong JJ, Singer HS. Increased prefrontal D2 protein in tourette syndrome: a postmortem analysis of frontal cortex and striatum. Journal of Neurological Science 2004;219:55–61. Nagai Y, Ueno S, Saeki Y, Soga F, Hirano M, Yanagihara T. Decrease of the D3 dopamine receptor mRNA expression in lymphocytes from patients with Parkinson’s disease. Neurology 1996;46:791–5. Rebec GV, Sun W. Neuronal substrates of relapse to cocaine-seeking behavior: role of prefrontal cortex. Journal of the Experimental Analysis of Behavior 2005;84:653–66. Ricci A, Bronzetti E, Mignini F, Tayebati SK, Zaccheo D, Amenta F. dopamine D1-like receptor subtypes in human peripheral blood lymphocytes. Journal of Neuroimmunology 1999;96:234–40. Rocca P, De Leo C, Eva C, Marchiaro L, Milani AM, Musso R, et al. Decrease of the D4 dopamine receptor messenger RNA expression in
M. Ferrari et al. / Journal of Psychiatric Research 43 (2009) 24–29 lymphocytes from patients with major depression. Progress in Neuropsychopharmacology and Biological Psychiatry 2006;26:1155–60. Sakaguchi S. Naturally arising CD4+ regulatory t cells for immunologic self-tolerance and negative control of immune responses. Annual Review of Immunology 2004;22:531–62. Scahill L, Riddle MA, McSwiggin-Hardin M, Ort SI, King RA, Goodman WK, et al. Children’s yale-brown obsessive compulsive scale: reliability and validity. Journal of American Academy of Child and Adolescent Psychiatry 1997;36:844–52. Singer HS, Szymanski S, Giuliano J, Yokoi F, Dogan AS, Brasic JR, et al. Elevated intrasynaptic dopamine release in tourette’s syndrome measured by PET. American Journal of Psychiatry 2002;159:1329–36. Spencer T, Biederman J, Coffey B, Geller D, Faraone S, Wilens T. Tourette disorder and ADHD. Advances in Neurology 2001;85:57–77. Swedo SE, Leonard HL, Garvey M, Mittleman B, Allen AJ, Perlmutter S. Pediatric autoimmune neuropsychiatric disorders associated with streptococcal infections: Clinical description of the first 50 cases. American Journal of Psychiatry 1998;155:264–71.
29
Termine C, Balottin U, Rossi G, Maisano F, Salini S, Di Nardo R, et al. Psychopathology in children and adolescents with tourette’s syndrome: a controlled study. Brain and Development 2006;2:69–75. Tucker DM, Leckman JF, Scahill L, Wilf GE, LaCamera R, Cardona L, et al. A putative poststreptococcal case of OCD with chronic tic disorder, not otherwise specified. Journal of American Academy of Child and Adolescent Psychiatry 1996;35:1684–91. Weisz JL, McMahon WM, Moore JC, Augustine NH, Bohnsack JF, Bale JF, et al. D8/17 and CD19 expression on lymphocytes of patients with acute rheumatic fever and tourette’s disorder. Clinical and Diagnostic Laboratory Immunology 2004;11:330–6. Wong DF, Singer HS, Brandt J, Shaya E, Chen C, Brown J, et al. D2-like dopamine receptor density in tourette syndrome measured by PET. Journal of Nuclear Medicine 1997;38:1243–7. Yang Z, Asico LD, Yu P, Wang Z, Jones JE, Escano CS, et al. D5 dopamine receptor regulation of reactive oxygen species production, NADPH oxidase, and blood pressure. American Journal of Physiology-regulatory Integrative and Comparative Physiology 2006;290:R96–R104.
JOURNAL OF PSYCHIATRIC RESEARCH
Journal of Psychiatric Research 43 (2009) 24–29
www.elsevier.com/locate/jpsychires
Dopaminergic receptor D5 mRNA expression is increased in circulating lymphocytes of Tourette syndrome patients Marco Ferrari a,1, Cristiano Termine b,c,1, Diego Franciotta d, Elisabetta Castiglioni b, Alessandra Pagani c, Giovanni Lanzi e, Franca Marino a, Sergio Lecchini a, Marco Cosentino a,*, Umberto Balottin c a
Department of Clinical Medicine, Section of Experimental and Clinical Pharmacology, University of Insubria, Via Ottorino Rossi n. 9, 21100 Varese VA, Italy b Child Neuropsychiatry Unit, Department of Clinical and Biological Sciences, University of Insubria and ‘Macchi Foundation’ Hospital, Varese, Italy c Department of Child Neurology and Psychiatry, IRCCS ‘‘C. Mondino’’, Pavia, Italy d Laboratory of Neuroimmunology, IRCCS Neurological Institute, ‘‘C. Mondino’’, University of Pavia, Pavia, Italy e Dosso Verde Institute and University of Pavia, Pavia, Italy Received 22 September 2007; received in revised form 12 January 2008; accepted 29 January 2008
Abstract Tourette syndrome (TS) is a neuropsychiatric disorder in which dopaminergic dysfunction and immune system abnormalities seem to coexist. Using real-time PCR, we determined mRNA expression of dopamine receptors (DRs) D1-5 in peripheral blood lymphocytes (PBLs) from 15 TS patients and 15 sex- and age-matched healthy controls (HCs). DRD5 mRNA levels in cells from TS were higher than in cells from HCs. In TS patients with obsessive–compulsive disorder, DRD5 mRNA levels in PBLs showed a highly positive correlation with the severity of compulsive symptoms. DRD5 mRNA upregulation in PBLs from TS patients may represent a peripheral marker of dopaminergic dysfunction and supports the involvement of the immune system in TS. Ó 2008 Elsevier Ltd. All rights reserved. Keywords: Tourette syndrome; Dopamine receptors; Peripheral blood lymphocytes; Real-time PCR; Peripheral marker
1. Introduction Tourette syndrome (TS) is a neuropsychiatric disorder characterized by multiple motor tics plus one or more vocal tics (DSM-IV), high prevalence of obsessive–compulsive disorder (OCD) (Carter et al., 1994; Kurlan et al., 2002; Termine et al., 2006) and of attention-deficit hyperactivity disorder (ADHD) (Carter et al., 1994; Spencer et al., 2001). Genetic factors, perinatal injuries, psychological factors and organic substrate involving neural basal ganglia are supposed to play a role in TS aetio-pathogenesis (Albin and Mink, 2006). *
1
Corresponding author. Tel.: +39 0332 217410; fax: +39 0332 217409. E-mail address: [email protected] (M. Cosentino). The first two authors contributed equally to the study.
0022-3956/$ - see front matter Ó 2008 Elsevier Ltd. All rights reserved. doi:10.1016/j.jpsychires.2008.01.014
Dopamine is one of the main neurotransmitters in the central nervous system (CNS), where it plays a critical role in motor control and cognitive function through its interactions with dopaminergic receptors (DRs) D1 to 5. The involvement of dopaminergic circuits in TS is supported by: (a) the beneficial effect of DR antagonists on tics (Fitzgerald et al., 2000), (b) the worsening of symptoms induced by direct and indirect dopaminergic agents (Bruggeman et al., 2001), and (c) the increased number of neuronal dopamine uptake sites and DRD2 in TS patients’ brain, in both caudate nucleus (Wong et al., 1997; Black et al., 1997; Singer et al., 2002) and prefrontal cortex (Minzer et al., 2004). Based upon these findings, the ‘dopaminergic theory’ of TS assumes the occurrence of a disruption (hyperactivity) of central dopaminergic circuits (Albin and Mink, 2006).
M. Ferrari et al. / Journal of Psychiatric Research 43 (2009) 24–29
DRs are also expressed on human peripheral blood lymphocytes (PBLs) (see e.g. McKenna et al., 2002), where they may be dysregulated in different neuropsychiatric disorders involving CNS dopaminergic circuits, e.g. schizophrenia, Alzheimer’s disease, Parkinson’s disease and major depression (Nagai et al., 1996; Barbanti et al., 2000; Ilani et al., 2001; Rocca et al., 2002). Since no information exists on DR expression in PBLs in TS, the aim of the present study was to compare DR mRNA expression in PBLs from healthy subjects and TS patients, and to assess in cells from TS patients the possible association between DR mRNA expression and the main TS comorbidities. 2. Patients and methods 2.1. Patients We recruited 15 children and adolescents with TS (diagnosed according to the DSM-IV criteria) and 15 matched controls (HCs) (Table 1). The protocol was conducted according to the principles stated in the Declaration of Helsinky (www.wma.net/e/policy/b3.htm) and was approved by the Ethics Committee of the Neurological Institute ‘‘Casimiro Mondino” of Pavia. After complete description of the study, written informed consent was obtained from parents. CRS-R:L (Conners, 1997) and CBCL (Achenbach, 1991) were used to diagnose ADHD and OCD. Tics and OCD severity were assessed by the Yale-Global Tic Severity Scale (Y-GTSS) (Leckman et al., 1989) and the Children’s Yale-Brown Obsessive Compulsive Scale (CYBOCS) (Scahill et al., 1997). Patients and controls were drug free for at least 3 months before the recruitment, with the exception of five TS patients on neuroleptics alone (2), SSRIs alone (2) or neuroleptics with SSRIs (1). 2.2. PBL separation and DR mRNA quantification by RealTime PCR All subjects participating in the study underwent a 3 mL venous blood sampling, between 9 and 10 a.m., after an overnight fasting. PBLs were separated by standard density-gradient centrifugation and 1 106 cells were resuspended in Perfect RNA lysis buffer (Eppendorf, Hamburg, Germany). Total mRNA was extracted with
Table 1 Demographic and clinical characteristics of Tourette syndrome (TS) patients and healthy controls (HCs)
Age (years, mean ± SD) Gender (male:female) Pure TS TS + ADHD TS + OCD TS + ADHD + OCD
TS patients
HCs
12.6 ± 0.2 11:4 3 2 6 4
12.5 ± 0.2 11:4 n.a. n.a. n.a. n.a.
ADHD = Attention-Deficit Hyperactivity Disorder; OCD = Obsessive Compulsive Disorder; n.a. = not applicable.
25
Perfect RNA Eukaryotic Mini kit (Eppendorf), quantitated by spectrophotometry at 260 nm, and reverse transcribed using the High-capacity cDNA Archive Kit (Applied Biosystems, Foster City, USA). DR mRNA was analysed by use of an ABI Prism 7700 and FAM dye-labeled TaqMan MGB probes (Applied Biosystems). Primers were designed using Primer express 2.0 (Applied Biosystems) and gene sequence data obtained from the Reference Sequence collection (RefSeq; www.ncbi.nlm. nih.gov/projects/RefSeq). Primers, probes, melting points and amplicon lengths are shown in Table 2. Human brain was used as positive control and Saccharomyces cerevisiae was used as negative control. Linearity of real-time PCR assays was tested by constructing standard curves by use of serial twofold dilutions of a human brain cDNA and regression coefficients (r2) were always > 0.900 (data not shown). Expression data were obtained from Ct values. DR mRNA levels (Ct1) were normalized to 18s rRNA (Ct2) and expressed as 2 DCt, where DCt = Ct1–Ct2. 2.3. Statistical analysis Data are presented as means ± SD. Statistical significance of the between-group differences was assessed by two-tailed Mann–Whitney test. Regression analysis was used for correlations. Calculations were performed using a commercial software (GraphPad Prism version 4.00 for Windows, GraphPad Software, San Diego, CA, USA, www.graphpad.com). 3. Results In agreement with previous observations (Ricci et al., 1999; Cosentino et al., 2007), PBLs expressed detectable levels of mRNA for DRD2–5, but not for DRD1. DRD2, 3 and 4 mRNA expression did not differ in cells from HCs and TS patients. On the contrary, DRD5 mRNA levels were significantly higher in cells from TS patients than from HCs (Fig. 1). No differences in DR mRNA expression were found when subgrouping TS patients according to the presence of ADHD and/or OCD (Table 3), or to the administration of drugs (Table 4). No correlation was found between tic severity, age/gender and DR expression (not shown), however compulsion severity showed a highly positive correlation with DRD5 mRNA expression (Fig. 2). 4. Discussion The main finding of our study is the upregulation of DRD5 mRNA expression in PBLs from TS patients in comparison with HCs, and its correlation with the severity of compulsion in TS patients with OCD. It has been suggested that DRs in PBLs may reflect corresponding DRs in the brain (Nagai et al., 1996; Ilani et al., 2001). Indeed, in TS a defect in CNS dopaminergic systems
26
M. Ferrari et al. / Journal of Psychiatric Research 43 (2009) 24–29
Table 2 Real-time PCR conditions Gene
Primer sequence
Probe sequence
Annealing temperature (°C)
Amplicon length (bp)
RefSeq code
DRD1
Forward CCCAGCGAAGTCCACATTCC Reverse TGACAGGAGATTCTCCCCTTCTGA
ACCCCAAGGCAAGGCGTTTGG
60
151
NM 000794.3
DRD2
Forward GCTGTGTCCCGCGAGAAG Reverse ACAGTGAATCCTGCTGAATTTCC
GTCTACCTGGAGGTGGTAGGT
59
150
NM 000795.2
DRD3
Forward AGAACAGTCAGTGCAACAGTGTCA Reverse GTAGTAACGCTTCAGCTCCAGATG
CCCCAACAAACCCTCTCCTCC
59
89
U32499.1
DRD4
forward TGGTGCTGCCGCTCTTC Reverse GAACCTGTCCACGCTGATG
CTACTCCGAGGTCCAGGGTGG
58
100
NM 000797.2
DRD5
Forward CTCCAGCCTGAATGCAACCTA Reverse GCGGTAGATGCGCGTGTAG
CTTCCTCGCTCATCAGCCTTCT
59
97
NM 000798.3
18s RNA
Forward TGAGTCCACTTTAAATCCTTTAACGA Reverse CGCTATTGGAGCTGGAATTACC
AGGGCAAGTCTGGTGCCAGCA
59
85
X03205
has been hypothesized as the etiological defect (Albin and Mink, 2006), however available evidence points to a preferential involvement of the inhibitory D2-like subclass, which includes the DRD2, DRD3, and DRD4 subtypes, rather than the D1-like subclass (including DRD1 and DRD5 subtypes), inasmuch as DR antagonists beneficial for tics act mainly on D2-like DRs (Fitzgerald et al., 2000), and upregulation of DRD2 (but not of other DR subtypes) has been reported in the brain of TS subjects (Wong et al., 1997; Singer et al., 2002). Moreover, the DRD5 gene locus has been studied in TS families, without finding any genetic linkage (Barr et al., 1997). Our results thus suggest that DRs on PBLs do not necessarily mirror central DRs, at least in TS. The present results of course do not exclude that dysregulation of DRs of the D2-like subclass may occur in TS. Rather, they point to an involvement of the D1-like subclass and in particular of the DRD5 subtype. In particular, the strong correlation between DRD5 mRNA expression and compulsion severity merits consideration. DRD5 are involved in anti-oxidant and anti-hypertensive responses (Yang et al., 2006), and in the modulation of hippocampal ACh release (Hersi et al., 2000), although the behavioral relevance of the latter finding remains to be established. In any case, the therapeutic efficacy of DR antagonists, which are used for tics, correlates with the affinity for DRD2, but not DRD5. Nevertheless, in animal models (a) the D1-like subclass in the prefrontal cortex is critically involved in cocaine-seeking behavior (reviewed in Rebec
and Sun, 2005), and (b) D1-like agonists seem to potentiate grooming chains (super-stereotypy), which are considered to be analogous to complex tics or OCDs (Berridge et al., 2005), an observation which seems to agree with our findings regarding the correlation between DRD5 mRNA expression and compulsion severity. DRs expressed on immune cells mediate the immunomodulating effects of dopamine (reviewed in Basu and
Fig. 1. DR mRNA expression levels in PBLs from healthy controls (empty boxes) and TS patients (hatched boxes). Median values (horizontal bars), 25th–75th percentiles (boxes), and highest and lowest values are shown. n.d. = not detected.
M. Ferrari et al. / Journal of Psychiatric Research 43 (2009) 24–29
27
Table 3 DR mRNA expression levels in PBLs from Tourette syndrome (TS) patients, without (pure) or with obsessive–compulsive disorder (OCD), attentiondeficit hyperactivity disorder (ADHD), or both
Pure TS (3) TS + OCD (6) TS + ADHD (2) TS + OCD + ADHD (4)
DRD1
DRD2
DRD3
DRD4
DRD5
n.d. n.d. n.d. n.d.
2.13 ± 1.98 1.62 ± 1.96 0.10 ± 0.01 2.38 ± 2.13
0.24 ± 0.15 0.30 ± 0.34 0.10 ± 0.09 0.55 ± 0.85
0.36 ± 0.38 0.59 ± 1.06 0.11 ± 0.01 0.16 ± 0.03
4.07 ± 0.55 5.25 ± 0.67 6.40 ± 0.60 5.03 ± 0.50
Data are means ± SD. Numbers in parentheses indicate subjects in each group. n.d. = not detected.
Table 4 DR mRNA expression levels in PBLs from TS patients without or with drug treatments
No drugs (10) On drugs (5) NLs only (2) SSRIs only (2) NLs + SSRIs (1)
DRD1
DRD2
DRD3
DRD4
DRD5
n.d. n.d. n.d. n.d. n.d.
1.38 ± 1.73 2.41 ± 2.10 2.90 ± 3.68 2.67 ± 1.12 0.91
0.40 ± 0.57 0.18 ± 0.05 0.13 ± 0.00 0.21 ± 0.04 0.21
0.14 ± 0.09 0.79 ± 1.12 0.13 ± 0.02 0.49 ± 0.44 2.73
5.35 ± 0.77 4.61 ± 0.93 4.76 ± 1.78 4.43 ± 0.46 4.66
Data are means ± SD. Numbers in parentheses indicate subjects in each group. NLs = neuroleptics; SSRIs = selective serotonin reuptake inhibitors; n.d. = not detected.
Dasgupta, 2000), and interestingly in TS subjects immune abnormalities have been reported, such as increased circulating B lymphocytes (Weisz et al., 2004), overexpressed natural killer cell genes (Lit et al., 2007), and decreased CD4+CD25+ regulatory T cells (Kawikova et al., 2007), a specialized subset of T lymphocytes which play a crucial role in immune homeostasis by suppressing the activity of CD4+ T lymphocytes (Sakaguchi, 2004). We recently showed that activation of DRD5 by endogenous dopamine results in profound reduction of the function of human CD4+CD25+ regulatory T cells (Cosentino et al., 2007), thus the present finding concerning overexpressed DRD5 in PBLs seems in line with the reported reduction of
Fig. 2. Correlation between DRD5 mRNA expression in PBLs and compulsion severity (assessed by CY-BOCS) in TS patients. One patient was missed at the evaluation.
CD4+CD25+ regulatory T cells in TS (Kawikova et al., 2007). Decreased frequency and activity of CD4+CD25+ regulatory T lymphocytes is a common finding in autoimmune diseases (see e.g. Levings et al., 2006), and autoimmune mechanisms have been suggested to represent a common trigger for both TS and the TS-related Paediatric Autoimmune Neuropsychiatric Disorders Associated with Streptococcal infections (PANDAS) (Swedo et al., 1998; Tucker et al., 1996). In conclusion, our findings regarding overexpression of DRD5 mRNA in PBLs of TS patients add to current knowledge regarding immune dysregulation in TS, and give further support to the hypothesis of the occurrence an autoimmune ‘‘trait” in the syndrome. Whether upegulation of DRD5 mRNA levels is exclusively related to TS or is also affected by the presence of ADHD and/ or OCD warrants further investigation, also in view of the high prevalence of such comorbidities in these patients. Nonetheless, the present results give further support to the hypothesis that in TS a link occurs between immune dysregulation and neuropsychiatric disturbances. At least in animal models evidence exists that T lymphocytes in the CNS are essential for neural development, maintenance and repair, under the control of CD4+CD25+ regulatory T cells (Kipnis et al., 2004 and 2005). Further studies are warranted to establish the clinical implications of such basic findings, we propose however, at least as a working hypothesis, that the occurrence of immunological abnormalities in neuropsychiatric disorders such as TS may indicate the involvement of neuroimmunologic mechanisms in the pathogenesis of the disturbances: in the future, clarification of such issue could allow better understanding of disease pathophysiology and possibly also offer novel clues for more effective therapeutic interventions.
28
M. Ferrari et al. / Journal of Psychiatric Research 43 (2009) 24–29
Conflict of Interest The authors declare no competing interests. Contributors M.F., C.T., U.B. and M.C. designed the study; C.T., E.C., A.P. and G.L. were in charge of the patient recruitment and evaluation; C.T. and M.F. collected, prepared and analyzed the samples; D.F., M.F., C.T. and M.C. performed the statistical analysis of the data; D.F., M.F., C.T., F.M., S.L., U.B. and M.C. contributed to the interpretation and discussion of results; M.F., C.T., D.F. and M.C. wrote the paper, and all the authors revised and finally approved the manuscript. Role of funding source The study was supported by a grant from the University of Insubria (FAR 2006) to MC. The University of Insubria had no further role in study design; in the collection, analysis and interpretation of data; in the writing of the report; and in the decision to submit the paper for publication. Acknowledgement The helpful assistance of Dr. Marta Monti in performing some of the assays is gratefully acknowledged. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.jpsychires. 2008.01.014. References Achenbach TM. Manual for the Child Behavior Checklist/4–18 and Profile. Burlington, VT: University of Vermont, Department of Psychiatry; 1991. Albin RL, Mink JW. Recent advances in tourette syndrome research. Trends in Neurosciences 2006;29:175–82. Barbanti P, Fabbrini G, Ricci A, Bruno G, Cerbo R, Bronzetti E, et al. Reduced density of dopamine D2-like receptors on peripheral blood lymphocytes in Alzheimer’s disease. Mechanisms of Ageing and Development 2000;120:65–75. Barr CL, Wigg KG, Zovko E, Sandor P, Tsui L-C. Linkage study of the dopamine D5 receptor gene and Gilles de la tourette syndrome. American Journal of Medical Genetics 1997;74:58–61. Basu S, Dasgupta PS. Dopamine, a neurotransmitter, influences the immune system. Journal of Neuroimmunology 2000;102:113–24. Berridge KC, Aldridge JW, Houchard KR, Zhuang X. Sequential superstereotypy of an instinctive fixed action pattern in hyper-dopaminergic mutant mice: a model of obsessive compulsive disorder and tourette’s. BMC Biology 2005;3:4. Black KJ, Gado MH, Perlmutter JS. PET measurement of dopamine D2 receptor-mediated changes in striatopallidal function. Journal of Neuroscience 1997;17:3168–77. Bruggeman R, van der Linden C, Buitelaar JK, Gericke GS, Hawkridge SM, Temlett JA. Risperidone versus pimozide in tourette’s disorder: a
comparative double-blind parallel-group study. Journal of Clinical Psychiatry 2001;62:50–6. Carter AS, Pauls DL, Leckman JF, Cohen DJ. A prospective longitudinal study of Gilles de la tourette’s syndrome. Journal of American Academy of Child and Adolescent Psychiatry 1994;33:377–85. Conners CK. Conners’ rating scales-revised (CRS-R). Technical manual. New York: MHS Ed; 1997. Cosentino M, Fietta AM, Ferrari M, Rasini E, Bombelli R, Carcano E, et al. Human CD4+CD25+ regulatory T cells selectively express tyrosine hydroxylase and contain endogenous catecholamines subserving an autocrine/paracrine inhibitory functional loop. Blood 2007;109:632–42. Fitzgerald PB, Kapur S, Remington G, Roy P, Zipursky RB. Predicting haloperidol occupancy of central dopamine D2 receptors from plasma levels. Psychopharmacology 2000;149:1–5. Hersi AI, Kitaichi K, Srivastava LK, Gaudreau P, Quirion R. Dopamine D-5 receptor modulates hippocampal acetylcholine release. Brain Research. Molecular Brain Research 2000;76:336–40. Ilani T, Ben-Shachar D, Strous RD, Mazor M, Sheinkman A, Kotler M, et al. A peripheral marker for schizophrenia: increased levels of D3 dopamine receptor mRNA in blood lymphocytes. Proceedings of National Academy Sciences of the United States of America 2001;98:625–8. Kawikova I, Leckman JF, Kronig H, Katsovich L, Bessen DE, Ghebremichael M, et al. Decreased numbers of regulatory T cells suggest impaired immune tolerance in children with tourette syndrome: a preliminary study. Biological Psychiatry 2007;61:273–8. Kipnis J, Cohen H, Cardon M, Ziv Y, Schwartz M. T cell deficiency leads to cognitive dysfunction: implications for therapeutic vaccination for schizophrenia and other psychiatric conditions. Proceedings of the National Academy of Sciences of the United States of America 2004;101:8180–5. Kipnis J, Schwartz M. Controlled autoimmunity in CNS maintenance and repair: naturally occurring CD4+CD25+ regulatory T-cells at the crossroads of health and disease. Neuromolecular Medicine 2005;7:197–206. Kurlan R, Como PG, Miller B, Palumbo D, Deeley C, Andresen EM, et al. The behavioral spectrum of tic disorders: a community-based study. Neurology 2002;59:414–20. Leckman JF, Riddle MA, Hardin MT, Ort SI, Swartz KL, Stevenson J, et al. The Yale Global Tic Severity Scale: initial testing of a clinicianrated scale of tic severity. Journal of the American Academy of Child and Adolescent Psychiatry 1989;28:566–73. Levings MK, Allan S, d’Hennezel E, Piccirillo CA. Functional dynamics of naturally occurring regulatory T cells in health and autoimmunity. Advances in Immunology 2006;92:119–55. Lit L, Gilbert DL, Walker W, Sharp FR. A subgroup of tourette’s patients overexpress specific natural killer cell genes in blood: a preliminary report. American Journal of Medicine Genetics Part B: Neuropsychiatric Genetics 2007;144:958–63. McKenna F, McLaughlin PJ, Lewis BJ, Sibbring GC, Cummerson JA, Bowen-Jones D, et al. Dopamine receptor expression on human T- and B-lymphocytes, monocytes, neutrophils, eosinophils and NK cells: a flow cytometric study. Journal of Neuroimmunology 2002;132:34–40. Minzer K, Lee O, Hong JJ, Singer HS. Increased prefrontal D2 protein in tourette syndrome: a postmortem analysis of frontal cortex and striatum. Journal of Neurological Science 2004;219:55–61. Nagai Y, Ueno S, Saeki Y, Soga F, Hirano M, Yanagihara T. Decrease of the D3 dopamine receptor mRNA expression in lymphocytes from patients with Parkinson’s disease. Neurology 1996;46:791–5. Rebec GV, Sun W. Neuronal substrates of relapse to cocaine-seeking behavior: role of prefrontal cortex. Journal of the Experimental Analysis of Behavior 2005;84:653–66. Ricci A, Bronzetti E, Mignini F, Tayebati SK, Zaccheo D, Amenta F. dopamine D1-like receptor subtypes in human peripheral blood lymphocytes. Journal of Neuroimmunology 1999;96:234–40. Rocca P, De Leo C, Eva C, Marchiaro L, Milani AM, Musso R, et al. Decrease of the D4 dopamine receptor messenger RNA expression in
M. Ferrari et al. / Journal of Psychiatric Research 43 (2009) 24–29 lymphocytes from patients with major depression. Progress in Neuropsychopharmacology and Biological Psychiatry 2006;26:1155–60. Sakaguchi S. Naturally arising CD4+ regulatory t cells for immunologic self-tolerance and negative control of immune responses. Annual Review of Immunology 2004;22:531–62. Scahill L, Riddle MA, McSwiggin-Hardin M, Ort SI, King RA, Goodman WK, et al. Children’s yale-brown obsessive compulsive scale: reliability and validity. Journal of American Academy of Child and Adolescent Psychiatry 1997;36:844–52. Singer HS, Szymanski S, Giuliano J, Yokoi F, Dogan AS, Brasic JR, et al. Elevated intrasynaptic dopamine release in tourette’s syndrome measured by PET. American Journal of Psychiatry 2002;159:1329–36. Spencer T, Biederman J, Coffey B, Geller D, Faraone S, Wilens T. Tourette disorder and ADHD. Advances in Neurology 2001;85:57–77. Swedo SE, Leonard HL, Garvey M, Mittleman B, Allen AJ, Perlmutter S. Pediatric autoimmune neuropsychiatric disorders associated with streptococcal infections: Clinical description of the first 50 cases. American Journal of Psychiatry 1998;155:264–71.
29
Termine C, Balottin U, Rossi G, Maisano F, Salini S, Di Nardo R, et al. Psychopathology in children and adolescents with tourette’s syndrome: a controlled study. Brain and Development 2006;2:69–75. Tucker DM, Leckman JF, Scahill L, Wilf GE, LaCamera R, Cardona L, et al. A putative poststreptococcal case of OCD with chronic tic disorder, not otherwise specified. Journal of American Academy of Child and Adolescent Psychiatry 1996;35:1684–91. Weisz JL, McMahon WM, Moore JC, Augustine NH, Bohnsack JF, Bale JF, et al. D8/17 and CD19 expression on lymphocytes of patients with acute rheumatic fever and tourette’s disorder. Clinical and Diagnostic Laboratory Immunology 2004;11:330–6. Wong DF, Singer HS, Brandt J, Shaya E, Chen C, Brown J, et al. D2-like dopamine receptor density in tourette syndrome measured by PET. Journal of Nuclear Medicine 1997;38:1243–7. Yang Z, Asico LD, Yu P, Wang Z, Jones JE, Escano CS, et al. D5 dopamine receptor regulation of reactive oxygen species production, NADPH oxidase, and blood pressure. American Journal of Physiology-regulatory Integrative and Comparative Physiology 2006;290:R96–R104.