- Email: [email protected]
Dorfman-Chanarin syndrome without mental retardation caused by a homozygous ABHD5 splice site mutation that skips exon 6
Accepted Manuscript Title: Dorfman-Chanarin syndrome without mental retardation caused by a homozygous ABHD5 splice site mutation that skips exon 6 Author: Kazumitsu Sugiura PII: DOI: Reference:
S0923-1811(14)00133-9 http://dx.doi.org/doi:10.1016/j.jdermsci.2014.05.009 DESC 2693
To appear in:
Journal of Dermatological Science
Author: Yasushi Suga PII: DOI: Reference:
S0923-1811(14)00133-9 http://dx.doi.org/doi:10.1016/j.jdermsci.2014.05.009 DESC 2693
To appear in:
Journal of Dermatological Science
Author: Masashi Akiyama PII: DOI: Reference:
S0923-1811(14)00133-9 http://dx.doi.org/doi:10.1016/j.jdermsci.2014.05.009 DESC 2693
To appear in:
Journal of Dermatological Science
Received date: Revised date: Accepted date:
1-4-2014 22-5-2014 26-5-2014
Please cite this article as: Akiyama Masashi.Dorfman-Chanarin syndrome without mental retardation caused by a homozygous ABHD5 splice site mutation that skips exon 6.Journal of Dermatological Science http://dx.doi.org/10.1016/j.jdermsci.2014.05.009
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Dorfman-Chanarin syndrome without mental retardation caused by a
ip t
homozygous ABHD5 splice site mutation that skips exon 6
cr
Kazumitsu Sugiura, M.D., Ph.D.1, Yasushi Suga, M.D., Ph.D.2
us
and Masashi Akiyama, M.D., Ph.D.1
1
M
an
Department of Dermatology, Nagoya University Graduate School of Medicine, 65 Tsurumai-cho, Showa-ku, Nagoya 466-8560, Japan 2 Department of Dermatology, Juntendo University Urayasu Hospital
Ac ce pt e
d
*Corresponding author: Masashi Akiyama, M.D., Ph.D. Tel: +81-52-744-2314, Fax: +81-52-744-2318 E-mail: [email protected]
Abbreviations: abhydrolase domain-containing 5 (ABHD5); alanine: 2-oxoglutarate aminotransferase (ALT); aspartate: 2-oxoglutarate aminotransferase (AST); creatine kinase (CK); direct bilirubin (D-Bil); Dorfman-Chanarin syndrome (DCS); -glutamyl transpeptidase (-GTP); lactate dehydrogenase (LDH); platelets (PLT); total bilirubin (T-Bil); white blood cells (WBC). Key Words: ABHD5, Dorfman-Chanarin syndrome, genotype-phonotype correlation, ichthyosis, Jordan’s anomaly, liver dysfunction, mental retardation
Page 1 of 13
Dorfman-Chanarin syndrome (DCS) is a rare autosomal recessive form of congenital ichthyosis, characterized by the presence of intracellular lipid droplets in multiple organs [1, 2] (OMIM: 275630). Extra-cutaneous
ip t
manifestations variably include fatty liver, myopathy, cataracts, and a variety of neurologic symptoms, such as mental retardation [3]. DCS
cr
patients often have mutations in ABHD5, which encodes abhydrolase
us
domain-containing 5 (ABHD5), an activator of adipose triglyceride lipase, leading to accumulation of triglycerides [4, 5]. Herein, we report a case of
an
DCS without mental retardation, caused by a homozygous ABDH5 splicing site mutation, which resulted in the skipping of the entire exon 6. Moreover,
M
we suggest a genotype-phenotype correlation of this type of ABDH5
Ac ce pt e
d
mutation and DCS without mental retardation.
A 36-year-old Tunisian man with fine, gray to brown scales on his body (that were apparent since birth), came to our clinic (Fig. 1A). His parents were non-consanguineous. He had three siblings; one sister also had congenital ichthyosis, but no mental retardation. Our patient showed pruritus and hypohidrosis, but did not experience mental retardation, growth retardation, muscle weakness, microtia, hearing involvement, or cataracts. A laboratory test revealed the following parameters: WBC, 3,400/L;PLT, 76,000/L;AST, 118 IU/L;ALT, 86 IU/L;LDH, 353 IU/L;
Page 2 of 13
-GTP, 157IU/L; T-Bil, 1.7mg/dL; D-Bil, 0.7mg/dL; and CK, 663 IU/L. Computer tomography revealed low density in the whole liver and
ip t
splenomegaly. The results of a liver biopsy previously performed at a
cr
different hospital revealed lipid deposits in the hepatocytes. Light
us
microscopy of a skin lesion sample taken from the patient’s trunk showed marked hyperkeratosis, with only a small number of parakeratotic cells (Fig.
an
1B). There were large cytoplasmic vacuoles containing amorphous material
M
in the basal layer cells of the epidermis (Fig. 1C). A peripheral blood smear showed leucocytes containing prominent lipid vacuoles (Jordan’s anomaly)
Ac ce pt e
d
(Fig. 1D), which is the pathognomonic finding in DCS. From these findings, the patient was diagnosed as DCS.
Following ethical approval, informed consent was obtained in compliance with the Declaration of Helsinki guidelines. The entire coding regions of ABHD5, including the exon/intron boundaries, were sequenced using genomic DNA samples from the patient [3]. The patient had a homozygous ABHD5 mutation c.773-1G>A (Fig. 2A). c.773-1G>A was previously reported as a pathogenic ABHD5 splice site mutation found in two Tunisian
Page 3 of 13
families [4]. However, the ABHD5 mRNA products derived from the mutant allele were not analyzed in detail. We therefore examined the
ip t
consequences of this ABHD5 mutation. Reverse transcription polymerase
cr
chain reaction (RT-PCR) analysis using total RNA samples from the
us
patient’s plucked scalp hair showed two aberrantly-spliced mRNA products, but did not show any normally spliced mRNA products (Fig. 2B)
an
(Supplementary Table S1) [6, 7]. Sequencing of the aberrant cDNA
M
fragments revealed that the major product skipped the entire exon 6 and the minor product skipped the 5’-95 bp of exon 6 (Fig. 2B). Thus, the
Ac ce pt e
d
splice-site mutation resulted predominantly in the skipping of the entire exon 6, leading to premature translation termination. This caused a truncation of ABHD5 into p.Ser258ArgfsX21. The minor product from the aberrant splicing, in which the 5’-95 bp of exon 6 was skipped, resulted into the formation of p.Gly259PhefsX65, although the amount of this minor product appeared to be very small (Fig. 2B). Interestingly, as shown in Figure 2B, RT-PCR of the scalp hair of a normal subject also produced the alternatively spliced mRNA product, in which the entire exon 6 was skipped. This finding was consistent with a previous report [8].
Page 4 of 13
In order to confirm that the alternatively spliced mRNA product (in which
ip t
the entire exon 6 was skipped) exists in normal fetal and adult brains as
cr
well as in normal adult livers, RT-PCR was conducted using total RNA
us
derived from human tissue that was purchased from Takara Bio Inc. (Otsu, Japan). We found that the alternatively spliced ABHD5 mRNA product, in
an
which the entire exon 6 was skipped, existed at higher levels in the normal
M
fetal brain than in the normal adult brain, liver, or scalp hair (Fig. 2C).
Ac ce pt e
d
ABHD5 has been reported to colocalize with perilipin [9]. The truncated ABHD5 p.Ser258ArgfsX21 possibly dissociates from perilipin because the truncated ABHD5 lacks p.260Glu, which is a critical residue for binding to perilipin [9]. The clinical manifestations of one of the Tunisian patients with the c.773-1G>A homozygous mutation, were previously described in detail, and they were found to be identical to those of the patient currently under investigation (Supplementary Table S2) [4]. The patient had bilateral cataracts and mild deafness, in addition to hepatomegaly, liver steatosis, and ichthyosis. However, this patient did not exhibit any signs of mental
Page 5 of 13
retardation. The laboratory parameters of the previously reported patient were similar to those of the patient currently under investigation [4].
ip t
Another DCS patient with a homozygous c.959+6 A>T mutation, leading
cr
predominantly to the skipping of the entire exon 6 of ABHD5, had
us
ichthyosis and hepatomegaly, but also showed no signs of mental retardation (Supplementary Table S2) [8]. There is a notion that
an
genotype-phenotype correlations are not possible in DCS [10]. However,
M
we suggest that the ABHD5 splicing site mutation, which results into the skipping of the entire exon 6, is associated with a DCS phenotype that is
Ac ce pt e
d
not associated with mental retardation. Based on the ABHD5 mRNA analysis, we think that the alternatively spliced ABHD5 mRNA, in which the entire exon 6 is skipped, produces a truncated form of ABHD5 in normal human tissues, especially in the fetal brain. This suggests that the shorter protein might function or compensate for the full length ABHD5 in the fetal brain. If this is true, the splice site mutations that form the truncated form of ABHD5 without exon 6 products, might prevent the patients from developing mental retardation.
Page 6 of 13
In conclusion, to our knowledge, this is the first proposed genotype-phenotype correlation between an ABHD5 mutation and a DCS
ip t
phenotype. We also determined the consequence of a splice site mutation
cr
of c.773-1G>A. In addition, we found an alternatively spliced ABHD5
us
mRNA, in which the entire exon 6 was skipped, more frequently in the
an
fetal human brain than in the adult brain, liver, or skin.
M
Conflicts of interest
The authors have no conflicts of interest to declare.
Ac ce pt e
d
Funding statement: None
Acknowledgements
The authors thank Ms. Haruka Ozeki and Ms. Yuka Terashita for their technical help in analyzing mutations of ABHD5. This study was supported in part by Grant-in-Aid for Scientific Research (A) 23249058 (M.A.) from the Ministry of Education, Culture, Sports, Science, and Technology of Japan.
Page 7 of 13
References systemic lipidosis. Arch Dermatol 110: 261-266, 1974.
ip t
[1] Dorfman ML, Hershko C, Eisenberg S, Sagher F: Ichthyosiform dermatosis with
[2] Chanarin I, Patel A, Slavin G, Wills EJ, Andrews TM, Stewart G: Neutral-lipid storage disease: a new disorder of lipid metabolism. Br Med J 1: 553-555, 1975.
cr
[3] Akiyama M, Sawamura D, Nomura Y, Sugawara M, Shimizu H: Truncation of CGI-58 protein causes malformation of lamellar granules resulting in ichthyosis in
us
Dorfman-Chanarin syndrome. J Invest Dermatol 121: 1029-1034, 2003.
[4] Lefevre C, Jobard F, Caux F, Bouadjar B, Karaduman A, Heilig R, et al.: Mutations in
an
CGI-58, the gene encoding a new protein of the esterase/lipase/thioesterase subfamily, in Chanarin-Dorfman syndrome. Am J Hum Genet 69: 1002-1012, 2001. [5] Akiyama M, Sakai K, Takayama C, Yanagi T, Yamanaka Y, McMillan JR, et al.: CGI-58 is
M
an alpha/beta-hydrolase within lipid transporting lamellar granules of differentiated keratinocytes. Am J Pathol 173: 1349-1360, 2008.
[6] Takeichi T, Sugiura K, Matsuda K, Kono M, Akiyama M: Novel ABCA12 splice site
d
deletion mutation and ABCA12 mRNA analysis of pulled hair samples in harlequin ichthyosis. J Dermatol Sci 69: 259-261, 2013.
Ac ce pt e
[7] Sugiura K, Takemoto A, Yamaguchi M, Takahashi H, Shoda Y, Mitsuma T, et al.: The majority of generalized pustular psoriasis without psoriasis vulgaris is caused by deficiency of interleukin-36 receptor antagonist. J Invest Dermatol 133: 2514-2521, 2013. [8] Badeloe S, van Geel M, Nagtzaam I, Rubio-Gozalbo ME, Oei RL, Steijlen PM, et al.: Chanarin-Dorfman syndrome caused by a novel splice site mutation in ABHD5. Br J Dermatol 158: 1378-1380, 2008.
[9] Yamaguchi T, Omatsu N, Matsushita S, Osumi T: CGI-58 interacts with perilipin and is localized to lipid droplets. Possible involvement of CGI-58 mislocalization in Chanarin-Dorfman syndrome. J Biol Chem 279: 30490-30497, 2004. [10] Aggarwal S, Maras JS, Alam S, Khanna R, Gupta SK, Ahuja A: Novel nonsense mutation of ABHD5 in Dorfman-Chanarin syndrome with unusual findings: a challenge for genotype-phenotype correlation. Eur J Med Genet 55: 173-177, 2012.
Page 8 of 13
ip t
Figure Captions
Figure 1. Clinical presentation, pathological findings, and blood smear
cr
of the patient
us
(A) Clinical presentation of the feet of the patient included fine, gray to
an
brown scales. (B, C) Hematoxylin and eosin staining of the ichthyosis. Marked hyperkeratosis with only a small number of parakeratotic cells was
M
seen. Intra-cytoplasmic lipid droplets within the epidermal keratinocytes
d
were observed (arrow); scale bar: 50 m (B), 20 m (C). (D) Jordan’s
Ac ce pt e
anomaly: lipid droplets were observed in a neutrophil.
Figure 2. ABHD5 sequence data of the patient, and mRNA analysis of the patient’s scalp hair and normal human brain and liver (A) ABHD5 sequence data for the patient is shown. Arrows indicate c.773-1G>A (homozygous). (B) ABHD5 mRNA analysis of total RNA derived from plucked hair samples is shown. The sequences of PCR primers, which cover exon 5 to exon 7, are provided in supplementary Table S1. 1, marker; 2, the patient; 3, a healthy human control. The
Page 9 of 13
sequence of the uppermost band of the patient’s sample was unread. The middle band corresponds to skipping of the 5’-95 bp of exon 6 (*). The
ip t
upper band of the control is the wild-type ABHD5 mRNA. The lowest
cr
bands of the patient and the control samples represent the completely
us
skipped exon 6 mutation product and an alternatively spliced variant respectively. (C) ABHD5 mRNA analysis of human tissues. 1, markers; 2,
an
fetal brain; 3, adult brain; 4, adult liver; 5, adult scalp hair. This is the
M
representative data of three independent experiments. The upper bands correspond to full length ABHD5 mRNA containing exons 5, 6, and 7. The
Ac ce pt e
d
lower bands represent splice variants, in which exon 6 was skipped. This truncated form is most apparent in the fetal brain.
Supplementary Table S1: Primer sequences and PCR protocols Table S1A: Primer sequences Name
Table S1B: PCR protoco
Sequence
ABHD5 mRNA F CTAGTGCAGCGTTTAAGGCC
ABHD5 mRNA R AGCTTCAGTGTGTTCAGTCC
95℃ 5 min (95℃ 1 min, 55℃
Page 10 of 13
1 min; 72℃ 1 min) x 35 72℃ 7 min
Ac ce pt e
d
M
an
us
cr
ip t
4℃ ∞
Supplemental Table S2: Clinical features and mutations of DCS patients with homozygous ABHD5 exon 6 skipping mutation Patie Se Origin Skin nt
Liver
Eyes
Ears
Growth
x
1
M Tunisi Ichthyo Liver a
2
steatosis
M Turke Ichthyo Liver y
3
sis
sis
a
sis
Growth
act
retardation
deafness -
-
-
-
Reference
c.773-1G>A
Lefevre et
(homo.) -
dysfunction
M Tunisi Ichthyo Fatty liver
Mutation
l
Bil.catar Mild
-
Menta
c.959+6 A>T (homo.)
-
-
-
c.773-1G>A
al. Badeloe et al. This paper
(homo.)
Page 11 of 13
ip t cr us an M d Ac ce pt e
Figure 1
Page 12 of 13
ip t cr us an M d Ac ce pt e
Figure 2
Page 13 of 13
S0923-1811(14)00133-9 http://dx.doi.org/doi:10.1016/j.jdermsci.2014.05.009 DESC 2693
To appear in:
Journal of Dermatological Science
Author: Yasushi Suga PII: DOI: Reference:
S0923-1811(14)00133-9 http://dx.doi.org/doi:10.1016/j.jdermsci.2014.05.009 DESC 2693
To appear in:
Journal of Dermatological Science
Author: Masashi Akiyama PII: DOI: Reference:
S0923-1811(14)00133-9 http://dx.doi.org/doi:10.1016/j.jdermsci.2014.05.009 DESC 2693
To appear in:
Journal of Dermatological Science
Received date: Revised date: Accepted date:
1-4-2014 22-5-2014 26-5-2014
Please cite this article as: Akiyama Masashi.Dorfman-Chanarin syndrome without mental retardation caused by a homozygous ABHD5 splice site mutation that skips exon 6.Journal of Dermatological Science http://dx.doi.org/10.1016/j.jdermsci.2014.05.009
This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Dorfman-Chanarin syndrome without mental retardation caused by a
ip t
homozygous ABHD5 splice site mutation that skips exon 6
cr
Kazumitsu Sugiura, M.D., Ph.D.1, Yasushi Suga, M.D., Ph.D.2
us
and Masashi Akiyama, M.D., Ph.D.1
1
M
an
Department of Dermatology, Nagoya University Graduate School of Medicine, 65 Tsurumai-cho, Showa-ku, Nagoya 466-8560, Japan 2 Department of Dermatology, Juntendo University Urayasu Hospital
Ac ce pt e
d
*Corresponding author: Masashi Akiyama, M.D., Ph.D. Tel: +81-52-744-2314, Fax: +81-52-744-2318 E-mail: [email protected]
Abbreviations: abhydrolase domain-containing 5 (ABHD5); alanine: 2-oxoglutarate aminotransferase (ALT); aspartate: 2-oxoglutarate aminotransferase (AST); creatine kinase (CK); direct bilirubin (D-Bil); Dorfman-Chanarin syndrome (DCS); -glutamyl transpeptidase (-GTP); lactate dehydrogenase (LDH); platelets (PLT); total bilirubin (T-Bil); white blood cells (WBC). Key Words: ABHD5, Dorfman-Chanarin syndrome, genotype-phonotype correlation, ichthyosis, Jordan’s anomaly, liver dysfunction, mental retardation
Page 1 of 13
Dorfman-Chanarin syndrome (DCS) is a rare autosomal recessive form of congenital ichthyosis, characterized by the presence of intracellular lipid droplets in multiple organs [1, 2] (OMIM: 275630). Extra-cutaneous
ip t
manifestations variably include fatty liver, myopathy, cataracts, and a variety of neurologic symptoms, such as mental retardation [3]. DCS
cr
patients often have mutations in ABHD5, which encodes abhydrolase
us
domain-containing 5 (ABHD5), an activator of adipose triglyceride lipase, leading to accumulation of triglycerides [4, 5]. Herein, we report a case of
an
DCS without mental retardation, caused by a homozygous ABDH5 splicing site mutation, which resulted in the skipping of the entire exon 6. Moreover,
M
we suggest a genotype-phenotype correlation of this type of ABDH5
Ac ce pt e
d
mutation and DCS without mental retardation.
A 36-year-old Tunisian man with fine, gray to brown scales on his body (that were apparent since birth), came to our clinic (Fig. 1A). His parents were non-consanguineous. He had three siblings; one sister also had congenital ichthyosis, but no mental retardation. Our patient showed pruritus and hypohidrosis, but did not experience mental retardation, growth retardation, muscle weakness, microtia, hearing involvement, or cataracts. A laboratory test revealed the following parameters: WBC, 3,400/L;PLT, 76,000/L;AST, 118 IU/L;ALT, 86 IU/L;LDH, 353 IU/L;
Page 2 of 13
-GTP, 157IU/L; T-Bil, 1.7mg/dL; D-Bil, 0.7mg/dL; and CK, 663 IU/L. Computer tomography revealed low density in the whole liver and
ip t
splenomegaly. The results of a liver biopsy previously performed at a
cr
different hospital revealed lipid deposits in the hepatocytes. Light
us
microscopy of a skin lesion sample taken from the patient’s trunk showed marked hyperkeratosis, with only a small number of parakeratotic cells (Fig.
an
1B). There were large cytoplasmic vacuoles containing amorphous material
M
in the basal layer cells of the epidermis (Fig. 1C). A peripheral blood smear showed leucocytes containing prominent lipid vacuoles (Jordan’s anomaly)
Ac ce pt e
d
(Fig. 1D), which is the pathognomonic finding in DCS. From these findings, the patient was diagnosed as DCS.
Following ethical approval, informed consent was obtained in compliance with the Declaration of Helsinki guidelines. The entire coding regions of ABHD5, including the exon/intron boundaries, were sequenced using genomic DNA samples from the patient [3]. The patient had a homozygous ABHD5 mutation c.773-1G>A (Fig. 2A). c.773-1G>A was previously reported as a pathogenic ABHD5 splice site mutation found in two Tunisian
Page 3 of 13
families [4]. However, the ABHD5 mRNA products derived from the mutant allele were not analyzed in detail. We therefore examined the
ip t
consequences of this ABHD5 mutation. Reverse transcription polymerase
cr
chain reaction (RT-PCR) analysis using total RNA samples from the
us
patient’s plucked scalp hair showed two aberrantly-spliced mRNA products, but did not show any normally spliced mRNA products (Fig. 2B)
an
(Supplementary Table S1) [6, 7]. Sequencing of the aberrant cDNA
M
fragments revealed that the major product skipped the entire exon 6 and the minor product skipped the 5’-95 bp of exon 6 (Fig. 2B). Thus, the
Ac ce pt e
d
splice-site mutation resulted predominantly in the skipping of the entire exon 6, leading to premature translation termination. This caused a truncation of ABHD5 into p.Ser258ArgfsX21. The minor product from the aberrant splicing, in which the 5’-95 bp of exon 6 was skipped, resulted into the formation of p.Gly259PhefsX65, although the amount of this minor product appeared to be very small (Fig. 2B). Interestingly, as shown in Figure 2B, RT-PCR of the scalp hair of a normal subject also produced the alternatively spliced mRNA product, in which the entire exon 6 was skipped. This finding was consistent with a previous report [8].
Page 4 of 13
In order to confirm that the alternatively spliced mRNA product (in which
ip t
the entire exon 6 was skipped) exists in normal fetal and adult brains as
cr
well as in normal adult livers, RT-PCR was conducted using total RNA
us
derived from human tissue that was purchased from Takara Bio Inc. (Otsu, Japan). We found that the alternatively spliced ABHD5 mRNA product, in
an
which the entire exon 6 was skipped, existed at higher levels in the normal
M
fetal brain than in the normal adult brain, liver, or scalp hair (Fig. 2C).
Ac ce pt e
d
ABHD5 has been reported to colocalize with perilipin [9]. The truncated ABHD5 p.Ser258ArgfsX21 possibly dissociates from perilipin because the truncated ABHD5 lacks p.260Glu, which is a critical residue for binding to perilipin [9]. The clinical manifestations of one of the Tunisian patients with the c.773-1G>A homozygous mutation, were previously described in detail, and they were found to be identical to those of the patient currently under investigation (Supplementary Table S2) [4]. The patient had bilateral cataracts and mild deafness, in addition to hepatomegaly, liver steatosis, and ichthyosis. However, this patient did not exhibit any signs of mental
Page 5 of 13
retardation. The laboratory parameters of the previously reported patient were similar to those of the patient currently under investigation [4].
ip t
Another DCS patient with a homozygous c.959+6 A>T mutation, leading
cr
predominantly to the skipping of the entire exon 6 of ABHD5, had
us
ichthyosis and hepatomegaly, but also showed no signs of mental retardation (Supplementary Table S2) [8]. There is a notion that
an
genotype-phenotype correlations are not possible in DCS [10]. However,
M
we suggest that the ABHD5 splicing site mutation, which results into the skipping of the entire exon 6, is associated with a DCS phenotype that is
Ac ce pt e
d
not associated with mental retardation. Based on the ABHD5 mRNA analysis, we think that the alternatively spliced ABHD5 mRNA, in which the entire exon 6 is skipped, produces a truncated form of ABHD5 in normal human tissues, especially in the fetal brain. This suggests that the shorter protein might function or compensate for the full length ABHD5 in the fetal brain. If this is true, the splice site mutations that form the truncated form of ABHD5 without exon 6 products, might prevent the patients from developing mental retardation.
Page 6 of 13
In conclusion, to our knowledge, this is the first proposed genotype-phenotype correlation between an ABHD5 mutation and a DCS
ip t
phenotype. We also determined the consequence of a splice site mutation
cr
of c.773-1G>A. In addition, we found an alternatively spliced ABHD5
us
mRNA, in which the entire exon 6 was skipped, more frequently in the
an
fetal human brain than in the adult brain, liver, or skin.
M
Conflicts of interest
The authors have no conflicts of interest to declare.
Ac ce pt e
d
Funding statement: None
Acknowledgements
The authors thank Ms. Haruka Ozeki and Ms. Yuka Terashita for their technical help in analyzing mutations of ABHD5. This study was supported in part by Grant-in-Aid for Scientific Research (A) 23249058 (M.A.) from the Ministry of Education, Culture, Sports, Science, and Technology of Japan.
Page 7 of 13
References systemic lipidosis. Arch Dermatol 110: 261-266, 1974.
ip t
[1] Dorfman ML, Hershko C, Eisenberg S, Sagher F: Ichthyosiform dermatosis with
[2] Chanarin I, Patel A, Slavin G, Wills EJ, Andrews TM, Stewart G: Neutral-lipid storage disease: a new disorder of lipid metabolism. Br Med J 1: 553-555, 1975.
cr
[3] Akiyama M, Sawamura D, Nomura Y, Sugawara M, Shimizu H: Truncation of CGI-58 protein causes malformation of lamellar granules resulting in ichthyosis in
us
Dorfman-Chanarin syndrome. J Invest Dermatol 121: 1029-1034, 2003.
[4] Lefevre C, Jobard F, Caux F, Bouadjar B, Karaduman A, Heilig R, et al.: Mutations in
an
CGI-58, the gene encoding a new protein of the esterase/lipase/thioesterase subfamily, in Chanarin-Dorfman syndrome. Am J Hum Genet 69: 1002-1012, 2001. [5] Akiyama M, Sakai K, Takayama C, Yanagi T, Yamanaka Y, McMillan JR, et al.: CGI-58 is
M
an alpha/beta-hydrolase within lipid transporting lamellar granules of differentiated keratinocytes. Am J Pathol 173: 1349-1360, 2008.
[6] Takeichi T, Sugiura K, Matsuda K, Kono M, Akiyama M: Novel ABCA12 splice site
d
deletion mutation and ABCA12 mRNA analysis of pulled hair samples in harlequin ichthyosis. J Dermatol Sci 69: 259-261, 2013.
Ac ce pt e
[7] Sugiura K, Takemoto A, Yamaguchi M, Takahashi H, Shoda Y, Mitsuma T, et al.: The majority of generalized pustular psoriasis without psoriasis vulgaris is caused by deficiency of interleukin-36 receptor antagonist. J Invest Dermatol 133: 2514-2521, 2013. [8] Badeloe S, van Geel M, Nagtzaam I, Rubio-Gozalbo ME, Oei RL, Steijlen PM, et al.: Chanarin-Dorfman syndrome caused by a novel splice site mutation in ABHD5. Br J Dermatol 158: 1378-1380, 2008.
[9] Yamaguchi T, Omatsu N, Matsushita S, Osumi T: CGI-58 interacts with perilipin and is localized to lipid droplets. Possible involvement of CGI-58 mislocalization in Chanarin-Dorfman syndrome. J Biol Chem 279: 30490-30497, 2004. [10] Aggarwal S, Maras JS, Alam S, Khanna R, Gupta SK, Ahuja A: Novel nonsense mutation of ABHD5 in Dorfman-Chanarin syndrome with unusual findings: a challenge for genotype-phenotype correlation. Eur J Med Genet 55: 173-177, 2012.
Page 8 of 13
ip t
Figure Captions
Figure 1. Clinical presentation, pathological findings, and blood smear
cr
of the patient
us
(A) Clinical presentation of the feet of the patient included fine, gray to
an
brown scales. (B, C) Hematoxylin and eosin staining of the ichthyosis. Marked hyperkeratosis with only a small number of parakeratotic cells was
M
seen. Intra-cytoplasmic lipid droplets within the epidermal keratinocytes
d
were observed (arrow); scale bar: 50 m (B), 20 m (C). (D) Jordan’s
Ac ce pt e
anomaly: lipid droplets were observed in a neutrophil.
Figure 2. ABHD5 sequence data of the patient, and mRNA analysis of the patient’s scalp hair and normal human brain and liver (A) ABHD5 sequence data for the patient is shown. Arrows indicate c.773-1G>A (homozygous). (B) ABHD5 mRNA analysis of total RNA derived from plucked hair samples is shown. The sequences of PCR primers, which cover exon 5 to exon 7, are provided in supplementary Table S1. 1, marker; 2, the patient; 3, a healthy human control. The
Page 9 of 13
sequence of the uppermost band of the patient’s sample was unread. The middle band corresponds to skipping of the 5’-95 bp of exon 6 (*). The
ip t
upper band of the control is the wild-type ABHD5 mRNA. The lowest
cr
bands of the patient and the control samples represent the completely
us
skipped exon 6 mutation product and an alternatively spliced variant respectively. (C) ABHD5 mRNA analysis of human tissues. 1, markers; 2,
an
fetal brain; 3, adult brain; 4, adult liver; 5, adult scalp hair. This is the
M
representative data of three independent experiments. The upper bands correspond to full length ABHD5 mRNA containing exons 5, 6, and 7. The
Ac ce pt e
d
lower bands represent splice variants, in which exon 6 was skipped. This truncated form is most apparent in the fetal brain.
Supplementary Table S1: Primer sequences and PCR protocols Table S1A: Primer sequences Name
Table S1B: PCR protoco
Sequence
ABHD5 mRNA F CTAGTGCAGCGTTTAAGGCC
ABHD5 mRNA R AGCTTCAGTGTGTTCAGTCC
95℃ 5 min (95℃ 1 min, 55℃
Page 10 of 13
1 min; 72℃ 1 min) x 35 72℃ 7 min
Ac ce pt e
d
M
an
us
cr
ip t
4℃ ∞
Supplemental Table S2: Clinical features and mutations of DCS patients with homozygous ABHD5 exon 6 skipping mutation Patie Se Origin Skin nt
Liver
Eyes
Ears
Growth
x
1
M Tunisi Ichthyo Liver a
2
steatosis
M Turke Ichthyo Liver y
3
sis
sis
a
sis
Growth
act
retardation
deafness -
-
-
-
Reference
c.773-1G>A
Lefevre et
(homo.) -
dysfunction
M Tunisi Ichthyo Fatty liver
Mutation
l
Bil.catar Mild
-
Menta
c.959+6 A>T (homo.)
-
-
-
c.773-1G>A
al. Badeloe et al. This paper
(homo.)
Page 11 of 13
ip t cr us an M d Ac ce pt e
Figure 1
Page 12 of 13
ip t cr us an M d Ac ce pt e
Figure 2
Page 13 of 13